Next Generation Sequencing Bioinformatics Stephen Taylor Computational Biology Research Group
Next Generation Sequencing BioinformaticsNext Generation Sequencing Bioinformatics
Stephen TaylorStephen Taylor
Computational Biology Research Group
HistoryHistory
• Sanger • Dominant for last ~30 years
• 1000bp longest read
• Based on primers so not good for repetitive or SNPs sites
• Next Generation Sequencing• Much shorter reads, 25 to 300 bp
• Higher throughput
• Cheaper cost per Mb
• Single molecule sequencing (no cloning step)
• Since Jan 2008 more DNA sequenced than all previous years
• Sanger • Dominant for last ~30 years
• 1000bp longest read
• Based on primers so not good for repetitive or SNPs sites
• Next Generation Sequencing• Much shorter reads, 25 to 300 bp
• Higher throughput
• Cheaper cost per Mb
• Single molecule sequencing (no cloning step)
• Since Jan 2008 more DNA sequenced than all previous years
Computational Biology Research Group
Hence We Need High Throughput Bioinformatics
Hence We Need High Throughput Bioinformatics
Computational Biology Research Group
SangerSanger
• Fred Sanger (1980)• Dye-terminator sequencing• PCR up DNA fragment• Separate into 2 strands• Polymerase elongates DNA• Incorporation of fluorescence labelled ddNTP causes
termination of elongation for each base • Run DNA fragments on gel/capillary• Peak generated for each base
• Fred Sanger (1980)• Dye-terminator sequencing• PCR up DNA fragment• Separate into 2 strands• Polymerase elongates DNA• Incorporation of fluorescence labelled ddNTP causes
termination of elongation for each base • Run DNA fragments on gel/capillary• Peak generated for each base
Computational Biology Research Group
Illumina (Solexa)Illumina (Solexa)
Computational Biology Research Group
Illumina (Solexa)Illumina (Solexa)
Computational Biology Research Group
Illumina (Solexa)Illumina (Solexa)
Computational Biology Research Group
Illumina (Solexa) ApplicationsIllumina (Solexa) Applications
Resequencing• Characterise different related species or strains
Transcriptome analysis • No chip/array required!
• random priming of RNA
DNA methylation analysis• sequencing bisulfite-converted DNA methylation-sensitive restriction
digest enriched fragments
Examine chromatin modifications• Quantify in vivo protein-DNA interactions using the combination of
chromatin immunoprecipitation and sequencing (ChIP-Seq)
Resequencing• Characterise different related species or strains
Transcriptome analysis • No chip/array required!
• random priming of RNA
DNA methylation analysis• sequencing bisulfite-converted DNA methylation-sensitive restriction
digest enriched fragments
Examine chromatin modifications• Quantify in vivo protein-DNA interactions using the combination of
chromatin immunoprecipitation and sequencing (ChIP-Seq)
Computational Biology Research Group
Price ComparisonPrice Comparison
Computational Biology Research Group
Processing and managementProcessing and management
Computational Biology Research Group
Assemble Data - IlluminaAssemble Data - Illumina
Generates short reads (~35-75bp)
Good for resequencing
Difficult to do de novo assembly all but smallest organisms
Generates short reads (~35-75bp)
Good for resequencing
Difficult to do de novo assembly all but smallest organisms
Computational Biology Research Group
Mapping Illumina Reads Mapping Illumina Reads
• Acquire and process images and convert to FASTQ*• Get data• Quality control**• Map to genome• Visualisation• Post Processing
• Peak Finding
• SNP Calling
* Not covered today
• Acquire and process images and convert to FASTQ*• Get data• Quality control**• Map to genome• Visualisation• Post Processing
