Page 1
© 2016. Published by The Company of Biologists Ltd.
Necrotic pyknosis is a morphologically and biochemically distinct event from
apoptotic pyknosis
Lin Hou1,2
, Kai Liu1, Yuhong Li
2, Shuang Ma
2, Xunming Ji
2 and Lei Liu
2
1State Key Laboratory of Membrane Biology, School of Life Sciences, Peking
University, Beijing, 100871, China
2 Aging and Disease Lab of Xuanwu Hospital and Center of Stroke, Beijing Institute
for Brain Disorders, Capital Medical University, Youanmen, Beijing, 100069, China
Correspondence:
[email protected]
[email protected]
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
JCS Advance Online Article. Posted on 29 June 2016
Page 2
Abstract
Classification of apoptosis and necrosis by morphological difference has been widely
used for decades. However, this method has been seriously doubt in recent years,
mainly due to lack of functional and biochemical evidence to interpret the
morphology changes. To address these questions, we devised genetic manipulations in
Drosophila to study pyknosis, a process of nuclear shrinkage and chromatin
condensation occurred in apoptosis and necrosis. By following the progression of
necrotic pyknosis, we surprisingly observed a transient state of chromatin detachment
from the nuclear envelope (NE), followed with the NE completely collapsed onto
chromatin. This phenomenon leads us to discover that phosphorylation of
barrier-to-autointegration factor (BAF) mediates this initial separation of NE from
chromatin. Functionally, inhibition of BAF phosphorylation suppressed the necrosis
in both Drosophila and human cells, suggesting necrotic pyknosis is conserved in the
propagation of necrosis. In contrast, apoptotic pyknosis did not show a detached state
of chromatin from NE and inhibition of BAF phosphorylation had no effect on
apoptotic pyknosis and apoptosis. Our research provides the first genetic evidence
supporting morphological classification of apoptosis and necrosis by pyknosis. Jo
urna
l of C
ell S
cien
ce •
Adv
ance
art
icle
Page 3
Introduction
Morphological difference in cell death has been used to classify apoptosis and
necrosis for a long time. These include apoptotic features such as cell shrinkage,
membrane blebbing, nuclear condensation and apoptotic body formation (Kerr et al.,
1972); and necrotic features such as cell swelling, plasma membrane rupture,
intracellular vacuolization and nuclear chromatin clumping (Raffray and Cohen,
1997). However, many exceptions have been discovered and classification of cell
death by morphology has been controversial (Raffray and Cohen, 1997). Recently, the
Nomenclature Committee on Cell Death (NCCD) has recommended using
biochemical markers for cell death classification instead of morphology (Galluzzi et
al., 2015; Galluzzi et al., 2012). The reasons include that morphology may not link to
functional aspect of cell death, a given morphology may be triggered by
heterogeneous insults, and existence of intermediate morphology shared by both
apoptosis and necrosis (Galluzzi et al., 2015; Galluzzi et al., 2012; Raffray and Cohen,
1997).
Pyknosis has been considered as an irreversible condensation of chromatin and the
nucleus. It commonly occurs in both apoptotic and necrotic cell death. For apoptosis,
the nucleus usually undergoes condensation, chromatin marginalization and
fragmentation into a few large and regular chromatin clumps, which are eventually
packed into apoptotic bodies (Kerr et al., 1972; Niquet et al., 2003). In contrast, nuclei
in necrotic cells condense into to smaller chromatin clumps with irregular and
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 4
dispersed morphologies, which may be later dissolved (Bortul et al., 2001; Fujikawa
et al., 2000; Hardingham et al., 2002; Niquet et al., 2003). Therefore, based on the
morphology of nuclear fragmentation, pyknosis can be divided into nucleolytic
pyknosis (mainly occurring in apoptosis) and anucleolytic pyknosis (mainly occurring
in necrosis) (Burgoyne, 1999). Although pyknosis has been widely considered as a
marker of cell death in vitro and in vivo (Colbourne et al., 1999; Fujikawa et al., 1999;
Fujikawa et al., 2010; Ji et al., 2013; Niquet et al., 2003; Sohn et al., 1998), it is
unclear whether pyknosis is a regulated process.
