8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
1/35
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
2/35
Running head: Composition alters the response of litter decomposition
Microbial composition alters the response of litter decomposition to environmental change
Kristin L. Matulich and Jennifer B.H. Martiny5
Department of Ecology and Evolutionary Biology, University of California-Irvine, Irvine, CA
92697
Correspondence:10
Kristin L. Matulich
321 Steinhaus, Irvine, CA 92697
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
3/35
Abstract
Recent studies demonstrate that microorganisms are sensitive to environmental change
and that their community composition influences ecosystem functioning. However, it is
unknown whether microbial composition interacts with the environment to affect the response of20
ecosystem processes to changing abiotic conditions. To investigate the potential for such
interactive effects on leaf litter decomposition, we manipulated microbial composition and
manipulated three environmental factors predicted to change in the future (moisture, nitrogen
availability, and temperature). We isolated fungal and bacterial taxa from leaf litter and used
them to construct unique communities. Communities were inoculated into microcosms25
containing sterile leaf litter and exposed to four environmental treatments (ambient conditions,
increased temperature, decreased moisture, and increased nitrogen availability). Respiration was
tracked over 60 days, and communities were pyrosequenced to assess compositional changes. As
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
4/35
Introduction40
Biodiversity (both the richness and composition of taxa) has a direct influence on the rate
of ecosystem processes (reviewed in Cardinale et al. 2011). Yet until recently, it was often
assumed that microbial communities are so diverse and physiologically flexible that changes in
their diversity would not affect ecosystem processes (Schimel 2001). However, recent research
demonstrates that microbial diversity directly influences a variety of ecosystem processes such as45
litter decomposition, CO2 flux, and nitrogen cycling (Mille-Lindblom and Tranvik 2003, Bell et
al. 2005, Tiunov and Scheu 2005, Allison et al. 2009, Strickland et al. 2009, Reed and Martiny
2013).
In addition to these direct effects on process rates, biodiversity can affect the response of
ecosystem processes to changing abiotic conditions. Such interactive effects of biodiversity and50
abiotic change have been documented in plant communities. A recent meta-analysis showed that
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
5/35
2005, Allison et al. 2009) isolates found that decomposition rate, as measured by CO2
production, varies with richness and composition. Similarly, microcosms including both fungal
and bacterial taxa had a higher decomposition rate than microbial communities containing just65
fungal or bacterial taxa alone (Mille-Lindblom and Tranvik 2003). Further, natural variation
found in complex microbial communities affected the rate of decomposition when inoculated
onto a common leaf litter (Strickland et al. 2009).
To test whether microbial diversity (specifically composition) alters an ecosystem’s
functional response to environmental change, we constructed mixed bacterial and fungal70
microcosms using isolates from natural leaf litter communities in a Mediterranean-type
ecosystem located in southern California. The use of cultured isolates allowed us to hold richness
constant while manipulating the identity of the taxa. We then measured microbial respiration (a
proxy for decomposition) and changes in composition over the course of the experiment. Each
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
6/35
enzymatic activity generally increase under warmer temperatures (Lloyd and Taylor 1994). We
also expected that microbial composition would directly influence decomposition because
different taxa (and therefore communities) likely vary in their functional traits, including their
ability to decompose leaf litter. In addition to these direct effects, we further hypothesized that
the community and environment would interact to affect decomposition. Specifically, taxa would90
vary in the their responses to the environmental changes, resulting in differential shifts in
composition. Such variability in response traits, combined with that in functional traits, would
lead to differential functional responses among communities (Allison and Martiny 2008).
