Nature Biotechnology: doi:10.1038/nbt · Tumors initiated by disruption of Apc in vivo in the colon epithelium were subjected to massive ly parallel sequencing of a 200 base pair

Supplementary Figure 1

Mucosal injection of PGK::Cre lentivirus results in recombination in crypt base stem cells and tumorigenesis in Apcfl/fl

mice.

(a) Schematic and matching optical colonoscopy images of colonoscopy-guided mucosal injection. Injection of 50 l of liquid results in a

“bubble” between the epithelium and lamina propria. (b) Bioluminescence (IVIS) and tdTomato fluorescence imaging of Rosa26LSL-

tdTomato/LSL-Luciferase mice (N=2) two days after mucosal delivery of adenovirus expressing Cre-recombinase (Ad5CMV::Cre, titer 300,000

TU/ l). Arrowheads indicate recombined areas. (c) EpCAM and tdTomato immunofluorescence imaging of colon sections from

Rosa26LSL-tdTomato/+

mice seven days following colonoscopy-guided mucosal injection of a lentiviral vector expressing Cre recombinase

(lenti-PGK::Cre, titer 100,000 TU/ l). Arrows indicate recombination in crypt base stem cells. Arrowhead shows recombination in

stromal cells (N=5 mice). (d) PGK::Cre-induced tumors in Apcfl/fl

mice (titer 30,000 TU/ l). Tumors are visualized with colonoscopy

Nature Biotechnology: doi:10.1038/nbt.3836

(dotted line), hematoxylin and eosin histology, and -catenin immunohistochemistry. Histology images are 20X and insets are 60X

(Scale bar: 200 m). (R26: Rosa26; PGK: human phosphoglycerate kinase-1 promoter; H&E: hematoxylin and eosin; T: tumor; N:

normal).



In situ deletion of Apc using floxed alleles results in tumorigenesis.

(a) Tumors in Apcfl/fl

mice after colonoscopy-guided mucosal injection of Ad5CMV::Cre (titer: 300,000 TU/ l). Tumorigenesis is

indicated by colonoscopy, necropsy, hematoxylin and eosin (H&E) histology, and -catenin immunohistochemistry. (b) tdTomato

immunofluorescence imaging of Rosa26LSL-tdTomato

;VillinCreER

mice injected via colonoscopy with 100 M 4-hydroxytamoxifen. Arrows

indicate recombination in epithelial cells. (c) Tumors in the distal colons of Apcfl/fl

;VillinCreER

mice following injection of 100 M 4-

hydroxytamoxifen (colonoscopy, H&E staining, and -catenin immunohistochemistry). H&E staining, biopsy of an in vivo tumor. (d)

Tumorigenesis in Apcfl/fl

;Lgr5eGFP-creER/+

mice after mucosal delivery of 100 M 4-hydroxytamoxifen (colonoscopy, brightfield/GFP

necropsy, H&E staining, and GFP immunofluorescence). Arrows indicate Lgr5+/GFP+ adenoma cells. Tumors are indicated with dotted

lines. Histology images are 20X and insets are 60X (Scale bar: 200 m) (tdT or tdTom:tTdTomato; R26: Rosa26; N: normal; T: tumor).



Mucosal delivery of lipid nanoparticle-encapsulated Cre mRNA induces tumor formation in Apcfl/fl

mice

(a) Lipid nanoparticles are composed of mRNA and an amine-containing ionizable lipid that electrostatically complexes with the

negatively charged mRNA and can both help facilitate cellular uptake and endosomal escape of the mRNA to the cytoplasm. In addition, a phospholipid is added that provides structure to the lipid nanoparticle and can assist in endosomal escape. Cholesterol is added to enhance the stability and promote membrane fusion. A lipid-anchored polyethylene glycol is also added to stabilize the particles and reduce nonspecific interactions. As represented in the schematic, the LNPs assume a multi-laminar spherical shape. (b)

Cryogenic transmission electron microscopy image of lipid nanoparticles (arrowhead) in a buffered solution on a lacey copper grid coated with a continuous carbon film (Scale bar: 200 nm). (c) Bioluminescence (IVIS) imaging two days after colonoscopy-guided

mucosal delivery into wild-type mice with luciferase mRNA alone (CL) or lipid nanoparticle-encapsulated luciferase mRNA (LNP). Arrowhead denotes luminescence signal at mucosal injection sites. (d) EpCAM and tdTomato immunofluorescence imaging of colon sections from Rosa26

