Mitochondrial DNA sequence variations in some Italian wild boar populations

OR IGINAL AR TIC LE

Mitochondrial DNA sequence variations in some Italian wildboar populationsL. Lattuada1, F. Quaglia1, F. Iannelli2, C. Gissi2, P. Mantecca3, R. Bacchetta1 & M. Polli4

1 Dipartimento di Biologia, Universita degli Studi di Milano, Milano, Italy

2 Dipartimento di Scienze Biomolecolari e Biotecnologie, Universita degli Studi di Milano, Milano, Italy

3 Dipartimento di Scienze dell’Ambiente e del Territorio, Universita degli Studi di Milano-Bicocca, Milano, Italy

4 Dipartimento di Scienze Animali, Universita degli Studi di Milano, Milano, Italy

Introduction

The Suidae family includes several species of great

biological interest and high economical value:

among them, the wild boar Sus scrofa L. is widely dis-

tributed from Eurasia to northeast Africa with at

least 16 different subspecies (Fang et al. 2006). The

number of subspecies still remains uncertain (Chen

et al. 2007), also because of hybridization among

populations (Randi 1995). In Italy, an indiscriminate

hunting during the eighteenth and nineteenth cen-

turies caused a reduction in the wild boar popula-

tion, whose geographical distribution, at the

beginning of the twentieth century, was restricted

only to Sardinia and a few central–southern regions

(Ghigi 1911). At that time two distinct subspecies

were recognized in these regions: Sus s. meridionalis

(the Sardinian wild boar) and Sus s. majori (the

Maremma wild boar) (De Beaux & Festa 1927).

Specimens of the wild European subspecies

Keywords

Hybridization; mtDNA; PCR analysis; pig; Sus

scrofa; wild boar.

Correspondence

Renato Bacchetta, Dipartimento di Biologia,

Universita degli Studi di Milano, 26, Via

Celoria, I-20133 Milano, Italy.

Tel: +39 02 5031 4794;

Fax: +39 02 5031 4781;

E-mail: [email protected]

Received: 11 February 2008;

accepted: 25 June 2008

Summary

In order to investigate the relationships between Italian wild boar and

major pig breeds, we studied the genetic variability of four wild boar

populations in Italy (Arezzo, Pisa, Parma, Bergamo) using a 533-bp frag-

ment of the mitochondrial control region. Sixty-nine wild boar samples

were analysed, allowing the identification of 10 distinct haplotypes,

which involve a total of 15 single nucleotide polymorphisms. Phyloge-

netic and network analyses were performed also considering several

sequences of wild and domesticated forms available in the databases.

The Bayesian phylogenetic tree and the Median-Joining network analy-

ses show three main groups: the Italian (IT), European (EU) and Asian

(AS) clades. The IT clade corresponds to the Maremma endemic wild

boar population and also includes Sardinian individuals, while the EU

and AS groups include wild boars as well as domestic pig breeds. Only

two individuals from Pisa cluster in the IT group, whereas two haplo-

types from Bergamo cluster in the AS group and all other samples clus-

ter in the EU clade. These findings suggest that in Italy wild boar

populations have a mixed origin, both EU and AS, and that an inter-

breeding between wild and domesticated strains has probably occurred.

Eight of the 10 wild boars coming from the Migliarino-San Rossore-

Massaciuccoli Regional Park (Pisa) belong to H2 and H3 haplotypes, and

cluster into the EU clade, suggesting that this regional park is not any-

more exclusive of the endemic Maremma wild boar.

J. Anim. Breed. Genet. ISSN 0931-2668

ª 2009 The Authors

doi:10.1111/j.1439-0388.2008.00766.x Journal compilation ª 2009 Blackwell Verlag GmbH • J. Anim.Breed. Genet. 126 (2009) 154–163

(Sus s. scrofa) were hypothesized to naturally re-colo-

nize northern Apennine from southern France

(Marsan et al. 1995), thus representing a third sub-

species present in Italy. From the 1950s, the Italian

wild boar population increased in number chiefly

because of the massive release of animals from east

European countries, for hunting purposes (Apollonio

et al. 1988). Presently the wild boar distribution cov-

ers all the Apennine territories, the northwestern

pre-Alpine and Alpine regions, with groups scattered

in almost all of the Italian provinces (Pedrotti et al.

2001). This demographic explosion created some

problems, the possible hybridization between indi-

viduals with different geographical origins, or

between wild and domesticated forms being the

main ones. Interbreeding between wild and domesti-

cated populations has been reported as a conse-

quence of the traditional free ranging pig rearing in

Sardinia (Onida et al. 1995), Piedmont (Durio et al.

1995) and other north Italian territories (Randi

2005), as well as in some provinces of central Italy

(Mazzoni della Stella et al. 1995), causing a genetic

modification of the pre-existing populations.

In this scenario, we have decided to examine the

phylogenetic relationships between some Italian wild

boar populations and the major pig breeds using the

control region (D-loop) of the mitochondrial DNA

(mtDNA). The mtDNA is maternally inherited, non-

recombining and fast-evolving (Avise 1994), making

it highly suitable for determining relationships

among individuals within species and among closely

related species with recent times of divergence

(Brown et al. 1979). Several papers have already

determined the relationships between wild boar and

domestic pig populations using mtDNA as a tool for

phylogenetic analysis (Watanobe et al. 1999, 2003;

Giuffra et al. 2000; Kijas & Andersson 2001;

Okumura et al. 2001; Hongo et al. 2002; Kim et al.