• Peak Finding
• SNP Calling
* Not covered today
Computational Biology Research Group
FASTQ formatFASTQ format
@HWUSI-EAS100R:6:73:941:1973#0/1
TATACAATGCACTTAGTCATCCGCGTATCACTTTAT
+
IIIIIIIIIIIIIIIIIIGIIIIIIIIII4IIII:I
1. HWUSI-EAS100R the unique instrument name
2. 6 flowcell lane
3. 73 tile number within the flowcell lane
4. 941 'x'-coordinate of the cluster within the tile
5. 1973 'y'-coordinate of the cluster within the tile
6. #0 index number for a multiplexed sample (0 for no indexing) /1 the member of a pair, /1 or /2 (paired-end or mate-pair reads only)
@HWUSI-EAS100R:6:73:941:1973#0/1
TATACAATGCACTTAGTCATCCGCGTATCACTTTAT
+
IIIIIIIIIIIIIIIIIIGIIIIIIIIII4IIII:I
1. HWUSI-EAS100R the unique instrument name
2. 6 flowcell lane
3. 73 tile number within the flowcell lane
4. 941 'x'-coordinate of the cluster within the tile
5. 1973 'y'-coordinate of the cluster within the tile
6. #0 index number for a multiplexed sample (0 for no indexing) /1 the member of a pair, /1 or /2 (paired-end or mate-pair reads only)
Computational Biology Research Group
FASTQ formatFASTQ format
Quality Score
ASCII representation of score for each base e.g. I
Convert to ASCII e.g. 73
Minus <a value>
Original Qphred= 40
See http://en.wikipedia.org/wiki/FASTQ_format
Quality Score
ASCII representation of score for each base e.g. I
Convert to ASCII e.g. 73
Minus <a value>
Original Qphred= 40
See http://en.wikipedia.org/wiki/FASTQ_format
Computational Biology Research Group
Formats – warning!Formats – warning!
FASTQ format appears ‘standard’ but there are 3 types based on the probabilities of the base calls…
Qphred = -10 x log10(error_prob)
Qsolexa = -10 x log10(error_prob/(1-error_prob))
1. Standard fastq: ASCII( Qphred + 33 )
2. Illumina pre v1.3 : ASCII( Qsolexa + 64 )
3. Illumina post v1.3: ASCII( Qphred+64 )
Option 3 should be the main one for the forseeable future!
FASTQ format appears ‘standard’ but there are 3 types based on the probabilities of the base calls…
Qphred = -10 x log10(error_prob)
Qsolexa = -10 x log10(error_prob/(1-error_prob))
1. Standard fastq: ASCII( Qphred + 33 )
2. Illumina pre v1.3 : ASCII( Qsolexa + 64 )
3. Illumina post v1.3: ASCII( Qphred+64 )
Option 3 should be the main one for the forseeable future!
Computational Biology Research Group
Convert between formatsConvert between formats
Computational Biology Research Group
Use sol2std2
Get DataGet Data
May be supplied in a variety of formats
.prb .txt files • Contain probabilities for each base• Some SNP callers use this• Usually convert to FASTQ
FASTQ• Like FASTA but with quality score associated with each base
May be supplied in a variety of formats
.prb .txt files • Contain probabilities for each base• Some SNP callers use this• Usually convert to FASTQ
FASTQ• Like FASTA but with quality score associated with each base
Computational Biology Research Group
WTCHGWTCHG
• If data is from WTCHG likely to get an email• E.g. http://www.well.ox.ac.uk/htseq/1T3qcHwk6jmlZeVtSnQO/• wget the FASTQ file in the GERALD directory• http://www.well.ox.ac.uk/htseq/1T3qcHwk6jmlZeVtSnQO/
GERALD_24-09-2009_johnb/s_2_sequence.txt.gz
• If data is from WTCHG likely to get an email• E.g. http://www.well.ox.ac.uk/htseq/1T3qcHwk6jmlZeVtSnQO/• wget the FASTQ file in the GERALD directory• http://www.well.ox.ac.uk/htseq/1T3qcHwk6jmlZeVtSnQO/
GERALD_24-09-2009_johnb/s_2_sequence.txt.gz
Computational Biology Research Group
Processing reads - IlluminaProcessing reads - Illumina
Mapping Tools• MAQ
• Sanger
• Uses quality scores
• ELAND
• Comes with the machine and runs as standard
• Very fast
• NOVOALIGN
• Slower, more accurate
• Output option includes pairwise (handy for following up SNP calls)