Here, we studied the morphological changes of pyknosis during the execution of
apoptosis and necrosis in a temporal manner. We found that necrotic pyknosis
occurred in a distinct pattern compared to apoptotic pyknosis, and phosphorylation of
BAF plays a key role only in necrotic pyknosis.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 5
Materials and methods
Drosophila stocks and maintenance
Flies were raised on standard cornmeal medium. The stocks were kindly provided by
colleagues including: UAS-eiger (Dr. Lei Xue), GMR-hid, GMR-Gal4 (Dr. Andreas
Bergmann) and UAS-IAP1 (Dr. Denise Montell). We generated the following lines
from the w1118
background by P-element insertion: UAS-GFP-BAF-WT,
UAS-GFP-BAF-3A, UAS-GFP-BAF-3D, UAS-BAF-WT-Flag, UAS-BAF-3A-Flag,
UAS-BAF-3D-Flag, UAS-GFP-BAF-2A and UAS-GFP-BAF-1A. UAS-koi.GFP
(BL#26266) and H2Av-mRFP1 (BL#23650) were obtained from the Bloomington
Drosophila Stock Center.
Protein extraction and immunoprecipitation
Fly heads and Ca2+
ionophore (A23187; Tocris Bioscience #1234) treated cells (all
cell lines were obtained from China Infrastructure of Cell Line Resources and tested
for contamination) were lysed in buffer (20 mM Tris pH 7.5, 100 mM NaCl, 0.5%
NP40) supplemented with protease inhibitor cocktail (Roche) and phosphatase
inhibitors (1 mM Na3VO4, 50 mM NaF, 30 mM glycerophosphate and 0.5 mM
EDTA). After sonication and centrifugation, the supernatant was incubated with
normal IgG (1:1000, Santa Cruz Biotechnology sc-2025) and protein A/G-agarose
beads (Thermo Scientific Pierce #20421). After centrifugation, the supernatant was
incubated with GFP antibody (1:200, Abcam ab1218; clone 9F9.F9) or Flag antibody
(1:1000, Sigma-Aldrich F3165; clone M2) for 2h. Then, pre-washed beads were
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 6
added and incubated overnight. After washing with lysis buffer 6 times, the pellet was
boiled in SDS loading buffer. Tricine-SDS-PAGE was used to separate the small
molecular weight proteins. BAF phosphorylation was detected by a phospho-
threonine antibody (1:500, Cell Signaling #9381).
Nuclear morphology and cell survival in cultured cells
The nuclear pore complex (NPC) antibody (1:1000, Abcam ab24609; clone Mab414)
was used for immunostaining. Mammalian cells were incubated with 20 M Ca2+
ionophore for the indicated times. The ATP level was determined by a CellTiter-Glo®
Luminescent Cell Viability Assay kit (Promega). The relative ATP level (%) = ATP
[with Ca2+
ionophore]/ATP [without Ca2+
ionophore] ×100.
Chromatin Immunoprecipitation (chIP) and quantitative PCR (qPCR)
After calcium ionophore or DMSO treatment for 30 min, chromatin
immunoprecipitation was performed as described (Boyd et al., 1998). The protein
A+G agarose/salmon sperm DNA (Merck Millipore #16-201) and lamin B1 antibody
(ab16048; Abcam) were used. Different size of DNAs were added the same joint at
both ends through multiple annealing and looping-based amplification cycles
(MALBAC) with 27-nucleotide sequence and 8 variable nucleotides as primers
(GTGAGTGATGGTTGAGG TAGTGTGGAGNNNNNNNN) (Zong et al., 2012),
and then quantified by qPCR using the 27-nucleotide sequence
(GTGAGTGATGGTTGAGGTAGTGTGGAG) as the primer. The lamin B1
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 7
precipitated DNA was quantified as a relative value to the IgG precipitation (IgG chIP
was set as 1).
Statistical Analysis
Student’s t-test and one-way ANOVA analysis with post hoc Tukey algorithm were
performed based on hypothesis of normal distribution and the variances within or
between the groups. All data were collected and analyzed without any preference.