2002; Alves et al. 2003; Gongora et al. 2003, 2004;

Larson et al. 2005; Fang et al. 2006; Wu et al. 2007).

Results from these studies revealed two major clades

of mtDNA types in Europe: a first one, which

included European wild boars as well as all modern

European pig breeds, and a second one which con-

sisted solely of Italian (Maremma and Sardinia) wild

boars. In this study, we examined the genetic popu-

lation structure of Italian wild boars analysing the

geographical distribution of distinct D-loop haplo-

types derived from 69 samples collected from four

Italian provinces (Arezzo, Pisa, Parma and Bergamo),

in order to define the possible origin of the reintro-

duced or recolonizing animals. Among the Italian

populations analysed (Figure 1), three populations

came from areas where releases have surely

occurred (Bergamo, Parma and Arezzo), and one

from the Migliarino-San Rossore-Massaciuccoli

Regional Park (Tuscany, Pisa), a restricted area

where major reintroductions can be excluded

(Vernesi et al. 2003). Wild boars living in the latter

were within the distribution range of the endemic

Maremma wild boar subspecies (S. s. majori) and

were expected to display the distinctive Italian signa-

ture (Randi et al. 1996).

The description of the genetic structure of these

populations, some of which are unstudied, repre-

sents a first step towards the complete characteriza-

tion of the Italian wild boars. This is a major point

in the development of conservation and manage-

ment programmes in which the genetic information

regarding individuals involved in reintroductions is

of primary importance (Polziehn et al. 2000; Maudet

et al. 2002).

Materials and methods

Sampling and DNA extraction

Tissue or blood samples were collected from 69 wild

boars hunted in four different Italian provinces: 21

individuals from Arezzo, 10 from Pisa, 7 from Parma

Figure 1 Map showing locations of the 69 samples examined in this

study. The four Italian provinces (Arezzo, Pisa, Parma and Bergamo)

are represented by dots.

L. Lattuada et al. Genetics of wild boars in Italy

ª 2009 The Authors

Journal compilation ª 2009 Blackwell Verlag GmbH • J. Anim. Breed. Genet. 126 (2009) 154–163 155

and 31 from Bergamo (Figure 1 and Table 1).

Individuals from Pisa came from the Migliarino-San

Rossore-Massaciuccoli Regional Park.

Total DNA was extracted using a proteinase K

digestion procedure followed by standard phe-

nol ⁄ chloroform extraction (Sambrook et al. 1989)

and GFX Genomic Blood Purification Kit (Amersham

Biosciences, Europe GmbH, Cologno Monzese, Italy).

Polymerase chain reaction (PCR) amplification and

sequencing

Two oligonucleotide primers were used to amplify a

533-bp fragment of the mitochondrial control

region, corresponding to position 15591–16123 of

the complete mitochondrial sequence of S. scrofa

(AJ002189; Ursing & Arnason 1998). Primers were

the same used by Montiel-Sosa et al. (2000), i.e.

PrF:AACCCTATGTACGTCGTGCAT and PrR:ACCAT-

TGACTGAATAGCACCT. Amplification reaction was

performed in a total volume of 25 ll, containing

0.75 units of Ready Mix Taq (Sigma-Aldrich, Italia

s.r.l., Milan, Italy) and 10 lm each of the primers.

Reaction profile included a 9 min of initial denatur-

ation step at 95�C, followed by 30 cycles, each con-

sisting of 1 min of denaturation at 94�C, 2 min of

annealing at 60�C, 3 min of extension at 72�C and

then a final extension step at 72�C for 30 min. The

amplification products were electrophoresed

through 2% agarose gels and made visible by stain-

ing with ethidium bromide and ultraviolet (UV)

transillumination. All amplified fragments were

purified using spin columns (Qiagen, S.p.A., Milan,

Italy) and the nucleotide sequences of both strands

were determined using an ABI PRISM 377 DNA

automatic sequencer (Applied Biosystem Inc., Foster

City, CA, USA) with the Big Dye Terminator Cycle

Sequencing v1.1 Ready Reaction Kit.

Data analysis

Comparison of the 69 newly determined sequences

with the S. scrofa mtDNA reference sequence

AJ002189 allowed the identification of 10 different

haplotypes, whose sequences were deposited in the

EMBL database (Table 1). These haplotypes were

aligned to the reference sequence and to 41 pub-

lished mitochondrial control regions belonging to

representatives of wild boars and pig breeds coming

from Italy and several Asiatic and European coun-

tries (Table 2).

The warthog (Phacochoerus aethiopicus) AB046876

sequence was also included in the alignment in

order to be used as outgroup in the phylogenetic

analyses. The entire alignment, obtained by the

CLUSTALW software (Thompson et al. 1994), was

447 bp long (position 15619–16065 of the AJ002189

reference sequence). The central, ETAS (Extended

Termination Associated Sequences), and CSB (Con-

served Sequence Blocks) domains of the control

region were identified accordingly to the mammalian

D-loop domains defined by Sbisa et al. (1997).