• TOPHAT
• For RNA-Seq
• Can map slice junctions
Mapping Tools• MAQ
• Sanger
• Uses quality scores
• ELAND
• Comes with the machine and runs as standard
• Very fast
• NOVOALIGN
• Slower, more accurate
• Output option includes pairwise (handy for following up SNP calls)
• TOPHAT
• For RNA-Seq
• Can map slice junctions
Computational Biology Research Group
Notes on MappingNotes on Mapping
• What genome?• Masking?• Some tools disregard multiple maps e.g. ELAND• Some tools map to one location and adjust probability score
e.g. MAQ• Can be confusing…• For ChIP-Seq we normally use DNA heavily masked for repeats
(simple/complex/ribosomal)
• What genome?• Masking?• Some tools disregard multiple maps e.g. ELAND• Some tools map to one location and adjust probability score
e.g. MAQ• Can be confusing…• For ChIP-Seq we normally use DNA heavily masked for repeats
(simple/complex/ribosomal)
Computational Biology Research Group
Databanks IndicesDatabanks Indices
• We have many indexed databanks• Under /databank/indices/<tool> e.g. for maq
• ens_human_chrs/ • ens_human_chrs_ucsc_rmfull_2/ • ens_mouse_chrs/ • ens_mouse_chrs_ucsc_rmfull/• ens_human_cdna/ • ens_mouse_masked_chrs/
• Indices for both maq and novoalign• If an index you need is not there please ask – don’t make a
local one in your account!
• We have many indexed databanks• Under /databank/indices/<tool> e.g. for maq
• ens_human_chrs/ • ens_human_chrs_ucsc_rmfull_2/ • ens_mouse_chrs/ • ens_mouse_chrs_ucsc_rmfull/• ens_human_cdna/ • ens_mouse_masked_chrs/
• Indices for both maq and novoalign• If an index you need is not there please ask – don’t make a
local one in your account!
Computational Biology Research Group
ChIP-Seq PipelineChIP-Seq Pipeline
Computational Biology Research Group
ChIP-Sequencing Advantages Less DNA needed Not limited by micro-array content More precise site mapping Increased reads increases sensitivity Produces higher quality data
ChIP-Seq exampleChIP-Seq example
NGSreads
Map (maq)
Peak pick
(cisgenome)
Extract sequences from features(Motif extract)
MEME
Weblogo
MAQMAQ
For simple runs use ‘easyrun’ option…
nohup /proj/hts/bin/maq.pl easyrun <db> <fastq> -d <results-directory > maq.log
In <results-directory> the main file is all.map
To see the binary to something usable:
maq pileup <db> all.map > all.pileup
These are quite large files…
For simple runs use ‘easyrun’ option…
nohup /proj/hts/bin/maq.pl easyrun <db> <fastq> -d <results-directory > maq.log
In <results-directory> the main file is all.map
To see the binary to something usable:
maq pileup <db> all.map > all.pileup
These are quite large files…
Computational Biology Research Group
VisualizationVisualization
all.map file converts to wig using CBRG custom tool
maq wig <db> all.map > all.wig
Then we convert to GFF format using custom scripts
all.map file converts to wig using CBRG custom tool
maq wig <db> all.map > all.wig
Then we convert to GFF format using custom scripts
Computational Biology Research Group
GFF formatGFF format
• Gene Feature Format• Developed at the Sanger Institute• http://www.sanger.ac.uk/Software/formats/GFF/• Format for describing features associated with DNA, RNA and
Protein sequences• Easy to parse• More tools e.g. EMBOSS starting to use this as standard• GFF3 is more standard and works best with GBrowse
• Gene Feature Format• Developed at the Sanger Institute• http://www.sanger.ac.uk/Software/formats/GFF/• Format for describing features associated with DNA, RNA and
Protein sequences• Easy to parse• More tools e.g. EMBOSS starting to use this as standard• GFF3 is more standard and works best with GBrowse
Computational Biology Research Group
