Top Banner
MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine , Sana’a ,University, Yemen Consultant of Genetic Center 48 MH
49

MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Dec 16, 2015

Download

Documents

Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY

Nagi ALHajProf of Molecular Biology

Assist,Faculty Medicine ,

Sana’a ,University, YemenConsultant of Genetic Center 48

MH

Page 2: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Overview on Genetic EpilepsyA genetic contribution to etiology has been estimated to be present in about 40% of patients with epilepsy..

Three major groups:

•Mendelian disorders, in which a single major locus can account for segregation of the disease trait

•Non-mendelian or 'complex' diseases, in which the pattern of familial clustering can be accounted for by the interaction of the maternal inheritance pattern of mitochondrial DNA

•Chromosomal disorders, in which a gross cytogenetic abnormality is present.

Page 3: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

• The ‘common’ non-familial idiopathic epilepsies tend to display ‘complex’ inheritance.

• They including various forms of

• Idiopathic generalised epilepsy (IGE)

• Juvenile myoclonic epilepsy (JME)

• Childhood absence epilepsy (CAE)

Page 4: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Genetics and Mutation • Mutations in over 2,000 genes have now been identified in

patients with more than 3,000 different disease phenotypes.

For the clinicians and their patients, it is becoming increasingly

important to obtain a genetic diagnosis

• Identifying the genetic aetiology of a disease may influence clinical management and will provide information regarding risk to future pregnancies.

• With the advent of high-throughput capillary sequencers and sequence analysis software, direct sequencing provides an accurate method for single gene analysis.

Page 5: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

The inheritance pattern can be

autosomal dominant, autosomal recessive, or X-linked.

Mutations in a single gene may be associated with different types of seizures (clinical heterogeneity),

and, conversely, mutations in different genes can cause the same epilepsy phenotype (genetic heterogeneity).

Page 6: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Traditional nomenclature of inherited epilepsy:

Different mutations in different genes can result in similar phenotypes

Different mutations within one gene can result in different phenotypes

Different mutations in different genes can result in different phenotypes

An identical mutation within one gene can result in different phenotypes in different individuals (cause: environment, other genes)

Page 7: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Mutation identification begins with aphenotype and proceeds toward the genotype

genotype phenotype

Page 8: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.
Page 9: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.
Page 10: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

The diagram showsthe distribution of all genetic differences that had been mapped to chromosome 1 at the time this diagram was drawn.

Page 11: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

mutationsite

Mutation identification by linkage analysis

• Genome scan has been replaced by mutational analysis but in a small number of families in whom the mutation cannot be identified

• Remains the only method for the genetic diagnosis of carriers.

Mutational analysis can be used to identify cells or DNA that have genotype and allele frequency differences from the normal genome.

Page 12: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Mutant alleles generating defects in particular proteins could disrupt the dance .

Cells homozygous for a mutant allele might be unable to complete chromosome duplication or mitosis or cytokinesis because a required component of the molecular machinery is missing or unable to function.

A genetic map of part of the human

X chromosome.

Page 13: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

genotype phenotype

mechanismdisease

Elucidation of a disease mechanism presents a much more complex set of challenges

mRNA

protein

cell

network

Page 14: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

genotype phenotype

The number of potential defects increasesexponentially with each emergent stage of complexity

mRNA

protein

cell

network

mechanismdisease

Not all potential defects arise from each mutation

Page 15: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

cell

network

genotype phenotype

Not all potential defects arise from each mutation

mRNA

protein

mechanismdisease

The most effective target for therapy ( ) would bethe DNA mutation, but this is currently unfeasible

T

T

Page 16: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

cell

network

genotype phenotype

mRNA

protein

mechanismdisease

The most effective target for therapy ( ) would bethe DNA mutation, but this is currently unfeasible

T

T

T

Proteins are also excellent targets for intervention

Page 17: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

The genetic contribution to epilepsy: the known and missing heritability.

