Multiple hok genes on the chromosome of Escherichia coli Kim Pedersen and Kenn Gerdes * Department of Molecular Biology, Odense University, Campusvej 55, DK-5230 Odense M, Denmark. Summary The hok/ sok locus of plasmid R1 mediates plasmid stabilization by the killing of plasmid-free cells. Many bacterial plasmids carry similar loci. For example, the F plasmid carries two hok homologues, flm and srnB, that mediate plasmid stabilization by this spe- cialized type of programmed cell death. Here, we show that the chromosome of E. coli K-12 codes for five hok homologous loci, all of which specify Hok- like toxins. Three of the loci appear to be inactivated by the insertion elements IS150 or IS186 located close to but not in the toxin-encoding reading frames (i.e. hokA , hokC and hokE ), one system is probably inacti- vated by point mutation (hokB ), whereas the fifth sys- tem is inactivated by a major genetic rearrangement (hokD ). In the ECOR collection of wild-type E. coli strains, we identified hokA and hokC loci without IS elements. A molecular and a genetic analysis show that the hokA and hokC loci specify unstable antisense RNAs and stable toxin-encoding mRNAs that are pro- cessed at their 38 ends. An alignment of the mRNA sequences reveals all the regulatory elements known to be required for correct folding and refolding of the plasmid-encoded mRNAs. The conser ved elements include fbi that ensure a long-range interaction in the full-length mRNAs, and tac and antisense RNA target stem–loops that are required for translation and rapid antisense RNA binding of the processed mRNAs. Con- sistently, we find that the chromosome-encoded mRNAs are processed at their 38 ends, resulting in the presumed translationally active mRNAs. Despite the presence of all of the regulatory elements, the chromosome-encoded loci do not mediate plasmid stabilization by killing of plasmid-free cells. The chro- mosome-encoded mRNAs are poorly translated in vitro, thus yielding an explanation for the lacking phenotype. These obser vations suggest that the chromosomal hok-like genes may be induced by an as yet unknown signal. Introduction In recent years, a large number of genes that mediate pro- grammed cell death in bacteria have been identified and analysed (Jensen and Gerdes, 1995; Naito et al ., 1995; Yarmolinsky, 1995; Gerdes et al ., 1997; Holcik and Iyer, 1997; Gotfredsen and Gerdes, 1998; Grønlund and Gerdes, 1999). The function of these genes has primarily been ascribed to their ability to mediate plasmid main- tenance by killing of plasmid-free cells. However, bacterial chromosomes encode numerous genes that are homo- logous to the plasmid-encoded killer genes. Two types of loci that mediate plasmid stabilization by post-segregational killing (PSK) have been described. One type, the toxin–antitoxin gene systems, encodes a stable toxin and an unstable protein antitoxin (Jensen and Gerdes, 1995; Holcik and Iyer, 1997). The antitoxins form tight complexes with the toxins and thereby neutral- ize their toxicity. However, because the antitoxins are degraded by cellular proteases (Lon or Clp), the plasmid- free cells will experience a decay of the antitoxins. This, in turn, leads to activation of the toxins and cell killing. A large number of such loci have been identified on plasmids, but it becomes increasingly evident that they are abundant on bacterial chromosomes as well (Gotfredsen and Gerdes, 1998). Recently, we identified homologues of the E. coli relBE toxin–antitoxin locus in Gram-positive and in Gram- negative eubacteria, and in Archeae (Grønlund and Gerdes, 1999). More surprisingly perhaps, plasmid-encoded restric- tion modification cassettes also mediate plasmid stabiliza- tion by PSK (Kulakauskas et al ., 1995; Naito et al ., 1995). The other type of PSK genes are regulated by antisense RNA. Here, the toxins are encoded by stable mRNAs, whose translation is inhibited by unstable antisense RNAs. The paradigm member of this gene family is hok / sok of plasmid R1, whose genetic organization is shown in Fig. 1. The locus encodes a ver y stable mRNA, which spe- cifies the toxic Hok ( host killing) protein that can kill the cells by damaging the cell membrane (Gerdes et al ., 1986a; b). Translation of hok is regulated by Sok-RNA ( sup- pression of killing), an unstable antisense RNA of 63 nucleotides (nts) that is complementary to the hok mRNA leader (Gerdes et al ., 1990b; Nielsen et al ., 1991; Thisted Molecular Microbiology (1999) 32(5), 1090–1102 Q 1999 Blackwell Science Ltd Received 21 January, 1999; revised 15 March, 1999; accepted 19 March 1999. *For correspondence. E-mail [email protected]; Tel. (45) 6557 2413; Fax (45) 6593 2781.
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Multiple hok genes on the chromosome ofEscherichia coli
Kim Pedersen and Kenn Gerdes*
Department of Molecular Biology, Odense University,
Campusvej 55, DK-5230 Odense M, Denmark.
Summary
The hok/sok locus of plasmid R1 mediates plasmid
stabilization by the killing of plasmid-free cells. Many
bacterial plasmids carry similar loci. For example,
the F plasmid carries two hok homologues, ¯m and
srnB, that mediate plasmid stabilization by this spe-
cialized type of programmed cell death. Here, we
show that the chromosome of E. coli K-12 codes for
®ve hok homologous loci, all of which specify Hok-
like toxins. Three of the loci appear to be inactivated
by the insertion elements IS150 or IS186 located close
to but not in the toxin-encoding reading frames (i.e.
hokA , hokC and hokE ), one system is probably inacti-
vated by point mutation (hokB ), whereas the ®fth sys-
tem is inactivated by a major genetic rearrangement
(hokD ). In the ECOR collection of wild-type E. coli
strains, we identi®ed hokA and hokC loci without IS
elements. A molecular and a genetic analysis show
that the hokA and hokC loci specify unstable antisense
RNAs and stable toxin-encoding mRNAs that are pro-
cessed at their 38 ends. An alignment of the mRNA
sequences reveals all the regulatory elements known
to be required for correct folding and refolding of the
plasmid-encoded mRNAs. The conserved elements
include fbi that ensure a long-range interaction in the
full-length mRNAs, and tac and antisense RNA target
stem±loops that are required for translation and rapid
antisense RNA binding of the processed mRNAs. Con-
sistently, we ®nd that the chromosome-encoded
mRNAs are processed at their 38 ends, resulting in
the presumed translationally active mRNAs. Despite
the presence of all of the regulatory elements, the
chromosome-encoded loci do not mediate plasmid
stabilization by killing of plasmid-free cells. The chro-
mosome-encoded mRNAs are poorly translated in vitro,
thus yielding an explanation for the lacking phenotype.