Results and Discussion
Necrotic pyknosis shows a different morphology compared to apoptotic pyknosis
To study necrotic pyknosis, we used a previously established necrosis model in
Drosophila. Using the transient expression of a leaky cation channel, glutamate
receptor 1 Lurcher mutant (GluR1Lc
), calcium is overloaded into cells, which results
in necrosis and fly lethality (Liu et al., 2014). This fly model contains a promoter
Appl-Gal4 (expressed in neurons and a few epithelial cells in the larval anal pad),
UAS-GluR1Lc
and tub-Gal80ts, and it is simplified as the AG (Appl>GluR1
Lc,
tub-Gal80ts) model (Liu et al., 2014). The AG flies are healthy at 18 C due to
inhibition of Gal4 function by Gal80ts. Upon flies shifted to 30 C, Gal80
ts is
deactivated, and necrosis is initiated by GluR1Lc
expression (Liu et al., 2014). To label
the nuclear envelope (NE) and the chromatin, the fluorescent reporters UAS-koi.GFP
and His2Av-mRFP1 (expressing His2Av-mRFP fusion protein in all cells) were used.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 8
At 30 C for 22 hours, the nuclei of control flies [Appl-Gal4;tub-Gal80ts, labeled as
wild type (WT) in Fig. 1Aa] showed normal morphology, with chromatin occupying
the whole nucleus, and the interaction of chromatin with the NE was clearly visible.
Interestingly, after 18 to 20 hours at 30 C, the chromatin in the epithelial cells of AG
flies dramatically condensed, whereas the NE only slightly shrank, leading to the
detachment of chromatin from the NE (Fig. 1Ab and c). Later, both the NE and the
chromatin were further compacted and eventually collapsed together (Fig. 1Ad). The
morphology is consistent with the features of anucleolytic pyknosis (Fujikawa et al.,
2010; Sohn et al., 1998).
We also studied apoptotic pyknosis in vivo by transient expression reaper (rpr)
(Appl>rpr, tub-Gal80ts, simplified as AR), which induced classical apoptosis (White et
al., 1996). We found that the NE and chromatin physically shrank together, with the
nucleus eventually fragmenting into regular clumps (Fig. 1Ba-d).
Phosphorylation of BAF specifically mediates necrotic pyknosis
Our data suggest that necrotic pyknosis is likely initiated by the detachment of
chromatin from the NE. Previous studies show that barrier-to-autointegration factor
(BAF) plays a key role in chromatin tethering to the NE through its interaction with
LEM (LAP2/Emerin/MAN1)-domain containing proteins and dsDNA in a sequence
non-specific manner (Umland et al., 2000; Zheng et al., 2000).
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 9
Based on the function of BAF, it is possible that the dissociation of chromatin from
the NE is induced by deregulation of BAF in necrosis. To examine BAF localization
in necrosis, we generated a GFP-tagged BAF transgene (UAS-GFP-BAF). It has been
reported that an N-terminal GFP tag does not affect BAF activity (Nichols et al., 2006;
Shimi et al., 2004). In wild-type cells (Appl-Gal4;tub-Gal80ts), GFP-BAF was
distributed on chromatin and interacted with the NE (Fig. 1Ca). In the AG flies, most
GFP-BAF proteins were also localized on the compacted chromatin (Fig. 1Cb),
suggesting that BAF localization is not drastically altered during necrosis. However,
GFP-BAF reduced its distribution in the chromatin and formed ring-like structures in
apoptosis (Fig. 1Cc). This phenomenon is consistent with a previous report stating
that BAF was disassembled and disappeared from the nucleus in apoptosis (Furukawa
et al., 2007).
The N-terminal phosphorylation of BAF has been reported to cause the detachment of
chromatin from the NE in karyosome formation during meiosis of the oocyte in
Drosophila (Lancaster et al., 2007). The BAF N-terminus has three potential
phosphorylation sites, including serine 2, threonine 4 and serine 5. To test the
importance of BAF phosphorylation in necrotic pyknosis, we generated transgenic
flies expressing BAF proteins with these three potential phosphorylation sites mutated
to alanine (the non-phosphorylatable form, simplified as "BAF-3A") or aspartic acid
(the phospho-mimic form, simplified as "BAF-3D"). These mutation sites of BAF are
illustrated (Fig. 1D). When these mutant flies were crossed to AG flies to induce
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 10
necrosis, GFP-BAF-3A localization appeared more similar to the pattern of
GFP-BAF-WT under normal condition (Fig. 1Cd). Whereas GFP-BAF-3D showed a
similar dissociation phenotype as that of the GFP-BAF-WT under the AG background
(Fig. 1Ce). This data suggests that chromatin disassociation from NE during necrosis
is likely inhibited by GFP-BAF-3A expression. To further confirm the role of
BAF-3A, we quantified the early stage of necrotic pyknosis with the chromatin and
NE labeled by His2Av-mRFP1 and koi.GFP. In the AG flies, 58% of cells displayed
the early morphology of necrotic pyknosis (Fig. 1Ea, b, and 1F). Strikingly, the
early-stage morphology defect of necrotic pyknosis was completely abolished by the
BAF-3A expression (Fig. 1Ec and Fig. 1F). Similarly, expression of BAF-3A rescued
the late-stage morphology of necrotic pyknosis (Fig. 1G a-c and 1H). For apoptotic
pyknosis, BAF-3A expression had no inhibitory effect (Fig. 1Gd-e and 1H), indicating
different molecule(s) might be required.
