MUTATION AND POLYMORFISM Genetics and genomics for ED students 20.02.2015.
Jan 01, 2016
MUTATION AND POLYMORFISM
Genetics and genomics for ED students 20.02.2015.
Genetic variability
- is increased by – mutation
– sexual reproduction
meiosis (generation of gametes)
- homologous recombination (crossing over) - independent assortment of homologous chromosomes
fertilisation
- significance
DNA
DNA variants, alleles(any coding or non-coding sequence)
Mutation causing any
change)
Genetic (DNA) polymorphism
Significance of mutation (for all species)
Without mutation, evolution would not be possible. This is because mutations provide the "raw material" upon which the mechanisms of natural selection can act.
• normal or wild variant (allele) is the most frequent in a population
• polymorphism (or polymorphic) is the variant (allele) if its frequency is › 1 % in the population (formerly:having no effect on phenotype)
• mutation (or mutant) is the variant (allele) if itsfrequency is ‹ 1 % in the population
(formerly: disease causing, it has a negative connotation)
Regarding the variants….
Long way from mutation to polymorphism
Appearance of new variant by mutation Survival of rare allele
Increase in allele frequency after population expand
New allele is fixed in population as novel polymorphism
Classification of mutation types
• by the cause
• by the site
• by the function
• by the fitness
• by the size
By the cause mutations may be
• Spontaneous
• Induced
Spontaneous mutation
- Spontaneous chemical reactions in bases• Tautomerization• Depurination • Deamination
- Errors in DNA related processes• Replication• Recombination• Repair
E.g. Tautomers of adenine
T - A
Imino groupAmino group
(Purine-Purine)
results
Frequent rare
Depurination (hydrolysis)
Deamination
Repaired Not repaired
DNA methylation(regulation of DNA functions, see epigenetics)
Mutation hot spot
Induced mutation
Some environmental agent = mutagen– physical - radiation
• Heat• UV• Ionizing
– chemicals • Natural toxins• Synthetic substances
– Laboratory substances– Pollutants– Chemoterapeutics
Natural substances
Psoralen
Aflatoxin Aspergillus sp.
Laboratory chemicals: acridine orange, ethidium bromide, propidium jodide
A senescent endothelial cell stained with the fluorescent dye acridine orange to visualise the lysosomes.
Fluorescent dyes
BrdU - thymine analogue
Acrylamide Polyacrylamide
Pollutants
E.g. benzpyrene Metabolized to epoxides in liver polyaromatic hydrocarbons (PAH)
DNA adduct
Mutation
Biological warfare agent
Mustard gase
Iranian victim (end of 20th century)
I. World war victim (beginning of 20th century)
Correction of DNA errors
• DNA polymerase with proofreading ability
• Repair mechanisms nuclear but not mitochondrial DNA
DNA repair mechanisms
• Direct repair the change is reversed
no template is needed
mainly in prokaryotes
• Excision repair template is needed
in eukaryotes
Repair of single strand damage(complementer strand is used as template)
Xeroderma pigmentosum is caused by the defective nucleotide excision repair enzymes
Repair of double strand breaks (DSB)
may result loss of nucleotides = deleterious
Sister chromatid (after S phase) or like in meiosis, homologous chromosome is used as template = safety
Multicellular cell cycle
GoG2
G1
S
M-phase
Restriction point
G2
M
- Growth factors- anchorange
mitosis cytokinesis
Interphase
Checkpoints:Restriction pointG2M (spindle)
Function and activity of checkpoint machinery
G1 G2 M
DNA damage free kinetochors not complete DNA replication sensor protein kinases
transducer
effector s t o p of c e l l c y c l e
repair
Ataxia telangiectasia (ATM=sensor)
Its mutation causes rare, neurodegenerative, inherited disease (AR), that affects many parts of the body and causes severe disability, characterized by radiosensitivityand different tumors.
Role of BRCA (transducer) proteins in DNA repair
BRCA mutations are found in breast and ovarian tumors.
p53
Site of mutations - in the organism
• Somatic - in somatic cells
localized- inherited within cells of an organism
(mosaicism: tumors,
antibody diversity, etc.)
higher in dividing cells
• Generative - in primordial
germ line inherited from one
generation to the next one
And nondisjunction of sex chromosomes
B.R. Korf: Human Genetics and Genomics,2006
Site of mutations - in a gene may be
1/ Promoter mutations decreased transcription2/ Exon mutations amino acid change or truncated protein (stop) see later3/ Intron mutations errors in splicing4/ Polyadenylation site mutations decreased mRNA stability 5 5 UTR disturbed ribosome binding
1 2
3 4
UTR UTR
Mutations of other regulatory sequences (enhancers, silencers) also may influence transcription.
Splicing mutations
B.R. Korf: Human Genetics and Genomics,2006
Splicing mutations
B.R. Korf: Human Genetics and Genomics,2006
Different mutations of a gene may lead to different malfunctions of the protein(=CFTR)
Most frequent
Function and mutationsBack mutation or reversion is a point mutation that restores the original sequence and hence the original phenotype.
Lethal mutations are mutations that lead to the death of the organisms which carry the mutations.
Gain-of-function mutations - change the gene product such that it gains a new and abnormal function. These mutations usually have dominant phenotypes.
Loss-of-function mutations - gene product having less or no function. Phenotypes associated with such mutations are most often recessive.
Exception is when the reduced dosage of a normal
gene product is not enough for a normal phenotye
(this is called haploinsufficiency).
Dominant negative mutations - the altered gene
product acts antagonistically to the wild-type allele.
These mutations are characterised by a dominant
phenotype. In humans, dominant negative mutations
have been implicated in cancer (e.g. mutations in
genes p53, ATM).
