Molecular Phylogenetics and Evolution 35 (2005) 323–343 www.elsevier.com/locate/ympev 1055-7903/$ - see front matter 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2005.01.013 Molecular and morphological evolution of the amphipod radiation of Lake Baikal Kenneth S. Macdonald III a,¤ , Lev Yampolsky b , J. Emmett DuVy a a School of Marine Science and Virginia Institute of Marine Science, The College of William and Mary, Gloucester Pt., VA 23062-1346, USA b Department of Biological Sciences, East Tennessee State University, Johnson City, TN 37614-1710, USA Received 20 January 2004; revised 29 December 2004 Abstract Lake Baikal, in Siberia, Russia, contains the highest biodiversity of any extant lake, including an impressive radiation of gamma- roidean amphipods that are often cited as a classic case of adaptive radiation. However, relationships among Baikal’s amphipods remain poorly understood. The phylogenetic history of 32 Lake Baikal amphipod species, representing most major lineages of the endemic fauna, was examined using three genes (COI, 16S rRNA, and 18S rRNA), and 152 morphological characters. Results sup- port monophyly of the largest and most diverse of the Baikalian families, the Acanthogammaridae. Analyses suggest that a second Baikalian family, the fossorial Micruropodidae, is paraphyletic and composed of two divergent clades, one of which includes Macro- hectopus branickii, a morphologically specialized pelagic planktivore traditionally assigned its own family. The extreme morphologi- cal and ecological divergence of Macrohectopus from its close genetic relatives, and conversely, the large genetic distances among other morphologically similar micruropodids, suggest that morphological and molecular evolution have often been uncoupled dur- ing the radiation of Baikal’s amphipods. This study suggests that the amphipod fauna of Lake Baikal is polyphyletic; originating from two independent invasions of the lake. 2005 Elsevier Inc. All rights reserved. Keywords: COI; 16S rRNA; 18S rRNA; Morphology; Amphipoda; Lake Baikal; Gammaroidea 1. Introduction The Siberian Lake Baikal is the oldest lake in the world and has the most diverse fauna and the highest level of endemism of any extant lake (Kozhov, 1963; Martin, 1994). Lake Baikal is also the world’s deepest (1637 m maximum depth), and volumetrically largest lake, containing 20% of the planet surface’s liquid fresh water (Martin, 1994). Baikal likely originated around 72 million years ago (ma) as a series of scattered, shallow, marsh-like lakes. A permanent lake probably originated around 27 ma, but it was not until the last 3 ma that the lake substantially deepened and became the cold, extremely deep lacustrine environment that exists today (Mats et al., 2000). Baikal’s great age and geological iso- lation likely have been important in generating its impressive endemic fauna, which contains radiations from several disparate taxa, including the Cottoidei (sculpins), Ostracoda, Rhabdocoela and Tricladida (Xat- worms), Copepoda, Gastropoda, and Amphipoda (Bazi- kalova, 1945; Brooks, 1950; Kozhov, 1963; Martin, 1994; Sherbakov, 1999). Because of the great number of species (7265; Kam- altynov, 1999b), as well as their morphological and eco- logical diversity, amphipods are often considered the most remarkable of Lake Baikal’s radiations. The endemic Baikalian amphipods represent a substantial ¤ Corresponding author. American Museum of Natural History, Di- vision of Invertebrate Zoology, Central Park West @ 79th St. New York, NY 10024, USA. Fax: +1 212 769 5277. E-mail address: [email protected](K.S. Macdonald III).
21
Embed
Molecular and morphological evolution of the amphipod radiation of ...
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Molecular Phylogenetics and Evolution 35 (2005) 323–343
www.elsevier.com/locate/ympev
Molecular and morphological evolution of the amphipod radiation of Lake Baikal
Kenneth S. Macdonald III a,¤, Lev Yampolsky b, J. Emmett DuVy a
a School of Marine Science and Virginia Institute of Marine Science, The College of William and Mary, Gloucester Pt., VA 23062-1346, USAb Department of Biological Sciences, East Tennessee State University, Johnson City, TN 37614-1710, USA
Received 20 January 2004; revised 29 December 2004
Abstract
Lake Baikal, in Siberia, Russia, contains the highest biodiversity of any extant lake, including an impressive radiation of gamma-roidean amphipods that are often cited as a classic case of adaptive radiation. However, relationships among Baikal’s amphipodsremain poorly understood. The phylogenetic history of 32 Lake Baikal amphipod species, representing most major lineages of theendemic fauna, was examined using three genes (COI, 16S rRNA, and 18S rRNA), and 152 morphological characters. Results sup-port monophyly of the largest and most diverse of the Baikalian families, the Acanthogammaridae. Analyses suggest that a secondBaikalian family, the fossorial Micruropodidae, is paraphyletic and composed of two divergent clades, one of which includes Macro-hectopus branickii, a morphologically specialized pelagic planktivore traditionally assigned its own family. The extreme morphologi-cal and ecological divergence of Macrohectopus from its close genetic relatives, and conversely, the large genetic distances amongother morphologically similar micruropodids, suggest that morphological and molecular evolution have often been uncoupled dur-ing the radiation of Baikal’s amphipods. This study suggests that the amphipod fauna of Lake Baikal is polyphyletic; originatingfrom two independent invasions of the lake. 2005 Elsevier Inc. All rights reserved.
The Siberian Lake Baikal is the oldest lake in theworld and has the most diverse fauna and the highestlevel of endemism of any extant lake (Kozhov, 1963;Martin, 1994). Lake Baikal is also the world’s deepest(1637 m maximum depth), and volumetrically largestlake, containing 20% of the planet surface’s liquid freshwater (Martin, 1994). Baikal likely originated around 72million years ago (ma) as a series of scattered, shallow,marsh-like lakes. A permanent lake probably originated
¤ Corresponding author. American Museum of Natural History, Di-vision of Invertebrate Zoology, Central Park West @ 79th St. NewYork, NY 10024, USA. Fax: +1 212 769 5277.
1055-7903/$ - see front matter 2005 Elsevier Inc. All rights reserved.doi:10.1016/j.ympev.2005.01.013
around 27 ma, but it was not until the last 3 ma that thelake substantially deepened and became the cold,extremely deep lacustrine environment that exists today(Mats et al., 2000). Baikal’s great age and geological iso-lation likely have been important in generating itsimpressive endemic fauna, which contains radiationsfrom several disparate taxa, including the Cottoidei(sculpins), Ostracoda, Rhabdocoela and Tricladida (Xat-worms), Copepoda, Gastropoda, and Amphipoda (Bazi-kalova, 1945; Brooks, 1950; Kozhov, 1963; Martin,1994; Sherbakov, 1999).
Because of the great number of species (7265; Kam-altynov, 1999b), as well as their morphological and eco-logical diversity, amphipods are often considered themost remarkable of Lake Baikal’s radiations. Theendemic Baikalian amphipods represent a substantial
324 K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343
and distinctive portion of the superfamily Gammaroi-dea, a large, diverse, and cosmopolitan amphipod groupthat is ecologically important in fresh and coastal watersthroughout the northern hemisphere (Barnard and Bar-nard, 1983; BousWeld, 1977, 1982). The Baikalian gam-maroideans currently are divided into 51 genera and 265species (Kamaltynov, 1999b), although some speciesappear to be cryptic species complexes (Väinölä andKamaltynov, 1999). Baikal’s amphipod fauna comprisesover 40% of the world gammaroidean species, and itsspecies are extremely diverse morphologically, rangingfrom generalized forms (Fig. 1B), similar to the cosmo-politan freshwater genus Gammarus (Fig. 1F), to highlyarmored, processiferous forms (Fig. 1C), to a uniquelyspecialized pelagic gammaroidean (Fig. 1A). They arealso ecologically diverse, with benthic, fossorial, andnektonic forms, including the world’s only pelagic gam-maroidean (Freyer, 1991; Kozhov, 1963). In addition tothe benthic detritivore habit common among
gammaroideans and the pelagic planktivore, there arealso predators and parasites (Bazikalova, 1945; Freyer,1991; Kozhov, 1963).
Taxonomically, amphipods have a history of instabil-ity (BousWeld and Shih, 1994). In fact, the higher-levelrelationships within Amphipoda as a whole are so uncer-tain that several taxonomic treatments simply list fami-lies alphabetically (Barnard and Barnard, 1983; Barnardand Karaman, 1975; Martin and Davis, 2001). Especiallyproblematic are the amphipods of the superfamily Gam-maroidea, in which high morphological diversity, appar-ent morphological convergence of unrelated lineages insimilar environments (e.g., fossorial amphipods), andevolutionary plasticity of many characters lead to greatdiYculties in identiWcation of homology (Barnard andBarnard, 1983; Barnard and Karaman, 1975; BousWeld,1977; Pinkster, 1983). The Baikal amphipods in particu-lar are by far the most morphologically diverse gamma-roideans (BousWeld, 1982; Brooks, 1950; Kozhov, 1963),
Fig. 1. Representatives from the three major lineages (Kamaltynov, 1999b) of Baikalian amphipods and a Eurasian Gammarus species. (A) Macro-hectopus branickii (Macrohectopidae). (B) Eulimnogammarus cruentus (Acanthogammaridae). (C) Acanthogammarus grewingkii (Acanthogammari-dae) (D). Micruropus wahli (Micruropodidae) (E). Crypturopus pachytus (Micruropodidae) (F). Gammarus duebeni (Gammaridae) (A, C, E modiWedfrom Barnard and Barnard, 1983).
K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343 325
consequently there has been much contention concern-ing their classiWcation and phylogenetic relationships(Barnard and Barnard, 1983; Bazikalova, 1945; Bous-Weld, 1977; Kamaltynov, 1999a,b). Thus, the taxonomichistory of the Baikal amphipods is long, unstable, andcurrently not well resolved.