Phylogenetic analyses were performed using mini-

mum evolution distance (ME), maximum likelihood

(ML) and Bayesian inference (BI) methods. The

best-fitting model of evolution was identified by

Modeltest v3.7 using the hierarchical likelihood

ratio tests (hLRT; Posada & Crandall 1998). The

Table 1 Geographical distribution of the 10 haplotypes identified in the 69 Italian wild boars analysed in this study

Haplotype Accession number

Animals sampled per locality

Total

Arezzo

(AR)

Pisa

(PI) Parma

Bergamo

(BG)

H1-AR AM744976 6 – – – 6

H2 AM748930 AM748938 4 7 5 9 25

AM773230 AM773231

H3 AM748931 AM773232 5 1 2 – 8

AM773233

H4-BG AM748932 – – – 7 7

H5-BG AM748933 – – – 13 13

H6-AR AM748934 5 – – – 5

H7-BG AM748935 – – – 1 1

H8-AR AM748936 1 – – – 1

H9-BG AM748937 – – – 1 1

H10-PI AM773234 – 2 – – 2

21 10 7 31 69

Genetics of wild boars in Italy L. Lattuada et al.

ª 2009 The Authors

156 Journal compilation ª 2009 Blackwell Verlag GmbH • J. Anim. Breed. Genet. 126 (2009) 154–163

Table 2 Nucleotide variations of a partial mitochondrial control region of both our samples (bold type) and GenBank sequences used in this

study, compared with the reference mtDNA AJ002189

Haplotype

Accession

number

Nucleotide and domain position

E E§ E§ E§ E E E E E C C C C C C C C C C# C C C C C C C C C C C C

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 9 5 6 6 6

6 6 7 7 7 7 7 7 7 7 7 7 8 8 8 8 8 8 8 8 8 8 8 9 9 9 9 9 0 0 0

4 7 0 1 1 2 3 3 4 5 5 5 2 2 2 2 4 4 7 8 9 9 9 0 0 3 3 9 1 3 4

8 5 7 1 4 9 6 7 1 7 8 9 2 3 5 6 0 1 8 7 5 6 7 2 9 6 7 5 0 2 5

Reference sequence AJ002189 T T C T T A C A C A T T A A C C T T A C C G C T C A T T A G T

H1-AR See Table 1 . . – . . . . G . . C . . . T . . . . . . . . . . . . . . . .

H2 See Table 1 . . – . C . . . . . C . . . . . . . . . . . . . . . . . . . .

H3 See Table 1 . . – . C . . G . . C . . . . . . . . . . . . . . . . . . . .

H4-BG See Table 1 . . – . C . . . . . C . . . . . . . G . . . . . . . . . . . .

H5-BG See Table 1 . C – . C G . . T . . . . . T . C . . T . . . . . . . . G . .

H6-AR See Table 1 . . – . . . . . . . C . . . T . . . . . . . . . . . . . . . .

H7-BG See Table 1 . . – . . . . . . . . . . . . . . . . . . . . . . . . . . . .

H8-AR See Table 1 . . – . C . . G . . C . . . . . . . . . . . . . . . . . G . .

H9-BG See Table 1 . C – . C G . . T . . . . . T . C . . T . . . . . . . . G . G

H10-PI See Table 1 . . – C . G . . . . . . . . . . . . G . . . . . . . . C G . G

$ Sardinian 1 AY884628 . . – . . G . . . . . . . . . . . . . . . . . . . . K C G . G

$ Sardinian 2 AY884668 . . – . C . . . . . C . . . . . . . . . . . . . . . . . . . .

$ Sardinian 3 AY884682 . . – . C G . . . . C . . . . . . . . . . . . . . . . . R . .

$ Sardinian 4 AY884690 . . – . . G . . . . . . . . . . . . . . . . . . . . . . G . G

Maremma WB 1 AY884716 . . – C . G . . . . C . . . . . . . G . . . . . . . . C G . G

Maremma WB 2 AY884717 . . – C . G . . . . . . . . . . . . G . . . . . . . . C G . G

Maremma WB 3 AY884721 . . – C . G . . . . C . . . . . . . G . . . . . . . . C G T G

Maremma WB 4 AY884719 . . – C . G . . . . C . . . . . . . G . . . . W . . . C G . G

Dutch WB AY884669 . . – . C . . . . . C . . . . . . . . . . . . . . . . . . . .

German WB AB059651 C . – . . G . . T . . . . . T . . . . . . . . . . . . . G . .

Spanish WB 1 AY884616 . . – . C G . . . . C . G . . . . . . . . . . . . . . . . . .

Spanish WB 2 AY884697 . . – . C . . . . . C . . . . . . . . . . . . . . . . . G . .

Spanish WB 3 AY884714 . . – . C . . . . . C . . . . . . . . . . . . . . . . . . . .

French WB 1 AY884667 . . – . C R . . . . C . . . . . . . . . . . . . . . . . . . .

French WB 2 AY884681 . . – . C . . . . . . . . . . . . . . . . . . . . . . . . . .

French WB 3 AY884729 . . – . C . . . . . C . . . . . . . . . . . . . . . . . . . .

* Iberian Black (Spain) AY884765 . . – . C . . . . . C . . . . . . . . . . . . . . . . . . . .

* Landrace (France) AY884760 . C – . C G . . T . . . . . T . C . . T . . . . . . . . G . .

* Landrace (Denmark) AY884747 . . – . C . . . . . C . . . . . . . . . . . . . . . . . . . .