LSL-tdTomato/+ mice seven days after colonoscopy-guided mucosal injection of lipid nanoparticle-encapsulated Cre

mRNA (N=3). Arrows indicate recombined crypt cells, and arrowheads point to recombination in stromal cells. Injection of Cre mRNA alone did not induce recombination in Rosa26

LSL-tdTomato/+ recipient colons (N=3 mice, not shown). (e) Tumors following delivery of lipid

nanoparticle-encapsulated Cre mRNA to the colon mucosa of Apcfl/fl

mice are demonstrated by colonoscopy (dotted line), H&E staining,

and -catenin immunohistochemistry. (PEG: polyethylene glycol; TEM: transmission electron microscopy; TdTom: TdTomato; R26:

Rosa26). Histology images are 20X and insets are 60X (Scale bar: 200 m).



Analysis of mutations introduced in vivo by CRISPR-Cas9 at the Apc locus.


Tumors initiated by disruption of Apc in vivo in the colon epithelium were subjected to massively parallel sequencing of a 200 base pair (bp) genomic region comprising 100 bp on either side of the sgApc binding site. (a) Tumor containing 4 different types of Apc mutations

induced by U6::sgApc-EFS::Cas9-P2A-GFP lentivirus infection in a wild-type mouse (representative results from eight analyzed tumors); (b) Representative 6-week-old and 1-year-old tumors containing multiple types of Apc mutations induced by U6::sgApc-EFS::turboRFP in Rosa26

LSL-Cas9-eGFP/+;Villin

CreER mice. Blue in the pie charts represents the fraction of wild-type reads, most likely

arising from wild-type stroma present in the tumors. Alignments of the wild-type locus sequence and the most common mutated alleles are shown below the pie charts. The 10 most common mutant alleles among 25 six-week-old samples and five one-year-old samples are described. Locations of the guide RNA target sequence and PAM sequence (light orange highlight) are indicated. Each mutant allele is characterized by its frequency in the total pool of mutant reads or samples, the type of event (DEL: deletion, INS: insertion), event size (in bp), and impact on the coding sequence (FS: frameshift mutation; NFS: non-frameshift mutation). Deletions are indicated by red dashes and insertions by red triangles. Locations of the guide RNA target sequence, PAM sequence, and mutant allele frequencies are described.



CRISPR-Cas9-based in situ Apc and Trp53 editing in the colonic epithelium induces adenoma formation.

(a) One-year-old tumors in tamoxifen-treated Rosa26LSL-Cas9-eGFP/+

;VillinCreER

mice that were injected under colonoscopy guidance with

U6::sgApc-EFS::turboRFP lentivirus (titer: 10,000 TU/ l). Tumors were seen with white light/GFP/turboRFP fluorescence colonoscopy

and necropsy. Immunofluorescence for GFP, turboRFP, and -catenin demonstrate GFP+ adenoma (arrows) and limited turboRFP

expression in stromal cells (arrowheads). (b) H&E staining of six-week-old vs. one-year-old tumors from tamoxifen-treated Rosa26LSL-

Cas9-eGFP/+;Villin

CreER mice that were injected with U6::sgApc-EFS::turboRFP lentivirus. (c) Colon tumors from Apc

fl/fl;Rosa26

LSL-Cas9-eGFP/+


mice injected under colonoscopy guidance with U6::sgTrp53-CMV::Cre lentivirus (titer: 10,000 TU/ l). Tumors were imaged by white

light/GFP fluorescence colonoscopy and necropsy as well as hematoxylin and eosin (H&E) histology. (d) Tumors in tamoxifen-treated Rosa26


CreER mice that received mucosal delivery of hU6::sgApc-sU6::sgTrp53-EFS::turboRFP lentivirus (titer: 10,000

TU/ l). Tumors were seen with white light/GFP/turboRFP fluorescence colonoscopy and necropsy and examined with H&E staining.

Histology images are 20X and insets are 60X (Scale bar: 200 m). (tRFP: turboRFP, R26: Rosa26).