Finally, we predicted that the type of environmental change would affect the importance
of microbial composition for a microcosm’s functional response (i.e., the strength of the95
community-by-environment interaction). In particular, we hypothesized that the effect of the
temperature and moisture treatments would depend less on community composition than that of
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
7/35
We isolated 32 bacterial taxa and 24 fungal taxa from leaf litter collected from the Loma
Ridge research site located 5 km north of Irvine, California, USA (33 44’N, 117 42’W, 365 m110
elevation). Briefly, litter was collected in January, April, July, and September of 2011. During
this period, the site was dominated by the annual grass genera Avena, Bromus, and Lolium the
annual forb genera Erodium and Lupinus and the native perennial grass Nassella pulchra. Once
collected, litter was ground and then washed with sterilized deionized (DI) water. Litter
fragments (106-212 μm) were suspended in sterile DI water and the resulting solution was115
passed through a 100 μm filter (Millipore).
For fungal isolation, the 100 μm filter containing the washed litter was collected and
placed into a Falcon tube containing 30 mL of 0.6% carboxymethyl cellulose (CMC) solution.
The resulting slurry was then added to 96-tube microplates containing malt extract agar, tap
water agar, minimal nutrient medium, or cornmeal agar media (modified from Rossman et al.120
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
8/35
16S rRNA gene for bacteria (~1500 bp) or the 18S rRNA and internal transcribed spacer (ITS)
region (~700 bp) of the rRNA gene for fungi. For the fungal isolates, approximately 2.5 ng of
DNA extract was added to a PCR cocktail containing 1.2 units of HotMasterTaq polymerase
(5PRIME) 1x PCR buffer supplied by the manufacturer, 200 μM of each DNTP, 0.5 μM of each135
primer (ITS1F (5'-CTTGGTCATTTAGAGGAAGTAA-3') and TW13 (5'-
GGTCCGTGTTTCAAGACG-3'); White et al. 1990, Gardes and Bruns 1993), and H2O to a
final volume of 25 μL. Following an initial denaturation step at 94°C for 1 min, PCR was cycled
34 times at 94°C for 1 min, 51°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 8
min. All PCRs here and below were performed on a PTC-100 thermocycler (Bio-Rad). DNA140
extract from each bacterial isolate was added to a PCR cocktail containing 1.5 units of
HotMasterTaq polymerase (5PRIME) 1x PreMixF (FailSafe), 0.3 μM of each primer (pA (5'-
AGAGTTTGATCCTGGCTCAG-3') and pH (5'-AAGGAGGTGATCCAGCCGCA-3'); Edwards
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
9/35
were amplified from residual DNA or viable organisms that escaped irradiation. Glass vials (40155
ml) with a sampling septum were filled with 4 g of sterile sand and autoclaved. Sterilized litter
(50 mg) was then added to each microcosm.
To create the communities, each of the 56 cultured taxa was randomly assigned to two
communities; this produced eight unique communities that each contained 8 bacterial and 6
fungal isolates (Appendix B: Table B1). Cultures of each isolate were first separated from the160
solid growth medium by mixing three agar plugs (7x2 mm) with 1.5 ml of 0.9% NaCl solution
and ~30 glass beads (2 mm diameter) in an eppendorf tube and shaken in a FastPrep-24
Instrument (MP Biomedicals, Solon, OH, USA) for 15 sec at 4.0 ms−1
. This procedure was used
to try to standardize the isolates in terms of growth stage rather than by abundance. For each
community, equal volumes of the 14 assigned isolates were combined, and the community165
inoculum was dispersed among replicate microcosms. The inoculated microcosms were then
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
10/35
expected in California, including at least a 3°C increase in annual temperature, a decrease of 10-
25% in annual precipitation, and increasing rates of nitrogen deposition over the next 50 years
(IPCC 2013). 180
Respiration measurements
CO2 concentrations in the microcosm headspace were measured every 5-9 days to
estimate cumulative CO2 production over a 60-day incubation period. For each measurement, an
8 ml subsample of headspace gas was withdrawn by syringe and injected into an infrared gas
analyzer (PP-Systems EGM-4). To keep the microcosms at atmospheric CO2 concentrations, the185
vial caps were kept loose except for 24 hours before each sampling. At the end of the
experiment, cumulative CO2 production was divided by initial litter mass (50 mg) and total
duration of the experiment (60 days) to determine average daily CO2 production (measured as
mg C glitter-1
day-1
), our metric for litter decomposition.
