GLUTATHIONE-S-TRANSFERASES (GSTT1 & GSTM1) GENE DELETIONS AND SUSCEPTIBILITY TO BREAST CANCER IN PAKISTAN A THESIS SUBMITTED TO BAHAUDDIN ZAKARIYA UNIVERSITY IN PARTIAL FULFILLMENT OF THE REQUIREMNT FOR THE DEGREE OF MASTER OF PHILOSOPHY IN BIOTECHNOLOGY By ASMA SOHAIL FEBRUARY - 2011 INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY MULTAN, PAKISTAN
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
A THESIS SUBMITTED TO BAHAUDDIN ZAKARIYA UNIVERSITY
IN PARTIAL FULFILLMENT OF THE REQUIREMNT FOR THE DEGREE OF
MASTER OF PHILOSOPHY
IN
BIOTECHNOLOGY
By
ASMA SOHAIL
SESSION 2008-10
INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY
MULTAN, PAKISTAN
Page | iii
READ IN THE NAME OF ALLAH
Page | iv
Page | v
CERTIFICATE It is certified that the research work described in this thesis is the original work of ASMA
SOHAIL and has been carried out under my direct supervision. I have personally gone
through all the data reported in the manuscript and certify their correctness/authenticity. It
is further certified that the material included in this thesis have not been used in part or
full in a manuscript already submitted or in the process of submission in partial/complete
fulfillment of the award of any other degree from any other institution. It is also certified
that the thesis has been prepared under my supervision according to the prescribed format
and we endorse its evaluation for the award of M.Phil degree through the official
procedures of the University.
In accordance with the rules of the Institute, her data book is declared as unexpendable
document that will be kept in the registry of the Institute for a minimum of three years
from the date of the thesis defense examination.
SIGNATURE OF SUPERVISOR: _________________ NAME OF THE SUPERVISOR: PROF. DR. MUHAMMAD ALI
DIRECTOR, INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY, MULTAN, PAKISTAN.
Page | vi
The Controller of Examination, Bahauddin Zakariya University, Multan. We the supervisory committee, certify that the contents and form of thesis submitted by
ASMA SOHAIL has been found satisfactory and recommend it for the award of degree of
M.Phil Biotechnology.
Supervisory Board
Supervisor ……………………… (Prof. Dr. Muhammad Ali) External Examiner ……………………… (……..........................) Director ……………………… (Prof. Dr. Muhammad Ali)
Page | vii
INDEX CERTIFICATE __________________________________________________________ v
SUPERVISORY BOARD ________________________________________________ vi
TABLE OF CONTENT __________________________________________________ vii
LIST OF TABLES ______________________________________________________ ix
LIST OF FIGURES ______________________________________________________ x
ACKNOWLEDGMENT __________________________________________________ xi
SUMMARY ___________________________________________________________ xii
Glutathione S transferases (GSTs) and glutathione peroxidase (GPx) are cell protective
enzymes that alter the action of different exogenous (xenobiotics) and endogenous agents.
The conjugation of tripeptide glutathione (GSH) is catalyzed by GSTs to a wide range of
endogenous and exogenous chemicals having the electrophilic functional groups (e.g.
carcinogens, environmental pollutants and products of oxidative stress), they neutralize
their electrophilic sites, and make the products more water-soluble (Haydes & Pulford
1995). On the basis of the immunological cross reactivity and sequence homology, human
cytosolic GSTs have been categorized into eight gene families, with each family encoded
by a separate gene (Mannervik et al. 1992; Pemble & Taylor 1992; Board et al. 2000).
Single nucleotide polymorphisms (SNPs) affecting genes function are commonly
observed but complete absence or deletion of a gene in form of a null allele is rarely
observed. That is why GSTM1 and GSTT1 null allele (-/-) genotypes have attracted much
consideration and over 500 publications on the subject have been published in recent
years. Moreover, considering the significance of GSTs in detoxification mechanism of
carcinogens, null genotypes of GSTM1 and GSTT1 are expected to weaken the ability to
eliminate carcinogenic compounds and may therefore placing individuals with GSTM1
and/or GSTT1 null alleles at higher cancer risk. Previously, studies have shown
relationship of GST genotypes with breast, lung, colon, brain, and various other types of
cancer in different populations (Rebbeck 1997; Dunning et al. 1999; Landi 2000, Strange
et al. 2000; Mohr et al. 2003; Bajpai et al. 2007; Hatagima et al. 2008).
Keeping in view the vital role of GSTM1 and GSTT1 in detoxification of carcinogens
and availability of no information on these null polymorphisms of GSTM1 and GSTT1 in
Pakistani population in relation to breast cancer, we intended to analyze the effect of
these null polymorphisms of GSTT1 and GSTM1 in our population. Further link between
GSTT1 and GSTM1 null alleles and breast carcinoma have been stated with contradictory
results. Therefore, in order to assess the influence of these GSTs genotypes in breast
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 3
carcinoma, we planned to conduct this study for the first in Pakistan. Since Pakistan is a
thickly populated agricultural country and Southern Punjab population is highly exposed
to pesticides, so analysis of these deletion polymorphisms in GSTM1 and GSTT1
detoxifying enzymes are crucial for us as lack of a helpful detoxification system might
prove to be a risk factor for breast carcinoma in our population.
OVERVIEW OF CANCER DISEASE The term cancer basically depicts disorder of cells and it usually appears as a tumor
made up of a mass of cells, the tumor is visible after many years due to the chain of
reactions that might have taken place for long.
Cancer has been known since human societies first recorded their activities. It was
well known to the ancient Egyptians and to succeeding civilizations but, as most cancers
develops in the latter decades of life, until the expectation of life began to increase from
the middle of the nineteenth century onwards, the number of people surviving to this age
was relatively small. Now as infectious diseases, the major causes of death in the past
have been controlled by improvements in public health and medical care, the proportion
of the population at risk of cancer has increased significantly. Although diseases of the
heart and blood vessels are still the main cause of death in our ageing population, cancer
is now a major problem. For this reason, cancer avoidance and control are major health
issues. History tells us that a German microscopist, Johannes Mueller, about 140 years
ago, found that cancers were made up of cells, a discovery which began the search for
changes which would help to identify the specific distinction between cancer and normal
cells. In the intervening period a huge amount of information has been acquired about the
cancer cells. Particularly in the past two decades, rapid scientific progress has allowed us
to begin to dissect the cancer genome, transcriptome, and proteome in unparalleled detail
and today there seems no limit to the amount of information that can be achieved.
NORMAL CELLS & TISSUES The human body is comprised of four different main types of tissues:
1. The general supporting tissues jointly known as Mesenchyme.
2. The tissue-specific cells called as Epithelium.
3. The defense cells called as the Haemato-lymphoid system.
4. The Nervous system.
The mesenchyme comprised of connective tissue (fibroblasts) which make collagen
fibers and associated proteins, bone, cartilage, muscle, blood vessels, and lymphatics. The
epithelial cells are the specific, specialized cells of the different organs, for example, liver
glands skin, intestine, etc. The haemato-lymphoid system contains a wide group of cells,
mostly derived from precursor cells in the bone marrow giving rise to all the red and
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 4
white blood cells. The nervous system is comprised of the central nervous system (spinal
cord and the brain) and the peripheral nervous system, which is comprised of nerves
leading from these central structures.
Thus, each tissue has its own specific cells, usually several different types, which
maintain the structure and function of the individual tissue. The specific cells are grouped
in organs which have a typical pattern (Fig: 1). There is a layer of epithelium, the tissue-
specific cells, separated from the supporting mesenchyme by a semi-permeable basement
membrane. The supporting tissues (or stroma) are made up of connective tissue (collagen
fibers) and fibroblasts (which make collagen), which may be supported on a layer of
muscle and/or bone depending on the organ. Blood vessels, nerves and lymphatic vessels
go through the connective tissue and provide nutrients and nervous control among other
things for the specific tissue cells.
Figure 1: A typical tissue showing epithelial and mesenchymal components. (Adopted from: Introduction to the cellular and molecular biology of cancer)
CONTROL OF GROWTH IN NORMAL TISSUES One of the most intensively studied areas in biology is the research on mechanism of
control of cell growth and proliferation. It is important to make the distinction between
the terms ‘growth’ and ‘proliferation’.
Growth refers to an increase in size of a cell, organ, tissue, or tumor and by means of
cell division the increase in number of cells is called proliferation. ‘Growth’ is frequently
used as a loose term for both of these processes but the difference is particularly
important now that factors controlling both of these processes are becoming obvious.
In normal development and growth there is a very defined mechanism that allows
individual organs to reach a particular size, which for all practical purposes, is never
exceeded. The surviving cells in most organs begin to divide to replace the damaged ones
if the tissue gets injured. When normal position is achieved, the process stops, this is the
normal control mechanism that persists throughout life. Although most cells in the
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 5
embryo can proliferate, but not all of the adult cells preserve this ability. In most organs
there are special stem cells, which have the ability to divide in response to a stimulus such
as an injury to replace organ-specific cells. The highly differentiated cells like that of
muscle or nerve cells are more likely to have lost their ability to divide. In some organs,
particularly the brain, the nerve cells (highly differentiated), can only proliferate in the
embryo; while the special supporting cells in the brain continue to be able to proliferate.
That is why tumors of nerve cells are only found in the very young and tumors of the
brain in adults are derived from the supporting cell
Control of organ or tissue size is achieved by means of a fine balance between
stimulatory and inhibitory stimuli. When the tissue is damaged and repair is needed, that
is when the balance is shifted and a specific physiological stimulus is applied (for
example, hormonal stimulation), the component cells may respond in one of two ways to
attain these objectives. Either by hypertrophy, that is, an increase in size of individual
components, usually of cells which do not normally divide (example is the increase in
size of particular muscles in athletes) or by hyperplasia, that is, an increase in number of
the cells. When the stimulus is removed, commonly the situation returns to the status quo
as shown by the rapid loss of muscle mass in the lapsed athlete. Some of the stimuli
resulting in these compensatory responses are well-known growth factors and hormones.
THE CELL CYCLE All somatic cells increase in numbers in the same way which involves the growth of
all cell components (increase in cell mass) followed by division to generate two daughter
cells. The cell cycle is comprised of all the structural changes that take place during this
process have been known for many years. Four stages are recognized: G1, S, G2, and M
(Fig: 2).
G1 is a gap or pause after proliferative stimulation where little action occurs.
However, if the cell is defined to divide, there is much biochemical activity in G1 for
DNA replication (preparation). The second phase S is of DNA synthesis, which is meant
for chromosomes replication and increase. G2 is a second gap period following DNA
synthesis and thirdly M is the stage of mitosis leading to the breakdown of nuclear
membrane and as a result the condensed chromosomes can be visualized as they pair and
divide prior to division of the cytoplasm to produce two daughter cells. The last cell cycle
phase is recognized, G0, which is a resting phase in which non-cycling cells rest with a
G1 DNA content.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 6
Figure 2: Cell Cycle
Progression through the cell cycle is now known to be restricted at specific
checkpoints, one in G1 and others in S and G2/M (Fig: 3). These provide a chance for
cells to be diverted out of the cycle or to programmed cell death (apoptosis) if, for
example, there is DNA damage or inappropriate expression of oncogenic proteins. In
many of the cancers interruption of these cell cycle checkpoints or alterations to key cell
cycle proteins are found.
THE PROCESS OF TUMOR GROWTH & CARCINOGENESIS Carcinogenesis is a multistage process. In animals, the exposure to the carcinogen
(cancer-producing agent) does not lead to the immediate production of a tumor. Cancers
arise after a long latent period and after the multiple carcinogen effects. At least three
major stages are involved:
1: The first stage known as initiation, involves mutagenic effects of the carcinogen on
skin stem cells.
2: The second stage called promotion is stimulated by type of agents that are not
directly carcinogenic in their own right.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 7
3: Finally in the third stage, progression, some of these benign tumors either
spontaneously or following additional treatment with carcinogens, progress to malignant
tumors.
Ample time is required between the initiation and appearance of tumor. In man, it may
take over 20 years before tumors develop after exposure to industrial carcinogens. Even
in animals it may take up to a quarter or more of the total lifespan before tumors appear.
In the tumor that finally observed, most of the genetic and epigenetic changes seen are
clonal, that is they are present in the entire population of cells (Fig: 4).
Figure 3: Checkpoints control the ability of the cell to progress through the cycle by determining whether earlier stages have been completed successfully A horizontal red bar indicates the stage at which a checkpoint blocks the cycle.(Adopted from : Genes viii)
Figure 4: Tumor development showing progression from normal to invasive tumor via accumulation of heritable changes over a long period of time. The rate of acquisition of these changes will be influenced by environmental exposures and host response (Adopted from: Introduction to the cellular and molecular biology of cancer).
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 8
CLASSIFICATION OF TUMORS The term tumor cannot be defined in absolute terms. Tumors have the quality that
these cells in contrast to the normal cells lack the response to normal control mechanism
and hence they show abnormal proliferation. As different factors are concerned with
tumor formation, but the abnormal cells may respond to some but not to others. Another
complication is that after transforming from normal cells, some of the tumor cells stop
their division.
So tumors can be classified into three main groups:
1: Benign Tumors which can arise in any tissue and grow locally. Damage is caused
by exerting local pressure or obstruction. They have the common character that they don’t
spread to distant areas.
2: In Situ Tumors, they are usually but not always small in size. They develop in
epithelium. Morphologically they resemble cancer cells but they remain in epithelium and
do not invade the basement membrane and mesenchyma.
3: Malignant Tumors, they are fully developed cancer and have specific capacity to
attack and destroy the underlying mesenchyma layer. These cells produce a range of
proteins via the nutrients obtained from blood stream, which stimulate the growth of
blood vessels into the tumor thus allowing the continuous growth. The new vessels are
not well developed and are easily injured so the invading tumor cells may penetrate these
and lymphatic vessels. Tumor fragments may be carried in the newly developed vessels to
local lymph nodes or to distant organs where they may grow into secondary tumors.
Cancers may arise in any tissue. Although benign tumors can develop into malignant,
this is far from invariable. Many benign tumors never become malignant. In order to
understand the confusion regarding these definitions we should have the knowledge of the
whole process of tumor induction and development.
ETIOLOGY OF CANCER (CAUSES OF CANCERS) The genetic makeup of mankind barely changes in hundred years and differs
somewhat due to geographical locations between human populations. Environmental
effects and geographical deviation are responsible for the changes in the individual
cancers incidences over time. Mainly Cancers are caused by are chemical, physical,
biological (exogenous) carcinogens and endogenous processes (Table 1). They act on
every human but due to diversity in human’s genetic makeup; differ in their ability to
show their results. Secondly because of the social, economic and psychological
conditions, different trends are shown by the human towards the exposure to carcinogens.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 9
TABLE 1: TYPES AND EXAMPLES OF HUMAN CARCINOGENS
CHEMICAL CARCINOGENS Human chemical carcinogenesis is a multistage process that results from exposures,
usually in the form of complex chemical mixtures, often encountered in the environment
or through our lifestyle and diet ( Poirier et al. 2000) Tobacco smoke is the major
example, which causes cancers of the head, neck, lung, and bladder (Peto et al. 2000;
Vineis et al. 2001). Most chemical carcinogens do not respond readily to nucleophilic
biochemicals, but metabolic processes activate them to carcinogenic and mutagenic
electrophiles. Electrophilic chemical species have natural attraction towards nucleophiles
like DNA and protein, and they covalently get bonded to deoxyribonucleic acid (DNA) as
a result genetic damage occurs. Once carcinogens become the part of the body they are
subject to challenge the processes of metabolic activation and detoxification, although
some chemical species can act directly. Variation among the human population in these
metabolic processes, as well as the capacity for repair of DNA damage and cellular
growth control results in inter individual distinction in cancer risk, and is an indication of
gene-environment interactions, which embodies the concept the effects of chemical
carcinogen exposure is modified due to genetic constitution of individuals (Shields &
Harris 2000). For example, among the tobacco smokers only 10% develop lung cancer.
PHYSICAL CARCINOGENS Energy-rich radiation having different dose and absorption rate, can work like a
carcinogen. On the other hand visible light is can't behave carcinogenic, except if
absorbed by photosensitizing agents, producing reactive oxygen species. Generally,
physical carcinogens constitute: mechanical traumas, electromagnetic radiations of
different kinds, low and high temperatures, alpha and beta radiations, solid and gel
materials, hard and soft materials, fibrous & non fibrous particles. Physical carcinogens
mainly produce effects not because of their chemical properties and actions, rather due to
their physical properties and effects. It was found for the first time scientifically by
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 10
Turner that when Bakelite disks were set in rats, they motivated local fibro sarcomas
(Turner 1942).
UVA increases the effect of UVB irradiation which is a main carcinogen in the skin.
Radiation from industrial, natural, and iatrogenic sources like that of used in X-ray
diagnostics penetrates into the body. Its carcinogenicity depends on the amount absorbed,
which damages the DNA and cells either directly or by producing reactive oxygen species
The amount of radioactive isotopes distributed in the body, determines its effect on
that body. For example, radioactive iodine causes only thyroid cancers because it is
accumulated in the thyroid gland, while radioactive cesium isotopes deposit mostly the
urinary bladder. The probable carcinogenicity caused by microwave and radio
wavelength electromagnetic radiation of course is debatable.
BIOLOGICAL CARCINOGENS Certain viruses and bacteria's are the main biological carcinogens in human. HPV16
and HPV18 are the particular strains of human papilloma viruses which are recognized as
the cause of cervical and other genital cancers. Moreover they also manipulate the cancers
of the head, neck and the skin. Epstein-Barr virus in lymphomas and Human herpes virus
8 in Kaposi sarcoma behave as carcinogens (Kieff & Rickinson 2001).
The viral etiology of infectious hepatitis had been recognized as early as 1885. The
hepatitis B virus and hepatitis C virus with their DNA and RNA genome, respectively, are
certainly concerned with the cause of liver cancer. HIV the human retrovirus assists the
growth of cancers most of the time by hindering the immune system, but on the other
hand human T-cell leukemia virus (HTLV1) is the basis of a rare leukemia and it shows
the effect by T cells' direct growth stimulation.
ENDOGENOUS PROCESSES Endogenous processes can also be the main cause of cancers. Carcinogenic
compounds such as aromatic amines, nitrosamines, reactive aldehydes and oxygen
species and quinones are generated by normal metabolism. Factors like diet or physical
activity vary the amount of these potential carcinogens. Several mechanisms like potent
protective and detoxification are working for many of these compounds but not perfectly.
The risk of cancer growth can be increased by some patho physiological conditions. In
particular chronic inflammation in many organs like stomach and colon might be linked
with increased risk of cancer. Numerous factors that favor the spread and growth of
tumors include secretion of cytokines, growth factors and proteases by different cell types
and raised production of reactive oxygen species (mutated) by inflammatory cells. So,
regeneration of tissues is generally linked with an elevated risk of cancer. Few of the
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 11
carcinogens are supposed to act basically by provoking tissue growth and without being
mutagenic, rebuild themselves.
So we can conclude that both exogenous and endogenous factors are responsible for
the development of human tumors. In most of the cancers, their interaction is so
complicated that it is difficult to distinguish their contributions. Study of mutations can be
helpful in diagnosing the part played by some of the carcinogens. It is estimated that 5%
of all human cancers are because of occupational carcinogens.
EPIDEMIOLOGY & TYPES OF CANCERS Cancer is one of the basic threats to people's health and life, resulting in 13% of all
disease-causing deaths in the world (WHO Data & Statistics 2006). In 2007 about 7.6
million people expired of cancer in the world and over 1.4 million new cancer cases each
year were accounted in U.S in past years, hence it is reported to be the second leading
fatal disease after cardio vascular diseases.
According to the records of GLOBOCAN 2008 it was suggested that higher ratio of
cancer occurs in under developed regions, both in terms of cancer mortality (63% of
cancer casualties) and cancer incidence (56% of new cancer cases diagnosed in low
developed areas in 2008)
The majority of the prevailing cancers worldwide are lung (12.7% of the total), breast
(10.9% of total) and colorectal cancers (9.7% of total). The most fatal cancers are lung
(18.2% of the total), stomach (9.7% of total) and liver cancers (9.2% of total).
Remarkable differences in the prototype of cancer from area to area are found, like liver
and cervix are frequent in under developed regions of the world, on the other hand
prostate and colorectal cancers are more reported in developed areas.
Cancers can be categorized into three large groups. Those originating from epithelia
are known as carcinomas. These are among the widespread cancers overall (Fig: 5). Four
carcinomas are worth mentioning with reference to their occurrence as well as mortality
i.e. cancers of the lung and the large intestine (both genders), breast cancer in females and
prostate cancer in males. Second category of cancers is not as widespread as the above
mentioned cancers it includes carcinomas of the stomach, bladder, liver, pancreas, kidney,
ovary, cervix and esophagus. They contribute to the less percent of total mortality and
incidence of cancers. The most widespread cancers are of the skin. Only melanoma is
fatal among them. The third group is of rare cancers including tumors of brain, soft
tissues, bone, testes and other organs. They can direct to a noteworthy disease in specific
regions and age groups. Example is that of testicular cancer which affects the young adult
males having a rate of >1% in Switzerland
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 12
Here are some main types of cancer which lead to overall cancer mortality each year:
Figure 5: World Wide Incidence and Mortality Rate of Most Frequent Cancers among Both Sexes
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 13
LEUKEMIA & LYMPHOMAS These cancers are termed as hematological cancers because they arise from
hematopoetic lineage cells. Leukemias initiate from hematopoetic stem cells and spread
in the whole body. On the other hand Lymphomas arise from lymphoid cells in lymphoid
system and observed as localized cell masses. Hematological cancers can be categorized
according to their origin either from erythroid, myeloid, or lymphoid cells or they can be
only evident genetic aberration (comprising of chromosome gains and losses, but
distinctly translocations).
COLON CANCER Carcinomas of the rectum and colon are most common cancers in Western
industrialized countries. They are one of the lethal cancers and major health problem to
the population. Life style factors play an important role in the cause of the disease.
Dietary factors are one of the main reasons of disease. The cancer development ranges
from hyperplasia, benign adenomas and locally invasive carcinoma to systemic metastatic
disease. Colon cancer also spreads as a result of the chronic inflammatory bowel diseases
like that of ulcerative colitis.
WILMS TUMOR (NEPHROBLASTOMA) Wilms' tumor is also known as nephroblastoma. It is the most common kidney tumor
in children and is linked to various syndromes and hereditary anomalies. A lot of research
done in molecular biology and genetics has helped to increase our knowledge about this
disease, and side by side paving the way to discover the genes playing critical role in
cancerous process. Genetically the disease is heterogeneous and occurs rarely in 1:10,000
children, but it occurs more in patients with syndromes disturbing genitourinary tract
development such as the WAGR, Denys-Drash, and Beckwith- Wiedemann syndromes.
CANCERS OF SKIN The skin being the largest organ is the most common site for cancers development in
humans. Fair-skinned individuals are at about 40% of more risk to develop skin cancer.
Epidermis of the skin is an actively proliferating tissue due to which apoptosis-like event
are often found, as seen in the falling off of hair follicles (Sieberg et al. 1995; Lindner et
al. 1997) and in terminal differentiation (McCall & Cohen 1991; Haake & Polakowska
1993; Polakowska et al. 1994). When the epidermis is exposed to UVB, sun burn cells are
frequently observed. They have apoptotic quality of condensed nuclei (Young 1987;
Schwarz et al. 1995). When the body fails to repair this DNA damage, or fails to remove
the damaged cells by apoptosis, toxic mutations are replicated as a consequence and it
may lead to skin carcinogenesis (Griffiths et al. 1998). Other factors involved are genetic
disposition, immune response and viral infections such as HPV (Proby et al. 1996). Types
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 14
of the skin cancers are squamous cell carcinoma, basal cell carcinoma (both are rarely life
threatening and common) and melanoma which is rare but increasing alarmingly.
BLADDER CANCER Another name for bladder cancer is urothelial cancer. Factors often involved are
chemical carcinogens (mainly aromatic amines). Genetic polymorphisms in carcinogen
metabolism genes alter risk of bladder cancer depending on exposure, while no high-risk
is evaluated showing it heritable predisposition. Urothelial cancers grow successively at
different sites. Important factors involved are true oligoclonality, spreading through urine
and migration of cancer cells within the epithelium.
RENAL CELL CARCINOMA Renal cell cancer (RCC) consists of highly heterogeneous epithelial tumors both
clinically and morphologically. They have the same origin of the renal tubule, having
similar antigenic phenotype, but they differ in genetic mutations. A number of factors are
reported and associated with elevated risk for example cellular, genetic, dietary, hormonal
and environmental factors while etiology of RCC is still not known. It is the most
widespread malignant tumor of the kidney, representing 85% all primary renal neoplasm
in elders. RCC is diagnosed more in males than in females and rarely it occurs in
adolescents and children. Geographical or ethnic preference is not observed (Muphy et al.
1994; Motzer et al. 1996).
LIVER CANCER Liver cancer is one of the major fatal malignancies all over the world. Hepatocellular
carcinoma is its subtype which is derived from hepatocytes which are the predominant
epithelial type of cells in the liver. It is due to the chronic inflammation and liver cirrhosis
caused by the hepatitis viruses HCV or HBV, by chronic alcohol use, or rarely by
hereditary diseases like hemochromatosis. Chemical carcinogens like aflatoxin B1
obtained from the mold Aspergillus flavus which activate the causes of inflammation, in
particular with chronic HBV infection is also one of the factors.
STOMACH CANCER Stomach cancer due to its low healing tendency and severe effect on quality of life,
causes a serious health problem. For several decades its incidence is decreasing in many
industrialized states fortunately. Altered diet, improved hygiene and extensive use of
antibiotics reducing the prevalence of Helicobacter pylori infection are responsible for the
reduction of this dilemma. Most of the cases of stomach cancer are associated with
Helicobacter Pylori infection. About 50% of the world population hold strains of the
bacterium, but <10% grow inflammatory disease and ulcers, and even fewer stomach
cancer.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 15
PROSTATE CANCER Prostate cancer is clinically noteworthy in about 10% of males in Western countries. It
is age related, rare in younger males, and its incidence increases with age. Clinically it
varies from minor tumors growing slowly for many years to chronic cancers spreading
locally and effecting the bones and organs leading to the death in few years. Androgens
and the androgen receptor (AR) have represented as major tool for treatment purposes.
Prostate cancers when treated with androgen receptor and depletion respond well. Genes
involved in ancestral prostate cancer are not same as classical tumor suppressors. Risk of
the prostate cancer is altered by the polymorphisms of the genes which are involved in
nucleotide metabolism, to hormone metabolism and action and cell protection.
BREAST CANCER
Breast cancer is one of the frequent ailment in women of developed and under
developed countries and it deals with the malignant tumor developed from cells in the
breast (Parkin et al. 2005). Besides being fatal disease, it affects the women’s quality of
life and society at large with reference to economic burden, such as premature death and
reduced productivity. The usual 5-year rate of survival for breast cancer in developing
and developed countries is 57% and 73% respectively (IARC Handbook on Cancer
Prevention). As a result of better techniques and awareness regarding the diagnosis and
treatment, in developed countries the breast cancer (age adjusted) death rate has declined
and unluckily due to lack of public and professional knowledge, attitudes and practice, it
is higher in under developed countries (Wilson et al. 2004).
Studies have shown that most cases are found in postmenopausal women, but a large
number of younger women are also seen affected, mostly in families having hereditary
tendency. The risk of breast cancer is about 10% for females, and almost 30% of all the
cases prove to be fatal. When talking about the Western countries, 50 yrs is the mean age
at menopause, all women between 45 and 55 have to face menopause. In women between
40-60 years of age, breast cancer is the common fatal disease. Its incidence rate is rising
in many countries.
Incidence rate of breast cancer ranges from 19.3/100,000 females belonging to Eastern
Africa to 89.9/100,000 in Western Europe and except for Japan its high in other
developed areas and its rate is low in less developed areas about 40/100,000 women. Due
to the survival of breast cancer patients in developed regions because of early diagnosis
and public awareness, the range of mortality rates is much less (Fig: 5).
Among the Asian populations, Pakistan has the highest rate of breast cancer
accounting to 40,000 deaths per year. It is estimated that 1 in 9 of Pakistani women will
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 16
suffer from this disease at age in their lives. In Pakistan due to the lack of awareness most
of the times the cases are reported at a very complex stage (Sadiqui 2006). If breast
cancer is diagnosed at early stage than the chances of survival of patient are almost 90%.
Its incidence has been increasing alarmingly, due to the area, community, socio-economic
conditions, life-style, hereditary factors, especially eating habits. In Pakistan the peak age
range of breast cancer onset is between 35- 50 years, about 10 years earlier than in
Western populations. 20% of all breast cancer cases are diagnosed in women less than 40
years of age in Pakistan (Bhurgri et al. 2007). Hence it is important to screen the young
women for breast as a prime need of time. The studies reported that Asian women are
highly at risk to breast cancer, and therefore the genetic constitution that may influence
young Pakistanis women towards breast cancer needs to be explored
The types of breast cancer include invasive ductal carcinoma (IDC), ductal carcinoma
in situ (DCIS), invasive lobular carcinoma (ILC), male breast cancer, inflammatory breast
cancer, metastatic breast cancer, recurrent breast cancer, and more. Generally breast
cancer either initiates in the lobular cells, which are the milk-producing glands, or the
passages that drain milk from the lobules to the nipple. Rarely it can initiate in the stromal
tissues, including the fatty and fibrous connective tissues of the breast. As the time
passes, cancer cells attack healthy breast tissue making their way into the underarm
lymph nodes. Once they enter the lymph nodes, then they can extend into other parts of
the body.
The stages of breast cancer refer to how far the cancer cells have spread beyond the
original tumor (Table 2).
TABLE 2: STAGES OF BREAST CANCER
STAGE DEFINITION
STAGE 0 Cancer cells remain within the breast duct, it is not spread to normal adjacent breast tissue.
STAGE I Cancer is 2 cm or less and is restricted to the breast (lymph nodes are not affected).
STAGE IIA Cancer cells are diagnosed in axillary lymph nodes (under arm), tumor is not found in breast. OR the tumor size is less than or equal to 2cm and has spread to the axillary lymph nodes. OR the tumor size is 2-5cm and has not spread to the axillary lymph nodes.
STAGE IIB The tumor is 2-5cm big and has spread to the axillary lymph nodes. OR the tumor size is greater than 5 centimeters but has not spread to the axillary lymph nodes.
STAGE IIIA No tumor is found in the breast. Cancer is found in axillary lymph nodes that are sticking together or to other structures, or cancer may be found in lymph nodes near the breastbone. OR the tumor is any size. Cancer has spread to the axillary lymph nodes, which are sticking together or to other structures, or cancer may be found in lymph nodes near the breastbone.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 17
STAGE IIIB The tumor may be any size and has spread to the chest wall and/or skin of the breast. AND may have spread to axillary lymph nodes that are clumped together or sticking to other structures or cancer may have spread to lymph nodes near the breastbone. Inflammatory breast cancer is considered at least stage IIIB.
STAGE IIIC There may either be no sign of cancer in the breast or a tumor may be any size and may have spread to the chest wall and/or the skin of the breast. AND the cancer has spread to lymph nodes either above or below the collarbone. AND the cancer may have spread to axillary lymph nodes or to lymph nodes near the breastbone.
STAGE IV The cancer has spread — or metastasized — to other parts of the body. ETIOLOGY OF BREAST CANCER
A “risk factor” is anything that increases your risk of developing breast cancer. Many
of the most important risk factors for breast cancer are beyond your control, such as age,
family history, and medical history. However, there are some risk factors you can control,
such as weight, physical activity, and alcohol consumption.
FACTORS UNDER OUR CONTROL Weight: Increased weight is linked with elevated risk of breast cancer especially on
post menopausal women. The ovaries discontinue the production of estrogen hormone
after menopause, so the fatty tissues are the only source of that hormone. Increased
deposition of fatty tissues means higher level of estrogen and hence increased risk of
breast cancer.
Diet: Although diet is known to be involved in several cancer types including breast
cancer, but still research has not proved the type of the risky food involved in the
occurrence of cancer. We should control the usage of red meat, animal fats including
dairy fats in milk, ice cream and cheese, as they may have certain hormones or other
growth factors which influence cancer. Some studies have reported that increased
consumption of cholesterol and other fats have proved to be the risk factors for cancer,
while few researchers have shown that too much use of red/processed meats is linked
with elevated breast cancer risk.
Exercise: It has been proven that exercise can play a vital role in reducing the risk of
breast cancer. The American Cancer Society recommends that one should engage
him/herself in 45-60 minutes of physical exercise for at least 5 or more days a week.
Alcohol Consumption: It has been reported in studies that alcohol consumption is
associated with increased breast cancer risk in women. As alcohol has the ability to
Alcohol can limit your liver’s ability to control blood levels of the hormone estrogen,
which in turn can increase risk.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 18
Smoking: Few studies have shown the association of smoking with the increased
breast cancer risk.
Exposure to Estrogen and Oral Contraceptives: Breast cell growth is stimulated by
the estrogen hormone; more exposure to estrogen for long periods increases the risk of
having breast cancer. When oral contraceptives are used by the women the risk is slightly
increased but if she has stopped taking the pills for more than 10 years the risk is almost
diminished.
FACTORS WHICH CAN’T BE CONTROLED Gender: Among the most significant risk factors linked with breast cancer is being a
female. Though we can also find a minute ratio of breast cancer in males also but due to
the activity of estrogen and progesterone hormones in women, the breast cell are under
constant change, this leads them towards the higher risk of having the breast carcinoma.
Age: Aging is another uncontrollable risk factor for mammary tumor. The risk is
0.43% in the age ranging between 30-39 years, while it increases to almost 4% when the
age reaches 60.
Family History of Breast Cancer: A woman is at higher risk of breast cancer if she
has a first degree relative (mother, daughter, sister) or multiple relatives suffering from
either breast or ovarian cancer.
Race: Fair women are slightly more likely to develop breast cancer than are African
American women. Hispanic, Native American and Asian women have a lower risk of
developing and dying from breast cancer.
Radiation Therapy: If someone has exposed to radiations especially to the chest area
as a child or adolescent, is more prone towards breast cancer. The risk increases when the
developing breasts are exposed to radiations for any other treatment.
Pregnancy and Breast Feeding: Breast feeding and pregnancy is known to be
negatively associated with breast carcinoma risk. Women getting pregnant after 30 years
of age or never having any pregnancy are at higher risk for breast cancer. Breast feeding
for 1.5-2years lowers the chances of getting breast cancer.
ROLE OF DIFFERENT GENES IN BREAST CARCINOGENESIS A cycle of genetic mutational actions that begin in a single cell are supposed to be
responsible for the development of breast cancer. Initially the number of normal cell is
increased by increased cell proliferation, then it is followed by additional mutations
which allow development of hyperplasia, dysplasia, carcinoma and ultimately, metastatic
disease. It is anticipated that 5–10% of all mammary tumor cases are inherited, and the
possibly associated genes i.e. BRCA1 and BRCA2 are responsible for about 21-40% of the
cases. Rests of the cases are sporadic and among them 70% of breast tumors are PR, ER
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 19
and/or HER /neu positive. Genetic composition of every individual is responsible for the
wide variation in behavior and growth of cancer cells.
The genes involved in the breast carcinogenesis can be divided into four classes. These
It has been proved by several studies that there lies an association between the induced
phase I and/or decreased Phase II activities and elevated risk of ailments such as
Parkinson's disease, cancer and systemic lupus erythematosus (Meyer et al. 1990; Ritchie
et al. 1980; Daly et al. 1993; Kawajiri et al. 1990; Nebert et al. 1991; Bandmann et al.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 23
1997). Adverse drug responses have also been reported due to compromised Phase I
and/or PhaseII activity (Meyer et al. 1990; Iarbovic et al. 1997; Lee. 1995).
The Phase II Detoxification System: Phase I activation is followed by the phase II
conjugation reactions, which converts the reactive molecule formed in phase I reaction to
a water-soluble compound which can be excreted out of body through urine or bile.
Sulfation, glucuronidation, glutathione and amino acid conjugation are among the types
of conjugation reactions which are present in the body (Fig: 8). Cofactors are required for
these reactions which must be replenished through dietary sources.
REGULATION OF DETOXIFICATION ACTIVITIES Specific detoxification pathways may be induced or inhibited depending on various
factors including the genetic polymorphisms, age, gender, dietary habits, and life style
habits like smoking, environment and diseases (Meyer et al. 1990; Benet et al. 1996; Park
et al. 1996; Vesell 1979; Goldberg 1996; Guengerich 1995).
Figure 7: Cytochrome P450 in Human Liver
INDUCTION
When a high xenobiotic load is faced by the body, the detoxification mechanism can
be fastened by the induction of phase I and/or phase II enzymes. Inducers can be mono-
functional or multi-functional (Fig: 9). Mono-functional inducers only affect one enzyme
or one phase of detoxification while a multi-functional inducer affects multiple activities
(Park et al. 1996).
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 24
Induction of the Cyp1A1 and Cyp1A2 enzymes is done by mono-functional inducers,
leading to a substantial increase in phase I action such as polycyclic hydrocarbons from
cigarette smoke and aryl amines from charbroiled meats, and with little or no effect on
phase II activity (Kall & Clausen 1995; Joeres et al. 1988; Parsons & Neims 1978; Smith
& Yang 1994; Guengerich 1984). Initiation of Phase I enzymes activities without co-
induction of Phase II enzymes activities results in the disconnection of the Phase I and
Phase II balance of activity. As a result, reactive intermediates are produced in large
amounts, leading to the injury to DNA, RNA, and proteins (Elangovan et al. 1994).
Multifunctional inducers can be produced by the flavonoid molecules found in fruits
and vegetables. For example, ellagic acid present in garlic oil, red grape skin, rosemary,
cabbage, soy and brussels sprouts all contain compounds responsible for the induction
several Phase II enzymes and reduction of Phase I activity (Manson et al. 1997; Barch et
al. 1994; Barch et al. 1995; Pantuck et al. 1979; Offord et al. 1995; Ip & Lisk 1997;
Appelt & Reicks 1997).
The enzymes glutathione S-transferase and glucuronyl transferases are commonly
stimulated by multi-functional inducers. The increase n the amount of these enzymes is a
healthy sign for better detoxification in an individual and this increase also helps in
maintainence of a balance among the activities of both phases. That is why it is reported
in several studies that fruits and vegetables can perform the specific role to protect
various cancers.
Figure 8: Major Phase II Detoxification Activities in Humans
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 25
Figure 9: Mono & Multi Functional Inducers
INHIBITION Whenever a competition is arose between two or more compounds for the same
enzyme for detoxification, inhibition can take place. Increased noxious load leads to
inhibition of detoxification of a number of compounds by devastating the systems and
competing for detoxification enzyme activities. Moreover, a few compounds selectively
inhibit only one detoxifying activity; for example Cimetidine is a compound that attaches
directly to the heme iron of the cytochrome P450 reactive site and slows down all
cytochrome- dependent Phase I enzyme activities (Benet et al. 1996).
The reduction of necessary cofactors is a common mechanism of inhibition for phase
II enzymes. Sulfation is more prone towards inhibition due to compromised cofactor
status in humans. Concentration of serum sulfate in the body is maintained by the balance
between absorption of inorganic sulfate and its production from cysteine, and its
excretion by urination and insertion into low molecular weight substrates of sulfation. Its
amount varies in humans throughout 24 hours (Levy & Yamada 1971; Slattery et al.
1987). Humans excrete about 20-25 mm of sulfate in 24 hours; so balance of sulfate
reserves should be maintained through dietary intake of sulfur containing amino acids or
inorganic sulfate.
EFFECT OF POLYMORPHISMS Variations in the genetic makeup of an individual to metabolize the toxic compounds
are associated with the presence of genetic polymorphisms. Cyp2D6 is the key example
showing the effect of genetic polymorphism on phenotype. This gene exists in several
forms in different populations. Some people have slow Cyp2D6 activity and hence are
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 26
slow metabolizer and don't detoxify the carcinogens as fast as the persons with faster
acting enzyme. Another example is of polymorphism in N-acetyltranferases leading to
slow metabolism through its pathway and hence proved to be a risk factor for some types
of cancers and parkinson's disease (Meyer et al. 1990; Daly et al. 1993; Bandmann et al.
1997).
Detoxification enzyme's activity and expression are also affected by other factors like
that of age, sex and hormones. Examples related to influence of hormones on detoxifying
enzymes is of Cyp3A, which is sensitive to hormones, similarly 30-40% more Cyp3A
activity is shown by premenopausal women than postmenopausal or men (Wacher et al.
1995; Gustavson & Benet 1994; Maurel 1996).
Health status of an individual also influences the detoxification mechanism. Liver is an
organ responsible for major detoxification activities, so if it is not functioning properly
due to any liver disease such as biliary cirrhosis, hepatocellular carcinoma etc, the
detoxification activity is slowed down (Lee 1995; Benet et al. 1996).
GLUTATHIONE CONJUGATION Glutathione is known as a defensive compound within the body for the elimination of
potentially toxic electrophillic compounds. Many pharmaceuticals either are, or can be
metabolized by phase I reactions to, strong electrophiles, and these in turn react with
glutathione to form non-toxic conjugates generally. The compounds conjugated to
glutathione include epoxides, haloalkanes, nitroalkanes, alkenes, and aromatic halo-and
nitro-compounds. The enzymes working as catalysts of above reactions are the
glutathione-S-transferases which are found in the cytosol of liver, kidney, gut and other
tissues. The glutathione conjugates may be excreted directly in urine, or more usually
bile.
The tripeptide glutathione (Gly—Cys—Glu), when attached to the acceptor molecule,
is attacked by a glutamyl transpeptidase & peptidase, which helps in removing the
glutamate and glycine respectively, and as a result the cysteine conjugate of xenobiotic is
formed. Afterwards the N-Acetylation of the cysteine conjugate occurs by the normal N-
acetylation pathway to produce the N-acetylcysteine conjugate or mercapturic acid. The
glycylcysteine and cysteine conjugates and the mercapturic acids all are found in
excretion products.
GLUTATHIONE-S-TRANSFERASES Glutathione S-transferases (GSTs) constitute a super family of omnipresent,
multifunctional enzymes, which play a vital role in cellular detoxification mechanisms,
and protect macromolecules from attack by reactive electrophiles (Strange et al. 2001).
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 27
Glutathione S transferases (GSTs) and glutathione peroxidase (GPx) are cell protective
enzymes that alter the action of different exogenous (xenobiotics) and endogenous agents
(Fig: 10). The conjugation of tripeptide glutathione (GSH) is catalyzed by GSTs to a wide
range of endogenous and exogenous chemicals having the electrophilic functional groups
(e.g. carcinogens, environmental pollutants and products of oxidative stress), they
neutralize their electrophilic sites, and make the products more water-soluble (Haydes &
Pulford 1995).
Human cytosolic GSTs have been grouped into eight gene families: GST- alpha (GST-
α), GST-mu (GST-μ or GSTM),GST- pi (GST-π), GST-theta (GST-θ or GSTT), GST-
zeta (GST-ζ),GST-sigma (GST-σ), GST-kappa (GST-κ) and GST- omega (GST-Ω) , with
each family encoded by a separate gene based on sequence homology and immunological
cross reactivity (Mannervik et al. 1992; Pemble & Taylor 1992; Board et al. 2000).
Figure 10: 3D Structure of Glutathione S-Transferase
All the genes present in GSTs super family have probably begun from the same
precursor. On the other hand all the forms are diverse and specified from each other due
to the gene recombination, duplication and accumulation of mutations. As the GSTs have
a very vital role in the process of detoxification of xenobiotics, therefore because of their
genetic variation the scientist have been attracted towards them and several studies have
been conducted to observe their association with cancer risk. Various studies have shown
relationship of GST genotypes with lung, breast, brain, colon and various other types of
cancer (Rebbeck 1997; Dunning et al. 1999; Landi 2000).
GSTM1 and GSTT1 are the most commonly examined genes so we will discuss them
in detail only.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 28
GSTM (µ) The sub family GSTM is subfamily is represented by a 100Kb gene cluster at
chromosomal site 1p13.3 arranged as 5'-GSTM4-GSTM2-GSTM1-GSTM5- GSTM3-3'
(Pearson et al. 1993; Xu et al. 1998). Both the allels are affected when the gene is
deleted, which results in the null genotype, GSTM1-/-. When the detailed mapping is
studied, it was found that GSTM gene is flanked by two almost alike 4.2-kb regions (Fig:
11). Homologous recombination involving the left and right 4.2-kb repeats is responsible
for the GSTM1 null genotype (Xu et al. 1998). Similarly a missense SNP also occurs in
the GSTM1 gene, i.e. nucleotide 534 G/C (172 Lys/ Asn, resulting to GSTM1*A and
GSTM1*B, respectively), which does not appear to affect the enzyme function (Widersten
et al. 1991).
Numerous studies have analyzed the GSTM1 genotype using a PCR-based assay
designed to identify the wild-type allele of GSTM1 (Seidegard et al. 1988).
Figure 11: The GSTM1 gene is part of the Mu-class GST gene cluster at 1p13.3, which is arranged as 5`-GSTM4-GSTM2-GSTM1-GSTM5-GSTM3-3` (top of diagram). The GSTM1 gene (black box) consists of 8 exons, which range in size from 36 to 112 bp, while the introns vary from 87 to 2641 bp. GSTM1 is embedded in a region with extensive homologies and flanked by two almost identical 4.2-kb regions (gray boxes). The GSTM1 null allele arises by homologous recombination of the left and right 4.2-kb repeats, which results in a 16-kb deletion containing the entire GSTM1 gene (bottom of diagram). The point of deletion cannot be precisely localized because of the high sequence identity between the repeats. (Adopted from: Mini review on GST genotypes and cancer risk by Fritz F.Parl)
GSTT (Θ) Two genes GSTT1 and GSTT2 are present in GSTT subfamily, which are positioned at
chromosomal site 22q11.2 and distance between them is about 50 kb (Landi et al. 2000;
Coggan et al. 1998; Whittington et al. 1999). Both genes consist of five exons with the
same intron/exon boundaries but share only 55% amino acid identity (Fig: 12). It has been
reported that about 20% of Caucasians are homozygous for a GSTT1 null allele (GSTT1-/-
). The GSTT1 null genotype is more common in Asians, with frequencies 47-64% (Grate
et al. 2001; Nelson et al. 1995).
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 29
Figure 12: The GSTT1 gene is part of the Theta-class GST gene cluster at 22q11.2 (top of diagram). GSTT1 and GSTT2 are separated by approximately 50 kb. GSTT2 lies head-to-head with a gene encoding the D-dopachrome tautomerase (DDCT). The GSTT2 and DDCT genes have been duplicated in an inverted repeat. The duplicated GSTT2 is a pseudogene (named GSTT2P) because an abnormal exon 2/intron 2 splice site causes a premature translation stop. The GSTT1 gene (black box) consists of five exons, which range in size from 88 to 195 bp, while the introns vary from 205 to 2363 bp. The GSTT1 gene is embedded in a region with extensive homologies and flanked by two 18 kb regions, HA3 and HA5 (gray boxes), which are more than 90% homologous. In their central portions HA3 and HA5 share a 403-bp sequence with 100%identity. (Adopted from: Mini review on GST genotypes and cancer risk by Fritz F.Parl)
The GSTT1-/- deletion similar to GSTM1-/- is probably due to a homologous
recombination event involving the left and right 403-bp repeats. Similar to GSTM1,
numerous studies of the GSTT1 genotype employed a PCR-based analysis that identified
the wild-type allele (Pemble et al. 1994).
GST GENOTYPES & CANCER RISK Carcinogen metabolism genes are commonly affected by the single nucleotide
polymorphisms (SNPs). The complete deletion of a gene in form of a null genotype is
rare. That is why GSTM1 and GSTT1 null genotypes have attracted so many concerns of
scientists and become the spotlight in more than 500 publications in the field molecular
epidemiology. Basically all the studies are conducted on the hypothesis that the activity of
GST enzymes either normal or increased is responsible for defending the susceptible cells
from DNA mutations by the attack of electrophilic carcinogens with the help of
detoxification mechanism. So because of their active role in the detoxification
mechanism, the homozygous deletions of both GSTT1 and GSTM1 are expected to have
disability to eliminate the carcinogens from the body therefore placing the persons with
GSTM1 and GSTT1 Null genotypes at higher cancer risk.
It is well known that GSTs have overlapping substrate specificities therefore
deficiency of an individual GST iso enzyme is supposed to be compensated by other
isoforms. This is the reason that assessment of all GST genotypes is a basic requisite for
reliable analysis of the role of the GSTs in cancer growth. A number of molecular studies
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 30
have reported the association between genotypes of one, two, or three GST subtypes and
breast carcinoma risk (Dunning et al. 1999; Mitrunen et al. 2001,). Nothing can be
concluded on the results obtained. An association among GSTs and cancer if found in one
study is negated by the other studies (Ambrosone et al. 1995; Kelsey et al. 1997; Bailey et
al. 1998; Coughlin et al. 1999; Garcia-Closas et al. 1999; Zhao et al. 2001). The
differences in results of these studies may be because of the variations among the studied
populations and the exposure of the individuals to different environmental and dietary
factors. GSTM1 and GSTT1 are not truly genotyped in any of the previous studies. Roodi
et al. and Sprenger et al. described the positive identification of the wild-type and null
alleles for GSTM1 and GSTT1 respectively, which allowed the exact explanation of the -/-
, +/+ and +/- genotypes and diversity among low, high and none conjugator phenotypes.
Associations between GSTM1 and GSTT1 null genotypes and breast cancer have been
reported with inconsistent results (Gudmundsdottir et al. 2001; Helzlsouer et al. 1998;
Mitrunen et al. 2001, Millikan et al. 2000) Therefore; we planned to conduct this study
for the first time in Pakistan to evaluate the influence of these GST genotypes in breast
cancer susceptibility in Pakistani population.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 31
MATERIAL AND METHODS
The proposed study was conducted according to the work plan essentially divided into
two phases and further sub divided as depicted below:
ANALYSIS OF GSTT1 AND GSTM1 NULL ALLELES
FIELD WORK BENCH WORK A)APPROVAL OF STUDY FROM INSTITUTIONAL REVIEW BOARD. A) DNA EXTRACTION
B)IDENTIFICATION AND ENROLLMENT OF SUBJECTS B)QUANTIFICATION OF DNA
C)COLLECTION OF BLOOD SAMPLES C)ANALYSIS OF GSTT1 AND GSTM1 NULL ALLELES BY MULTIPLEX PCR
FIELD WORK INSTITUTIONAL REVIEW BOARD (IRB)
Approval for this study was obtained from the Institutional Review Board (IRB) of
Institute of Biotechnology, Bahauddin Zakariya University, Multan. Informed consent
forms had been designed containing risks, facts and discomforts that might be anticipated
to influence an individual’s willingness to participate as a volunteer in a research project.
ENROLMENT OF SUBJECTS The present study consisted of 100 case subjects (females) with pathologically
confirmed breast cancer that were recruited from Department of Radiology and
Oncology, Nishter Hospital, Multan. A total of 204 healthy volunteer females were
included in the study as controls samples. The volunteers that took part in this study
belong to Multan, Layyah, and D. G Khan and Rajanpur areas of Southern Punjab
(Pakistan) belonging to different ethnic groups, and age ranges. The nature and purposes
of this study were presented to all the subjects and a proper informed consent was
obtained from them. Each subject (patients and controls) was asked to provide
information regarding age, marital status, menopause, age at menopause, smoking status,
family history of cancer, pregnancies, nature of work etc.
COLLECTION OF BLOOD SAMPLES Blood sampling of controls samples was performed during May to August, 2009 and
that of case samples from May, 2009 to March, 2010 visiting Department of
Radiotherapy and Oncology, Nishter Hospital, from different areas of the Southern
Punjab. 5ml of blood from all subjects was collected using sterilized disposable syringes
in 15 ml Sterilin® falcon tubes having 400µl EDTA (Ethylene Diamine Tetra Acetic
Acid) as anticoagulant, stored at -70°C till further processing.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 32
BENCH WORK DNA EXTRACTION
The genomic DNA was extracted by using a standardized non organic method
(Grimberg et al. 1989). With this method, DNA was extracted from white blood cells
(WBC) because the white blood cells are the only blood cells which are nucleated. The
protocol for DNA extraction is as follows: In 15 ml Sterilin® falcon tubes, 3-5 ml blood
samples were collected containing 400µl of 0.5 M EDTA. Samples were freezed at -70°C
for at least 20-30 minutes before processing. Samples can also be stored at -20°C for long
duration. The blood samples were thawed before processing to lyses the red blood cells
(RBC). TE buffer (10 mM Tris Hcl, 2mM EDTA, pH8.0) was added to fill the falcon
tubes volume for washing of blood samples. Samples were centrifuged at 3000 rpm for 20
minutes and supernatant was discarded for washing out lysed RBCs. Washing was
repeated three to four times till the white blood cells are free of hemoglobin and pellet
appears whitish . Proteins in the pellets of WBC were digested by adding the 0.5 mg of
proteinase k along with 200µl of SDS buffer in the presence of 6 ml TNE buffer (10mM
Tris HCl, 2mM EDTA, 400mM NaCl). Samples were left in shaking water bath for
overnight at 37°C and at a speed of 250rpm. By this, mixing takes place and ultimately
proteins digested. These digested proteins can be precipitated by adding 1ml of
supersaturated NaCl, followed by vigorous shaking and chilling on ice for 15 minutes and
then centrifuged at 2400 rpm. Supernatant is shifted to another Sterilin® falcon tube and
DNA was extracted from the supernatant by adding equal volume of Isopropanol. Wash
the DNA pellet with freshly prepared 70% ethanol. Dissolved the DNA in TE (10mM
Tris HCl, 2m M EDTA) buffer and heat it on 70°C for one hour in water bath. By this any
remaining nucleases and proteins inactivated. DNA can be stored at-20°C for long time.
QUANTIFICATION OF DNA Concentration of DNA was measured using Spectrophotometer by following method:
The optical Density (OD) was measured by spectrophotometer (Perklin Elmer Ltd,
UK) at 260nm.
50µG /ML X OD 260NMX200
After calculation of DNA concentration, working dilutions were prepared with final
concentration of 25ng/ul conc. and 2-4ul of each DNA dilution was used for setting up a
PCR reaction.
GSTT1/GSTM1 MULTIPLEX PCR & ANALYSIS Analysis of the GSTT1 & GSTM1 was performed by using a standard multiplex PCR
protocol with some changes to describe the presence or absence of GSTT1 and GSTM1
(Shaikh et al. 2010). This technique does not distinguish between the heterozygosity or
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 33
homozygosity in genotypes of GSTT1 and GSTM1, but identifies the null genotypes i. e.
homozygous deletion. β-globin used as internal control to confirm the PCR amplification.
100ng of DNA was amplified in a total volume of 25 µl reaction mixture containing
8pmol of each primer (Table 7). Primers of GSTT1, GSTM1 and β-globin were got
synthesized commercially from Centre for Applied Molecular Biology (CAMB) Lahore,
Pakistan (Table 8). Multiplex PCR was performed with initial denaturation at 95°C for 5
minutes followed by 40 cycles of 94°C for 45 sec, annealing at 60°C for 45 sec and
extension at 72°C for 45 sec. Final extension was at 72°C for 7 mins (Fig: 13). PCR
products were electrophoresed on 2% agarose gel, stained with ethidium bromide and
visualized it on UV light. Presence and absence of bands represent the presence or
absence of null alleles of GSTT1and GSTM1. GSTT1 has a product size 473bp, β-globin
has 260bp product while the third GSTM1 has 210bp size. If β-globin band is absent it
means PCR reaction has failed.
TABLE 7: OLIGONUCLEOTIDES PRIMERS USED IN AMPLIFICATION
Figure 13: Profile of Multiplex PCR
GENES PRIMER TYPE SEQUENCE PRODUCT SIZE
GSTT1 FORWARD 5’TTCCTTACTGGTCCTCACATCTC3’ 473BP
REVERSE 5’ TCACCGGATCATGGCCAGCA 3’
GSTM1 FORWARD 5’GAACTCCCTGAAAAGCTAAAGC3’ 210BP
REVERSE 5’GTTGGGCTCAAATATACGGTGG3’
B-GLOBINS FORWARD 5’ CAACTTCATCCACGTTCACC3’ 260BP
REVERSE 5’ GAAGAGCCAAGGACAGGTAC3’
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 34
TABLE 8: INGREDIENTS FOR MULTIPLEX PCR REACTION MIXTURE
INGREDIENTS CONCENTRATION VOLUME TAKEN FOR MULTIPLEX PCR REACTION (µL)
10X PCR BUFFER 10MM 2. 5
MAGNESIUM CHLORIDE 50MM 1.25
DNTPS 2. 5MM 0. 8
PRIMERS GSTT1 FORWARD 8µM 0. 5
REVERSE 0. 5
GSTM1 FORWARD 0. 5
REVERSE 0. 5
Β-GLOBIN
FORWARD 0. 5
REVERSE 0. 5
TEMPLATE DNA 25NG 4.0
TAQ DNA POLYMERASE 5U 0. 4
DISTILLED WATER 13.05
TOTAL REACTION MIX 25
STATISTICAL ANALYSIS Null allele frequency of GSTM1and GSTT1 in case and control subjects from Southern
Punjab was determined according to the Hardy–Weinberg equilibrium. Chi-Square test
was applied to evaluate the relation between null alleles of GSTM1 and GSTT1 with
disease, smoking, and age groups, pesticide, menopause etc using the SPSS 17 statistical
package for Windows.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 35
RESULTS
For the present study 204 healthy individual and 100 female patients of breast cancer
were enrolled. GSTM1 and GSTT1 genetic polymorphisms were analyzed using a
multiplex PCR procedure. The presence or absence of the genes was detected by the
presence or absence of 473 bp, 260bp and 210 bp bands corresponding to GSTT1, β-
globin and GSTM1 genes respectively. Β-globin was used as internal control to document
the successful PCR amplification. A picture of multiplex PCR products run on 2%
agarose gel stained with ethidium bromide is given below (Fig: 14).
Figure 14: Ethidium bromide-stained electrophoresed PCR products samples: 1 kb ladder (lane 9); GSTM1 and GSTT1 wild type (lanes 3, 4, 12 and 13, representing individuals BC 04, 06, 10, 12); GSTM1 null (lanes 5, 6, 14 and 15, representing individuals BC 07, 08, 11 ,25); GSTT1 null genotype (lanes 7, 8, 16 and 17, representing individuals BC 14, 15, 16, 17); concomitant deletion of both GSTM1 and GSTT1 (lanes 1, 2, 10 and 11, representing individuals BC 21, 30, 40, 49).
Different biological/physiological and environmental factors, thought to play some
role in breast cancer predisposition were considered and analyzed during the study (Table
9). Among the biological factors, age was firstly considered and individuals were
distributed in five age groups. It was observed that females belonging to the age group
36-45 years are more prone towards the breast cancer. Although age is significantly
related to breast cancer (p=0.00, Table 9, Fig: 15) but we cannot conclude any strong
association between age and disease as random sampling was done.
Results have shown that 49% of the patients had menopause, which are almost three
folds that of controls samples with menopause (11.3%, p=0.00). It was also observed that
more breast cancer patients (24%) belonged to same age group (36-45years) as mentioned
above (Table 9, Fig: 16). 20% of the patients reported a history of cancer in their family.
Our data suggest that individuals who have more than 3 pregnancies are exposed to a
higher risk of getting breast cancer (p=0.018, Table 9). Statistics show that marriage,
breast feeding, etc has no significant association with the genes and breast cancer.
However a weak association of breast cancer was observed with environmental factor
like smoking (p=0.078) and a significant association with pesticides exposure (p=0.042),
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 36
though on further analysis of pesticides exposure along with GSTM1, GSTT1 genes and
breast cancer no significant evidence was observed (p=0.559, Table 13).
It was observed that null genotype of GSTT1 is present in 25.98 % (79) of individuals
while 225 of the total 304 individuals (74.01%) carry the wild type genotype. GSTT1 wild
genotype was present almost in the same ratio in normal and affected persons i.e. 74.5%
and 73% respectively, while its null genotype was found at a little higher percentage
(27%) in breast cancer patients as compared to (25. 5 %) in control individuals (Table
10). Above allele frequencies and statistical analysis clearly depicts that GSTT1 is not
associated with breast cancer (p=0.08, Table 10).
GSTM1 wild type allele was present in 54.27% (165) individuals while its null allele
was found in 45.7% (139) individuals. Presence of the GSTM1 wild type allele among the
control and case was found to be 52.9% and 57% respectively, while 46.1% and 43% of
normal and affected individuals, respectively, carry null allele of GSTM1 (Table 10).
Statistically no significant relationship was found between the patient’s phenotype and
different categories of GSTM1 (p=0.445) and hence we may conclude that distribution of
GSTM1 null genotype remains the same for normal as well as affected individuals.
Cross tabulation of GSTT1 and GSTM1 with the disease represents that 9.86% (30) of
the all the individuals showed null mutation for both GSTM1 and GSTT1 genes and
38.15% of the individuals had both the wild type GSTT1 and GSTM1 genes, while
51.97% of individuals have either any one of the both genes deleted. As frequency of null
alleles of GSTM1 and GSTT1 genes is almost similar in patients and control so no
significant association of these genes was detected with the breast cancer, moreover, it is
proved that presence and absence of one gene has no effect on the occurrence of other
gene (Table 11).
Statistical analysis between the two genes (GSTM1 & GSTT1), menopause and the
breast cancer show significant results, that with null mutation of both the genes the
percentages of patients either having menopause or no menopause was similar i.e. 50%.
On the contrary, percentage of null mutations of both the genes in normal individuals
having menopause or no menopause are 10% and 90%, respectively, showing a
significant association with the disease either due to genes deletion or combination with
menopause. While when only GSTM1 or GSTT1 was deleted the percentage of patients
having menopause is 54.5% and 58.5%, respectively, which is more than those without
menopause, 45.5% and 41.2%, respectively (Table 12).
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 37
TABLE 9: SELECTED CHARACTERISTIC FOR CASE & CONTROLS INDIVIDUALS OF SOUTHERN PUNJAB, PAKISTAN.