Fitness and mutations
- Most are neutral – during evolution later may be harmful or beneficial
- Some are beneficial – - harmful one mutates back to wild - getting beneficial function – diversity of antibody - CCR532 – HIV resistency - sickle cell anemia – malaria resistency
- Some are harmful – causing diseases (all monogenic inherited diseases)
Size of mutations
• Large Genome mutation = change of chromosome number
• Medium Chromosome mutations = change of chromosome structure
• Small gene mutations = ranging from a change of single nucleotide to a whole gene (not visible) Affecting the lenght of DNA Deletion (single base or shorter-longer sequences)
Insertion (single base or shorter-longer sequences- repetitive more insertion than deletion
No effect on the length of DNA
nucleotide substitution
Cytogenetics
38
Repetitive insertions
– Tandem repeats• Satellite DNA
– pericentromeric heterochromatin
• Minisatellite (VNTR)– 10-60 bp– Telomere
• Microsatellite (STR=short tandem repeats)– 2- some bp– good markers of kinship– Repeat number expansion diseases
– Interspersed repeats: • SINEs (Short Interspersed Elements), • LINEs (Long …) e. g. L1
Microsatellite (STR = short tandem repeats)
• 1-4 bp• Trinucleotide (triplet) repeats are very frequent
– only few of them cause disease
(huntingtin)(Huntingtin)
Trinucleotide repeats may be either in coding(C) or noncoding (NC) region
NC
C
NC
C
C codingNC noncoding
Polyglutamine Polyalanine disorders disorders
• CAG repeats
• Neurodegenerative disorders • Different proteins
• Gain of function mutations
• Variable length
• Expansion
• Replicational slippage
Replication slippage
MATLEKLMKAFESLKSFQQQQQQQQQQQQQQQQQQQQQQQPPPP
PPPPPPPQLPQPPPQAQPLLPQPQPPPPPPPPPPGPAVAEEPLHRPK
KELSATKKDRVNHCLTICENIVAQSVRNSPEFQKLLGIAHELFLLCSDD...
Huntingtin
• 350 kD protein • ubiquitously expressed • function unknown • correlation between repeat size and age of onset and the severity of disease (Huntington chorea)
Huntington
healthy
Polyglutamine Polyalanine disorders disorders
• CAG repeats
• Neurodegenerative disorders • Different proteins
• Gain of function mutations
• Variable length
• Expansion
• Replicational slippage
• GCX repeats
•Developmental abnormalities
• Transcription factors
• Loss of function mutations
• Constant length
• Stable
• Uneven crossing over
Uneven crossing over
Unevensister chromatid exchange
Disorder Gene
• Holoprosencephaly ZIC2
Polyalanine disorder
Deletion or insertion of a single nucleotide (InDel)
It is a frameshift mutation if number of nucleotide is not a multiple of three,and in-frame if number of nucleotide is a multiple of three
DNA
mRNA
protein
Mutant protein
Medium InDel mutations
• Deletion– Pl. Hypodontia
(Deletion of Pax 9)
• Insertion– (retro)transposons
• Eg. L1 hemophilia A
L1 is a LINE: Long Interspersed Elements
51
L1 insertion and recombination in Hemophilia A
Hemophilia A inversion mutation due to recombination between L1 repetitive sequences within (gray arow) an outside (red arrow) the F8 gene
VIII. Blood clotingfactor gene (F8)
Single nucleotide substitution
Nucleotide substitutions in coding region
Transition
Transversion
Pyr ↔ PyrPu ↔ Pu
Pyr ↔ Pu
Synonymous not synonymousNo change in amino acid change of amino acid or no amino acid
More frequent in human
Missense mutation – sickle cell anemia
Frequences of disease causing mutations
Polymorphism
• Polymorphism appears at different levels:
– Phenotype polymorphism– Protein polymorphism (Immunoglobulins, ABO blood groups)– Genetic (DNA) polymorphism
Rate of genetic polymorphism
– Identity between individuals = 99,5%
– Difference between individuals = 0,5%
• It is variation of DNA sequence that is common in the general population (>1%)
• Most are neutral, but some confer susceptibility or resistance to disease
• In human genome there are many, that is why can be used for personal identification
• Detection technics are available
DNA Polymorphism
Genetic polymorphism
• chromosomal (minor variants)• tandem repeats
Satellite DNApericentromeric heterochromatin
Minisatellite (VNTR)Telomere
Microsatellite (STR=short tandem repeats)
• Single nucleotide polymorphism (SNP)
Chromosomal polymorphism
1, 9,16 chromosomes centromeresY chromosome long arm
ATGGTAAGCCTGAGCTGACTTAGCGT ATGGTAAACCTGAGTTGACTTAGCGT SNP SNP
Nucleotide substitution=SNP(single nucleotide polymorphism)
Disease resistant population Disease susceptible population
Genotype all individuals for thousands of SNPs
ATGATTATAG ATGTTTATAG
Resistant people all have an ‘A’ at position 4 in geneX, while susceptible people have a ‘T’
geneX
PPARG = Peroxiszóma Proliferátor Aktivátor Receptor γ, APOE = Apolipoprotein E; F5 = Faktor V; CTLA4 = Cytotoxikus T-lymphocyta Antigén 4; GSTM1 =Glutathione S-transferase Mu 1; INS = inzulin;KCNJ11 = ATP szenzitív K+csatornát kódoló gén; HF1/CFH = Komplement faktor H;COL1A1 = Kollagén 1 típus A1; CARD15 = Caspase Recruitment Domain 15;
Some disease associated SNPs
Association ≠ correlation
CNVR = copy number variations
1 kb - 5 megabAbout 1500 CNV12% of genome2900 gene
is based on mutations and polymorphisms