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
11/35
approximately 2 μl of a 1:10 dilution of each DNA extract was added to a PCR cocktail
containing 1.2 units of HotStarTaq polymerase (Qiagen), 1x PCR buffer supplied by the
manufacturer, 200 μM of each DNTP, 0.5 μM of each primer, and H2O to a final concentration
of 25 μL. 16S amplification used concatemers containing the universal primer 907R (Lane
1991), an 8-bp multiplex tag (Table A1), and the 454 ‘B’ adaptor205
CCTATCCCCTGTGTGCCTTGGCAGTCTCAG (in the reverse direction) and the
complimentary primer 515F (Turner et al. 1999) and the 454 ‘A’ adaptor
CCATCTCATCCCTGCGTGTCTCCGACTCAG (in the forward direction). Following an initial
denaturation step at 95°C for 5 min, PCR was cycled 34 times at 95°C for 30 sec, 62°C for 45
sec, 72°C for 1 min, and a final extension at 72°C for 10 min.210
For the fungi, the same PCR cocktail was used as above. 28S amplification used
concatemers containing the fungal-specific LROR (Tedersoo et al. 2008), an 8-bp multiplex tag
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
12/35
experiment were detected by sequencing (42 out of 56); however, 3 fungi and 11 bacteria taxa
were not detected even in the inoculum samples (Table B1), suggesting they were present but not225
amplified during PCR. While the method detected clear differences in community composition
(see Results), this bias may have masked some correlations between functional (respiration rate)
and taxonomic responses.
Analyses
We analyzed average daily respiration rate and final community richness using a factorial230
mixed-model ANOVA. The model included environmental treatment as a fixed effect and
community composition as a random effect, and their interaction. To compare the initial and
final community richness in the control treatment (hereafter, “inoculum ANOVA”), we used a
factorial mixed-model ANOVA with time as a fixed effect and community composition as a
random effect. Significant pairwise differences were determined post-hoc using Tukey’s honest235
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
13/35
To test the effect of environmental treatment on overall microbial composition, similarity
matrices were generated on rarified abundance data using the Bray–Curtis method in QIIME
(Bray and Curtis 1957, Caporaso et al. 2010). The resulting resemblance matrix served as a basis
for non-metric multidimensional scaling (NMDS), as well as a permutational multivariate
analysis of variance (PERMANOVA; Anderson et al. 2008) to test the effects of experimental250
factors on the final composition. PERMANOVA analyses were conducted using partial sums of
squares, on 999 permutations of residuals under a reduced model. Multivariate analysis was
conducted using PRIMER6 and PERMANOVA+ (Primer-E Ltd, Plymouth, UK). Statistical
routines are described in Clarke and Warwick (2001) and Anderson et al. (2008).
255
Results
Community responses
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
14/35
All three environmental treatments – moisture, nitrogen, and temperature – altered both
microbial richness and composition in the microcosms. Richness was significantly lower in the270
three environmental perturbations than under ambient conditions (Table 1; Figure B2). This
reduction was most pronounced in the elevated nitrogen treatment, where on average 1.25 fewer
taxa were observed by the end of the experiment. Further, the response of richness to nitrogen
addition varied by community (χ 2
=6.0, p=0.01); the other environmental treatments did not show
an interactive effect (Table 1).275
Like richness, bacterial and fungal composition (as measured by relative abundance of
the taxa) was also influenced by environmental change. However, for all three perturbations,
bacterial and fungal composition was not directly affected by the environmental treatment alone.