These observations suggest that the chromosomal
hok-like genes may be induced by an as yet unknown
signal.
Introduction
In recent years, a large number of genes that mediate pro-
grammed cell death in bacteria have been identi®ed and
analysed (Jensen and Gerdes, 1995; Naito et al., 1995;
Yarmolinsky, 1995; Gerdes et al., 1997; Holcik and Iyer,
1997; Gotfredsen and Gerdes, 1998; Grùnlund and
Gerdes, 1999). The function of these genes has primarily
been ascribed to their ability to mediate plasmid main-
tenance by killing of plasmid-free cells. However, bacterial
chromosomes encode numerous genes that are homo-
logous to the plasmid-encoded killer genes.
Two types of loci that mediate plasmid stabilization
by post-segregational killing (PSK) have been described.
One type, the toxin±antitoxin gene systems, encodes a
stable toxin and an unstable protein antitoxin (Jensen
and Gerdes, 1995; Holcik and Iyer, 1997). The antitoxins
form tight complexes with the toxins and thereby neutral-
ize their toxicity. However, because the antitoxins are
degraded by cellular proteases (Lon or Clp), the plasmid-
free cells will experience a decay of the antitoxins. This,
in turn, leads to activation of the toxins and cell killing. A
large number of such loci have been identi®ed on plasmids,
but it becomes increasingly evident that they are abundant
on bacterial chromosomes as well (Gotfredsen and Gerdes,
1998). Recently, we identi®ed homologues of the E. coli
relBE toxin±antitoxin locus in Gram-positive and in Gram-
negative eubacteria, and in Archeae (Grùnlund and Gerdes,
1999). More surprisingly perhaps, plasmid-encoded restric-
tion modi®cation cassettes also mediate plasmid stabiliza-
tion by PSK (Kulakauskas et al., 1995; Naito et al., 1995).
The other type of PSK genes are regulated by antisense
RNA. Here, the toxins are encoded by stable mRNAs,
whose translation is inhibited by unstable antisense RNAs.
The paradigm member of this gene family is hok/sok
of plasmid R1, whose genetic organization is shown in
Fig. 1. The locus encodes a very stable mRNA, which spe-
ci®es the toxic Hok (host killing) protein that can kill the
cells by damaging the cell membrane (Gerdes et al.,
1986a; b). Translation of hok is regulated by Sok-RNA (sup-
pression of killing), an unstable antisense RNA of 63
nucleotides (nts) that is complementary to the hok mRNA
leader (Gerdes et al., 1990b; Nielsen et al., 1991; Thisted
Fig. 1. Structural organization, RNAs and regulatory elements ofthe hok/sok system from plasmid R1. Genetic nomenclature: mok,mediation of killing; hok, host killing; sok, suppression of killing;sokT, Sok antisense RNA target; fbi, foldback inhibition element;tac, translational activation element, FL full length; TR, truncated.Numbers refer to the coordinates in the mRNAs.
Fig. 2. Molecular model that explains activation of hok translationin plasmid-free cells.A. Folding pathway of hok mRNA. During transcription, ametastable hairpin at the mRNA 58 end prevents formation of thetac stem (translational activation). Formation of the tac stem in thenascent transcript would be expected to lead to prematureactivation of translation or antisense RNA binding. In the full-lengthtranscript, the fbi-element (foldback inhibition) pairs with tacthereby locking the mRNA into an inert con®guration: the SDmok
element is base paired to ucb (upstream complementary box) andthe Sok-RNA target (sokT ) is shielded by the foldback structure.During steady state, a pool of inert full-length mRNA accumulatesin plasmid-containing cells. The full-length mRNA is activated byslow 38 processing, which removes the fbi element. The removalof fbi triggers a refolding of the 58 end of the mRNA with theformation of the tac and antisense target hairpins.B. In plasmid-carrying cells, the truncated mRNA is rapidly boundby Sok-RNA, which prevents translation. Subsequently, the RNAsform a duplex that is cleaved by RNase III.C. In plasmid-free cells, in which the unstable antisense RNA hasdecayed, translation of the truncated hok mRNA is allowed, thusleading to cell killing. The RNA structures shown were veri®ed bynucleotide covariations in phylogenetically related RNAs (Gultyaevet al., 1997) and by mutational and structural analyses (Thistedet al., 1995; Franch and Gerdes, 1996; Franch et al., 1997). Themodel was recently described in a review (Gerdes et al., 1997).
E. coli hok homologues 1091
promoter are not detectable by Northern analysis (data not
shown). However, with IPTG, strong transcription is
induced towards the cloning site. We PCR ampli®ed the
hokAK12, hokBK12 and hokCK12 genes and cloned the
resulting DNA fragments into pKP219, which resulted in
plasmids pKP612 (�138 to �368), pKP611 (�147 to
�451) and pKP613 (�136 to �370) respectively (�1 refers
to the ®rst nucleotide at the mRNA 58 ends; see Figs 4 and
5). The plasmids were transformed into strain CSH50 and
subsequently tested in an induction experiment. Addition
of IPTG to cells containing pKP612, pKP611 or pKP613
yielded arrest of cell growth, rapid host cell killing and the
typical Hok-induced changes in cell morphology. These
results show that genes hokAK12, hokBK12 and hokCK12
encode polypeptides that, resembling Hok of R1, are
very toxic to E. coli host cells.
Insertion elements in the hokA, hokC and hokE loci
of E. coli K-12
The hokAK12 gene is located at 80.1 min between glyS and
cspA , see Fig. 4 (Blattner et al., 1997). We noticed that an
IS150 element had inserted 32 bp upstream of the start
codon of hokAK12. Subtraction of the DNA sequence of
the IS element revealed a hok-homologous system with
a potential promoter for a hokA mRNA, fbi and tac ele-
ments in the mRNA, and a processing stem±loop just
downstream of the hokA reading frame (see Fig. 5). A
potential antisense RNA gene is also present in the K-12
sequence. However, the base pairs between IS150 and
hokAK12, which would be expected to encode the ÿ10
sequence of the antisense RNA promoter and the start
of a mok-homologous reading frame (mokA), is missing.