Anucleolytic pyknosis plays a functional role in necrotic cell death
Although anucleolytic pyknosis has been considered to be a marker of necrosis, its
function in cell death is unclear. To address this question, we investigated the survival
of AG flies under different transgenic BAF mutant backgrounds. Transient
overexpression of BAF-3A or BAF-3D in neurons had no effect on fly survival (Fig.
2A). Upon induction of necrosis, the survival rate of adult AG flies decreased to
38.4% (Fig. 2A). Overexpression of wild-type BAF (BAF-WT) resulted in a similar
survival rate (Fig. 2A). Strikingly, the overexpression of BAF-3A increased the
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 11
survival rate to 70.0%, whereas the expression of BAF-3D reduced the survival rate to
11.7% (Fig. 2A). At the cellular level, BAF-3A suppressed the necrotic morphology,
whereas BAF-3D enhanced it, and BAF-WT had no effect (Fig 2B and 2C).
Altogether, BAF phosphorylation alone is not sufficient to induce cell death, but it is
necessary for necrotic pyknosis and the propagation of cell death. In contrast, the
expression of BAF-3A or BAF-3D had no effect on fly models of apoptosis, including
the eye defects of GMR-Hid (Grether et al., 1995) and GMR>eiger (Hid and Eiger
induce caspase-mediated and JNK-mediated apoptosis, respectively) (Moreno et al.,
2002) (Fig. 2D).
Due to lack of antibody to directly detect the phosphorylation of Drosophila BAF, we
assessed BAF phosphorylation by the immunoprecipitation of GFP-BAF proteins
with a GFP antibody followed by Western blotting with a phospho-threonine antibody.
The result showed that BAF phosphorylation indeed increased in the AG flies, and the
expression of BAF-3A abolished the phosphorylation (Fig. 2E). The subtle change in
BAF phosphorylation is likely due to only approximately 1% of neurons undergoing
necrosis, which was sufficient to cause fly lethality in the AG flies (Liu et al., 2014).
No signal could be detected when a phospho-serine antibody was applied. This result
suggests that threonine 4 in the N-terminal of BAF is the functional site that is
phosphorylated during necrotic pyknosis. To test this hypothesis, we generated
transgenes to express BAF proteins with both threonine 4 and serine 5 mutated to
alanine (BAF-2A) or threonine 4 alone mutated to alanine (BAF-1A) (Fig. 1D). We
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 12
found that both BAF-2A and BAF-1A could rescue the lethality of the AG flies,
similar to BAF-3A (Fig. 2A).
BAF phosphorylation regulates necrotic pyknosis in mammalian cells
Because of the conserved function of BAF in chromatin anchoring in metazoans
(Segura-Totten and Wilson, 2004), we asked whether BAF phosphorylation regulates
necrotic pyknosis in mammalian cells. To induce necrosis, human neuroblastoma
SH-SY5Y cells were treated with calcium ionophore to overload calcium. Calcium
ionophore treatment led to nuclear shrinkage into PI-positive, small round and bright
chromatin clumps within 30 minutes (Fig. 3Aa, a', b and b'). However, we did not
observe the transient detachment of chromatin from the NE in SH-SY5Y cells and in
several other cultured mammalian cells (Fig. 3Ac and Fig. S1). This variation might
be due to the difference between in vivo and in vitro systems. In tissues, the cellular
contacts play important role to set the threshold of cell death (Raffray and Cohen,
1997). In fact, the intermediate state of NE detached from chromatin has been
observed in the retinoblastoma patients (Buchi et al., 1994). In mammalian cells, the
nucleus is highly compacted and the dissociation of NE from chromatin may be less
obvious at the cell morphological level. To study the interaction between NE and
chromatin in mammalian cells, the DNA that tethered on the inner nuclear membrane
was precipitated by a lamin B1 antibody. Then, the precipitated DNA was quantified
by an agarose gel and a qPCR assay. The result showed that the lamin B1 bound DNA
was significantly decreased during necrosis in the SY5Y cells (Fig. 3B and C). This
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 13
result indicated that the dissociation of chromatin and NE might also take place
during necrosis in the mammalian cells.