Analysis of mutations introduced in vivo by CRISPR-Cas9 at the Apc and Trp53 loci.

(a) Tumors were induced in Apcfl/fl

;R26LSL-Cas9-eGFP/+

mice by mucosal injection of U6::sgTrp53-CMV::Cre lentivirus, then subjected to

massively parallel sequencing of a 200 base pair (bp) genomic region consisting of 100 bp on either side of the sgTrp53 binding site. (b) Mucosal delivery of hU6::sgApc-sU6::sgTrp53-EFS::turboRFP lentivirus into Rosa26


CreER mice treated with

tamoxifen generated tumors that were then subjected to massively parallel sequencing of a 200 bp genomic region consisting of 100 bp on either side of the loci in Apc and Trp53 targeted by the respective sgRNAs. Blue in the pie charts represents the fraction of wild-type

reads, most likely arising from wild-type stroma present in the tumors. Alignments of the wild-type locus sequence and the 10 most common mutated alleles in a representative sample and in three tumors are shown. Locations of the guide RNA target sequence and PAM sequence (light orange highlight) are indicated. Each mutant allele is characterized by its frequency in the total pool of mutant reads or samples, the type of event (DEL: deletion, INS: insertion), event size (in bp), and impact on the coding sequence (FS: frameshift mutation; NFS: non-frameshift mutation). Deletions are indicated by red dashes and insertions by red triangles. Locations of the guide RNA target sequence, PAM sequence, and mutant allele frequencies are described.



Orthotopic engraftment of intestinal organoids.

(a) Orthotopic transplantation of small intestinal organoids derived from tamoxifen-treated Rosa26LSL-tdTomato/+

;VillincreER

mice. tdTomato+

organoids are visualized in vivo with white light colonoscopy and tdTomato fluorescence colonoscopy. Mice received a pulse of 5-ethynyl-2’-deoxyuridine (EdU) four hours before sacrifice. Arrowheads on immunofluorescence images indicate tdTomato+ intestinal organoids in the lamina propria of the recipient mice. Arrows point to lysozyme positive Paneth cells and EdU positive proliferating cells. Orthotopic transplantation was successful in all three mice receiving two organoid injections each. (b) Tumors in mice transplanted with

Apcfl/fl

VillincreER

intestinal organoids and treated with tamoxifen. Tumors are imaged with colonoscopy, necropsy, hematoxylin and eosin

histology, and -catenin immunohistochemistry (N=2). Tumors are indicated with dotted lines. (Scale bar: 200 m). Dotted lines indicate

tumors. (EdU: 5-ethynyl-2’-deoxyuridine; NSG: nod SCID gamma; H&E: hematoxylin and eosin).



Orthotopic transplantation of murine colorectal cancer cells and organoids results in tumor formation.

(a) Tumors in C57BL/6 mice following orthotopic transplantation of a murine CRC cell line derived from a Cre-excised

Apc / ;KrasG12D/+

Trp53 / (AKP) genetically engineered tumor. Tumors are visualized with colonoscopy, hematoxylin and eosin (H&E)

stain, and -catenin immunohistochemistry. Arrow indicates invasion of the muscularis propria. (b) Wild-type C57BL/6 intestinal

organoids infected with U6::sgApc-EFS::Cas9-P2A-GFP lentivirus, then selected in media without Wnt agonists. (c) sgApc intestinal


organoids were subjected to massively parallel sequencing of a 200 base pair (bp) genomic region comprising 100 bp on either side of the sgRNA binding site. Locations of the guide RNA target sequence and PAM sequence (light orange highlight) are indicated. Each mutant allele is characterized by its frequency in the total pool of mutant reads, the type of event (DEL: deletion, INS: insertion), event size (in bp), and impact on the coding sequence (FS: frameshift mutation; NFS: non-frameshift mutation). Deletions are indicated by red dashes and insertions by red triangles. The ten most common mutated sequences are listed. (d) RT-PCR for selected Wnt target genes in sgApc small intestinal and colon organoids. (e) Tumors in C57BL/6 mice following orthotopic engraftment of sgApc organoids