The missing bases are consistent with the proposal that
the insertion element introduced a deletion of 39 bp in a
complete hok-homologous system. Thus, subtraction of
the IS150 element from the E. coli K-12 sequence indi-
cates that the element may have transposed into a system
that had all of the regulatory elements as described for the
hok/sok system of R1. This interpretation is corroborated
by ®ndings described later.
Similarly, the hokCK12 locus (formerly gef ) located at
0.4 min between nhaA and dnaJ contains an IS186 ele-
ment 22 bp downstream of the toxin-encoding reading
frame (Fig. 4). Subtraction of the DNA sequence of the
IS186 element revealed a hokC system with all of the
Fig. 3. Alignment of the known Hok-homologoustoxins. A fully conserved amino acid in theconsensus sequence is underlined and highlyconserved amino acids are shown in bold. SeeFig. 5 for the origin and the sequence of thecorresponding genes.
Fig. 4. Structural organization of the hokA , hokB, hokC, hokD,and hokE loci of E. coli K-12. An IS150 element is located 32 bpupstream of hokA . A deletion of 39 bp is marked with a K. In hokCand hokE, an IS186 element is located 22 and 21 bp downstreamof the toxin-encoding reading frames respectively. The start codonof the mokE homologue is missing (shown with a dotted line). ThehokD system is transcribed in the operon with the relB and relEgenes (a D marks the presumed deletion of the upstream part ofthe hokDK12 locus).
Fig. 6. Stability and processing patterns of the hok-like mRNAsshown by Northern analyses. Parts A, B and C show the hokAC,hokBK12 and hokCECOR24 mRNAs respectively. Cells were grown inLB medium to an OD450 of <0.5 and rifampicin was added to a®nal concentration of 300 mg mlÿ1 (at time 0). Cell samples for totalRNA preparation were withdrawn at the intervals indicated (in min).Samples were loaded in the following order: lane 1, radioactivelylabelled RNA markers with lengths of 351 and 276 nts; lanes 2and 3, total RNA from NWL37/pOU82DBgl II; lanes 4±7(9) totalRNA from: A, NWL37/pKP402 (pOU82DBgl II� hokAC system);B, NWL37/pKP408 (pOU82DBgl II� hokBK12 system); and C,NWL37/pKP406 (pOU82DBgl II� hokCECOR24 system). Thepositions of full-length (FL) and truncated (TR) mRNAs, and anRNase III cleavage product are indicated.
E. coli hok homologues 1095
Also, in both cases, tac elements that are complementary
to putative 38 fbi elements are located at the very 58 ends
of the mRNAs, thus indicating a long-range 58 to 38 inter-
action in these mRNAs as well (see Fig. 5).
The chromosome-encoded Sok-like antisense RNAs
are relatively unstable
Using Northern analysis, we detected antisense RNAs
encoded by the chromosomally encoded loci hokAC,
hokBK12 and hokCECOR24 (Fig. 7). SokAC RNA was
estimated to be 52 nt, SokBK12 RNA to be 53 nt, and
SokCECOR24 RNA to be 55 nt. The 58 ends of the antisense
RNAs were determined using primer extension, and the
nucleotide complementary to the ®rst nucleotide of each
antisense RNA is indicated in Fig. 5. In all cases, the 58
ends correspond well with ÿ10 and ÿ35 promoter sequ-
ences in the DNA sequences. Thus, the hokAC, hokBK12
and hokCECOR24 loci encode antisense RNAs that are
homologous to Sok-RNA of plasmid R1. SokCECOR24 is
identical to the Sof-RNA from E. coli K-12 previously
described by Poulsen et al. (1991).
The secondary structures of the three new antisense
RNAs are very similar to that of Sok-RNA from plasmid
R1. In all cases, the RNAs consist of a 58 single-stranded
leader of 10±12 nts and an energy-rich stem±loop that
keeps the 58 parts of the molecules in single-stranded con-
formations. The single-stranded 58 ends are complemen-
tary to the loops of the potential target stem±loops of
the cognate mRNAs (e.g. see Fig. 5).
The metabolic stabilities of the antisense RNAs were
also measured. Estimates from the Northern blots in Fig.
7 show that SokAC, SokBK12 and SokCECOR24 are charac-
terized by half-lives of 5, 4 and 3 min respectively.
None of the chromosomally encoded loci mediate PSK
The preceding sections show that the new, chromoso-
mally encoded loci contain all of the regulatory elements
as previously described for the hok system of plasmid R1.
Therefore, we investigated the possibility that the chromo-
somal loci might mediate plasmid stabilization by PSK.
To this end, we used the unstably inherited R1 cloning
vector pOU82 as a test plasmid and bacterial host strains
that do not themselves produce the inhibitory antisense
RNAs (see Table 1 for an explanation). Plasmids pKP110
(hokAC), pKP302 (hokBK12) and pKP208 (hokCECOR24)
are pOU82 derivatives carrying the chromosomal loci.
Included as controls were pOU82 without any PSK system
and pTT820, which carries hok/sok of R1. As seen from
Table 1, the hok/sok system stabilized pOU82 <100-
fold, as described previously. However, none of the chro-
mosomally encoded loci stabilized pOU82 in any of the
strains tested, thus indicating that the loci do not mediate
PSK.
The plasmid-encoded hok-homologous genes are
induced by the addition of the transcriptional inhibitor
rifampicin (Gerdes et al., 1990a). This is because addition
of the drug leads to depletion of the antisense RNA, and
Fig. 7. Stability and processing patterns of the antisense RNAsshown by Northern blotting. Parts A, B and C show the SokAC,SokBK12 and SokCECOR24 antisense RNAs respectively. Cells weregrown in LB medium to an OD450 of <0.5. At time 0, rifampicinwas added to a ®nal concentration of 300 mg mlÿ1. Cell samplesfor total RNA preparation were taken at the intervals indicated(in min). Samples were loaded in the following order: lane 1,radioactively labelled RNA markers of 63 and 33 nts; lanes 2 and3, total RNA from NWL37/pOU82DBgl II; lanes 4±7(9) total RNAfrom: A, NWL37/pKP402 (pOU82DBgl II� hokAC system); B,NWL37/pKP408 (pOU82DBgl II� hokBK12 system); and C, NWL37/pKP406 (pOU82DBgl II� hokCECOR24 system). The positions ofthe antisense RNAs and possible RNase E cleavage products aremarked.