The potential phosphorylation sites of human BAF (BANF1) include threonine 2,
threonine 3 and serine 4 (Fig. 3D). Because the site equivalent to the Drosophila BAF
threonine 4 was unclear (Lancaster et al., 2007), we mutated all three sites (Fig. 3D,
BANF1-3A), and expressed the mutant constructs in SH-SY5Y cells. The result
showed that expression of BANF1-3A (a non-phosphorylatable mutant) abolished the
reduction of lamin B1-bound DNA during necrosis (Fig. 3B and C). For the functional
role of BANF1 phosphorylation on necrosis, calcium ionophore treatment induced
approximately 30.4% PI-positive nuclei (Fig. 3E and Fig. 3F). However, expression
of BANF1-3A reduced the ratio of cell death to 14.4% (Fig. 3Ec and d and Fig. 3F).
BANF1-3A also blocked the ATP depletion (Fig. 3G).
To examine BANF1 phosphorylation, BANF1-Flag proteins were precipitated with a
Flag antibody and assessed by a phospho-threonine antibody. The result showed that
the phosphorylation of BANF1-WT-Flag was not detectable under normal condition,
and it was greatly increased upon treatment with calcium ionophore (Fig. 3H).
Importantly, there was no detectable phosphorylation of BANF1 when
BANF1-3A-Flag was expressed (Fig. 3H). This result indicates that BAF
phosphorylation is a conserved event of necrosis.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 14
Our study identified BAF phosphorylation as a specific biochemical marker for
necrotic pyknosis in certain types of cells, suggesting that classical apoptotic and
necrotic pyknosis may be distinct processes at the molecular level. A schematic model
of necrotic pyknosis is shown (Fig. 4). For classification of cell death, identification
of more biochemical markers that directly regulate morphology should greatly
improve the uncertainty to categorize more complicated cell death (Raffray and
Cohen, 1997). In fact, several regulators of apoptosis and necrosis have been
identified, including caspase-activated DNase (CAD), endonuclease G and DNase I in
nuclear fragmentation (Enari et al., 1998; Li et al., 2001; Liu et al., 1997; Oliveri et al.,
2001), and phospholipase A2 in necrotic pyknosis (Shinzawa and Tsujimoto, 2003).
Here, we provide an example of morphological regulation of necrotic pyknosis by a
biochemical event.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 15
Acknowledgements
This work is supported by grants provide to L.L. by the Chinese Ministry of Science
and Technology (2013CB530700), and the National Science Foundation for
Distinguished Young Scholars (81325007) to X.J.
Author contributions
LH, KL, XJ and LL designed the experiments; KL and SM performed the initial
Drosophila study; LH performed the Drosophila and mammalian cell study; YL
generated the Drosophila transgenes; and LH, KL, XJ and LL wrote the manuscript.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 16
References
Bortul, R., Zweyer, M., Billi, A. M., Tabellini, G., Ochs, R. L., Bareggi, R., Cocco, L. and
Martelli, A. M. (2001). Nuclear changes in necrotic HL-60 cells. Journal of Cellular Biochemistry
Supplement 36, 19-31.
Boyd, K. E., Wells, J., Gutman, J., Bartley, S. M. and Farnham, P. J. (1998). c-Myc target
gene specificity is determined by a post-DNAbinding mechanism. Proc Natl Acad Sci U S A 95,
13887-92.
Buchi, E. R., Bernauer, W. and Daicker, B. (1994). Cell death and disposal in retinoblastoma:
an electron microscopic study. Graefes Arch Clin Exp Ophthalmol 232, 635-45.
Burgoyne, L. A. (1999). The Mechanisms of Pyknosis: Hypercondensation and Death.
Experimental Cell Research 248, 214-222.
Colbourne, F., Sutherland, G. R. and Auer, R. N. (1999). Electron Microscopic Evidence
against Apoptosis as the Mechanism of Neuronal Death in Global Ischemia. The Journal of
Neuroscience 19, 4200-4210.
Enari, M., Sakahira, H., Yokoyama, H., Okawa, K., Iwamatsu, A. and Nagata, S. (1998). A
caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature 391,
43-50.