Instead, the response to each environmental treatment varied by community; that is, the
community and environment interacted to affect composition (Table 1). This interaction was280
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
15/35
ANOVA: χ 2=6.5, p=0.01). Environmental treatment also had a significant effect on respiration
(χ 2
=38.4, p
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
16/35
(R 2=0.16, p=0.05; Figure 4). For example, none of the taxa in Community 7 differed in relative315
abundance when exposed to elevated temperature, and the average respiration rate of this
community did not significantly vary from the control conditions (Figure 4). In contrast, 40% of
taxa in Community 4 shifted in their relative abundances when exposed to nitrogen addition, and
the average respiration rate of this community was significantly higher than the control
treatment. This correlation was largely driven by the nitrogen treatment (R 2
=0.22, p=0.24; Figure320
4), suggesting that the compositional shifts resulting from increased nitrogen availability were
especially important for changes in overall respiration. In contrast, changes in physiology or total
microbial abundance may be more important in explaining the functional responses to moisture
and temperature shifts.
325
Discussion
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
17/35
response traits vary would one observe an interactive effect of the community and the
environment.
Artificially assembled communities in microcosms allow researchers to test questions340
about microbial diversity that would be infeasible in natural communities; however, their
applicability to the ‘real-world’ is a relevant concern (Carpenter 1996). Our experimental
communities were highly reduced in diversity compared to natural litter-decomposing
communities (Voriskova and Baldrian 2013, Kim et al. 2014). Indeed, in a PCR survey of litter
from the same ecosystem (Matulich et al., in prep), we observed well over 2000 bacterial and345
800 fungal taxa (again defined by 97% sequence similarity of 16S rDNA). Notably, almost all of
the bacterial taxa used in the microcosms were detected in the natural community, where their
relative abundance ranged from 0.002% to 18.6% of the samples (Appendix: Table B1). Further,
fungal families containing our cultures represented almost 50% of the natural community,
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
18/35
(increased abundance), or a combination (Ratkowsky et al. 1982, Lloyd and Taylor 1994, Sheik
et al. 2011). Likewise, nitrogen addition also increased decomposition, and elevated nitrogen
availability often stimulates decomposition rates by lowering the C:N ratio of the organic
material (Taylor et al. 1989, Allison et al. 2009, Bragazza et al. 2012). Contrary to our
predictions, however, microcosms subjected to reduced moisture showed significantly higher365
respiration rates than those in ambient conditions (Figure 2). Arid environments often have slow
rates of decomposition because water limits the physiological performance of microbes and the
diffusion of nutrients in the soil pore space (Harris 1981). We suspect that the higher respiration
rates in the drier microcosms may be caused by increased fungal activity, as many fungi grow
well in drier, Mediterranean conditions (Yuste et al. 2011). Indeed, both the bacteria and fungi370
used in this study were isolated from a Mediterranean-like ecosystem where high temperatures
and prolonged droughts are common, thus they may not only tolerate, but thrive in such
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
19/35
and functional responses, such that changes in respiration were generally correlated with large
changes in the relative abundance of taxa. This result was most evident in the nitrogen addition385
treatment, where 11-50% of the taxa in all communities had significantly different relative
abundances than in the control treatment (Figure 4). However, these functional responses could
not be correlated to the presence or absence of particular taxa (i.e., sampling effects), although
this couldn’t be tested directly because each taxon was only present in two of the communities.
Moreover, environmental treatment, which had a main effect on respiration rates, did not directly390
alter microbial composition over the course of the experiment (Table 1). Together, these results
suggest that some of the changes in respiration rate may be due not only to changes in
composition, but also to changes in microbial activity or total abundance, which were not
measured here.
To our knowledge, this work is the first to directly demonstrate that microbial395
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
20/35
Acknowledgements
We would like to thank S. Allison and D. Campbell for advice on the design and analysis
of the experiment, A. Amend for isolation of the fungal taxa, C. Weihe for assistance sequencing410
the communities, S. Nguyen for collecting measurements of CO2 production, and two
anonomous reviewers for comments that improved the clarity of the manuscript. Funding for this
project provided by the Office of Science (BER) US Department of Energy (program in
Microbial Communities and Carbon Cycling); the NSF Major Research Instrumentation program
(1126749); and the US Department of Education.415
Literature Cited
Allison, S. D. 2012. A trait-based approach for modelling microbial litter decomposition.