1096 K. Pedersen and K. Gerdes
thus to the accumulation of the truncated, translatable
mRNA. We knew from the data in Fig. 6 that addition of
rifampicin leads to accumulation of the truncated, pre-
sumed active mRNAs of the chromosomal loci. Therefore,
we added rifampicin to growing cells of the strains listed in
Table 1, and we inspected the cells for induction of Hok. All
cultures of strains carrying the pTT820 control plasmid
(carrying hok/sok ) exhibited the Hok-induced changes in
cell morphology, whereas none of the other strains carry-
ing plasmids with the chromosomal loci exhibited this phe-
notype. This result indicates that the chromosomal genes
are not inducible by rifampicin. This result is consistent
with the observed lack of PSK.
Translation in vitro of truncated hokAC and hokCECOR24
mRNAs
The lack of PSK and the missing induction by rifampicin
were puzzling because the chromosomal loci contain all
known regulatory elements present in the hok/sok system
of plasmid R1, and they produce the truncated, presumed
active mRNAs after decay of the antisense RNAs. There-
fore, we synthesized the truncated hokAC and hokCECOR24
mRNAs in vitro and tested whether they could be trans-
lated. Truncated hok mRNA was included as a positive
control. As seen from Fig. 8, the hokAC and hokCECOR24
mRNAs were translated at a signi®cantly lower rate than
that of hok mRNA. We cannot exclude that the low trans-
lation rates were due to misfolding of the RNAs. However,
in vitro binding assays between the hokAC and hokCECOR24
mRNAs and their cognate antisense RNAs showed that
the truncated RNAs bound the antisense RNAs at rates
similar to those described for the truncated hok mRNA
(data not shown). Furthermore, in vitro processing of the
mRNAs resulted in degradation patterns similar to those
seen in vivo, indicating that the mRNAs folded correctly
in vitro. Thus, our results indicate that the lack of PSK
in the case of the chromosomal hok homologues may be
explained by reduced translation rates of the truncated
mRNAs.
Discussion
We show here that E. coli K-12 codes for ®ve hok-homo-
logous genes. Previously, it was shown that hokCK12
and hokDK12 encode active Hok-like cytotoxins (Gerdes
et al., 1986b; Poulsen et al., 1989). The ®ndings described
here con®rm that HokCK12 is a cytotoxin and that HokAK12
and HokBK12 can be added to the list. Curiously, three
of the ®ve loci were inactivated by IS elements. Thus,
hokAK12 contains an IS150 element just upstream of the
toxin gene, and hokCK12 and hokEK12 contain IS186 ele-
ments 22 and 21 bp downstream of the toxin genes respec-
tively. A sixth hok-homologous locus in E. coli B, denoted
hokX, contains an IS186 element also 21 bp downstream
of the toxin gene. The IS elements are located such that
they interrupt the stable, toxin-encoding mRNAs, and they
Fig. 8. In vitro translation of truncated hokR1, hokAC andhokCECOR24 mRNAs. The mRNAs indicated above the lanes weretranslated in an S30 extract containing 35S-methionine. Sampleswere withdrawn at 5 and 20 min after initiation of the reactions andanalysed by SDS±PAGE. The positions of the Hok, HokAC andHokCECOR24 proteins are indicated. Relative translation frequencies(lower line) were normalized to LacZ(a) (internal standard). Theamount of Hok protein detected after 5 min was set to 1. `C'denotes a control reaction without exogenously added mRNA.
Table 1. Test of plasmid stabilization (via PSK) for hokAC, hokBK12, hokCECOR24.
Loss rate per cellPlasmid Toxin system Strain used to assay PSK per generation Folds of stabilization
a. The E. coli K-12 strain used was CSH50, which does not produce the SokA antisense RNA from its chromosome.b. S. typhimurium does not produce SokB antisense RNA from its chromosome.c. NWL35 is an E. coli K-12 strain from which the sokC (sof ) gene was deleted (Poulsen et al., 1992).
E. coli hok homologues 1097
thereby prevent the appropriate expression of the toxins
(see below).
Subtraction of the DNA sequences of the IS elements
from the E. coli contigs revealed that the chromosomal
loci specify most or all of the regulatory components, as
previously described for hok/sok of R1 (Gerdes et al.,
1997). These components include tac and fbi elements
located in the mRNA 58 and 38 ends, respectively, antisense
RNAs that repress translation of their cognate mRNAs, and
antisense RNA target stem±loops required for translation
and for antisense RNA binding. Of the six known plasmid-
encoded hok-like loci, none appears to be inactivated. The
reason for this difference between the chromosome- and
plasmid-encoded loci can only be speculated upon, but
indicates that the chromosome-encoded loci have a pre-
ponderance to suffer from inactivation by mutation. More-
over, the hok loci seem to attract IS186.
To investigate this problem further, we decided to search
for chromosome loci devoid of IS elements. To this end, we
screened collections of wild-type E. coli strains for hokA and
hokC loci of sizes compatible with the lack of linked IS ele-
ments. We found that E. coli C and ECOR24 encode loci
devoid of the IS150 and IS186 elements respectively.
The nucleotide sequences of the hokAC and hokCECOR24
mRNAs revealed two loci with all of the regulatory ele-
ments, as previously described for hok/sok of R1 (Fig. 5).
Northern analyses of the mRNAs encoded by hokAC,
hokBK12 and hokCECOR24 showed in all cases stable
mRNAs that are slowly processed to truncated versions,
which are also very stable (except for the truncated
hokBK12 mRNA; see Fig. 6). This processing pattern is
similar to that of the plasmid-encoded hok-homologous
loci (Gerdes et al., 1990b; Nielsen et al., 1991; Thisted
et al., 1994b; Franch and Gerdes, 1996). This suggests
that the processing removes the fbi elements in the mRNA
38 ends. This conjecture was supported by the by primer
extension analyses, which showed that the mRNA 58
ends were not processed after the addition of rifampicin
(data not shown).