Fujikawa, D. G., Shinmei, S. S. and Cai, B. (1999). Lithium-pilocarpine-induced status
epilepticus produces necrotic neurons with internucleosomal DNA fragmentation in adult rats. Eur J
Neurosci 11, 1605-14.
Fujikawa, D. G., Shinmei, S. S. and Cai, B. (2000). Kainic acid-induced seizures produce
necrotic, not apoptotic, neurons with internucleosomal DNA cleavage: implications for programmed
cell death mechanisms. Neuroscience 98, 41-53.
Fujikawa, D. G., Zhao, S., Ke, X., Shinmei, S. S. and Allen, S. G. (2010). Mild as well as severe
insults produce necrotic, not apoptotic, cells: evidence from 60-min seizures. Neurosci Lett 469, 333-7.
Furukawa, K., Aida, T., Nonaka, Y., Osoda, S., Juarez, C., Horigome, T. and Sugiyama, S.
(2007). BAF as a caspase-dependent mediator of nuclear apoptosis in Drosophila. J Struct Biol 160,
125-34.
Galluzzi, L. Bravo-San Pedro, J. M. Vitale, I. Aaronson, S. A. Abrams, J. M. Adam, D.
Alnemri, E. S. Altucci, L. Andrews, D. Annicchiarico-Petruzzelli, M. et al. (2015). Essential versus
accessory aspects of cell death: recommendations of the NCCD 2015. Cell Death Differ 22, 58-73.
Galluzzi, L., Vitale, I., Abrams, J. M., Alnemri, E. S., Baehrecke, E. H., Blagosklonny, M. V.,
Dawson, T. M., Dawson, V. L., El-Deiry, W. S., Fulda, S. et al. (2012). Molecular definitions of cell
death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012. Cell Death
Differ 19, 107-20.
Grether, M. E., Abrams, J. M., Agapite, J., White, K. and Steller, H. (1995). The head
involution defective gene of Drosophila melanogaster functions in programmed cell death. Genes &
Development 9, 1694-1708.
Hardingham, G. E., Fukunaga, Y. and Bading, H. (2002). Extrasynaptic NMDARs oppose
synaptic NMDARs by triggering CREB shut-off and cell death pathways. Nat Neurosci 5, 405-14.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 17
Ji, W. T., Lee, C. I., Chen, J. Y., Cheng, Y. P., Yang, S. R., Chen, J. H. and Chen, H. R. (2013).
Areca nut extract induces pyknotic necrosis in serum-starved oral cells via increasing reactive oxygen
species and inhibiting GSK3beta: an implication for cytopathic effects in betel quid chewers. PLoS
ONE 8, e63295.
Kerr, J. F. R., Wyllie, A. H. and Currie, A. R. (1972). Apoptosis: a Basic Biological
Phenomenon with Wide-ranging Implications in Tissue Kinetics. Br.J. Cancer 26, 239-257.
Lancaster, O. M., Cullen, C. F. and Ohkura, H. (2007). NHK-1 phosphorylates BAF to allow
karyosome formation in the Drosophila oocyte nucleus. J Cell Biol 179, 817-24.
Li, L. Y., Luo, X. and Wang, X. (2001). Endonuclease G is an apoptotic DNase when released
from mitochondria. Nature 412, 95-9.
Liu, K., Ding, L., Li, Y., Yang, H., Zhao, C., Lei, Y., Han, S., Tao, W., Miao, D., Steller, H. et
al. (2014). Neuronal necrosis is regulated by a conserved chromatin-modifying cascade. Proc Natl
Acad Sci USA 111, 13960-5.
Liu, X., Zou, H., Slaughter, C. and Wang, X. (1997). DFF, a Heterodimeric Protein That
Functions Downstream of Caspase-3 to Trigger DNA Fragmentation during Apoptosis. cell 89,
175-184.
Moreno, E., Yan, M. and Basler, K. (2002). Evolution of TNF Signaling Mechanisms:
JNK-Dependent Apoptosis Triggered by Eiger, the Drosophila Homolog of the TNF Superfamily. Curr
Biol 12, 1263–1268.
Nichols, R. J., Wiebe, M. S. and Traktman, P. (2006). The vaccinia-related kinases
phosphorylate the N' terminus of BAF, regulating its interaction with DNA and its retention in the
nucleus. Mol Biol Cell 17, 2451-64.
Niquet, J., Baldwin, R. A., Allen, S. G., Fujikawa, D. G. and Wasterlain, C. G. (2003).