The Causes of Epilepsy, eds S.D. Shorvon et al, pp 6367. Cambridge University Press, Cambridge, 2011).

Page 18: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Genes and mutations in neonatal syndromes and GEFS+

KCNQ2 Chr. 20q13.3Benign familial neonatal convulsions (BFNC); Benign neonatal epilepsy-1 (EBN1)BFNC/myokymia syndrome

KCNQ3 Chr. 8q24Benign familial neonatal convulsions (BFNC); Benign neonatal epilepsy-2 (EBN2)

Page 19: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

SCN1B Chr. 19q13Generalized epilepsy with febrile seizures plus, type 1 (GEFS+ type 1; GEFSP1)

SCN1A Chr. 2q24GEFS+ type 2; GEFSP2

GABRG2 Chr. 5q33-q34GEFS+ type 3; GEFSP3

SCN2A Chr. 2q23-q24Febrile seizures associated with afebrile seizures

Severe myoclonic epilepsy in infancy (SMEI)

SMEI

Benign familial neonatal-infantile seizures (BFNIS)

Page 20: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Unknown Chr. 19q12-q13.1Benign familial infantile convulsions, type 1 (BFIS type 1; BFIC1)

Unknown Chr. 16p12-q12BFIS type 2; BFIC2

Unknown Chr. 16p12-p11.2Rolandic epilepsy, paroxysmal exercise-induced dystonia, writer's cramp (RE-PED-WC)

Unknown Chr. 16p13Autosomal recessive (familial) benign idiopathic myoclonic epilepsy of infancy (FIME)

Paroxysmal kinesigenic choreoathetosis (PKC)

Infantile convulsions and paroxysmal choreoathetosis (ICCA)

Page 21: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Traditional nomenclature of inherited epilepsy:

Syndrome “A”:

Gene 1 Gene 2 Gene 3 Gene 4

Phenotype:

Syndrome “B”:

Syndrome “C”:

Syndrome “D”:

Syndrome “E”:

Syndrome “F”:

Syndrome “G”:

etc…

Gene 1 Gene 2 Gene 3 Gene 4

BB

Gene 2 Gene 1

Gene 3 Gene 1

Gene 1

Gene 4

Gene 2

Gene 2

Gene 3

D F,G EEEC CCA A A AAMutations:

Page 22: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Gene-centric nomenclature of inherited epilepsy:

Gene 1: Phenotypic range A, B, C, D

etc…

Gene 2:

Gene 3:

Gene 4:

Phenotypic range A, B, E, F, G

Phenotypic range A, S, E

Phenotypic range A, E

Both “Traditional” and “Gene-centric” nomenclatures have specific advantages and disadvantages

Gene 1 Gene 2 Gene 3 Gene 4

AMutations:

BPhenotype: AB C D A ACF,G EEE CA

Page 23: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Molecular Diagnosis

Page 24: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

PATIENT HISTORY FOR MOLECULAR GENETIC TESTING

Page 25: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

(1) The Infantile Epilepsy includes sequencing and deletion/duplication analysis of 38 genes causing Mendelian forms of epilepsy with onset of seizures during the first year of life.

38 gene activity, including•voltage-gated sodium channels,• the voltage-gated calcium channels,• and gamma-aminobutyric acid (GABAA) receptors.

Page 26: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.
Page 27: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

• (2) The Childhood-Onset Epilepsy 40 Genes (3)The Adolescent-Onset Epilepsy 21 Genes

Includes sequencing and deletion/duplication analysis of 40 and 21 genes respectively that causing Mendelian forms of epilepsy.

• Genes that encode nicotinic acetylcholine receptors and calcium channels,

Page 28: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.
Page 29: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Methodology(1) Infantile Epilepsy Panel (2) The Childhood-Onset Epilepsy(3) The Adolescent-Onset Epilepsy

Using genomic DNA obtained from blood, ~ 570 coding exons and the flanking splice junctions of 38 genes are sequenced simultaneously by (next-generation sequencing).