(colonoscopy, necropsy, H&E stain, and -catenin immunohistochemistry). (f) Tumors in C57BL/6 mice transplanted with AKP colon

organoids (colonoscopy, necropsy, H&E stain, -catenin immunohistochemistry, and trichrome stain). Arrows indicate invasion of the

muscularis propria. Arrowheads show desmoplastic reaction. (g) Tumors following orthotopic transplantation of Apcfl/fl

;Rosa26LSL-Cas9-

eGFP/+ colon organoids infected with U6::sgTrp53-CMV::Cre lentivirus (white light/GFP fluorescence colonoscopy, GFP/ -catenin

immunofluorescence). Histology images are 20X and insets are 60X (Scale bar: 200 m). Dotted lines indicate tumors. (R26: Rosa26;

N: normal; T: tumor).




Analysis of mutations introduced by CRISPR-Cas9 at the sgApc locus in wild-type colon organoids and organoid orthotopic transplant tumors.

(a) Wild-type colon organoids were infected with U6::sgApc-EFS::Cas9-P2A-GFP lentivirus, then subjected to massively parallel

sequencing of a 200 base pair (bp) genomic region comprising 100 bp on either side of the sgApc binding site. Alignments of the wild-type locus sequence and all 18 mutant reads are shown next to the pie chart. (b) These Apc-null organoids were orthotopically

transplanted into recipient NSG mice. Eight weeks after transplantation, three samples each from two tumors were sequenced at the sgApc locus, as described above. Alignments of the wild-type locus sequence and the 10 most common mutant reads are shown. (c)

Summary of the 10 most common Apc mutations in the six orthotopic transplant samples from Tumors 1 and 2. Locations of the guide RNA target sequence and PAM sequence (light orange highlight) are indicated. Each mutant allele is characterized by its frequency in the total pool of mutant reads or samples, the type of event (DEL: deletion, INS: insertion), event size (in bp), and impact on the coding sequence (FS: frameshift mutation; NFS: non-frameshift mutation). Deletions are indicated by red dashes and insertions by red triangles.



Analysis of mutations introduced by CRISPR-Cas9 at the Trp53 locus in Apcfl/fl

;R26LSL-Cas9-eGFP/+

colon organoids and organoid orthotopic transplant tumors.

(a) Apcfl/fl

;R26LSL-Cas9-eGFP/+

colon organoids were infected with U6::sgTrp53-CMV::Cre lentivirus, and then subjected to massively

parallel sequencing of a 200 bp genomic region comprising 100 bp on either side of the sgTrp53 binding site. (b) Apc / , Trp53-edited

organoids were then orthotopically transplanted into recipient NSG mice to form tumors that were similarly sequenced at the sgTrp53 locus (N=3; data from a representative tumor are shown). Blue in the pie charts represents the fraction of wild-type reads, most likely arising from wild-type stroma present in the tumors. Alignments of the wild-type locus sequence and the 10 most commonly mutated sequences are shown below the pie charts. Locations of the guide RNA target sequence and PAM sequence (light orange highlight) are described. Each mutant allele is characterized by its frequency in the total pool of mutant reads, the type of event (DEL: deletion, INS: insertion), event size (in bp), and impact on the coding sequence (FS: frameshift mutation; NFS: non-frameshift mutation). Deletions are indicated by red dashes and insertions by red triangles.



Orthotopic engraftment of human colorectal cancer cell lines and patient-derived tumors.

Tumors initiated by orthotopic engraftment of (a) LS174 human CRC cells, (b) HT29 human CRC cells, and (c) patient-derived CRC

(colonoscopy, necropsy, hematoxylin and eosin staining, and -catenin immunohistochemistry). Arrows indicate invasion invasion into

the muscularis propria. Histology images are 20X and insets are 60X (Scale bar: 200 m). Dotted lines indicate tumors. (N: normal; T:

tumor; NSG: nod SCID gamma; H&E: hematoxylin and eosin).




Orthotopic engraftment of patient-derived organoids.