* Landrace (Finland) AY884775 . . – . . . . . . . . . . . . . . . . . . . . . . . . . . . .

* Landrace (UK) AY884750 . C – . . G . . T . . . . . T . . . . . . . . . T . . . G . .

* Landrace (Germany) AY884787 . . – . C . . . . . C . . . . . . . . . . . . . . . . . . . .

* Large White (France) AY884763 . . – . . . . . . . C . . . . . . . . . . . . . . . . . . . .

* Manchado de Jabugo (Spain) DQ379190 . C – . C G . . T . . . . . T . C . . T . . . . . . . . G . .

* Large White (Germany) AY884786 . . – . . G . . T . . . . . T . . . . . . . . . . G . C G . .

* Berkshire 1 (UK) AF276936 . . – . C . . . . . C . . . . . . . . . . . . . . . . . . . .

* Berkshire 2 AB059650 . . – . C G . . T . . . . . T . . . . T . . . . . . . C G . .

* Duroc (UK) AY884746 . . – . C . . . . . C . . . . . . . . . . . . . . . . . . . .

* Pietrain (Germany) AY884769 . . – . C . . . . . C . . . . . . . G . . . . . . . . . . . .

* Mangalica (Hungary) AY884764 . . – . C . . . . . C . . . . . . . . . . . . . . . . . . . .

* Linderodssvin (Sweden) AY884751 . . – . C . . . . . C . . . . . . . . . . . . . . . . . G . .

* Hanoi 1 (Vietnam) AB053622 . . – . . G . . T G . C G G T T . . G T . . . . . . . . G . .

* Hanoi 2 (Vietnam) AB053620 . C – . C G . G T G . . . . T . C . . T . . . . . . . C G . .

* Asian Meishan AY232888 . C – . C G T . T . . . . . T . . . . T A . A . . . . C G . .

* Jinhua 1 (China) AB041477 . C – . . G . . T . . . . . T . . . . . . . . . . . . . G . .

* Jinhua 2 (China) AB041476 . C – . . G . . T . . . . . T . . . . . . A . . . . . . G . .

Japanese WB 1 AY884634 . . – . . G . . T . . . . . T . . . . T . . . . . . . C G . .


ª 2009 The Authors


Hasegawa–Kishino–Yano (HKY) model assuming a

proportion of invariant sites (I) and a gamma distri-

bution for rate heterogeneity across sites (G), was

selected as the best-fit model among all 56 models

tested by ModelTest (I = 0.76; G = 0.38). ME dis-

tance analyses were carried out with PAUP* v4.0b10

(Swofford 1998). ML analyses were carried out with

PHYML v2.4.4 (Guindon & Gascuel 2003) starting

from the BIONJ tree, with transition ⁄ transversion

ratio estimated from the data, and fixing the propor-

tion of invariant sites and the gamma shape parame-

ter to the value previously estimated by ModelTest.

Bootstrap values were based on 1000 replicates for

both ME and ML analyses. Bayesian analyses were

carried out with MrBayes v3.0b4 (Huelsenbeck &

Ronquist 2001). One cold and three incrementally

heated chains were run for 1 000 000 generations,

with trees sampled every 100 generations. The

results of the initial 200 000 generations were dis-

carded (burn-in), after checking that the stationarity

of the lnL had been reached. Thus, a consensus tree

was made with the results of the remaining 800 000

generations (8000 reconstructed trees), allowing the

calculation of the Bayesian posterior probabilities

(BPP) at different nodes. Network analysis of haplo-

types was performed using the Median-Joining (MJ)

network method (Bandelt et al. 1999) implemented

in the Network software package version 4.5.0.0

(http://www.fluxus-engineering.com).

Results and discussion

The PrF and PrR primers used for the amplification

of the D-loop fragment are located in the ETAS1 and

CSB1 blocks (Sbisa et al. 1997) respectively, thus the

amplified sequence corresponds to two domains of

the D-loop: the entire central domain (316 bp; 70%

of the alignment), and the portion of the ETAS

domain (134 bp; 30% of the alignment) including

the conserved ETAS2 block (ETAS2 position: 15651–

15712 of the AJ002189 reference sequence).

Compared with the reference sequence, the 69

analysed wild boars allow the identification of 10

distinct haplotypes, named according to the Italian

place of origin (Table 1), with the haplotype H7-BG

identical to the reference mtDNA (Table 2). The

identified haplotypes involve a total of 15 single

nucleotide polymorphisms (SNP) evenly distributed

between the ETAS and the central domain (seven

and eight SNP, respectively), with three SNP located

in the ETAS2 block (symbol § in Table 2). Fourteen

SNP are nucleotide substitutions: 13 transitions and

1 transversion (T->G, at position 16045 in the cen-

tral domain). Only the SNP at position 15707,

located in the ETAS2 block, represents a deletion

compared with the reference sequence. However,

this SNP was observed in all analysed sequences

(Table 2) and in almost all D-loop sequences of

S. scrofa available in GenBank (October 2007).

Indeed, a BlastN search of the ETAS domain against

the 2814 available mitochondrial entries of S. scrofa

identifies 2324 similar D-loop sequences, all showing

a deletion corresponding to position 15707 of the

AJ002189 reference, except for three cases: a Duroc

breed (AY232881) and two Californian specimens

(AY968707-8). This situation suggests a very rare

insertion event or a sequence error in a few D-loop

sequences including the reference mtDNA

(AJ002189). The presence of this indel suggests

the use of a different complete mtDNA sequence as

Table 2 Continued

Haplotype

Accession

number

Nucleotide and domain position

E E§ E§ E§ E E E E E C C C C C C C C C C# C C C C C C C C C C C C

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 9 5 6 6 6

6 6 7 7 7 7 7 7 7 7 7 7 8 8 8 8 8 8 8 8 8 8 8 9 9 9 9 9 0 0 0

4 7 0 1 1 2 3 3 4 5 5 5 2 2 2 2 4 4 7 8 9 9 9 0 0 3 3 9 1 3 4

8 5 7 1 4 9 6 7 1 7 8 9 2 3 5 6 0 1 8 7 5 6 7 2 9 6 7 5 0 2 5

Japanese WB 2 AB015084 . . – . C G . G T . . . . . T . . . . T . . . . . G . C G . .

Chinese WB 1 AY884639 . . – . . G . . . G . C G G T T . C G . . . . . . . . C G . .

Chinese WB 2 AY884642 . C – . . G . . T . . . . . T . . . . . . . . . . . . . G . .

Mongolian WB AB041464 . . – . C G . G T . . . . . T . . . . T . . . . . G . C G . .

Nucleotide positions are numbered according to the reference mtDNA, and domain position refers to the location of the nucleotide in the ETAS (E)

or central (C) domain. Sequence identities and deletions are indicated by dots and dashes, respectively. The 15 SNP identifying the new haplo-

types are underlined with grey background. §, nucleotide belonging to the ETAS2 block; #, nucleotide belonging to the AvaII site discussed in the

text. * before the name indicates pig breed; $ before the name indicates feral status; ETAS, Extended Termination Associated Sequences.


ª 2009 The Authors


reference mt genome for S. scrofa, i.e the NC_000845

complete genome recommended by NCBI

(http://www.ncbi.nlm.nih.gov/genomes/ORGANELLES/

40674.html).

The analysed D-loop fragment includes the

GGWCC AvaII restriction site (position 15876–15880

of the reference sequence) reported by Montiel-Sosa

et al. (2000) as a distinctive character sufficient to

distinguish between wild boars and pigs. Indeed, this

AvaII site is supposed to be present in pigs and

absent in boars (Montiel-Sosa et al. 2000). As shown

in Table 2, we did not find the deletion at position

15879 indicated as causing the elimination of the

AvaII site in wild boars (Montiel-Sosa et al. 2000),

but the A->G transition observed at position 15878

is expected to abolish the AvaII cut in Maremma

wild boars, the haplotypes H4-BG and H10-PI, and

in some Asiatic and European pig strains. Thus, our

data indicate that the AvaII restriction enzyme test

described by Montiel-Sosa et al. (2000) is inadequate

to discriminate among wild boars and pigs in both

European and Asiatic samples.

warthog$ Sardinian 4

$ Sardinian 1H10-PIMaremma wb2

Maremma wb1Maremma wb4

Maremma wb3

* AJ002189H7-BG* Landrace Finland

H2H3H8-AR

$ Sardinian 2Dutch wbSpanish wb2

Spanish wb3French wb1

French wb2French wb3* Iberian Black Spain* Large White France

* Duroc UK* Berkshire 1 UK* Landrace Germany* Landrace Denmark* Mangalica Hungary* Linderodssvin Sweden

H1-ARH6-AR

H4-BG* Pietrain Germany$ Sardinian 3

Spanish wb1

German wb* Large White Germany

* Hanoi 1 VietnamChinese wb1

* Landrace UK

* Jinhua 2 ChinaChinese wb2

Japanese wb1* Berkshire 2

Japanese wb2Mongolian wb

* Hanoi 2 VietnamH5-BG

H9-BG* Manchado de Jabugo Spain* Landrace France

0.1

87

99

87

96

88

85

62

65

66

100

62

99

65

8354

62

54

65

IT

EU

AS

* Asian Meishan

* Jinhua 1 ChinaFigure 2 Bayesian phylogenetic tree

(HKY + I + G model) reconstructed from

the D-loop sequences reported in Table 2.

Haplotypes identified in this study are in

bold. Branch length is proportional to the

number of substitutions per site. Numbers

close to the nodes represent posterior

probabilities (BPP). Nodes with support

values <50% were collapsed. * before the

name indicates the pig breed; $ before

the name indicates the feral status.


ª 2009 The Authors


The ME and ML phylogenetic trees show a very

low resolution, with most of the nodes unresolved

or weakly supported, hence they are not shown.

On the contrary, the BI reconstruction (Figure 2)

exhibits a better resolution, although several

polytomies are still present. The MJ network

(Figure 3) constructed using the same dataset

exactly matches the Bayesian tree. In fact, the

basal part of the BI reconstruction is characterized

by a polytomy of three clusters, which are also

easily distinguishable in the MJ network and

correspond to the following.

1. A group including about half of the total haplo-

types coming from Italy (7 haplotypes over 18; IT in

Figures 2 and 3).

2. A group including most of the European

specimens (EU in Figures 2 and 3).

3. A group including all Asian and a few European

haplotypes (8 over 41 European haplotypes; AS in

Figures 2 and 3).

This result is consistent with data from previ-

ously published papers (Giuffra et al. 2000; Kijas &

Andersson 2001; Okumura et al. 2001; Kim et al.

2002; Gongora et al. 2003, 2004; Larson et al. 2005)

which identified three different clusters of S. scrofa

mtDNA sequences: two European (here called IT

and EU) and one Asiatic groups (here called AS).

The IT clade included all Italian wild boars from

Maremma and, as expected, the H10-PI haplotype.

This is consistent with results of Apollonio et al.

(1988), Randi et al. (1996) and Vernesi et al. (2003)

who reported Maremma to represent the only area

where native Italian wild boar populations have not

been replaced by recent introductions, and highlights

Figure 3 Median-Joining network depicting the relationships among the D-loop sequences reported in Table 2. Haplotypes identified in this study

are in bold. Numbers on the branch indicate the number of nucleotide substitutions, when they are more than one. The frequency of a given hap-

lotype in the dataset is reported inside the node, when higher than 1, and is proportional to the node size. mv indicates median vectors, i.e.

hypothesized sequences required to connect existing sequences; * before the name indicates pig breed; $ before the name indicates feral status.

The 11 haplotypes grouped in the same node of H2 are: $ Sardinian 2, $ Dutch wb, $ Spanish wb 3, $ French wb 1, $ French wb 3, * Iberian Black

(Spain), * Duroc (UK), * Berkshire 1 (UK), * Landrace (Germany), Landrace (Denmark) and * Mangalica (Hungary).


ª 2009 The Authors


that special care is required in the maintenance of

the Italian population. In addition, the IT clade

includes two samples from Sardinia. Within the IT

clade, the basal position of the Sardinian samples in

the BI tree (Figure 2) and their proximity to the

basal median vector in the MJ network (Figure 3)

suggests that these two specimens belong to the orig-

inally reported subspecies S. s. meridionalis (De Beaux

& Festa 1927). The prehistoric origin of all the Sardi-

nian samples considered in this study well agrees

with our results. In fact, these samples came from

specimens collected in the late eighteenth and the

early nineteenth centuries (Larson et al. 2005), thus

predating the massive introduction since World War

II (Apollonio et al. 1988). Additionally, owing to

their feral status (Larson et al. 2005), Sardinian sam-

ples may share a close affinity to wild or domesti-

cated forms and this is in accordance with the

distribution of the Sardinian specimens in both the

IT and EU clades. Unfortunately, data from our anal-

ysis do not help to clarify the subspecies status of

the so-called wild boar in Sardinia, which still

remains contentious.

With regard to the geographical distribution of the

Italian haplotypes located in the EU clade, three of

them were found only in Arezzo (H1-AR, H6-AR and

H8-AR), two only in Bergamo (H4-BG and H7-BG),

whereas H2 and H3 haplotypes were found in three

or four of the localities considered (Table 1). These

two latter haplotypes represent about half of our

samples (33 out of 69), including all samples from

Parma. This data suggests a European origin of the

wild boars used for restocking in Tuscany (Arezzo

area) as well as in Lombardy (Bergamo area). It must

be however considered that as many European pig

breeds clustered in the EU clade, wild boar samples

from the aforementioned Italian regions could also

be the result of a possible interbreeding between wild

and domesticated forms. Surprisingly, most of the

samples coming from the Migliarino-San Rossore-

Massaciuccoli Regional Park (Pisa) belong to H2 and

H3, suggesting that this regional park is not anymore

exclusive of the endemic Maremma wild boar.

The AS clade included all the Asian types and

four European pig breeds (Landrace, Berkshire,

Large White and Manchado de Jabugo) confirming

the documented introgression of Asian DNA into

European swine stocks (Giuffra et al. 2000; Kim

et al. 2002). These data are also consistent with

analyses of nuclear markers including microsatel-

lites (Paszek et al. 1998; Vernesi et al. 2003; Fan

et al. 2005) and genes (Giuffra et al. 2000; Naya

et al. 2003; Gongora et al. 2004). The clustering of

H5-BG and H9-BG in the AS clade in both the BI

tree and the MJ network (Figures 2 and 3)

suggests that an interbreeding between Asian wild

boars and pigs was not to be excluded. This is in

accordance with previously published data showing

European domestic pigs sometimes possessing Asian

mtDNA haplotypes (Ishiguro et al. 2002; Naya et al.

2003).

The presence in both AS and EU clades of wild

and domesticated forms suggest that higher atten-

tion must be devoted to restocking operations and

that more efficient control strategies are necessary

at least to minimize new hybridizations among pop-

ulations. This latter point assumes much more

importance considering that only two out of the

ten samples from Pisa (H10-PI) are in the IT clade

and then show the typical Italian signature that

should has been conserved in all animals coming

from this area (Randi et al. 1996). The wild boars

from Pisa clearly showed that hybridization has

occurred even in the restricted area of Migliarino-

San Rossore-Massaciuccoli Regional Park, where the

‘pure’ Italian wild boar has been however demon-

strated to be still present. More samples from other

different sites may help to clarify the genetics of

Italian wild boars for which more detailed analyses

are also needed.

Acknowledgements

The authors wish to thank Prof. M. Apollonio,

Dr M. Scandura and Dr P. Lamberti, University of

Sassari and Dr C. Cesaris, University of Pavia, for

providing samples from Arezzo, Pisa and Parma. The

authors also thank Prof. G. Vailati, University of

Milan, cordially for having generously sponsored the

present work.

References

Alves E., Ovilo C., Rodrıguez M.C., Silio L. (2003)

Mitochondrial DNA sequence variation and phylo-

genetic relationships among Iberian pigs and other

domestic and wild pig populations. Anim. Genet., 34,

319–324.

Apollonio M., Randi E., Toso S. (1988) The systematics of

the wild boar (Sus scrofa L.) in Italy. Boll. Zool., 3,

213–221.

Avise J.C. (1994) Molecular Markers, Natural History

and Evolution. Chapman and Hall, NY, USA.

Bandelt H.J., Forster P., Rohl A. (1999) Median-joining

networks for inferring intraspecific phylogenies. Mol.

Biol. Evol., 16, 37–48.


ª 2009 The Authors


Brown W.M., George M. Jr., Wilson A.C. (1979) Rapid

evolution of mitochondrial DNA. Proc. Nat. Acad. Sci.

USA, 76, 1967–1971.

Chen K., Baxter T., Muir W.M., Groenen M.A., Schook

L.B. (2007) Genetic resources, genome mapping and

evolutionary genomics of the pig (Sus scrofa). Int. J.

Biol. Sci., 3, 153–165.

De Beaux E., Festa E. (1927) La ricomparsa del cinghiale

nell’Italia Settentrionale-Occidentale. Memorie Soc. It. Sc.

Nat., 9, 263–322.

Durio P., Macchi E., Rasero R. (1995) Genetic character-

ization of some populations of wild boar (Sus scrofa

scrofa) in Piedmont (Italy). Ibex JME, 3, 15–16.

Fan B., Gongora J., Chen Y., Garkavenko O., Li K.,

Moran C. (2005) Population genetic variability and

origin of Auckland Island feral pigs. J. R. Soc. N. Z., 35,

279–285.

Fang M., Berg F., Ducos A., Andersson L. (2006) Mito-

chondrial haplotypes of European wild boars with

2n=36 are closely related to those of European domes-

tic pigs with 2n=38. Anim. Genet., 37, 459–464.

Ghigi A. (1911) Ricerche faunistiche e sistematiche sui

mammiferi d’Italia che formano oggetto di caccia. Natu-

ra, 2, 289–337.

Giuffra E., Kijas J.M.K., Amarger V., Carlborg O., Jeon

J.-T., Andersson L. (2000) The origin of the domestic

pig: independent domestication and subsequent intro-

gression. Genetics, 154, 1785–1791.

Gongora J., Poltoniemi O.A.T., Tammen I., Raadsma H.,

Moran C. (2003) Analyses of possible domestic pig con-

tribution in two populations of Finnish farmed wild

boar. Acta Agricult. Scand., Sect. A, Anim. Sci., 53, 161–165.

Gongora J., Fleming P., Spencer P.B.S., Mason R., Gar-

kavenko O., Meyer J.-N., Droegemueller C., Lee J.H.,

Moran C. (2004) Phylogenetic relationships of Austra-

lian and New Zealand feral pigs assessed by mitochon-

drial control region sequence and nuclear GPIP

genotype. Mol. Phylogenet. Evol., 33, 339–348.

Guindon S., Gascuel O. (2003) A simple, fast, and accu-

rate algorithm to estimate large phylogenies by maxi-

mum likelihood. Syst. Biol., 52, 696–704.

Hongo H., Ishiguro N., Watanobe T., Shigehara N.,

Anezaki T., Long V.T., Binh D.V., Tien N.T., Nam N.H.

(2002) Variation in mitochondrial DNA of Vietnamese

pigs: relationships with Asian domestic pigs and

Ryukyu wild boars. Zool. Sci., 19, 1329–1335.

Huelsenbeck J.P., Ronquist F. (2001) MRBAYES: Bayes-

ian inference of phylogenetic trees. Bioinformatics, 17,

754–755.

Ishiguro N., Naya Y., Horiuchi M., Shinagawa M. (2002)

Genetic method to distinguish crossbred Inobuta from

Japanese wild boars. Zool. Sci., 19, 1313–1319.

Kijas J.M.H., Andersson L.A. (2001) Phylogenetic study

of the domestic pig estimated from the near-complete

mtDNA genome. J. Mol. Evol., 52, 302–308.

Kim K-I., Lee J-H., Li K., Zhang Y-P., Lee S-S., Gongora

J., Moran C. (2002) Phylogenetic relationships of Asian

and European pig breeds determined by mitochondrial

DNA D-loop sequence polymorphism. Anim. Genet., 33,

19–25.

Larson G., Dobney K., Albarella U., Fang M., Matisoo-

Smith E., Robins J., Lowden S., Finlayson H., Brand T.,

Willerslew E., Rowley-Conwy P., Andersson L., Cooper

A. (2005) Worldwide phylogeography of wild boar

reveals multiple centers of pig domestication. Science,

307, 1618–1621.

Marsan A., Spano S., Rognoni C. (1995) Management

attempts of wild boar (Sus scrofa L.): first results and

outstanding researches in Northern Apennines (Italy).

Ibex JME, 3, 219–221.

Maudet C., Miller C., Bassano B., Breitenmoser-Wursten

C., Gauthier D., Obexer-Ruff G., Michallet J., Taberlet

P., Luikart G. (2002) Microsatellite DNA and recent

statistical methods in wildlife conservation manage-

ment: applications in Alpine ibex [Capra ibex (ibex)].

Mol. Ecol., 11, 421–436.

Mazzoni della Stella R., Calovi F., Burrini L. (1995) Wild

boar management in an area of southern Tuscany

(Italy). Ibex JME, 3, 217–218.

Montiel-Sosa J.F., Ruiz-Pesini E., Montoya J., Roncales

P., Lopez-Perez M.J., Perez-Martos A. (2000) Direct

and highly species-specific detection of pork meat

and fat in meat products by PCR amplification of

mitochondrial DNA. J. Agricult. Food Chem., 48,

2829–2832.

Naya Y., Horiuchi M., Ishiguro N., Shinagawa M. (2003)

Bacteriological and genetic assessment of game meat

from Japanese wild boars. J. Agricult. Food Chem., 51,

345–349.

Okumura N., Kurosawa Y., Kobayashi E., Watanobe T.,

Ishiguro N., Yassue H., Mitsuhashi T. (2001) Genetic

relationships amongst the major non-coding regions

of mitochondrial DNAs in wild boars and several

breeds of domesticated pigs. Anim. Genet., 32,

139–147.

Onida P., Garau F., Cossu F. (1995) Damages caused to

crops by wild boars (S. scrofa meridionalis) in Sardinia

(Italy). Ibex JME, 3, 230–235.

Paszek A.A., Flickinger G.H., Fontanesi L., Beattie C.W.,

Rohrer G.A., Alexander A., Schook L.B. (1998) Evalu-

ating evolutionary divergence with microsatellites.

J. Mol. Evol., 46, 121–126.

Pedrotti L., Dupre E., Preatoni D., Toso S. (2001) Banca

dati ungulati: status, distribuzione, consistenza, gesti-

one prelievo venatorio e potenzialita delle popolazioni

di ungulati in Italia. Biologia e Conservazione della Fauna,

109, 1–132.

Polziehn R.O., Hamr J., Mallory F.F., Strobeck C. (2000)

Microsatellite analysis of North American wapiti (Cervus

elaphus) populations. Mol. Ecol., 9, 1561–1576.


ª 2009 The Authors


Posada D., Crandall K.A. (1998) MODELTEST: testing the

model of DNA substitution. Bioinformatics, 14, 817–818.

Randi E. (1995) Conservation genetics of the genus Sus.

Ibex JME, 3, 6–12.

Randi E. (2005) Management of wild ungulate popula-

tions in Italy: captive-breeding, hybridisation and

genetic consequences of translocations. Vet. Res. Comm.,

29(Suppl. 2), 71–75.

Randi E., Lucchini V., Diong C.H. (1996) Evolutionary

genetics of the Suiformes as reconstructed using

mtDNA sequencing. J. Mamm. Evol., 3, 163–194.

Sambrook J., Fritsch E.F., Maniatis T. (1989) Molecular

Cloning: A Laboratory Manual. Cold Spring Harbor

Laboratory Press, Cold Spring Harbor, NY, USA.

Sbisa E., Tanzariello F., Reyes A., Pesole G., Saccone C.

(1997) Mammalian mitochondrial D-loop region struc-

tural analysis: identification of new conserved

sequences and their functional and evolutionary impli-

cations. Gene, 205, 125–140.

Swofford D.L. (1998) PAUP*: Phylogenetic Analysis using

Parsimony (and other methods). Sunderland, MA, USA.

Thompson J.D., Higgins D.G., Gibson T.J. (1994) CLUS-

TAL W: improving the sensitivity of progressive multi-

ple sequence alignment through sequence weighting,

positions-specific gap penalties and weigh matrix

choice. Nucleic Acids Res., 22, 4673–4680.

Ursing B.M., Arnason U. (1998) The complete mitochon-

drial DNA sequence of the pig (Sus scrofa). J. Mol. Evol.,

47, 302–308.

Vernesi C., Crestanello B., Pecchioli E., Tartari D.,

Caramelli D., Hauffe H., Bertorelle G. (2003) The

genetic impact of demographic decline and reintroduc-

tion in the wild boar (Sus scrofa): a microsatellite analy-

sis. Mol. Ecol., 12, 585–595.

Watanobe T., Okumura N., Ishiguro N., Nakano M.,

Matsui A., Sahara M., Komatsu M. (1999) Genetic

relationship and distribution of the Japanese wild boar

(Sus scrofa leucomystax) and Ryukyu wild boar (Sus scrofa

ryukiuanus) analyzed by mitochondrial DNA. Mol. Ecol.,

8, 1509–1512.

Watanobe T., Ishiguro N., Nakano M. (2003) Phylogeog-

raphy and population structure of the Japanese wild

boar Sus scrofa leucomystax: mitochondrial DNA varia-

tion. Zool. Sci., 20, 1477–1489.

Wu G.S., Yao Y.G., Qu K.X., Ding Z.L., Li H.,

Palanichamy M.G., Duan Z.Y., Li N., Chen Y.S., Zhang

Y.P. (2007) Population phylogenomic analysis of mito-

chondrial DNA in wild boars and domestic pigs

revealed multiple domestication events in East Asia.

Genome Biol., 8, R245.


ª 2009 The Authors


Mitochondrial DNA sequence variations in some Italian wild boar populations

Documents