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
21/35
Balser, T. C. and M. K. Firestone. 2005. Linking microbial community composition and soil
processes in a California annual grassland and mixed-conifer forest. Biogeochemistry430
73:395-415.
Bell, T., J. A. Newman, B. W. Silverman, S. L. Turner, and A. K. Lilley. 2005. The contribution
of species richness and composition to bacterial services. Nature 436:1157-1160.
Bragazza, L., A. Buttler, J. Habermacher, L. Brancaleoni, R. Gerdol, H. Fritze, P. Hanajík, R.
Laiho, and D. Johnson. 2012. High nitrogen deposition alters the decomposition of bog435
plant litter and reduces carbon accumulation. Global Change Biology 18:1163-1172.
Bray, J. R. and J. T. Curtis. 1957. An Ordination of the Upland Forest Communities of Southern
Wisconsin. Ecological Monographs 27:326-349.
Caporaso, J. G., J. Kuczynski, J. Stombaugh, K. Bittinger, F. D. Bushman, E. K. Costello, N.
Fierer, A. G. Pena, J. K. Goodrich, J. I. Gordon, G. A. Huttley, S. T. Kelley, D. Knights,440
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
22/35
Edwards, U., T. Rogall, H. Blocker, M. Emde, and E. C. Bottger. 1989. Isolation and Direct
Complete Nucleotide Determination of Entire Genes - Characterization of a Gene Coding
for 16s-Ribosomal Rna. Nucleic Acids Research 17:7843-7853.
Fenn, M. E., J. S. Baron, E. B. Allen, H. M. Rueth, K. R. Nydick, L. Geiser, W. D. Bowman, J.455
O. Sickman, T. Meixner, D. W. Johnson, and P. Neitlich. 2003. Ecological effects of
nitrogen deposition in the western United States. Bioscience 53:404-420.
Gardes, M. and T. D. Bruns. 1993. ITS primers with enhanced specificity for basidiomycetes--
application to the identification of mycorrhizae and rusts. Mol Ecol 2:113-118.
Harris, R. F. 1981. Effect of water potential on microbial growth and activity. Pages 23-95 in J.460
F. Parr, W. R. Gardner, and L. F. Elliott, editors. Water Potential Relations in Soil
Microbiology. ASA, Madison, WI.
IPCC. 2013. The Physical Science Basis. Contribution of Working Group I to the Fifth
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
23/35
Larcher, W. 2000. Temperature stress and survival ability of Mediterranean sclerophyllous
plants. Plant Biosystems 134:279-295.475
Lavorel, S. and E. Garnier. 2002. Predicting changes in community composition and ecosystem
functioning from plant traits: revisiting the Holy Grail. Functional Ecology 16:545-556.
Lebauer, D. S. 2010. Litter degradation rate and beta-glucosidase activity increase with fungal
diversity. Canadian Journal of Forest Research-Revue Canadienne De Recherche
Forestiere 40:1076-1085.480
Lloyd, J. and J. A. Taylor. 1994. On the Temperature-Dependence of Soil Respiration.
Functional Ecology 8:315-323.
McGrady-Steed, J., P. M. Harris, and P. J. Morin. 1997. Biodiversity regulates ecosystem
predictability. Nature 390:162-165.
Mille-Lindblom, C. and L. J. Tranvik. 2003. Antagonism between bacteria and fungi on485
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
24/35
Romani, A. M., H. Fischer, C. Mille-Lindblom, and L. J. Tranvik. 2006. Interactions of bacteria495
and fungi on decomposing litter: Differential extracellular enzyme activities. Ecology
87:2559-2569.
Rossman, A. Y., R. E. R. E. Tulloss, T. E. O'Dell, and R. G. Thorn. 1998. Protocols for an all
taxa biodiversity inventory of fungi in a Costa Rican conservation area. Parkway
Publishers, Boone, N.C.500
Schimel, J. P. 1995. Ecosystem consequences of microbial diversity and community structure.