Computational Biology Research Group
##gff-version 3
chr3 src exon 1300 1500 . + . ID=exon00001
chr3 src exon 1050 1500 . + . ID=exon00002
chr3 src exon 3000 3902 . + . ID=exon00003
chr3 src exon 5000 5500 . + . ID=exon00004
chr3 src exon 7000 9000 . + . ID=exon00005
##gff-version 3
chr3 src exon 1300 1500 . + . ID=exon00001
chr3 src exon 1050 1500 . + . ID=exon00002
chr3 src exon 3000 3902 . + . ID=exon00003
chr3 src exon 5000 5500 . + . ID=exon00004
chr3 src exon 7000 9000 . + . ID=exon00005
SOFA term Note ‘=‘
http://gmod.org/wiki/GFF3
Wig binary filesWig binary filesScripts and modules to handle :
UCSC wiggle format (1 column; 2 column; 4 column)
or, gff3
binary (.wib)GMOD script
wiggle_to_wigBinary.pl gff file
Function:
wiggle_to_wigBinary.pl variables
(source / method / trackname / paths / input & output filenames )
command line to load binary / gff data into GBrowse (bp_seqfeature_load.pl + all variables: database name, filenames, paths etc)
a conf file stanza - to display the loaded data
construct an intermediate wiggle format file (....if input was gff3, maq binary)
Peak CallingPeak Calling
• Lots of algorithms to do this• Problems with identifying a good cut off score• Over and under prediction
F-Seq• Based on a training set of peaks identified by researcher in specific
region
• Iterate over parameter space until achieve best TP/FP score
cisgenome• Uses IP and Non IP ChIP-Seq data, increases accuracy of predictions
• Lots of algorithms to do this• Problems with identifying a good cut off score• Over and under prediction
F-Seq• Based on a training set of peaks identified by researcher in specific
region
• Iterate over parameter space until achieve best TP/FP score
cisgenome• Uses IP and Non IP ChIP-Seq data, increases accuracy of predictions
Computational Biology Research Group
Motif ExtractionMotif Extraction
• Extract underlying DNA from peak calls• Run using web based motif finders
• Weeder• MEME
• May need to do successive rounds to find weaker motifs
• Extract underlying DNA from peak calls• Run using web based motif finders
• Weeder• MEME
• May need to do successive rounds to find weaker motifs
Computational Biology Research Group
Quick note: SNP CallingQuick note: SNP Calling
Often finds errors in the PCR amplication step
• maq cns2snp (run during the easyrun option)
• SNPseeker
• Novoalign + CBRG script
Worth trying all of the above!
Often finds errors in the PCR amplication step
• maq cns2snp (run during the easyrun option)
• SNPseeker
• Novoalign + CBRG script
Worth trying all of the above!
Computational Biology Research Group
Molbiol Data StructureMolbiol Data Structure
Analyse your data on deva.molbiol.ox.ac.uk
CBRG set up /proj/hts/data/<username>
Suggested structure:
batch/
fastq/ dbname/
Contact us if you want a GBrowse database for your data
Analyse your data on deva.molbiol.ox.ac.uk
CBRG set up /proj/hts/data/<username>
Suggested structure:
batch/
fastq/ dbname/
Contact us if you want a GBrowse database for your data
Computational Biology Research Group
FutureFuture
Problem• In depth analysis after mapping = bottleneck• Need to empower the users to do their own analysis
Solution• Makefiles for bulk data analysis• Allow access to NGS data via GBrowse ‘workbench’• GBrowse plugins to export data to other tools• Galaxy http://main.g2.bx.psu.edu/ looks promising
Problem• In depth analysis after mapping = bottleneck• Need to empower the users to do their own analysis
Solution• Makefiles for bulk data analysis• Allow access to NGS data via GBrowse ‘workbench’• GBrowse plugins to export data to other tools• Galaxy http://main.g2.bx.psu.edu/ looks promising
Computational Biology Research Group