(a) Patient A colorectal cancer hematoxylin and eosin (H&E) histology and corresponding patient-derived organoids. (b) Human CDX2 in situ hybridization in tumors derived from orthotopic transplantation of Patient A CRC organoids. (c) Lynch Syndrome colorectal

cancer H&E histology (characterized by a high level of microsatellite instability and tumor lymphocytic infiltration; Patient B) and

corresponding tumor organoids engrafted into the flanks of recipient NSG mice (H&E stain, -catenin immunohistochemistry). (d)

Tumors derived from orthotopic transplantation of Patient B organoids (H&E histology, -catenin immunohistochemistry). Arrows

indicate invasion of the muscularis propria. (e) Liver metastasis after orthotopic transplantation of Patient B tumor organoids (H&E staining, CDX2/human Keratin20 immunohistochemistry). (f) Analysis of human CD3 T cells in Patient B-derived tumors orthotopically

transplanted into NSG mice with a reconstituted human immune system (humanized NSG). These tumors and their exhibited human CD3 T cell infiltration by immunohistochemistry and flow cytometry, with enrichment for human memory T cells (CD45RO memory / CD45 RA naive ratio = 26) compared to spleen control (memory / naive ratio = 2.2). Histology images are 20X and insets are 60X

(Scale bar: 200 m). Dotted lines indicate tumors. (ISH: in situ hybridization; N: normal; T: tumor; S: stromal lymphocytes; NSG: nod

SCID gamma; hKeratin20: human Keratin20; MSI-H, microsatellite instability-high).


Supplementary Video Supplementary Video 1. Colonoscopy-guided mucosal injection. During optical

colonoscopy, a 33-gauge needle with 45-degree bevel is inserted into the working

channel of the endoscopy and directed to the colonic mucosa without passing through

the muscularis propria or serosa. 50-100 μl of liquid (containing virus or organoids, for

example) is then rapidly injected to produce a mucosal bubble.


Supplementary Table 1: Primer sequences for Wnt target gene RT-PCR Gene Forward Primer Reverse Primer

Lgr5 CCTACTCGAAGACTTACCCAGT GCATTGGGGTGAATGATAGCA

Ccnd1 GCGTACCCTGACACCAATCTC CTCCTCTTCGCACTTCTGCTC

Myc ATGCCCCTCAACGTGAACTTC CGCAACATAGGATGGAGAGCA

Bcl2l1 GACAAGGAGATGCAGGTATTGG TCCCGTAGAGATCCACAAAAGT

Axin2 TGACTCTCCTTCCAGATCCCA TGCCCACACTAGGCTGACA

Ephb2 GCGGCTACGACGAGAACAT GGCTAAGTCAAAATCAGCCTCA

Cox2 TGAGCAACTATTCCAAACCAGC GCACGTAGTCTTCGATCACTATC

Vegf GCCAGACAGGGTTGCCATAC GGAGTGGGATGGATGATGTCAG

Smc3 CGAAGTTACCGAGACCAAACA TCACTGAGAACAAACTGGATTGC


Supplementary Table 2: Clinical characteristics of patient-derived organoids and

outcomes of orthotopic transplantation experiments

Patient-derived organoid transplantation studies were performed in NSG mice. Tumors

were identified by colonoscopy and confirmed by necropsy and histology. For all

experiments, two injections were performed per mouse. (T: Tumor; N: Node; M:

Metastasis; MSS: microsatellite stable; MSI-H: microsatellite instability-high).

Patient Age Sex Location / pathology

Stage Mutations Primary tumors / mice

Liver metastases / primary tumors

Week 4

Week 8

Week 12

Week 24

A 61 Female Moderately differentiated liver metastasis from rectal adenocarcinoma

T4 M1

MSS. Mutations in KRAS, TP53, PTCH1

17/18 0/7 1/3 2/4 2/3

B 68 Female Right colon adenocarcinoma with peritumoral lymphocytic infiltrate

Tis N0 M0

MSI-H, loss of MSH6 nuclear expression on IHC. KRAS wild-type. Mutations in TP53 and PIK3CA

12/13 0/3 1/5 2/4 -

C 47 Female Moderately differentiated peritoneal metastasis from right colon

T4b N1b M1b

MSS. Mutation in KRAS 11/11 0/4 1/4 1/3 -

All patients (%)

- - - - - 40/42 (95%)

0/14 (0%)

3/12 (25%

5/11 (45%)

2/3 (67%)


Nature Biotechnology: doi:10.1038/nbt · Tumors initiated by disruption of Apc in vivo in the colon epithelium were subjected to massive ly parallel sequencing of a 200 base pair

Documents