The most recent classiWcation of Baikal’s amphipodsis by Kamaltynov (1999b), who placed all Baikal amphi-pods into the superfamily Gammaroidea, and assignedthem to four families. The largest family is the endemicAcanthogammaridae. Whereas this family historicallywas restricted to the characteristic armored amphipods(Bazikalova, 1945; BousWeld, 1977, 1982; Kamaltynov,1992), Kamaltynov’s diagnosis of Acanthogammaridaenow includes smooth-bodied, generalized amphipodswith elongate antennae and pereopods and a dominantWrst gnathopod (see Fig. 1B), as well as the armored, car-inate and/or processiferous amphipods, considereduniquely Baikalian (Fig. 1C). Unfortunately, there seemto be no diagnostic characters for Acanthogammaridaein this conception. Kamaltynov (1999b, p. 935) simplystated that this family is ‘Distinguished from all othergammaroideans by high development and morphologi-cal diversity of body processes and body appendages.’The second Baikalian family is Micruropodidae. Theseamphipods are smooth-bodied, small, compact withshortened antennae, and pereopods, apparently adaptedto their fossorial (burrowing) lifestyle (Figs. 1D and E).The third family, Macrohectopidae, is monotypic, com-prising the species Macrohectopus branickii. This bizarrespecies is highly modiWed for a strictly pelagic lifestyle,with a streamlined body and elongated appendages (Fig.1A). The fourth family is Pachyschesidae, a small groupcontaining 16 species that are commensals or parasites inthe marsupia of larger amphipods.
Only in the last several years have molecular studiesattempted to address the phylogeny of the major amphi-pod groups within Lake Baikal. Ogarkov et al. (1997)examined phylogenetic relationships among selectedBaikal gammaroideans using the mitochondrial cyto-chrome c oxidase subunit III (COIII) gene. They focusedon two genera, namely Pallasea, an acanthogammarid,and Eulimnogammarus, at the time considered a memberof the widespread family Gammaridae, but they did notinclude any non-Baikalian outgroups. Phylogenetic reso-lution was poor but the study did suggest that the familyAcanthogammaridae (at the time comprising only thearmored amphipods) was not monophyletic. A subse-quent study by Sherbakov et al. (1998) examined thephylogeny of 18 selected amphipod taxa from Lake Bai-kal by sequencing a segment of the 18S rRNA gene.Their resultant phylogenetic hypothesis contained only asingle well supported clade, unexpectedly uniting theunique, pelagic Macrohectopus branickii with Gammaruspulex, a morphologically generalized freshwater amphi-pod found through much of Europe. Finally, the most
recent study was an update by Sherbakov et al. (1999),reexamining their previous 18S rRNA sequences andadding preliminary cytochrome c oxidase subunit I(COI) data. Their results were little changed from the1998 paper, except to suggest that several of the generawithin Lake Baikal (Acanthogammarus, Pallasea) maynot be monophyletic. Unfortunately, no molecular studyto date has produced suYcient resolution or support toelucidate either relationships within and among the fam-ilies of amphipods in Lake Baikal, or the origin of Bai-kal’s fauna by including data on relevant outgroup taxa.
A question of more general interest to evolutionarybiology is how many invasions from nearby waters gaverise to the radiation of the current Baikalian amphipodfauna. It is universally accepted that Baikal’s amphipodsresulted from multiple invasions, and past estimatesrange from four to more than 18 (Barnard and Barnard,1983; BousWeld, 1977, 1982; Brooks, 1950; Kamaltynov,1992, 1999a; Kozhov, 1963; Ogarkov et al., 1997; Sher-bakov, 1999; Sherbakov et al., 1998). However, theseestimates have never been tested through rigorous phy-logenetic analysis. Additionally, no studies on Baikal’samphipods have been conducted that combine morpho-logical characters with molecular sequences in a cladisticframework. In this study, we examine the phylogeneticrelationships among most major lineages of Baikalianamphipods using molecular data from portions of threegenes and 152 morphological characters.
2. Materials and methods
2.1. Sampling
We sequenced portions of the mitochondrial 16SrRNA and cytochrome c oxidase subunit I (COI) genes,and two portions of the nuclear 18S rRNA gene, one atthe 5� end and the other at the 3� end of the gene, for 62amphipod species from Lake Baikal, northern Europe,the Ponto-Caspian region, and North America (Table 1).Additionally, 152 morphological characters for thesesame species were scored. Species were chosen to sampleas broadly as possible the great diversity of Baikal’samphipods, and included several representative generafrom each of Kamaltynov’s (1999b) hypothesized fami-lies, except for the small, parasitic family, Pachyschesi-dae, which we were unable to obtain. Additionally, non-Baikalian gammaroidean amphipods were sampled,including several Gammarus and Chaetogammarus spe-cies (Gammaridae) from Eurasia and North America,species from the Caspian and Black Seas (Pontogam-maridae), and members of Anisogammaridae, a familyfound exclusively along the PaciWc Rim, to assist in clar-ifying the origin of Baikal’s fauna.
The uncertainty of higher-level amphipod systematicsmakes the selection of an appropriate outgroup diYcult.
326 K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343
Table 1List of all species sequenced, sorted by taxonomic family (Kamaltynov, 1999a, 1999b), with sampled location and Genbank Accession numbers forall genes
Collecting locality Accession Nos.
COI 16S 18S-1 18S-3Gammaroidea
AcanthogammaridaeAbludogammarus Xavus Listvyanka, Lake Baikal — AY926692 AY926752 AY926814Abyssogammarus gracilis Listvyanka, Lake Baikal — AY926693 AY926753 AY926815Acanthogammarus brevispinus OV Selenga Delta, Lake Baikal AY926651 AY926694 AY926754 AY926816Acanthogammarus victorii Ushkani, Lake Baikal AY926652 AY926695 AY926755 AY926817Brandtia lata Bolshoi Kotoye, Lake Baikal AY926654 AY926698 AY926758 AY926820Eulimnogammarus cruentus Bolshoi Kotoye, Lake Baikal AY926661 AY926709 AY926769 AY926831Eulimnogammarus inconspicuous Bolshoi Kotoye, Lake Baikal AY926662 AY926710 AY926770 AY926832Eulimnogammarus maacki Ushkani, Lake Baikal AY926663 AY926711 AY926771 AY926833Eulimnogammarus testaceus Olkhon, Kurkutskaya, Lake Baikal — AY926712 AY926772 AY926834Eulimnogammarus verrucosus Olkhon, Khorgojskaya, Lake Baikal — AY926713 AY926773 AY926835Eulimnogammarus viridis Bolshoi Kotoye, Lake Baikal AY926664 AY926714 AY926774 AY926836Eulimnogammarus viridulus Ushkani, Lake Baikal AY926665 AY926715 AY926775 AY926837Eulimnogammarus vittatus Olkhon, Khorgojskaya, Lake Baikal AY926666 AY926716 AY926776 AY926838Hakonboekia strauchi Olkhon Gates, Baikal AY926676 AY926731 AY926792 AY926853Odontogammarus calcaratus Listvyanka, Lake Baikal AY926685 AY926739 AY926801 AY926862Ommatogammarus albinus Ushkani, Lake Baikal AY926686 AY926740 AY926802 AY926863Pallasea cancelloides Ushkani, Lake Baikal — AY926741 AY926803 AY926864Pallasea cancellus Olkhon, Kharin-Irgi, Lake Baikal AY926687 AY926742 AY926804 AY926865Pallasea grubei Maloye More, Lake Baikal AY926688 AY926743 AY926805 AY926866Pallasea viridis Olkhon, Kharin-Irgi, Lake Baikal — AY926744 AY926806 AY926867Parapallasea borowskii Ushkani, Lake Baikal — AY926745 AY926807 AY926868Plesiogammarus brevis OV Selenga Delta, Lake Baikal AY926689 AY926746 AY926808 AY926869Poekilogammarus pictoides Olkhon Gates, Baikal AY926690 AY926747 AY926809 AY926870
MacrohectopidaeMacrohectopus branickii Bolshoi Kotoye, Lake Baikal AY926677 AY926732 AY926793 AY926854
GammaridaeChaetogammarus marinus Bergin, Norway AY926655 AY926700 AY926760 AY926822Chaetogammarus obtusatus Novia Scotia, CA AY926656 AY926701 AY926761 AY926823Chaetogammarus stoerensis Maine, USA AY926657 AY926702 AY926762 AY926824Gammarus aequicauda Black Sea AY926667 AY926718 AY926778 AY926840Gammarus annulatus Massachusetts, USA AY926668 AY926719 AY926779 AY926841Gammarus balcanicus Alma-Ata, Kazahstan — AY926720 AY926780 AY926842Gammarus duebeni Maine, USA AY926669 — AY926781 AY926843Gammarus fasciatus Washington DC, USA — AY926721 AY926782 AY926844Gammarus lacustris BK Olkhon Island, Lake Baikal AY926671 AY926723 AY926784 AY926846Gammarus lacustris HV Lake Hovsgol, Mongolia AY926670 AY926722 AY926783 AY926845Gammarus lacustris VI Vancouver Island, CA AY926672 AY926724 AY926785 AY926847Gammarus lacustris WA Washington, USA AY926673 AY926725 AY926786 AY926848Gammarus locusta RoscoV, FR — AY926726 AY926787 AY926849Gammarus mucronatus Chesapeake Bay, USA — AY926727 AY926788 AY926850Gammarus oceanicus Massachusetts, USA AY926674 AY926728 AY926789 AY926851Gammarus pseudolimnaeus Virginia, USA — AY926729 AY926790 —
AnisogammaridaeEogammarus confervicolus Columbia River, Washington, USA AY926659 AY926707 AY926767 AY926829Eogammarus oclairi Vancouver Island, CA AY926660 AY926708 AY926768 AY926830Ramellogammarus vancouverensis Vancouver Island, CA — AY926751 AY926813 AY926874
K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343 327
Thus, a range of non-gammaroidean species were sam-pled as potential outgroups. Some of these were mem-bers of the family Gammaridae before BousWeld’s (1977,1982) revision. These include Melita nitida and Megom-aera subtener, two members of the family Melitidae, andCrangonyx serratus, a member of the family Cran-gonyctidae, often considered one of the oldest freshwateramphipod groups. Other sampled taxa have historicallybeen considered more distantly related. These includeMonoporeia aYnis, a freshwater pontoporeid fromEurope, the marine amphipod Gammarellus angulosus,which Barnard and Barnard (1983) suggested may havean aYnity to Macrohectopus branickii, although thishypothesis has not been mentioned elsewhere, andAmpithoe longimana, a marine ampithoid from theAtlantic. Voucher specimens of all sampled species willbe deposited in the American Museum of Natural His-tory in New York and in the National Museum of Natu-ral History in Washington, DC.
The amphipods of Lake Baikal were collected usingdipnets on sublittoral cobble shorelines; by hand and netfrom large rubble and associated aquatic sponges usingSCUBA; by bottom dredging at depths of 30–90 m; witha spotlight and plankton net at night; and using meat-baited traps at depths of 25–100 m. Most non-Baikalianamphipods were collected by dipnetting in nearshoreaquatic vegetation. Specimens were collected from Bai-kal in the summers of 1995 and 2002, Moscow in 1998,the Caspian and Black Seas in 1999, and from NorthAmerica from 1997 through 2003, and were preservedand stored in 95% EtOH or in Vodka.
2.2. Molecular methods
DNA was isolated from all specimens using QIA-amp or DNeasy (Qiagen, Valencia, California) tissuepreparation kits. Primers for ampliWcation are listed inTable 2.
AmpithoidaeAmpithoe longimana Chesapeake Bay, USA AY926653 AY926697 AY926757 AY926819
Table 2Primers used for ampliWcation and sequencing in this study
Primer Sequence (5�–3�) Source
18S rRNA18SF CCTAYCTGGTTGATCCTGCCAGT Englisch et al. (2003)18S700R CGCGGCTGCTGGCACCAGAC Englisch et al. (2003)18S1500R CATCTAGGGCATCACAGACC Englisch et al. (2003)18SR TAATGATCCTTCCGCAGGTT Englisch et al. (2003)
16S rRNA16STf GGTAWHYTRACYGTGCTAAG Developed by author (K.S.M.)16Sbr CCGGTTTGAACTCAGATCATGT Palumbi et al. (1991)
COIHCO2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994)LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994)
328 K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343
Typical 50�l PCRs for the 16S rRNA and COIsequences contained 5 �l 10£ PCR buVer, 2 mM (2 �l)MgCl2, 0.2 mM (2 �l) dNTP mixture (Sigma), 10�M(0.5�l) of each primer, 1 U (0.25 �l) Amplitaq DNApolymerase (Perkin-Elmer, Foster City, California), and1 �l template DNA solution. Reactions were cycled on aMJResearch PTC200 thermocycler, and started with a4 min denaturing step at 95 °C, followed by 40 cycles ofthe following reaction: 95 °C for 1 min, 45 °C for 1 min,and 72 °C for 2 min 30 s. Reactions Wnished with a single72 °C, 7 min elongation step. PCR products were cleanedusing Wizard PCR Preps (Promega, Madison, WI).Gene segments were sequenced using Sequenase 2.0 kits(Epicenter), and were run through 5 1/2% Long Rangeracrylamide gels (FMC Bioproducts, Rockland, ME) ona LI-COR DNA4200L automated DNA sequencer.
18S rRNA gene fragments were ampliWed withReady-To-Go PCR beads (Amersham–Pharmacia Bio-tech, Piscataway, NJ) with 0.5�l of each 10 �M primer,1 �l of template solution, and 23 �l H2O. Reactions werecycled on a GeneAmp PCR System 9700 (PE AppliedBiosystems), with an initial 5 min denaturing step at95 °C, followed by 35 cycles of the following reaction:95 °C for 20 s, 50 °C for 20 s, and 72 °C for 45 s. ReactionsWnished with a single 72 °C, 7 min elongation step.AmpliWcation products were puriWed using QIAquickPCR PuriWcation Kits (Qiagen). Each sequencing reac-tion mixture included 2�l BigDye (Applied Biosystems,Perkin-Elmer), 2 �l of 1�M primer, and 5 �l DNA tem-plate, and ran for 40 cycles of 96 °C (10 s), 50 °C (10 s),and 60 °C (4 min). Sequencing products were puriWed by70% isoproponal/70% ethanol precipitation and wererun on an ABI Prism 3700 sequencer (Applied Biosys-tems).
2.3. Morphological methods
We chose and scored 152 morphological charactersfor 62 taxa (see Appendix A for character list). Charac-ter states were scored by a single worker (KSM) byexamination of a minimum of three male specimens perspecies, where possible (see Appendix B for data matrix).Nine characters were found to be autapomorphic. Asthese characters may become informative with the futureaddition of taxa, they were retained. All characters weretreated as unordered, thus character state does not implypolarity.
2.4. Phylogenetic analysis
Sequences were edited using CodonCode Aligner(http://www.codoncode.com/aligner/). 16S rRNA and18S rRNA sequences were aligned with BioEdit (IsisPharmaceuticals), which aligns using the ClustalW pro-gram (Thompson et al., 1994) using the following gapopening/extensions costs: 10/5; 10/1; 5/5; 5/1; 2/2; 2/1.
COI sequences were conserved in length and required noinsertion/deletion events (indels). Phylogenetic hypothe-ses of relationships among taxa were constructed byanalyzing the aligned nucleic acid sequences using parsi-mony and maximum likelihood in PAUP* (SwoVord,2002), and Bayesian inference in MrBayes v3.01 (Huel-senbeck, 2000; Ronquist and Huelsenbeck, 2004). Indelswere considered missing data in all analyses. First, eachdataset (three gene segments and the morphologicaldata) was analyzed separately. Next, the three moleculardatasets were analyzed together using both parsimonyand likelihood. Finally, the molecular and morphologi-cal data were used in combined-data parsimony andBayesian analyses.
All parsimony analyses assumed equal weights for allcharacter changes, and used the heuristic search optionwith 100 random addition replicates and TBR branchswapping in PAUP*. The likelihood analysis used theGTR + � + I model, which was determined to be thebest-Wt model using the Akaike information criterion(AIC) in Modeltest (Posada and Crandall, 1998). Thelikelihood analysis was conducted using the heuristicsearch option in PAUP* and a single stepwise additionstarting tree. Because a single replicate random additionsequence took over one week of computation time usinga 1.5 GHz PowerBook G4, we were not able to performmore replicates. Two Bayesian MCMCMC (Metropolis-coupled Markov chain Monte Carlo) searches were runwith four simultaneous chains for 5,000,000 and10,000,000 generations, respectively, sampling every1000 chains (for a total of 5000 and 10,000 sampledtrees, respectively). For the Bayesian analysis, theGTR + � + I model was used for the molecular data,with parameter values determined independently foreach gene, while the Mk model of Lewis (2001) was usedfor the morphological data. Stationarity in the Bayesiananalyses was determined by plotting ln L, �, m, and arange of substitution parameters for all partitions versusgeneration (as suggested by Nylander et al., 2004) andexamining for leveling of values. These same parameterswere also plotted separately for all eight chains to ensurechain convergence. Using this criterion, stationarity wasreached by the 30,000th tree (the 30th saved tree), for theWrst run, and the 110,000th tree (110th saved tree) for thesecond. Convergence of all chains for both runs was alsoreached by the 30th and 110th saved trees, respectively.Giving a small margin for error, trees 50–5000 from theWrst search and trees 120–10,000 from the second searchwere used to construct separate 50% majority-rule con-sensus tree, and were combined in a single majority-ruleconsensus tree.
For parsimony and likelihood analyses, non-paramet-ric bootstrap support values for clades were obtainedusing the heuristic bootstrap search command (with1000 parsimony and 100 likelihood pseudoreplicates) inPAUP*. Bremer support values (Bremer, 1988, 1994) for
K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343 329
the parsimony analyses were calculated using the pro-gram TreeRot (Sorenson, 1999).
Monophyly of the Baikal amphipods as a whole, thefamilies Micruropodidae and Acanthogammaridae, andseveral of the well-sampled genera were examined usingthe molecular data and the SH (Shimodaira and Hase-gawa, 1999) test as implemented in PAUP*.
3. Results
Parsimony analyses of the 16S rRNA and 18S rRNAgene segments indicate that both datasets were robust tochanges in alignment parameters. Analyses of the sixdiVerent aligned datasets produced almost identicaltrees. The few diVerences between these trees were inpoorly supported nodes. As there was no objective justi-Wcation for choosing any particular set of alignmentparameters, we chose to use the 5/1 (gap opening/gapextension) alignment. After alignment, the COI datasetconsisted of 709 bp (of which 354 were parsimony infor-mative and 294 were constant), the 16S rRNA consistedof 621 bp (326 parsimony informative, 211 constant), the5� 18S rRNA gene portion consisted of 867 bp (145 par-simony informative, 646 constant), and the 3� 18S rRNAgene portion consisted of 922 bp (192 parsimony infor-mative, 627 constant).
The trees resulting from the analyses of individual genes(not shown) were generally in agreement, and did not dis-agree on any node with bootstrap support >50% orBremer support >2. There were also no well-supportednode diVerences between any single-gene tree and the com-bined molecular data tree. The parsimony analysis of com-bined molecular data resulted in seven most parsimonioustrees (strict consensus presented in Fig. 2A) with a lengthof 6668 steps. The likelihood analysis of the same dataresulted in a single most likely tree, with ¡lnLD31790.87614 (Fig. 3). The results of both analyses sharemany points of agreement, although an SH test comparingthe seven parsimony derived trees and the likelihood treeindicated that the likelihood topology was signiWcantlymore likely to give rise to the data than any of the parsi-mony topologies (with p values ranging from 0.031 to0.042), while the likelihood topology required 34 additionalsteps compared to the most parsimonious trees. Neitheranalysis supports monophyly of the Baikal amphipods,since some members of the genus Gammarus are nestedwithin the Baikal clade. The most likely tree with a mono-phyletic Baikal clade is not signiWcantly less likely than theunconstrained most-likely tree using the SH test(pD0.053), although this comparison is only marginallynon-signiWcant, and only Wve additional steps are requiredfor a parsimony tree containing a monophyletic Baikalfauna. Within the Baikal fauna, both parsimony and likeli-hood analyses support the monophyly of the morphologi-cally diverse family Acanthogammaridae (as designated by
Kamaltynov, 1999b), although this is not signiWcantaccording to the SH test (bootstrapD96%, BremersupportD16 for parsimony analysis, likelihoodbootstrapD100%, SH test pD0.10). In contrast to the con-sistent support for monophyly of Acanthogammaridae,both parsimony and ML analyses Wnd the morphologicallymore homogeneous family Micruropodidae to be para-phyletic, showing strong support for inclusion in this cladeof Macrohectopus branickii, the sole member of the familyMacrohectopidae. Constraining a monophyletic Micruro-podidae adds 30 steps to the parsimony analysis, and yieldsa signiWcantly less likely tree according to a SH test(pD0.001). One potential diVerence between the parsi-mony and ML analyses regards the relationship of the Bai-kal amphipods to the cosmopolitan freshwater genusGammarus. The parsimony analysis unites two Gammarusspecies, the Holarctic G. lacustris and the North AmericanG. pseudolimnaeus, with the micruropodid/Macrohectopusclade, albeit with little support, while uniting the remainingGammarus species with the Baikalian acanthogammarids.The likelihood analysis, in contrast, unites all the sampledGammarus species with the micruropodid/Macrohectopusclade, although Gammarus remains paraphyletic. WithinMicruropodidae–Macrohectopidae, both analyses supporttwo distinct groups, henceforth referred to as the Gmelino-ides-group (parsimony bootstrap and Bremer support val-ues of 95% and 10, respectively, likelihood bootstrapD77%) and the Crypturopus-group (76% and 4 for parsi-mony, 73% for likelihood), the latter including Macrohec-topus. These two groups are sister to each other, but arehighly divergent when compared to other Baikaliangroups, with uncorrected-parameter distances based on16S rRNA data between these two micruropodid groups(0.16–0.27) similar to distances between each group and theAcanthogammaridae (0.17–0.32 between the Acanthogam-maridae and Gmelinoides-group, 0.18–0.32 between theAcanthogammaridae and Crypturopus-group). The pelagicMacrohectopus is strongly supported as a member of thepredominantly fossorial Crypturopus-group. A tree with-out a monophyletic Crypturopus-group+Macrohectopusrequires an additional four steps, and is signiWcantly lesslikely according to the SH test (pD0.033). Additionally,neither the parsimony nor the likelihood analysis supportsthe monophyly of the armored Baikal amphipods (dashedlines in Figs. 2 and 3).
Finally, both parsimony and ML analyses of themolecular data support polyphyly of several generawithin the Baikal fauna. The genus Micruropus is one ofthese, with members in both the Gmelinoides-group andthe Crypturopus-group (31 additional steps required formonophyly and p < 0.001 in the SH test). The genusPallasea is also polyphyletic, with Pallasea cancellusdistantly related to the other members of the genus(16 steps required for monophyly, but results of theSH test are not signiWcant, with p D 0.482). Overall,there is little support for most clades within the family
330 K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343
Acanthogammaridae, with only Wve clades (out of 21)exhibiting bootstrap support values >50%.
Parsimony analysis of the morphological data (143parsimony informative characters) resulted in four mostparsimonious trees with a length of 1209 (Fig. 2B; see
Appendix B for character state matrix). These treesgreatly diVer from those of both molecular data analy-ses. Notably, the morphological analysis does not sup-port a monophyletic Acanthogammaridae. Nor does itsupport a monophyletic Baikal fauna, but instead
Fig. 2. A. Strict consensus of seven most parsimonious trees (tree length D 4022) from analysis of all molecular data (16S rRNA, 18S rRNA, andCOI). B. Strict consensus of four most parsimonious trees from analysis of 152 morphological characters (tree length D 1209). Numbers abovebranches are bootstrap values (1000 pseudoreplicates), and those below branches are Bremer branch support values. Boxes enclose all sampled Bai-kal amphipods. Each box encloses a monophyletic group and is labeled with family designation, based on Kamaltynov (1999b). Black vertical line toright of species names unites BousWeld’s (1978, 1928) Gammaroidea. Dashed branches denote armored/processiferous lineages.
K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343 331
includes a clade comprising most of the Baikalian fauna(with the lone exception being P. rotundatulus) with thePonto-Caspian family Pontogammaridae. The morpho-logical analysis also does not support the monophyly ofthe processiferous Baikal gammaroideans, although onlyHakonboekia strauchi is excluded. However, it does showa monophyletic Micruropodidae with the exception ofPseudomicruropus rotundatulus, which has a basal posi-tion in the morphological analysis. Overall, most cladesdiVering between the morphological and molecular
topologies are poorly supported, and the morphologicalanalysis generally exhibits poor support, with only 10nodes having bootstrap support values >50%, and only 5nodes with bootstrap support values >75%.
Combining the morphological and molecular data in aparsimony analysis yields a single tree with a length of8017 steps (Fig. 4). Majority-rule consensus trees result-ing from the two Bayesian analyses of the entire datasetwere identical, with almost identical posterior probabili-ties (three probabilities diVered by a maximum of 0.02),
Fig. 2. (continued)
332 K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343
thus the topology and posterior probabilities from themajority-rules consensus tree of all 14,850 trees were used(Fig. 5). Both parsimony and Bayesian analyses of thecombined dataset strongly support a monophyleticAcanthogammaridae (100% bootstrap and Bremer sup-port of 22 for the parsimony analysis, Bayesian posteriorprobability of 1.00), and a monophyletic micruropodid/
Macrohectopus clade (82% bootstrap, 11 Bremer support,1.00 posterior probability) composed of two monophy-letic groups. Both analyses also show Gammarus lacustrisand G. pseudolimnaeus as sister to the micruropodid/Macrohectopus clade. A diVerence between the parsimonyand Bayesian combined data analyses is the placement ofthe remaining Gammarus species, which are sister to the
Fig. 3. Single best tree (¡ln L D 31790.87614) from likelihood analysis of all molecular data (16SrRNA, 18SrRNA, COI). Numbers above branchesare bootstrap values (100 pseudoreplicates). Brackets enclose two distinct, reciprocally monophyletic micruropodid groups found in this study. Othersymbols as in Fig. 2. The extraordinarily long branch uniting Megomaera subtener and Melita nitida was shortened by 50% (denoted by //) to allowbetter visualization of branch lengths for the rest of the tree.
K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343 333
G. lacustris/micruropodid clade in the Bayesian analysis,and are sister to the acanthogammarid/G. lacustris /micruropodid clade in the parsimony analysis. However,the placement of these taxa is not well supported in eitheranalysis. There are also diVerences between the Bayesianand parsimony analyses in the relationships within theBaikalian families, but they are all on nodes that arepoorly supported in the parsimony tree.
The addition of the morphological data increases sup-port for many clades over values found in the molecularparsimony analysis. Of clades with bootstraps >60% andBremer values 73 in the molecular analysis, all werepresent and supported in the combined-data parsimony
analysis, with 17 clades showing increased support and 8clades showing decreased support. Additionally, 5 cladesthat were present but poorly supported (<50% bootstrapand <3 Bremer value) in the molecular analysisincreased support in the combined data analysis.
4. Discussion
4.1. Phylogeny of Acanthogammaridae
Our analyses provide the Wrst rigorous support formonophyly of the diverse, Baikalian endemic amphipod
Fig. 4. Single most parsimonious tree (tree length D 8017) from combined analysis of all data (16S rRNA, 18S rRNA, COI, and morphology). Num-bers above branches (or numbers before “/” for short branches) are bootstrap values (1000 pseudoreplicates), and those below branches (or after “/”for short branches) are Bremer branch support values. Other symbols as in Fig. 3.
334 K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343
family Acanthogammaridae as deWned by Kamaltynov(1999b). Many of the taxa within this recently redeWnedfamily historically have been classiWed in diVerent fami-lies due to their highly divergent morphologies (Kamal-tynov, 1999a,b). Kamaltynov’s inclusion of manysmooth-bodied, morphologically generalized amphipodsin a family that was once primarily diagnosed by armoror large processes seems mostly a response to prelimi-nary molecular data that showed little genetic diVerenti-ation between armored and non-armored Baikalianspecies (Sherbakov et al., 1998, 1999). In fact, Kamalty-nov (1999b) listed no diagnostic characters for Acantho-
gammaridae, which he deWned as consisting of Baikalamphipods that are neither small and smooth-bodiedfossorial forms (Micruropodidae), nor streamlined withelongated appendages built for a pelagic lifestyle (i.e.,Macrohectopus). Our analysis also has not identiWeddiagnostic morphological characters for Acanthogam-maridae. Despite the lack of clear morphological syna-pomorphies, however, Acanthogammaridae as deWnedby Kamaltynov (1999b) was strongly supported as a nat-ural taxonomic group in the parsimony and Bayesiananalyses. This suggests that the amazing diversity inbody form and ecology within this endemic family
Fig. 5. Majority rules consensus tree of 14,850 trees resulting from Bayesian analysis of combined molecular and morphological data. Values abovebranches are Bayesian posterior probabilities (%). Other symbols as in Fig. 3.
K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343 335
diversiWed from a single ancestral lineage. As all of themany species are restricted to Lake Baikal and its water-shed, this spectacular radiation presumably occurredwithin the lake.
Unfortunately, despite application of three gene seg-ments totaling more than 3100 bp and 143 informativemorphological characters, little resolution or supportwas found among lineages within Acanthogammaridae.This is likely due to the many short internal branchesuniting the species in this family, coupled with propor-tionally long terminal branches (see likelihood analysis,Fig. 3), a pattern similar to those found in several otherdiverse taxa such as African cichlids (Sturmbauer et al.,1994), saxifragalean plants (Fishbein et al., 2001), NewWorld warblers (Lovette and Bermingham, 1999), andsnapping shrimp (Morrison et al., 2004). A combinationof short internal and long terminal branches has oftenbeen interpreted as indicative of an ancient rapid radia-tion (Donoghue and Sanderson, 1992), and departuresfrom null model expectations in several of the foregoingexamples support this conclusion. It is tempting toascribe the similar pattern in Baikal’s amphipods to arapid ancient radiation as well, although our incompletesampling of the lake’s tremendous species diversityadvises caution. If Acanthogammaridae indeed divergedanciently and rapidly, relationships within this familymay never be fully resolved.
The most morphologically generalized of Baikal’samphipod lineages, the genus Eulimnogammarus, ismonophyletic with low internal support in all parsimonyanalyses, and relationships within the genus were almostcompletely unresolved in our analysis of morphologicaldata. Our Bayesian analysis does show high posteriorprobability values for relationships within this genus, butvalues such as these are generally acknowledged to besometimes unreasonably large (Cummings et al., 2003;Douady et al., 2003; Erixon et al., 2003; Huelsenbecket al., 2002; Suzuki et al., 2002). The processiferous genusPallasea is a well-supported clade in all analyses, with theexception of Pallasea cancellus (the type species of thegenus), which falls well outside the rest of the genus.Sequencing of multiple P. cancellus individuals veriWedthis unexpected result. The outlier status of P. cancellus issupported by the morphological data as well (Fig. 2B),with 22 characters uniting the rest of the Pallasea speciesto the exclusion of P. cancellus. All analyses show a non-monophyletic armored Baikal fauna, albeit withgenerally low support. These results suggest that theexaggerated body processes characteristic of manyendemic Baikalian amphipods may have evolved orbeen lost in parallel multiple times within the lake, con-sistent with opinions held by some previous researchers(Kamaltynov, 1999a), and recalling the parallel evolu-tion characteristic of several other adaptive radiationssuch as those of the African cichlids (Kocher et al.,1993).
4.2. Phylogeny of Micruropodidae
The second major family of endemic Baikalian gam-maroideans in Kamaltynov’s (1999b) classiWcation is thetaxonomically diverse but morphologically rather uni-form Micruropodidae. This new family, consisting mostlyof burrowers in sediments, was proposed largely on thebasis of preliminary molecular studies and older immu-nological work (Kamaltynov, 1999b), yet its membershave long been considered to have a close aYnity (Bar-nard and Barnard, 1983; Bazikalova, 1945). Despite theirmorphological uniformity and fossorial habit and body-form, our analysis indicates that Micruropodidae is para-phyletic, containing the morphologically divergent,pelagic species Macrohectopus branickii, and that eventhe type genus Micruropus is polyphyletic. Micruropodi-dae consists of two distinct, reciprocally monophyleticgroups: the Gmelinoides-group (Gmelinoides fasciatus,Micruropus crassipes, M. glaber, M. wahli), and the Cryp-turopus-group (Crypturopus pachytus, Carinogammarussp., Macrohectopus branickii, Micruropus Wxseni, andPseudomicruropus rotundatulus). These clades are highlydivergent, with between-group distances comparable todistances between each group and the family Acantho-gammaridae. Despite this level of divergence, all analysesstrongly support monophyly of the micruropodid/Mac-rohectopus clade, as well as both the Crypturopus-groupand Gmelinoides-group. Our results suggest a deep diver-gence within Micruropodidae, and that the commonancestor of this fossorial family also gave rise to the mor-phologically divergent pelagic Macrohectopus branickii.
While the molecular divergence of the two micruropo-did clades may roughly equal their respective divergencesfrom Acanthogammaridae, micruropodids have notdiversiWed morphologically to nearly the same extent asthe latter taxon. Members of the Gmelinoides-group andthe Crypturopus-group are morphologically very similar,as reXected in the parsimony analysis of the morphologi-cal data (Fig. 2B), yet are genetically diverse, with geneticdistances ranging from 16 to 27%. In contrast, distancesbetween the genus Eulimnogammarus and the genusAcanthogammarus range from 13 to 17% yet these twogenera are morphologically highly distinct (Figs. 1B andC; 2B). The apparent morphological stasis in the micruro-podid species may result from their predominantly fosso-rial (burrowing) lifestyle, and its probable constraints ontheir morphology—short, compact bodies and append-ages, and numerous setae. This explanation is supportedby the main exception within the group, the pelagicplanktivore Macrohectopus. Although Macrohectopus isstrongly supported as a member of the Crypturopus-group, it is one of the few within the Micruropodidae tohave completely given up the fossorial lifestyle. Probablynot coincidentally, it is also drastically diVerent morpho-logically from the rest of the micruropodids (Fig. 1),retaining only the setation characteristic of this group,
336 K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343
which also may be beneWcial for a pelagic lifestyle. Inter-estingly, even some of the burrowing species are some-times found in the water column. Micruropus wahli, whichsuspension feeds from burrows in muddy substrate, wascaught in large quantities in surface waters swarmingaround a light at night. Some (Barnard and Barnard,1983; Kamaltynov, 1999b) have considered micruropod-ids to be the ‘Baikalian analogue’ in morphology to Pon-togammarus, a predominantly burrowing genus in thePonto-Caspian region. Yet these groups are undoubtedlynot closely related (with 79 additional steps required formonophyly using the molecular data, and 74 requiredusing all data), further supporting the idea that the rela-tively homogeneous morphology of micruropodids hasbeen shaped by their fossorial lifestyle.
4.3. Phylogeny of the Lake Baikal fauna
None of our analyses supported monophyly of theBaikal amphipod fauna as a whole, yet nowhere wasoverwhelming evidence against Baikal monophyly. Non-monophyly of the Baikal fauna would not be unex-pected, for it has been generally believed that this faunaconsists of multiple lineages (Bazikalova, 1945; Bous-Weld, 1977; Kamaltynov, 1999b; Kozhov, 1963). Addi-tionally, a close relationship between a member of thegenus Gammarus and the micruropodid/Macrohectopusclade recalls the similar results of Sherbakov et al.(1998), who found a close relationship between Macro-hectopus and Gammarus pulex (they included no otherCrypturopus-group amphipod, nor G. lacustris, in theiranalyses). Thus, this study suggests that the Baikal faunais polyphyletic, consisting of two lineages, one consistingof Acanthogammaridae, and the other consisting ofMicruropodidae (including Macrohectopus).
Relationships within both Micruropodidae andAcanthogammaridae support the conclusion that molec-ular and morphological evolution became uncoupledduring the radiation of the Baikalian amphipods. Theapparent parallel evolution of well-developed armor inmultiple acanthogammarid lineages and the divergenceof the pelagic Macrohectopus suggest evolutionaryresponses to ecological opportunity. Conversely, the rel-atively uniform morphology of the genetically divergentmicruropodid clades suggest constrained morphologicalevolution within fossorial niches. Similar instances ofdecoupling between molecular and morphological evo-lution have been found in other well-studied examples ofadaptive radiation, such as the cichlids of the AfricanRift Lakes (Kocher et al., 1993; Rüber et al., 1999; Stur-mbauer and Meyer, 1992), and the songbirds of Hawaii(Lovette and Bermingham, 1999). Our results may con-tradict Greenwood’s (2000) conclusions (discussed andsupported by Sturmbauer, 1998) that radiations withmorphologically similar species are younger, while mor-phologically diverse radiations indicate an older species
Xock. Baikal’s two radiations seem to be relatively old,inferring from the large pairwise distances and branchlengths, yet the Baikal clades exhibit both diverse andconservative morphologies.
Admittedly, this study does not take into accountmembers of the fourth of Kamaltynov (1999b) families,Pachyschesidae, which we were not able to obtain. How-ever, Sherbakov et al.’s (1998) study did include a Pachy-schesis species, which was found to belong to a groupincluding Parapallasea, Pallasea, and Eulimnogammarus,so our conclusions likely would not change signiWcantlywith the addition of the missing taxa.
4.4. Origin of Lake Baikal fauna
Understanding the origins of the Lake Baikal faunarequires one to examine how they relate to non-Baikalianamphipods. Some researchers have suggested a closeaYnity between the Baikalian and Ponto-Caspian amphi-pod fauna, and their views have been reviewed byBazikalova (1945) and Kozhov (1963). In addition to thesimilarities between the micruropodids and some ponto-gammarids, other members of the Ponto-Caspianamphipod fauna, such as Amathillina pusilla, exhibit well-developed processes similar to the armored Baikalianspecies. Our morphological results (Fig. 2B) suggest simi-larities between the Baikalian and Ponto-Caspian faunas,especially between the pontogammarids and micruropod-ids. However, our molecular and combined analyses showthat the Baikal fauna is actually more closely related tothe Holarctic genus Gammarus, especially Gammaruslacustris, the most widespread freshwater gammaroidean.G. lacustris, has not been found within the main body ofLake Baikal, but is common in ephemeral pools aroundits margins, as well as in a pond on Olkhon Island, sur-rounded entirely by Baikal. An individual sampled fromthe pond on Olkhon (designated Gammarus lacustris BK)is part of a well supported monophyletic G. lacustris, withindividuals sampled from Lake Hovsgol, Mongolia,Washington, USA, and Vancouver Island, Canada. OtherEurasian gammaroideans have also been hypothesized tobe closely related to members of the Baikalian fauna.Chaetogammarus obtusatus has often been referred to asEulimnogammarus obtusatus, for it shares some distinc-tive morphological characteristics with the Baikaliangenus Eulimnogammarus (Pinkster, 1973; Pinkster andStock, 1970; Stock, 1969). However, our analyses showthat this species is instead closely related to Chaetogamm-arus marinus, and is basal to both the Baikal/Gammarus,and pontogammarid clades. Finally, no analyses supportthe monophyly of BousWeld’s (1977, 1982) superfamilyGammaroidea. Eogammarus and Ramellogammarus,both members of the North PaciWc family Anisogam-maridae, are apparently not closely related to the othergammaroideans, instead being more closely related toCrangonyx serratus, Monoporeia aYnis, and possibly
K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343 337
Gammarellus angulosus, all non-gammaroideans. Thefamily Anisogammaridae may not even be monophyletic,with the molecular likelihood and combined-data Bayes-ian analyses both showing a relationship between Ram-ellogammarus and Crangonyx.
While our results do not resolve completely the ori-gins of Baikal’s amphipods, they do reduce the numberof invading taxa from historical estimates that rangefrom 4 to 18 (Barnard and Barnard, 1983; BousWeld,1977, 1982; Brooks, 1950; Kamaltynov, 1992, 1999a;Kozhov, 1963; Ogarkov et al., 1997; Sherbakov, 1999;Sherbakov et al., 1998). The most parsimoniousreconstruction suggests that the Baikal amphipod faunaarose from two independent invading ancestor lineages,one giving rise to the Acanthogammaridae, the other toa Micruropodidae/Macrohectopus clade. The Micruro-podidae/Macrohectopus clade probably arose from afreshwater Gammarus lacustris-like ancestor. Acantho-gammaridae may have also arisen from a Gammarus-likeancestor, but the evidence for this is not as strong. Addi-tional sampling of gammaroidean species from EasternEurope and Asia is needed to develop a better under-standing of the origins of the spectacular gammaroideanfauna of Baikal, especially the principal endemic familyAcanthogammaridae, as well as the relationshipsbetween Baikalian and other non-Baikalian amphipods.
5. Conclusions
This study clariWes the evolutionary history of thehighly diverse, endemic amphipods of Lake Baikal, andreveals some new and unexpected relationships. Whilethere is strong molecular support for the endemic, mor-phologically and ecologically diverse Acanthogammari-dae as a natural taxonomic family, albeit without areliable morphological diagnosis, the family Micruropodi-dae is comprised of two highly divergent monophyleticgroups. Most surprisingly, while the pelagic Macrohecto-pus has been considered morphologically distinct enoughto merit creation of its own family, this distinctiveness isnot reXected in the molecular data, which strongly sup-ports the placement of the pelagic planktivore within thepredominantly fossorial Crypturopus-group. These severalresults highlight the uncoupling of molecular and mor-phological evolution that appears to be common in adap-tive radiations. Our results also emphasize thatmorphological data, long considered highly homoplasticin amphipods, adds support and resolution to moleculardata analyses, even when the two data types are stronglyincongruent. We hope that with additional taxonomicsampling, mainly of the non-Baikalian species foundthroughout Europe and Asia, we can better resolve thephylogeny and obtain a better detailed understanding ofhow these amphipods evolved into one of the mostimpressive invertebrate endemic faunas in existence.
Acknowledgments
We are grateful for Wnancial support from theNational Science Foundation (DEB-9815785 to J.E.D.)and the National Geographic Society (to J.E.D. andL.Y.). Thanks to Valery Chernyk and Nikolai Mugue forWeld support, and Nikolai Mugue and Christy Henzlerfor the addition of several important specimens. A spe-cial thanks to John Graves for advice, support, and thegenerous use of his facilities. We are grateful to MarkSiddall for advice, extensive laboratory assistance andan essential review of this manuscript. We also thankCliV Cunningham, John Holsinger, and Steve Kuehl forresearch advice and for comments on a previous versionof this manuscript. We thank Kirsten Jensen, Liz Borda,Louise Crowley, Rebecca BudinoV, and Megan Harrisonfor their comments on this manuscript. Finally, we thankMike Vecchione and CMER as well as the Lincoln Ells-worth Fund at the American Museum of Natural His-tory, for monetary support for KSM. This is VIMSContribution # 2652.
Appendix A. Morphological characters used in this study
1. Accessory Xagellum: 0 D absent; 1 D 1 article; 2 D 2–6 articles;3 D 7+ articles
2. Calceoli, antenna 1 Xagellum: 0 D absent; 1 D present3. Calceoli, antenna 2 Xagellum: 0 D absent; 1 D present4. Peduncle article 2, antenna 2: 0 D bare; 1 D setae only present;
2 D spine present5. Anterior-most segment with dorsal spines: 0 D head; 1 D pareon
1; 2 D pareon 2; 3 D pareon 3; 4 D pareon 4; 5 D pareon 5;6 D pareon 6; 7 D pareon 7; 8 D pleon 1; 9 D pleon 2; 10 D pleon3; 11 D urosome 1; 12 D urosome 2; 13 D urosome 3; 14 D nodorsal spination
6. Anterior-most segment with spines on dorso-posterior margin:0 D head; 1 D pareon 1; 2 D pareon 2; 3 D pareon 3; 4 D pareon4; 5 D pareon 5; 6 D pareon 6; 7 D pareon 7; 8 D pleon 1;9 D pleon 2; 10 D pleon 3; 11 D urosome 1; 12 D urosome 2;13 D urosome 3; 14 D no dorsal spination
7. Anterior-most segment with dorsal setae: 0 D head; 1 D pareon1; 2 D pareon 2; 3 D pareon 3; 4 D pareon 4; 5 D pareon 5;6 D pareon 6; 7 D pareon 7; 8 D pleon 1; 9 D pleon 2; 10 D pleon3; 11 D urosome 1; 12 D urosome 2; 13 D urosome 3; 14 D nodorsal spination
8. Anterior-most segment with setae on dorso-posterior margin:0 D head; 1 D pareon 1; 2 D pareon 2; 3 D pareon 3; 4 D pareon4; 5 D pareon 5; 6 D pareon 6; 7 D pareon 7; 8 D pleon 1;9 D pleon 2; 10 D pleon 3; 11 D urosome 1; 12 D urosome 2;13 D urosome 3; 14 D no dorsal spination
9. Setae on ventral margin of coxal plates 1–4: 0 D bare/few setae;1 D highly setose
10. Spines on ventral margin of Epimeron 1: 0 D absent;1 D present
11. Spines on ventral margin of Epimeron 2: 0 D absent;1 D present
12. Setae on ventral margin of Epimeron 2: 0 D absent; 1 D singlyinserted; plain; 2 D inserted in sets >2; plain; 3 D singlyinserted; plumose; 4 D inserted in sets >2; plumose
13. Spines on ventral margin of Epimeron 3: 0 D absent;1 D present
338 K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343
14. Setae on ventral margin of Epimeron 3: 0 D absent; 1 D singlyinserted; plain; 2 D inserted in sets >2; plain; 3 D singlyinserted; plumose; 4 D inserted in sets >2; plumose
15. Mid ventral lateral margin, uronite 1: 0 D bare; 1 D plain setaepresent; 2 D plumose setae present; 3 D spine present
16. Posterior ventral lateral margin, uronite 1: 0 D bare; 1 D plainsetae present; 2 D plumose setae present; 3 D spine present
17. Medial armor of head segment: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
18. Lateral armor of head segment: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
19. Medial armor of 1st pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
20. Lateral armor of 1st pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
21. Marginal armor of 1st pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
22. Medial armor of 2nd pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
23. Lateral armor of 2nd pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
24. Marginal armor of 2nd pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
25. Medial armor of 3rd pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
26. Lateral armor of 3rd pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
27. Marginal armor of 3rd pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
28. Medial armor of 4th pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
29. Lateral armor of 4th pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
30. Marginal armor of 4th pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
31. Medial armor of 5th pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
32. Lateral armor of 5th pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
33. Marginal armor of 5th pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
34. Medial armor of 6th pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
35. Lateral armor of 6th pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
36. Marginal armor of 6th pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
37. Medial armor of 7th pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
38. Lateral armor of 7th pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
39. Marginal armor of 7th pareon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
40. Medial armor of 1st pleon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
41. Lateral armor of 1st pleon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
42. Marginal armor of 1st pleon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
43. Medial armor of 2nd pleon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
44. Lateral armor of 2nd pleon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
45. Marginal armor of 2nd pleon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
46. Medial armor of 3rd pleon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
47. Lateral armor of 3rd pleon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
48. Marginal armor of 3rd pleon: 0 D none; 1 D tubercles;2 D mounds/swellings; 3 D pronounced (keels, teeth),4 D mucronations (extension of posterior margin)
49. Armor of 1st uronite: 0 D none; 1 D tubercles; 2 D mounds/swellings; 3 D pronounced (keels, teeth), 4 D mucronations(extension of posterior margin)
50. Armor of 2nd uronite: 0 D none; 1 D tubercles; 2 D mounds/swellings; 3 D pronounced (keels, teeth), 4 D mucronations(extension of posterior margin)
51. Armor of 3rd uronite: 0 D none; 1 D tubercles; 2 D mounds/swellings; 3 D pronounced (keels, teeth), 4 D mucronations(extension of posterior margin)
52. Armor of 1st coxal plate: 0 D none; 1 D tubercles; 2 D mounds/swellings; 3 D pronounced (keels, teeth), 4 D mucronations(extension of posterior margin)
53. Armor of 2nd coxal plate: 0 D none; 1 D tubercles; 2 D mounds/swellings; 3 D pronounced (keels, teeth), 4 D mucronations(extension of posterior margin)
54. Armor of 3rd coxal plate: 0 D none; 1 D tubercles; 2 D mounds/swellings; 3 D pronounced (keels, teeth), 4 D mucronations(extension of posterior margin)
55. Armor of 4th coxal plate: 0 D none; 1 D tubercles; 2 D mounds/swellings; 3 D pronounced (keels, teeth), 4 D mucronations(extension of posterior margin)
56. Proximal lateral face, peduncle of uropod 1: 0 D bare; 1 D setaeonly present; 2 D spine present
57. Number of sets of setae/spines on proximal lateral face, pedun-cle of uropod 1: 0 D none; 1 D 1; 2 D 2+
58. Proximal medial face, peduncle of uropod 1: 0 D bare; 1 D setaeonly present; 2 D spine present
59. Number of sets of setae/spines on proximal medial face, pedun-cle of uropod 1: 0 D none; 1 D 1; 2 D 2+
60. Dorso-lateral margins, peduncle of uropod 1: 0 D bare;1 D setae only present; 2 D spines present
K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343 339
61. Lateral interramal margin, peduncle of uropod 1: 0 D bare;1 D setae only present; 2 D 1 spine present; 3 D 2 spines present
62. Lateral margins, outer ramus of uropod 1: 0 D bare; 1 D setaeonly present; 2 D spines present
63. Lateral margins, inner ramus of uropod 1: 0 D bare; 1 D setaeonly present; 2 D spines present
64. Proximal lateral face, peduncle of uropod 2: 0 D bare; 1 D setaeonly present; 2 D spine present
65. Number of sets of setae/spines on proximal lateral face, pedun-cle of uropod 2: 0 D none; 1 D 1; 2 D 2+
66. Dorso-lateral margins, peduncle of uropod 2: 0 D bare;1 D setae only present; 2 D spines present
67. Lateral interramal margin, peduncle of uropod 2: 0 D bare;1 D setae only present; 2 D 1 spine present; 3 D 2 spines present
68. Lateral margins, outer ramus of uropod 2: 0 D bare; 1 D setaeonly present; 2 D spines present
69. Lateral margins, inner ramus of uropod 2: 0 D bare; 1 D setaeonly present; 2 D spines present
70. Apical spines, rami of uropods 1 & 2: 0 D 5 spines; 1 D 3 spines;2 D 1 spine
71. Lateral face, peduncle of uropod 3: 0 D bare; 1 D setae onlypresent; 2 D spines present
72. Number of sets of setae/spines on lateral face, peduncle of uro-pod 3: 0 D none; 1 D 1; 2 D 2+
73. Distal dorso-lateral margin, peduncle of uropod 3: 0 D bare;1 D setae only present; 2 D spines present
74. Distal dorso-medial margin, peduncle of uropod 3: 0 D bare;1 D setae only present; 2 D spines present
75. Distal ventral margin, peduncle of uropod 3: 0 D bare; 1 D setaeonly present; 2 D spines present
76. Number of articles, outer ramus of uropod 3: 0 D 0; 1 D 1; 2 D 277. Lateral margin spines, outer ramus of uropod 3: 0 D absent;
1 D present78. Lateral margin setae, outer ramus of uropod 3: 0 D absent;
1 D plain setae only; 2 D plumose setae present79. Medial margin spines, outer ramus of uropod 3: 0 D absent;
1 D present80. Medial margin setae, outer ramus of uropod 3: 0 D absent;
1 D plain setae only; 2 D plumose setae present81. Apical spines, outer ramus of uropod 3: 0 D absent; 1 D present82. Apical setae, outer ramus of uropod 3: 0 D absent; 1 D plain
setae only; 2 D plumose setae present83. Inner ramus of uropod 3: 0 D absent; 1 D vestigial (scale-like);
2 D < 1/2 length of outer ramus; 3 D < length of outer (>1/2length of outer); 4 D subequal length of outer; 5 D > length ofouter
84. Lateral margin spines, inner ramus of uropod 3: 0 D absent;1 D present
85. Lateral margin setae, inner ramus of uropod 3: 0 D absent;1 D plain setae only; 2 D plumose setae present
86. Medial margin spines, inner ramus of uropod 3: 0 D absent;1 D present
87. Medial margin setae, inner ramus of uropod 3: 0 D absent;1 D plain setae only; 2 D plumose setae present
88. Apical spines, inner ramus of uropod 3: 0 D absent; 1 D present89. Apical setae, inner ramus of uropod 3: 0 D absent; 1 D plain
setae only; 2 D plumose setae present90. Shape of telson: 0 D entire; 1 D notched; 2 D partially split
(split < 3/4 of length), lobes together; 3 D partially split, lobesseparated; 4 D entirely split (split > 3/4 of length), lobestogether; 5 D entirely split, lobes separated
91. Dorso-lateral margin of telson: 0 D bare; 1 D setae only present;2 D spines present
92. Number of sets of setae/spines on dorso-lateral margin of tel-son: 0 D none; 1 D 1; 2 D 2+
93. Dorso-medial margin of telson: 0 D bare; 1 D setae only pres-ent; 2 D spines present
94. Number of sets of setae/spines on dorso-medial margin of tel-son: 0 D none; 1 D 1; 2 D 2+
95. Apex of telson: 0 D bare; 1 D setae only present; 2 D spines pres-ent
96. Free-hanging distal lobe of posterior margin, basis of pereopod7: 0 D absent; 1 D present
97. Anterior distal margin spines, basis of pereopod 7: 0 D absent;1 D present
98. Anterior distal margin setae, basis of pereopod 7: 0 D absent;1 D plain setae only; 2 D plumose setae present
99. Shape of 3rd article, mandible palp: 0 D normal; 1 D reduced(rounded)
100. Comb-setae (D spines/setae of Karaman, 1969), 3rd article,mandible palp: 0 D absent; 1 D plain setae only; 2 D plumosesetae present
101. Apical setae, 3rd article, mandible palp: 0 D absent; 1 D plainonly; 2 D plumose present
102. Medial setae, 2nd article, mandible palp: 0 D absent; 1 D plainonly; 2 D plumose present
103. Lateral setae, 2nd article, mandible palp: 0 D absent; 1 D plainonly; 2 D plumose present
104. Apical elongate setae, 3rd article, maxilliped palp: 0 D absent;1 D plain only; 2 D plumose present
105. Short, fuzz-like setae, lateral distal tip 3rd article, maxillipedpalp: 0 D absent; 1 D present
106. Distal modiWed setae (similar to the type 3aiii, setulate-serratepore-bearing setae, of Oshel and Steele, 1988), 3rd article, max-illiped palp: 0 D absent; 1 D present
107. Medial setae, dactyl (4th article), mandible palp: 0 D absent;1 D present
108. Lateral distal margin setae, 2nd article, maxilliped palp:0 D absent; 1 D plain only; 2 D plumose present
109. Medial setae, 2nd article, maxilliped palp: 0 D absent,1 D inserted singly; 2 D inserted in sets > 2
110. Medial setae, 2nd article, maxilliped palp: 0 D absent, 1 D plainonly; 2 D plumose present
111. Lateral setae, 2nd article, maxilliped palp: 0 D absent, 1 D plainonly; 2 D plumose present
112. Gnathopod propod (6th article), relative size: 0 D 1st gnatho-pod larger; 1 D subequal in size; 2 D 2nd gnathopod larger
113. Propod palmar margin, gnathopod 1: 0 D oblique (no evidentangle); 1 D intermediate (angle between 0° and 90°); 2 D acute(angle790°)
114. Propod mid-palmar spine, gnathopod 1: 0 D absent; 1 D short/blunt (truncate); 2 D long/sharp
115. Propod palmar angle spine, lateral face, gnathopod 1:0 D absent; 1 D short/blunt (truncate); 2 D long/sharp
116. Propod palmar angle spine, medial face, gnathopod 1:0 D absent; 1 D short/blunt (truncate); 2 D long/sharp
117. Propod posterior margin spines (extending proximally frompalm), gnathopod 1: 0 D absent; 1 D present
118. Propod posterior margin setae, gnathopod 1: 0 D absent;1 D inserted singly; 2 D inserted in sets > 2
119. Propod posterior margin setae, gnathopod 1: 0 D absent;1 D plain only; 2 D plumose present
120. Propod lateral face setae, gnathopod 1: 0 D absent; 1 D insertedsingly; 2 D inserted in sets > 2
121. Propod lateral face setae, gnathopod 1: 0 D absent; 1 D plainonly; 2 D plumose present
122. Propod medial face setae, gnathopod 1: 0 D absent; 1 D insertedsingly; 2 D inserted in sets > 2
123. Propod medial face, anterior margin setae, gnathopod 1:0 D absent; 1 D plain only; 2 D plumose present
124. Propod lateral face, anterior margin setae, gnathopod 1:0 D absent; 1 D inserted singly; 2 D inserted in sets > 2
125. Propod lateral face, anterior margin setae, gnathopod 1:0 D absent; 1 D plain only; 2 D plumose present
340 K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343
126. Propod medial face, anterior margin setae, gnathopod 1:0 D absent; 1 D inserted singly; 2 D inserted in sets > 2
127. Propod medial face, anterior margin setae, gnathopod 1:0 D absent; 1 D plain only; 2 D plumose present
128. Propad palm: 0 D normal; 1 D serrate129. Elongated setae, base of palm (near conjunction with dac-
tyl), propod, gnathopod 1: 0 D absent; 1 D plain; 2 Dplumose
130. Carpus (5th article) posterior margin setae, gnathopod 1:0 D absent; 1 D inserted singly; 2 D inserted in sets > 2
131. Carpus posterior margin setae, gnathopod 1: 0 D absent;1 D plain only; 2 D plumose present
132. Carpus posterior margin modiWed setae (similar to the type 3ai,serrate pore-bearing setae, of Oshel and Steele, 1988), gnatho-pod 1: 0 D absent; 1 D present
133. Propod palmar margin, gnathopod 2: 0D oblique (no evidentangle); 1 D intermediate (angle between 0° and 90°); 2 D acute(angle 7 90°)
134. Propod mid-palmar spine, gnathopod 2: 0 D absent; 1 D short/blunt (truncate); 2 D long/sharp
135. Propod palmar angle spine, lateral face, gnathopod 2:0 D absent; 1 D short/blunt (truncate); 2 D long/sharp
136. Propod palmar angle spine, medial face, gnathopod 2:0 D absent; 1 D short/blunt (truncate); 2 D long/sharp
137. Propod posterior margin spines (extending proximally frompalm), gnathopod 2: 0 D absent; 1 D present
138. Propod posterior margin setae, gnathopod 2: 0 D absent;1 D inserted singly; 2 D inserted in sets > 2
139. Propod posterior margin setae, gnathopod 2: 0 D absent;1 D plain only; 2 D plumose present
140. Propod lateral face setae, gnathopod 2: 0 D absent; 1 D insertedsingly; 2 D inserted in sets > 2
141. Propod lateral face setae, gnathopod 2: 0 D absent; 1 D plainonly; 2 D plumose present
142. Propod medial face setae, gnathopod 2: 0 D absent; 1 D insertedsingly; 2 D inserted in sets > 2
143. Propod medial face, anterior margin setae, gnathopod 2:0 D absent; 1 D plain only; 2 D plumose present
144. Propod lateral face, anterior margin setae, gnathopod 2:0 D absent; 1 D inserted singly; 2 D inserted in sets > 2
145. Propod lateral face, anterior margin setae, gnathopod 2:0 D absent; 1 D plain only; 2 D plumose present
146. Propod medial face, anterior margin setae, gnathopod 2:0 D absent; 1 D inserted singly; 2 D inserted in sets > 2
147. Propod medial face, anterior margin setae, gnathopod 2:0 D absent; 1 D plain only; 2 D plumose present
148. Propad palm: 0 D normal; 1 D serrate149. Elongated setae, base of palm (near conjunction with dactyl),
propod, gnathopod 2: 0 D absent; 1 D plain; 2 D plumose150. Carpus (5th article) posterior margin setae, gnathopod 2:
0 D absent; 1 D inserted singly; 2 D inserted in sets > 2151. Carpus posterior margin setae, gnathopod 2: 0 D absent;
1 D plain only; 2 D plumose present152. Carpus posterior margin modiWed setae (similar to the type 3ai,
serrate pore-bearing setae, of Oshel and Steele, 1988), gnatho-pod 2: 0 D absent; 1 D present
Appendix B
Character states of all taxa used in this study. Question Marks denote unknown states. Dashes denote non-applicable character. ! D 10, # D 11,$ D 12, % D 13, & D 14
Barnard, J.L., Barnard, C.M., 1983. Freshwater Amphipoda of theWorld I & II. HayWeld Associates, Mt. Vernon, VA 471pp.
Barnard, J.L., Karaman, G.S., 1975. The higher classiWcation in amphi-pods. Crustaceana 28, 304–310.
Bazikalova, A., 1945. Amphipods of Baikal. [Department of Com-merce of the USA translation of the original] Moscow 440pp.
BousWeld, E.L., 1977. A new look at the systematics of gammaroi-dean amphipods of the world. Crustaceana Supplement 4, 282–316.
BousWeld, E.L., 1982. Amphipoda. In: Parker, S.P. (Ed.), Synopsis andClassiWcation of Living Organisms. McGraw-Hill, New York, pp.254–294.
BousWeld, E.L., Shih, C., 1994. The phyletic classiWcation of amphipodcrustaceans: Problems in resolution. AmphipaciWca 1, 76–134.
Bremer, K., 1988. The limits of amino acid sequence data in angio-sperm phylogenetic reconstruction. Evolution 42, 795–803.
Bremer, K., 1994. Branch support and tree stability. Cladistics 10, 295–304.
Brooks, J.L., 1950. Speciation in ancient lakes. Quarterly Review ofBiology 25, 30–60.
Cummings, M.P., Handley, S.A., Myers, D.S., Reed, D.L., Rokas, A.,Winka, K., 2003. Comparing bootstrap and posterior probabil-ity values in the four-taxon case. Systematic Biology 52, 277–487.
Donoghue, M.J., Sanderson, M.J., 1992. The suitability of molecularand morphological evidence in reconstructing plant phylogeny. In:Soltis, P.S., Soltis, D.E., Doyle, J.J. (Eds.), Molecular Systematics ofPlants. Chapman and Hall, London, pp. 341–368.
Douady, C.J., Delsuc, F., Boucher, Y., Doolittle, R.F., Douzery, E.J.P.,2003. Comparison of Bayesian and maximum likelihood bootstrapmeasures of phylogenetic reliability. Molecular Biology and Evolu-tion 20, 248–254.
Englisch, U., Coleman, C.O., Wägele, J.W., 2003. First observations onthe phylogeny of the families Gammaridae, Crangonyctidae, Melit-idae, Niphargidae, Megaluropidae, and Oedicerotidae (Amphi-poda, Crustacea), using small subunit rDNA gene sequences.Journal of Natural History 37, 2461–2486.
Fishbein, M., Hibsch-Jetter, C., Soltis, D.E., HuVord, L., 2001. Phylog-eny of Saxifragales (angiosperms, eudicots): Analysis of a rapid,ancient radiation. Systematic Biology 50, 817–847.
Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNAprimers for ampliWcation of mitochondrial cytochrome c oxidasesubunit I from diverse metazoan invertebrates. Molecular MarineBiology and Biotechnology 3, 294–299.
Freyer, G., 1991. Comparative aspects of adaptive radiation and speci-ation in Lake Baikal and the great rift lakes of Africa. Hydrobiolo-gia 211, 137–146.
K.S. Macdonald III et al. / Molecular Phylogenetics and Evolution 35 (2005) 323–343 343
Greenwood, P.H., 1984. What is a species Xock? In: Echelle, A.A.,KornWeld, I. (Eds.), Evolution of Fish Species Flocks. University ofMaine at Orono Press, Orono, Maine, pp. 13–19.
Huelsenbeck, J.P., 2000. MrBayes: Bayesian inference of phylogeny.University of Rochester.
Huelsenbeck, J.P., Larget, B., Miller, R.E., Ronquist, F., 2002. Potentialapplications and pitfalls of Bayesian inference of phylogeny. Sys-tematic Biology 51, 673–688.
Kamaltynov, R.M., 1992. On the present state of amphipod systemat-ics. Zoologicheskiy Zhurnal 71, 24–31.
Kamaltynov, R.M., 1999a. On the evolution of Lake Baikal amphi-pods. Crustaceana 72, 921–931.
Kamaltynov, R.M., 1999b. On the higher classiWcation of Lake Baikalamphipods. Crustaceana 72, 933–944.
Karaman, G.S., 1969. XXVII. Beitrag zur kenntnis der Amphipoden.Arten der genera Echinogammarus Stebb. und ChaetogammarusMart. an der jugoslawischer Adriaküste. Glasnik RepublickogZavoda Za Zantitu Prirode I Prirodnjacke Zbirke u titograd. 2, pp.59–84.
Kocher, T.D., Conroy, J.A., McKaye, K.R., StauVer, J.R., 1993. Similarmorphologies of cichlid Wshes in Lakes Tanganyika and Malawi aredue to convergence. Molecular Phylogenetics and Evolution 2, 158–165.
Kozhov, M., 1963. Lake Baikal and Its Life. Dr. W. Junk Publishers,The Hague p. 344.
Lewis, P.O., 2001. A likelihood approach to estimating phylogeny fromdiscrete morphological character data. Systematic Biology 50, 913–925.
Lovette, I.J., Bermingham, E., 1999. Explosive speciation in the NewWorld Dendroica warblers. Proceedings of the Royal Society ofLondon, B 266, 1629–1636.
Martin, J.W., Davis, G.E., 2001. An Updated ClassiWcation of theRecent Crustacea. Natural History Museum of Los AngelesCounty, Lost Angeles p. 124.
Mats, V.D., Khlystov, O.M., De Batist, M., Ceramicola, S., Lomonos-ova, T.K., Klimansky, A., 2000. Evolution of the Academician RidgeAccommodation Zone in the central part of the Baikal Rift, fromhigh-resolution reXection seismic proWling and geological Weld inves-tigations. International Journal of Earth Science 89, 229–250.
Morrison, C.L., Rios, R., DuVy, J.E., 2004. Phylogenetic evidence foran ancient rapid radiation of Caribbean sponge-dwelling snappingshrimps (Synalpheus). Molecular Phylogenetics and Evolution. 30,563–581.
Ogarkov, O.B., Kamaltynov, R.M., Belikov, S.I., Sherbakov, D.Y.,1997. Phylogenetic relatedness of the Baikal Lake endemical [sic.]amphipods (Crustacea, Amphipoda) deduced from partial nucleo-tide sequences of the cytochrome oxidase subunit III genes. Molec-ular Biology 31, 24–29.
Oshel, P.E., Steele, D.H., 1988. Comparative morphology of amphipodsetae, and a proposed classiWcation of setal types. Crustaceana Sup-plement 13, 90–99.
Palumbi, S.R., Martin, A., Romano, S., McMillan, W.V., Stice, L., Gra-bowski, G., 1991. The Simple Fool’s Guide to PCR. version 2.0.University of Hawaii.
Pinkster, S., 1973. On members of the presumed Baikal-genus Eulimno-gammarus (Crustacea–Amphipoda) in Western Europe. Ver-
handluugen der Internationalen Vereinigung fur Theoretische undAngewandte Limnologie 18, 1498–1504.
Pinkster, S., 1983. The value of morphological characters in the taxon-omy of Gammarus. Beaufortia 33, 28.
Pinkster, S., Stock, J., 1970. Western European species of the presumedBaikal-genus Eulimnogammarus (Crustacea–Amphipoda), withdescription of a new species from Spain. Bulletin ZoologischMuseum, Universiteit van Amsterdam. 1, 205–219.
Posada, D., Crandall, K.A., 1998. Modeltest: Testing the model ofDNA substitution. Bioinformatics 14, 817–818.
Rüber, L., Verheyen, E., Meyer, A., 1999. Replicated evolution of tro-phic specializations in an endemic ciclid Wsh lineage from LakeTanganyika. Proceedings of the National Academy of Sciences ofthe United States of America 96, 10230–10235.
Sherbakov, D.Y., 1999. Molecular phylogenetic studies on the origin ofbiodiversity in Lake Baikal. Trends in Ecology and Evolution 14,92–95.
Sherbakov, D.Y., Kamaltynov, R.M., Ogarkov, O.B., Vainola, R., Vai-nio, J.K., Verheyen, E., 1999. On the phylogeny of Lake Baikalamphipods in the light of mitochondrial and nuclear DNAsequence data. Crustaceana 72, 911–919.
Sherbakov, D.Y., Kamaltynov, R.M., Ogarkov, O.B., Verheyen, E.,1998. Patterns of evolutionary change in Baikalian gammaridsinferred from DNA sequences (Crustacea, Amphipoda). MolecularPhylogenetics and Evolution 10, 160–167.
Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-like-lihoods with applications to phylogenetic inference. MolecularBiology and Evolution 16, 1114–1116.
Sorenson, M.D., 1999. TreeRot. Boston University, Boston.Stock, J., 1969. Members of Baikal amphipod genera in European
waters, with description of a new species Eulimnogammarus macro-carpus, from Spain. Proceedings of the Koninklijke NederlandseAkademie van Wetenschappen. Series C. Biological and MedicalSciences 72, 66–75.
Sturmbauer, C., 1998. Explosive speciation in cichlid Wshes of the Afri-can Great Lakes: A dynamic model of adaptive radiation. Journalof Fish Biology 53, 18–36.
Sturmbauer, C., Meyer, A., 1992. Genetic divergence, speciation andmorphological stasis in a lineage of African cichlid Wshes. Nature358, 578–581.
Sturmbauer, C., Verheyen, E., Meyer, A., 1994. Mitochondrial phylog-eny of the Lamprologini, the major substrate spawning lineage ofcichlid Wshes from Lake Tanganyika in Eastern Africa. MolecularBiology and Evolution 11, 691–703.
Suzuki, Y., Glazko, G.V., Nei, M., 2002. Overcredibility of molecularphylogenies obtained by Bayesian phylogenetics. Proceedings ofthe National Academy of Sciences of the United States of America99, 16138–16143.
SwoVord, D.L., 2002. PAUP* v.4.0b10. Phylogenetic Analysis UsingParsimony (* and other methods). Sinauer Associates, Sunderland.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W:Improving the sensitivity of progressive multiple sequence align-ment through sequence weighting, positions-speciWc gap penal-ties and weight matrix choice. Nucleic Acids Research 22, 4673–4680.
Väinölä, R., Kamaltynov, R.M., 1999. Species diversity and speciationin the endemic amphipods of Lake Baikal: Molecular evidence.Crustaceana 72, 945–956.