Hypoxic neuronal necrosis: protein synthesis-independent activation of a cell death program. Proc Natl
Acad Sci U S A 100, 2825-30.
Oliveri, M., Daga, A., Cantoni, C., Lunardi, C., Millo, R. and Puccetti, A. (2001). DNase I
mediates internucleosomal DNA degradation in human cells undergoing drug-induced apoptosis. Eur J
Immunol 31, 743-51.
Raffray, M. and Cohen, G. M. (1997). Apoptosis and necrosis in toxicology: a continuum or
distinct modes of cell death? Pharmacol Ther 75, 153-77.
Segura-Totten, M. and Wilson, K. L. (2004). BAF: roles in chromatin, nuclear structure and
retrovirus integration. Trends Cell Biol 14, 261-6.
Shimi, T., Koujin, T., Segura-Totten, M., Wilson, K. L., Haraguchi, T. and Hiraoka, Y. (2004).
Dynamic interaction between BAF and emerin revealed by FRAP, FLIP, and FRET analyses in living
HeLa cells. J Struct Biol 147, 31-41.
Shinzawa, K. and Tsujimoto, Y. (2003). PLA2 activity is required for nuclear shrinkage in
caspase-independent cell death. J Cell Biol 163, 1219-30.
Sohn, S., Kim, E. Y. and Gwag, B. J. (1998). Glutamate neurotoxicity in mouse cortical neurons:
atypical necrosis with DNA ladders and chromatin condensation. Neurosci Lett 240, 147-50.
Umland, T. C., Wei, S. Q., Craigie, R. and Davies, D. R. (2000). Structural basis of DNA
bridging by barrier-to-autointegration factor. Biochemistry 39, 9130-8.
White, K., Tahaoglu, E. and Steller, H. (1996). Cell Killing by the Drosophila Gene reaper.
Science 271, 805-807.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 18
Zheng, R., Ghirlando, R., Lee, M. S., Mizuuchi, K., Krause, M. and Craigie, R. (2000).
Barrier-to-autointegration factor (BAF) bridges DNA in a discrete, higher-order nucleoprotein complex.
Proc Natl Acad Sci U S A 97, 8997-9002.
Zong, C., Lu, S., Chapman, A. R. and Xie, X. S. (2012). Genome-Wide Detection of
Single-Nucleotide and Copy-Number Variations of a Single Human Cell. Science 338, 1622-1626.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 19
Figures
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 20
Figure 1. Characterization of pyknosis in Drosophila
A) Observation of necrotic pyknosis in vivo. In the larval anal pad epithelial cells, the
nuclear envelope (NE) and chromatin were labeled by UAS-koi.GFP and
H2Av-mRFP1, respectively. a, The NE and chromatin in wild type (WT) cells
(Appl-Gal4;tub-Gal80ts). b and c, The early stage of NE and chromatin changes in AG
flies (Appl-Gal4;tub-Gal80ts, UAS-GluR1
Lc/cyo). d, The late stage of NE and
chromatin changes in AG flies. Trial N = 10. For each trial, 50 cells were observed. B)
Observation of apoptotic pyknosis in vivo. The NE and chromatin were labeled by
UAS-koi.GFP and H2Av-mRFP1, respectively. C) BAF protein localization in vivo.
The micrographs show pattern of GFP-tagged wild type BAF (GFP-BAF-WT) under
wild type (a), AG (b) and AR (c) backgrounds. In addition, the patterns of
GFP-BAF-3A (d) and GFP-BAF-3D (e) under the AG background were shown. D)
List of potential phosphorylation sites in the N-terminus of BAF. Red letters highlight
the mutations made. E) An example of BAF-3A effect on the early-stage of necrotic
pyknosis (disassociation of chromatin from NE). F) Quantification of data from E.