(1) The sequence is assembled and compared to published genomic reference sequences.

(2) Sanger sequencing is used to compensate for low coverage and refractory amplifications in regions where pathogenic mutations have been previously published.

Page 30: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

DNA in the Cell

Target Region for PCRTarget Region for PCR

chromosome

cell nucleus

Double stranded DNA molecule

Individual nucleotides

Page 31: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Extract and discard plasma, taking care not to remove the buffy coat.

Page 32: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Genetic Lab 48 MH

Page 33: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Make copies (extend primers)

Starting DNA Template

5’

5’

3’

3’

5’

5’

3’

3’

Add primers (anneal) 5’3’

3’5’

Forward primer

Reverse primer

DNA Amplification with the Polymerase Chain Reaction

(PCR)

Separate strands

(denature)

5’

5’3’

3’

Page 34: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created

In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created

PCR Copies DNA Exponentially through Multiple Thermal

Cycles

Original DNA target region

Thermal cycleThermal cycleThermal cycle

Page 35: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Deletion analysis of the SCN1A gene by multiplex PCR.

M 1 2 3 4 5 6 7 8 9 10 11

loss of bands

loss of bands

Page 36: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

COMPARATIVE GENOMIC HYBRIDIZATION (CGH)

Page 37: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Identification of a deletion encompassing gene in a male patient.

Identification of a hemizygous Xq22.1 deletion with a 370 K SNP microarray

Y-axes represent R Log ratio

B allele frequency The red line (log R ratio profile) corresponds to the median smoothing series.

The X-axis indicates the position on the X chromosome

Page 38: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Figure 1. Identification of a deletion encompassing PCDH19 in a male patient.

Analysis of the patient and his mother with CGH microarrays, showing that the new deletion occurred.

Black horizontal bars represent the gene PCDH19) and pseudogenes comprised in the deleted region

Page 39: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.
Page 40: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

ABI Prism 310 Genetic Analyzer

Page 41: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

3’-TAAATGATTCC-5’

ATT

ATTTACTAA

ATTTACT ATTTAC

ATTTATTTA

AT

ATTTACTA

ATTTACTAAGATTTACTAAGG

A

DNA template5’ 3’

Primer anneals Extension produces a series of ddNTP

terminated products each one base different in length

Each ddNTP is labeled with a different color fluorescent dye

Page 42: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Epilepsy GEFS

Page 43: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

OMIM Record Link to Gene

Coriell Cell RepositoriesHuman Gene Mutation Database

Epilepsy GEFS

Page 44: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Gene

Links to Everywhere (almost)Epilepsy GEFS

Page 45: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Gene

NTNM

records GeneUniGeneGene Model

GEFS Genome Maps

GEFS

Page 46: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Detection of 9 different point mutations of PCDH19 in 11 female patients by direct sequencing.

Sequence electropherograms of the mutations and the missense variant (c.3319C>G/p.Arg1107Gly) identified in association with the c.859G>T/p.Glu287X nonsense mutation.

The A of the ATG translation initiation codon in the reference sequence

Page 47: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

Alignment of the regions surrounding the mutations (indicated by an arrow) in orthologous and paralogous proteins,

showing the high conservation of each affected amino-acid in vertebrates and in the delta protocadherin paralogous genes.

Page 48: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.

FISH analysis of the gene deletion in the male patient showing somatic mosaicism in fibroblasts.

FISH analysis on PBL (C) and fibroblasts (D) of a female control. PCDH19-specific signals (red) are indicated by arrowheads.

A) Absence of the specific Xq22.1 probe site on metaphase chromosomes (PBL);

(B) In fibroblasts, presence of one hybridization spot in 53% of the cells and absence of signal in the remaining 47%;

Page 49: MOLECULAR DIAGNOSIS OF GENETIC EPILEPSY Nagi ALHaj Prof of Molecular Biology Assist, Faculty Medicine, Sana’a,University, Yemen Consultant of Genetic Center.