The intact hokAC, hokBK12 and hokCECOR24 loci all
encode small regulatory antisense RNAs that are com-
plementary to the mRNA leader regions (Fig. 7). In all
cases, the antisense RNAs contain single-stranded 58
ends followed by a stem±loop structure, and their second-
ary structures are thus very similar to that of Sok-RNA of
R1. The antisense RNAs are in all cases more unstable
than their cognate mRNAs. This differential RNA decay
is the basis for the PSK mechanism (i.e. the onset of hok
translation in plasmid-free cells). Therefore, we tested the
ability of the chromosomally encoded loci to mediate plas-
mid stabilization by PSK (Table 1). However, none of the
chromosomal loci mediated plasmid stabilization, thus
indicating that the PSK mechanism is not operational in
any of them. Because in all cases the full-length RNAs
are processed to the presumed active, 38-truncated
RNAs, this observation was not expected. However, the
low translation rates of the truncated RNAs (Fig. 8) yield
an explanation for the absence of the PSK phenotype.
The alignment of all of the chromosome- and plasmid-
encoded hok-homologous mRNAs is shown in Fig. 5. As
may be seen, the chromosomal homologues encode all
of the regulatory elements as previously described for
hok mRNA, including the complementary fbi and tac ele-
structures at their very 58 ends, thus indicating similar fold-
ing pathways in all cases (see Fig. 2; Gerdes et al., 1997).
The alternative (i.e. mutually exclusive) secondary struc-
tures are supported by a large number of coupled covaria-
tions (Gultyaev et al., 1997).
It is surprising that E. coli K-12 codes for ®ve hok-homo-
logous loci, and their function can only be guessed upon.
Kobayashi's group has suggested that genes mediating
PSK may function as sel®sh genetic elements just as
transposons and viruses, and that their PSK phenotype
help their persistence and spreading (Kusano et al., 1995;
Naito et al., 1995; Kobayashi, 1998). Furthermore, chromo-
somal restriction modi®cation genes were shown to protect
linked DNA from replacement, through homologous recom-
bination, by invading foreign DNA (Y. Nakayama, N. Handa
and I. Kobayashi, personal communication). They argued
that the PSK genes may thus confer an evolutionary
advantage to the host genome.
Experimental procedures
Enzymes and chemicals
Antibiotics and chemicals were added at the following concen-trations: 30 mg mlÿ1 and 100 mg mlÿ1 ampicillin when the copynumber of the plasmids was less than and more than 8respectively; 300 mg mlÿ1 rifampicin; 2 mM IPTG. All enzymeswere purchased from Boehringer Mannheim unless statedotherwise. The growth medium used was Luria±Bertanibroth (Bertani, 1951).
Bacterial strains and plasmids
Bacterial strains and plasmids are listed in Table 2. All plasmidsare described below. Primers used in the PCR reactions arealso described below.
Plasmids used. Plasmid pOU82 is derived from the mini-R1`runaway replication' vectors originally developed by Larsenet al. (1984). In addition to the bla gene conferring ampicillinresistance, pOU82 contains the lacZYA genes fused to thedeoP2 promoter. Thus, cells containing pOU82 give rise toblue colonies on Xgal (5-bromo-4-chloro-3-indolyl-b-D-galacto-side) indicator plates. Furthermore, pOU82 contains unique,
juxtaposed EcoRI and BamHI restriction sites for the insertionof DNA fragments (Gerdes et al., 1985).
Plasmid pRBJ200 is isogenic to pOU82 except for the clon-ing region, in which the deoP2 promoter was replaced withpromoterless multiple cloning sites (mcs), such that the plas-mid can be used as a transcriptional lacZ fusion vector (Jensenet al., 1995)
Plasmid pTT820 is a pOU82 derivative carrying the hok/sok locus on a 580 bp EcoRI±BamHI fragment (Nielsen etal., 1991).
Plasmids constructed. All hokA , hokB and hokC coordi-nates refer to the sequence from the C, K-12 and ECOR24strains respectively. For all genes, the base pair coding forthe very ®rst nucleotide at the 58 end of the mRNA was set to�1 (see Fig. 5).
Plasmids pKP101 and pKP110. pKP101 and pKP110 arepOU82 derivatives that contain the hokA locus from E. coli C(strain 1055) on EcoRI±BamHI fragments. The fragment inpKP101 (ÿ114 to �466) was generated with primers KP26(CCCGGATCCGCAACCTTTAATAATCTTCTG) and KP24
(CCCGAATTCCTAAGATCCCTGCCATTTG), and pKP110(ÿ294 to �466) was generated with primers KP11 (CCC-GGATCCTTTCTTCGATAAAGTGATGG) and KP24.
Plasmids pKP201 and pKP208. pKP201 and pKP208 arepOU82 derivatives that contain the hokC locus from ECOR24on EcoRI±BamHI fragments. The fragment in pKP201 (ÿ225to �400) was generated with primers KP29 (CCCGGATCC-GAGGGATTAATTAGGAAAAG) and KP30 (CCCGAATTC-AAAAGCCTGCCCGTGGGC), and pKP208 (ÿ640 to �400)was generated with primers KP9 (CCCGGATCCCATCAG-CGCGTCATTTATCC) and KP30.
Plasmids pKP301 and pKP302. pKP301 and pKP302 arepOU82 derivatives that contain the hokB locus from E. coliK-12 (MG1655) on EcoRI±BamHI fragments. The fragmentin pKP301 (ÿ74 to �451) was generated with primers KP40(CCCGGATCCAAATTCTGGAAAACAGCACG) and KP43(CCCGAATTCGGGATCTCACACTGTACG), and pKP302(ÿ1090 to �451) was generated with primers KP39 (CCC-GGATCCGTCGAACAGTCCCTACTG) and KP43.
Plasmids pKP402, pKP406 and pKP408 were generated by
Table 2. Bacterial strains, plasmids used and constructed.