The bar graph shows the ratio of normal nuclei without NE and chromatin
disassociation. Trial N = 5 and data quantified from 4, 7, and 7 larvae respectively. G)
Effect of BAF-3A on late-stage of necrotic and apoptotic pyknosis. The chromatin
changes revealed by H2Av-mRFP1 in the larval anal pad. White dotted lines mark the
boundary of the anal pad. H) Quantification of G. The bar graph shows the number of
fragmented, anucleolytic pyknotic or normal nuclei in the larval anal pad. Trial N = 3
and data quantified from 5 larvae. Data of all bar graphs are means + s.d. * for p<0.05,
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 21
** for p<0.01 and *** for p<0.001; NS for not significant. Two-tailed, One-way
ANOVA with post hoc Tukey algorithm were performed for three or more sample
comparison. For two sample comparisons, two-tailed Student’s t-test were used.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 22
Figure 2. Functional role of BAF phosphorylation on necrosis and apoptosis
A) The effect of BAF mutants on the survival of AG flies. The flies were incubated at
30 C for 12 hours. Then, the flies were returned to 18 C, and the fly survival was
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 23
recorded 48 hours later. Trial N = 3, 3, 3, 7, 7, 7, 7, 7, and 7. Fifty flies were tested for
each trial. B) The effect of BAF mutants on necrosis in larval anal pads. A later time
point (26 h) is shown to demonstrate the rescue effect of BAF-3A, and an earlier time
point (20 h) is shown to demonstrate the enhanced effect of BAF-3D. Trial N = 4, 5,
and 4. C) Quantification of cell number in B. N = 6, 7, and 7 larvae. D) Effects of
BAF mutants on the caspase-dependent apoptosis and the JNK-dependent cell death
models in Drosophila eyes. Overexpression of IAP1 and bskDN
are shown as the
positive controls, which suppress the indicated cell death pathways. E)
Immunoprecipitation (IP) and immunoblot to detect BAF phosphorylation during
necrosis. Trial N = 3. The asterisk indicates a none specific band appeared in all
samples, which run slightly higher than the phosphorylated GFP-BAF band (labeled
with "<").
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 24
Figure 3. Characterization of necrotic pyknosis in the human SH-SY5Y cells
A) The change of nuclear morphology upon the induction of necrosis. a, a', b and b',
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 25
the same view with different staining. In b, b' and c, the cell cultures were treated
with calcium ionophore (20 M) for 30 minutes. b and b' show the chromatin
condensation (DAPI) in necrotic cells (PI-positive). c, Chromatin (DAPI) and the NE
(NPC antibody) are co-stained. B) Quantification of lamin B1 bound DNA by agarose
gel electrophoresis. Trial N = 3. With the relative level of the control (IgG
precipitation without adding calcium ionophore) to be set as 1, the density of other
samples are shown, means ± s.d. C) Quantification of the lamin B1 bound DNA by
qPCR. For each sample, the Ct value of the chIP DNA fraction was normalized to its
own input DNA fraction; and the DNA level of the normalized background (IgG chIP)
was set as 1. chIP Trial N = 3. For each trial, the MALBAC and qPCR were
performed twice. D) Comparison of the N-terminal sequences of Drosophila BAF
(dBAF) and human BANF1 (hBANF1). The potential phosphorylation sites are
indicated by blue arrowheads. Red letters indicate non-phosphorylatable mutation
sites. E) Effect of BANF1 on necrosis. Stable cell lines expressing GFP (a and b),
wild type BANF1 (BANF1-WT, c) or non-phosphorylatable BANF1 (BANF1-3A, d)
were treated with DMSO or calcium ionophore for 30 minutes and necrotic cells are
revealed by PI staining. The upper panels are the same views as lower panels with
DAPI or PI staining, respectively. F) The quantification of E. Trial N = 3 and data
quantified from 6, 8, 8, 8 images respectively. G) Cell viability quantified by an ATP
assay. Trial N = 4. H) Immunoprecipitation (IP) and immunoblot (IB) to detect
BANF1 phosphorylation during necrosis. Trial N = 3.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 26
Figure 4. A schematic model for necrotic pyknosis
At early stages of necrotic pyknosis, BAF phosphorylation promotes condensed
chromatin to dissociate from the NE. Then, at later stages, the NE collapses onto the
chromatin with damaged plasma membrane.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Page 27
Supplementary information
Figure S1. Nuclear morphology during necrosis in cultured mammalian cells
B16 (mouse melanoma cell), C6 (rat glioma cell), HEK-293 (human embryonic
kidney cell) and HeLa cells (human adenocarcinoma cell) are used. The normal
nuclear morphology (DAPI staining) are shown in a-d, and nuclear morphologies are
observed after 20 µM calcium ionophore treatment for a short time (a’-d’) and a
longer time (a’’-d’’). Chromatin (DAPI) and NE (NPC) are co-stained. single section
images are shown.
J. Cell Sci. 129: doi:10.1242/jcs.184374: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion