Microbial Genetics MICB404, Spring 2008 Lecture #13 Biology of plasmids: II. Modes of replication
Dec 21, 2015
ColE1 plasmids• Copy number regulated by siRNA (RNA I)
inhibiting primer RNA (pRNA, RNA II) availability– pRNA: 550 nt
• RNA Pol product• processed by RNase H
• anti-sense RNA (RNA I) transcribed from opposite strands of the pRNA locus– RNA I: 108 nt– complementary to 5’ end of RNA II
ColE1 plasmids• RNA I:RNA II duplex forms
– step 1, small number of base pairs (“kissing complex”); rate-limiting
– step 2, full-length duplex formed (“hug”)– prevents RNase H processing of RNA II and
formation of RNA:DNA primer complex
• RNA I transcribed from constitutive promoter– Increasing plasmid copy number yields more
RNA I, thus increasing inhibition of replication
R1 copy number control
• RepA required to initiate plasmid replication
• therefore control of Rep protein concentration will control copy number
• Antisense RNA inhibits expression of Rep protein– Plasmid-encoded
R1 copy number control• repA gene transcribed from 2
promoters on plasmid1) prepA: RepA mRNA
• located in copB• repressed by CopB
protein
2) pcopB: CopB-RepA polycistronic mRNA
• Regulatory antisense RNA, CopA, transcribed from pcopA
– constitutive
R1 copy number control• Transcription from prepA only occurs
immediately after transformation– RepA then drives replication until
copy number reached– expression of copB results
in repression of RepA expression from prepA
– repA can now only betranscribed from the pcobB promotor
R1 copy number control• CopA RNA binds to CopB-RepA mRNA
– double-stranded RNA forms over region spanning 5’ end of RepA ORF• upstream of repA is a short leader peptide ORF• translationally coupled with RepA
R1 copy number control• CopA:RepA dsRNA cleaved by RNase III
in leader peptide ORF– interferes with RepA translation
– more plasmid CopA RNA– more CopA RNA less RepA protein– limiting RepA protein no plasmid
replication
Iteron plasmids: copy number control
• Some plasmids contain iterated (repeated) sequences in oriV– e.g. pSC101, F, RK2
• pSC101 first plasmid used for cloning recombinant DNA: 1973, frog rRNA genes cloned into EcoRI site
– 17 to 22 bp– 3 to 7 copies per plasmid
Iteron plasmids• ori contains repA gene
– Sole plasmid-encoded protein required for replication
– 3 iteron sequences, R1, R2, & R3
Iteron plasmids
• Two-part copy number regulationI. RepA protein multi-functional– Required for replication– Represses transcription of repA gene
• Transcriptional auto-regulation• Increasing plasmid copy number
increasing RepA protein increasing repression of repA expression
Iteron plasmidsII. Coupling
– RepA protein binds to iteron sequences• Low plasmid concentrations
– bimolecular interaction– replication activated
• High plasmid concentrations– multimolecular interaction– “handcuffed” or “coupled”
plasmids prevented from replication
– Results in replication control according to [RepA] and [plasmid]
Eukaryote plasmid 2μ
• Typically, 50 to 100 copies per cell• Replication initiated only once per
cell cycle• Bidirectional and rolling circle
replication• Regulation of recombinase
expression.
Eukaryote 2μ
Inverted repeats
Partitioning into daughter cellsDuring mitosis and meiosis
“Flip protein”Site-directed recombinase
Proteins repressing expression of FLP(constitutive)
Plasmid maintenance
• Curing– Loss of all plasmids from cell after
cytokinesis– Prevented by
• plasmid addiction• multimer resolution• partitioning
Plasmid addiction• Plasmid-encoded factor that kills
cells cured of plasmid– plasmid also encodes “antidotes” to
toxic protein– upon curing, antidotes are lost and cell
is killed by toxic protein– Toxicity
• aberrant DNA gyrase• disrupt membrane
potential• etc
Restriction endonuclease toxicity
CH3 |GTATGCTCACCATACGAGTG
Methylase CH3 endonucleaseX
Plasmid curing
GTATGCTCACCATACGAGTG
endonucleaseMethylase
Multimer resolution
• Plasmid replication can result in formation of dimers & multimers– Result in increased curing
• Prevented by site-specific recombination – Resolve multimers into monomers
• Plasmid or chromosomeencoded
Multimer resolution• Site-specific recombinase
– XerC and XerD proteins• encoded by chromosomal
genes
– Promote recombination between cer sites on plasmid
– Irreversible• recombination does not occur
between cer sites on monomers
– Cytokinesis delayed until recombination complete
Partitioning
• System that segregates plasmids into each daughter cell– Probability of segregation– 50:50 chance per
plasmid; either cell:
2.(1/2)2n
n = copy number= 1/128
R1 ParM-based segregation
ATP hydrolysis is proposed to induce a structural change in ParM. ParR is released and reassociates with ParM-ATP.
ParR N-terminal binds specifically to parC while the C-terminal interacts with ParM-ATP.
R1 ParM mediated partitioning
ParM foci
ParR bound to parC site
DNA rep. apparatus
Plasmid tethered to pole via ParM and ParR/parC
Movement to mid-cell, replication, ParR binding
Rapid movement to cell poles
Dissociation of filament
Incompatibility
• Some plasmids are incompatible in the same cell– mutual interference in replication or
partitioning• Inc group defines plasmids which are unable
to coexist in same cell
Compatibleplasmids
Incompatibility• Replication control
– Two plasmids of same Inc group and same replication control will share copy number between them• unequal replication will
result in declining proportion of one plasmid
• eventually that plasmid is cured from cell
– Particularly with stringent plasmids• low copy number
Incompatibility• Partitioning
– Two plasmids using same par system will be incompatible
– They will be partitioned into one or the other daughter cell at random• one daughter receives only plasmid X, other
receives on plasmid Y
– Stringent plasmids
Incompatibility• Measurement of plasmid curing
– Incompatibility test: two plasmids with different antibiotic resistance genes• Higher rate of curing for 2 plasmids together
indicates they are of same Inc group
Maintaining antibiotic selection for both plasmids can overcome loss of plasmids from same Inc group