Strain/plasmid Relevant characteristicsa Reference/source and coordinates of hok inserts
StrainsCSH50 DSokA, Dlac Miller (1972)NWL35 DSokA, DhokC/SokC, Dlac Poulsen et al. (1989)NWL37 HokR Poulsen et al. (1992)MG1655 K-12 wt, hokB/sokB � Jensen (1993)C1055 E. coli C, hokA/sokA� Laboratory collectionECOR 24 WT E. coli, hokC/sokC� Ochman and Selander, 1984KP1274 S. typhimurium, rÿ, m� Laboratory stock
Plasmids usedpOU82 Mini R1 replicon, bla, deoP2-lacZYA Gerdes et al. (1985)pRBJ200 MiniR1 replicon, bla, mcs-lacZYA Jensen et al., 1995pTTQ19 pUC replicon, Ptac-mcs, rrnBT1T2, lacI q, bla Stark 1987pTT820 hok/sok system in pOU82 Nielsen et al. (1991)Litmus 28 High copy number probe vector New England Biolabs
Plasmids constructedpKP40 PA1/04/03 inserted in pRBJ200 This workpKP219 lacZYA replaced by lacI q in pKP40 This workpKP101 hokAC: ÿ114 to �466, in pOU82 This workpKP110 hokAC: ÿ294 to �466, in pOU82 This workpKP201 hokCECOR24: ÿ225 to �400, in pOU82 This workpKP208 hokCECOR24: ÿ640 to �400 in pOU82 This workpKP301 hokBK12: ÿ74 to �451, in pOU82 This workpKP302 hokBK12: ÿ1090 to �451, in pOU82 This workpKP402 DBglII of pKP110 This workpKP406 DBglII of pKP208 This workpKP408 DBglII of pKP302 This workpKP501 hokAC: ÿ9 to �368, in Litmus 28 This workpKP502 hokAC: �138 to �368, in Litmus 28 This workpKP507 hokCECOR24: ÿ9 to �370, in Litmus 28 This workpKP508 hokCECOR24: �136 to �370, in Litmus 28 This workpKP511 hokBK12: �131 to �364, in Litmus 28 This workpKP512 hokBK12: ÿ74 to �101, in Litmus 28 This workpKP602 hokAC: �138 to �368, in pKP219 This workpKP608 hokCECOR24: �136 to �370, in pKP219 This workpKP611 hokBK12: �147 to �451, in pKP219 This workpKP612 hokAK12: �138 to �368, in pKP219 This workpKP613 hokCK12: �136 to �370, in pKP219 This work
a. The coordinates refer to the mRNA sequences in Fig. 5.
E. coli hok homologues 1099
deleting a 248 bp Bgl II fragment carrying the copB gene fromplasmids pKP110, pKP208 and pKP302 respectively. Dele-tion of copB increases the plasmid copy number eightfold.
Plasmid pKP40 is a pRBJ200 derivative carrying thePA1/04/03 promoter from pUHE24 (ÿ46 to �21) and was con-structed using the PCR primers KP4 (CCCCCCCTGATCAA-GATCTCCCGGGCAAAAAGAGTGTTGACTTGTG) and KP5(CCCCGGATCCAATTGTTATCCGCTCACAAT), digested withBcl I and BamHI and ligated into the BamHI site ofpRBJ200. In pKP40, the PA1/O4/O3 promoter reads intothe mcs and from thereon into the lacZ gene.
Plasmid pKP219 is a pKP40 derivative with the 5 kbp Stu I±EcoRI lacZYA fragment replaced by the 2 kbp SspI±EcoRIlacI q fragment from pTTQ19 (Stark, 1987). Thus, pKP219 isa useful expression vector that carries lacI q and a lacI regu-lated promoter.
Plasmid pKP602 (�138 to �368) and pKP612 (�138 to�368) are pKP219 derivatives that carry the hokA genesfrom E. coli C (C1055) and K-12 (MG1655) cloned onBamHI±EcoRI fragments using PCR primers KP12 (CCC-GGATCCAGGAGGCTGGGAATGCCGCAG) and KP18 (CCC-GAATTCAAATTTGGGTGCAATGAGAATGC). Thus, uponaddition of IPTG to growing cells, plasmids pKP602 andpKP612 express the HokA proteins of E. coli C and K-12respectively.
Plasmids pKP608 (�136 to �370) and pKP613 (�136 to�370) are pKP219 derivatives that carry the hokC genesfrom E. coli ECOR24 and K-12 (MG1655) cloned on BamHI±EcoRI fragments using primers KP14 (CCCGGATCCAGGA-GAAGAGAGCAATGAAGCAG) and KP17 (CCCGAATTCA-AAATAGGGTGCGTTGAAG).
Plasmid pKP611 is a pKP219 derivative that carries thehokB gene from E. coli K-12 (MG1655) in which nucleotides�147 to �451 is fused to the strong SDparA translational initia-tion signal by using the PCR primers KP58 (CCCGGATCC-ATAAGGAGTTTTATAAATGAAGCACAACCCTCTGGT; theunderlined sequence is ÿ16 to ÿ1 of parA with the startcodon as�1) and KP43 (CCCGAATTCGGGATCTCACACTG-TACG) and cloned in the BamHI±EcoRI sites of pKP219.
Plasmids used for in vitro generation of single-stranded RNAprobes. Plasmid Litmus28 (New England Biolabs) is a highcopy number cloning vector that contains opposing T7 RNApolymerase promoters adjacent to the mcs, such that a DNAfragment inserted into the mcs can be transcribed by T7 RNApolymerase.
Plasmids pKP502 and pKP508 are Litmus28 derivativesthat contain the BamHI±EcoRI fragments from pKP602 andpKP608, encoding the hokA and hokC genes respectively.
Plasmid pKP511 (�131 to �364) is a Litmus28 derivativethat contain the hokB gene of E. coli K-12 (MG1655) on aBamHI±EcoRI fragment generated by using PCR primersKP41 (CCCGGATCCGGCAAGGAGAAAGGCTATG) andKP42 (CCCGAATTCGTAAAAGGGGTGCCATGAG).
The pKP502, pKP508 and pKP511 plasmids were linear-ized with BamHI before being used as templates for in vitrotranscription by T7 RNA polymerase, generating single-stranded run-off RNA probes complementary to their respec-tive mRNAs.
Plasmid pKP501 (ÿ9 to �368) is a Litmus28 derivativecarrying the hokA gene from E. coli C (C1055) on a
BamHI±EcoRI fragment using PCR primers KP16 (CCC-GGATCCAATAGCGGCGGGTGCTTGAG) and KP18.
Plasmid pKP507 (ÿ9 to �370) is a Litmus28 derivativecarrying the hokC gene from ECOR24 on an BamHI±EcoRIfragment using PCR primers KP16 and KP17.
Plasmid pKP512 (ÿ74 to �101) is a Litmus28 derivativecarrying the hokB gene of E. coli K-12 (MG1655) between theBamHI±EcoRV sites. The PCR fragment was generated usingprimers KP40 and KP47 (TTGCTAGGTTCATTCGTTGG).
The plasmid pKP501 was linearized with EcoRI and Dra III,pKP507 with EcoRI and EcoNI and pKP512 with EcoRIbefore being used as templates for in vitro transcription byT7 RNA polymerase, generating single-stranded run-off RNAprobes complementary to their respective antisense RNAs.
Genetic methods
Test for induction of Hok expression by inhibition of transcrip-tion was accomplished by looking for `ghost cells' in a phase-contrast microscope before and after the addition of rifampicinto exponentially growing cells. The toxicity of the cloned hokgenes was tested by restreaking colonies on LA plates bothwith and without 2 mM IPTG in the plates, and by the additionof IPTG to a ®nal concentration of 2 mM to an exponentiallygrowing culture. The cultures were followed by taking samplesfor microscopy and by determinations of viable counts. Plasmidstability tests were carried out according to Dam and Gerdes(1994). See Table 1 for the strains used.
Northern transfer analysis
Preparation of total RNA and Northern transfer analysis wasperformed essentially as described by Gerdes et al., 1990b.Cells carrying one of the R1 copB (DBglII ) copy-up plasmidswere grown exponentially at 358C. At OD450� 0.5, rifampicinwas added to a ®nal concentration of 300 mg mlÿ1. For sizefractionation, 10 mg of total RNA was loaded in each laneof a 5.5% (for mRNA) or 10% (for antisense RNA) low bis-acrylamide, polyacrylamide gel containing 8 M urea. The32P-labelled RNA probes used were generated by phage T7RNA polymerase (Promega) with the linearized plasmids,described above, as templates.
Synthesis of in vitro RNA
The in vitro T7-RNA polymerase synthesis and puri®cation ofuniformly 3H- or 32P-labelled mRNA and antisense RNA wereperformed as described by Thisted et al. (1994a). The follow-ing PCR primers were used to generate DNA templates fortruncated mRNAs of hokR1, hokAC and hokCECOR24: T7-1DG�T7-3N, KP48�KP50 and KP51�KP53 respectively.The sequence of the primers, with the T7-RNA promoter under-lined, is: T7-1DG (CGGGATCCTGTAATACGACTCACTAT-AGGCGCTTGAGGCTTTCTCCTCATG), KP48 (TGTAATA-CGACTCACTATAGGGTGCTTGAGACTGTTTGTC), KP51(TGTAATACGACTCACTATAGGGTGCTTGAGGCTGTCT-GT), T7-3N (AAGGCGGGCCTGCGCCCGCCTCCAGG),KP50 (GGCGGGAATAACTTCCCGC) and KP53 (GGCG-GGGATCACTCCCCG).
Transcript concentration was determined by liquid scintilla-tion counting for 3H-labelled transcripts. After gel puri®cation,
transcripts were dissolved in H2O at 200 nM. The uniformity ofthe transcripts was tested by boil-in experiments.
Translation in S30 extract
The E. coli coupled transcription/translation system (Zubay,1973) was purchased from Promega. Translation reactions ofthe synthesized 3H-labelled mRNAs were performed accordingto Franch et al. (1997).
Acknowledgements
We thank Thomas Franch for stimulating discussions and forhelp with the in vitro translation experiments. This work wassupported by the Danish Biotechnology Programme in theCenter for Interaction, Structure, Function, and Engineeringof Macromolecules (CISFEM).
References
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang,Z., Miller, W., and Lipman, D.J. (1997) Gapped BLAST andPSI-BLAST: a new generation of protein database search pro-grams. Nucleic Acids Res 25: 3389±3402.
Bertani, G. (1951) Studies on lysogenesis. I. The mode ofphage liberation by lysogenic Escherichia coli. J Bacteriol62: 293±300.
Blattner, F.R., Plunkett, III, G., Bloch, C.A., Perna, N.T., Bur-land, V., Riley, M., et al. (1997) The complete genomesequence of Escherichia coli K-12. Science 277: 1453±1474.
Dam, M., and Gerdes, K. (1994) Partitioning of plasmid R1.Ten direct repeats ¯anking the parA promoter constitutea centromere-like partition site parC, that expresses incom-patibility. J Mol Biol 236: 1289±1298.
Fecker, L.F., Beier, H., and Berin, J. (1986) Cloning and char-acterization of a lysine decarboxylase gene from Hafniaalvei. Mol Gen Genet 203: 177±184.
Franch, T., and Gerdes, K. (1996) Programmed cell death inbacteria: translational repression by mRNA end-pairing.Mol Microbiol 21: 1049±1060.
Franch, T., Gultyaev, A.P., and Gerdes, K. (1997) Pro-grammed cell death by hok/sok of plasmid R1: processingat the hok mRNA 38-end triggers structural rearrangementsthat allow translation and antisense RNA binding. J MolBiol 273: 38±51.
Gerdes, K., Larsen, J.E.L., and Molin, S. (1985) Stable inheri-tance of plasmid R1 requires two different loci. J Bacteriol161: 292±298.
Gerdes, K., Rasmussen, P.B., and Molin, S. (1986a) Uniquetype of plasmid maintenance function: Postsegregationalkilling of plasmid-free cells. Proc Natl Acad Sci USA 83:3116±3120.
Gerdes, K., Bech, F.W., Jùrgensen, S.T., Lùbner-Olesen, A.,Rasmussen, P.B., Atlung, T., et al. (1986b) Mechanism ofpostsegregational killing by the hok gene product of theparB system of plasmid R1 and its homology with therelF gene product of the E. coli relB operon. EMBO J 5:2023±2029.
Gerdes, K., Poulsen, L.K., Thisted, T., Nielsen, A.K., Marti-nussen, J., and Andreasen, P.H. (1990a) The hok killer
gene family in Gram-negative bacteria. New Biologist 2:946±956.
Gerdes, K., Thisted, T., and Martinussen, J. (1990b) Mech-anism of post-segregational killing by the hok/sok systemof plasmid R1: sok antisense RNA regulates formation ofa hok mRNA species correlated with killing of plasmid-free cells. Mol Microbiol 4: 1807±1818.
Gerdes, K., Gultyaev, A.P., Franch, T., Pedersen, K., andMikkelsen, N.D. (1997) Antisense RNA-regulated pro-grammed cell death. Annu Rev Genet 31: 1±31.
Gotfredsen, M., and Gerdes, K. (1998) The Escherichia colirelBE genes belong to a new toxin±antitoxin gene family.Mol Microbiol 29: 1065±1076.
Grùnlund, H., and Gerdes, K. (1999) Toxin±antitoxin sys-tems homologous to relBE of Escherichia coli plasmidP307 are ubiquitous in prokaryotes. J Mol Biol 285:1401±1415.
Gultyaev, A.P., Franch, T., and Gerdes, K. (1997) Pro-grammed cell death by hok/sok of plasmid R1: couplednucleotide covariations reveal a phylogenetically conservedfolding pathway in the hok family of mRNAs. J Mol Biol273: 26±37.
Holcik, M., and Iyer, V.N. (1997) Conditionally lethal genesassociated with bacterial plasmids. Microbiology 143:3403±3416.
Jensen, K.F. (1993) The Escherichia coli K-12 `wild types'W3110 and MG1655 have an rph frameshift mutationthat leads to pyrimidine starvation due to low pyrE expres-sion levels. J Bacteriol 175: 3401±3407.
Jensen, R.B., and Gerdes, K. (1995) Programmed cell deathin bacteria: proteic plasmid stabilization systems. MolMicrobiol 17: 205±210.
Jensen, R.B., Grohmann, E., Schwab, H., Diaz-Orejas, R.,and Gerdes, K. (1995) Comparision of ccd of F, parDEof RP4 and parD of R1 using a novel conditional replica-tion control system of plasmid R1. Mol Microbiol 17:211±220.
Kobayashi, I. (1998) Sel®shness and death. Raison d'etre ofrestriction, recombination and mitochondria. Trends Genet14: 368±374.
Kulakauskas, S., Lubys, A., and Ehrlich, S.D. (1995) DNArestriction-modi®cation systems mediate plasmid mainte-nance. J Bacteriol 177: 3451±3454.
Kusano, K., Naito, T., Handa, N., and Kobayashi, I. (1995)Restriction±modi®cation systems as genomic parasites incompetition for speci®c sequences. Proc Natl Acad SciUSA 92: 11095±11099.
Lanzer, M., and Bujard, H. (1988) Promoters largely determinethe ef®ciency of repressor action. Proc Natl Acad Sci USA85: 8973±8977.
Larsen, J.E.L., Gerdes, K., Light, J., and Molin, S. (1984)Low-copy-number plasmid-cloning vectors ampli®able byderepression of an inserted foreign promoter. Gene 28:45±54.
Miller, J. (1972) Experiments in Molecular Genetics. ColdSpring Harbor, NY: Cold Spring, Harbor Laboratory Press.
Naito, T., Kusano, K., and Kobayashi, I. (1995) Sel®sh behav-ior of restriction±modi®cation systems. Science 267: 897±899.
Nielsen, A.K., Thorsted, P., Thisted, T., Wagner, E.G.H., andGerdes, K. (1991) The rifampicin-inducible genes srnB
from F and pnd from R483 are regulated by antisenseRNAs and mediate plasmid maintenance by killing of plas-mid-free segregants. Mol Microbiol 5: 1961±1973.
Ochman, H., and Selander, R.K. (1984) Standard referencestrains of Escherichia coli from natural populations. J Bac-teriol 157: 690±693.
Ostrowski, J., Wu, J.-Y., Rueger, D.C., Miller, B.E., Siegel,L.M., and Kredich, N.M. (1989) Characterization of thecysJIH regions of Salmonella typhimurium and Escherichiacoli B: DNA sequences of cysI and cysH and a model forthe siroheme-Fe4S4 active center of sul®te reductasehemoprotein based on amino acid homology with spinachnitrite. J Biol Chem 264: 15726±15737.
Poulsen, L.K., Larsen, N.W., Molin, S., and Andersen, P.(1989) A family of genes encoding a cell-killing functionmay be conserved in all Gram-negative bacteria. MolMicrobiol 3: 1463±1472.
Poulsen, L.K., Refn, A., Molin, S., and Anderssin, P. (1991)The gef gene from Escherichia coli is regulated at thelevel of translation. Mol Microbiol 5: 1639±1648.
Poulsen, L.K., Larsen, N.W., Molin, S., and Anderssin, P.(1992) Analysis of an Escherichia coli mutant strain resis-tant to the cell-killing function encoded by the gef genefamily. Mol Microbiol 6: 895±905.
the lac repressor gene for regulated high-level expressionof genes in Escherichia coli. Gene 51: 255±267.
Thisted, T., and Gerdes, K. (1992) Mechanism of post-segre-gational killing by the hok/sok system of plasmid R1. Sokantisense RNA regulates hok gene expression indirectlythrough the overlapping mok gene. J Mol Biol 223: 41±54.
Thisted, T., Sùrensen, N.S., Wagner, E.G.H., and Gerdes, K.(1994a) Mechanism of post-segregational killing: Sok anti-sense RNA interacts with Hok mRNA via its 58-end single-stranded leader and competes with the 38-end of HokmRNA for binding to the mok translational initiation region.EMBO J 13: 1960±1968.
Thisted, T., Nielsen, A.K., and Gerdes, K. (1994b) Mechan-ism of post-segregational killing: translation of Hok SrnBand Pnd mRNA of plasmids R1, F and R483 is activatedby 38-end processing. EMBO J 13: 1950±1959.
Thisted, T., Sùrensen, N.S., and Gerdes, K. (1995) Mechan-ism of post-segregational killing: secondary structure ana-lysis of the entire Hok mRNA from plasmid R1 suggest afold-back structure that prevents translation and antisenseRNA binding. J Mol Biol 247: 859±873.
Yarmolinsky, M.B. (1995) Programmed cell death in bacterialpopulations. Science 267: 836±837.
Zubay, G. (1973) In vitro synthesis of protein in microbial sys-tems. Annu Rev Genet 7: 267±287.