Pages 239-254 in F. S. Chapin and C. Korner, editors. Arctic and Alpine Biodiversity:
patterns, causes, and ecosystem consequences. Springer-Verlag, Berlin.
Schimel, J. P. 2001. Biogeochemical Models: Implicit versus Explicit Microbiology. Pages 177-
183 in E. D. Schulze, M. Heimann, S. Harrison, E. Holland, J. Lloyd, I. C. Prentice, and505
D. Schimel, editors. Global Biogeochem Cycles in the Climate System. Academic Press,
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
25/35
Singh, B. K., R. D. Bardgett, P. Smith, and D. S. Reay. 2010. Microorganisms and climate
change: terrestrial feedbacks and mitigation options. Nature Reviews Microbiology
8:779-790.
Specht, R. L., E. J. Moll, F. Pressinger, and J. Sommerville. 1983. Moisture regime and nutrient520
control of seasonal growth in Mediterranean ecosystems. Pages 120–132 in F. J. Kruger,
D. T. Mitchell, and J. U. M. Jarvis, editors. Mediterranean-type Ecosystems: The Role of
Nutrients. Springer, Berlin.
Strickland, M. S., C. Lauber, N. Fierer, and M. A. Bradford. 2009. Testing the functional
significance of microbial community composition. Ecology 90:441-451.525
Swift, M. J., O. W. Heal, and J. M. Anderson. 1979. Decomposition in terrestrial ecosystems.
Blackwell Scientific Publications, Oxford.
Taylor, B. R., D. Parkinson, and W. F. J. Parsons. 1989. Nitrogen and Lignin Content as
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
26/35
Voriskova, J. and P. Baldrian. 2013. Fungal community on decomposing leaf litter undergoes
rapid successional changes. ISME J 7:477-486.540
White, T. J., T. D. Bruns, S. Lee, and J. Taylor. 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. Pages 315–322 in M. A. Innis, D. H.
Gelfand, J. J. Sninsky, and T. J. White, editors. PCR Protocols: a guide to methods and
applications. Academic Press, Ney York, USA.
Yuste, J. C., J. Penuelas, M. Estiarte, J. Garcia-Mas, S. Mattana, R. Ogaya, M. Pujol, and J.545
Sardans. 2011. Drought-resistant fungi control soil organic matter decomposition and its
response to temperature. Global Change Biology 17:1475-1486.
550
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
27/35
n a l c o m m u n i t y r i c h n e s s a n d a v e r a g
e d a i l y r e s p i r a t i o n r a t e
s a n d
s i z e s o f t h e v a r i a n c e c o m p o n e n t s ) e x p l a i n e d f o r f a c t o r s a
f f e c t i n g
C o m m u n i t y
m p o s i t i o n
F u n g a l C o m
m u n i t y
C o m p o s
i t i o n
A v e
r a g e D a i l y
R e
s p i r a t i o n
P r o p o r t i o n a l
V a r i a t i o n
d f
P
P
r o p o r t i o n a l
V a r i a t i o n
d f
C h
i s q
P
0 . 8
9
7
< 0 . 0
0 1
0 . 8
5
1
6
. 5
0 . 0
1 0
0 . 0
1
3
0 . 5
5 6
N S
3
3 8 . 4
< 0 . 0
0 1
0 . 0
6
2 1
< 0 . 0
0 1
0 . 1
1
1
3 8 . 8
< 0 . 0
0 1
0 . 0
5
0 . 0
4
0 . 9
4
7
< 0 . 0
0 1
0 . 9
4
1
0
. 7
0 . 4
1 6
N S
1
0 . 6
3
N S
1
2 8 . 6
< 0 . 0
0 1
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
28/35
0 . 0
3
7
< 0 . 0
0 1
0 . 0
2
1
7
. 3
0 . 0
0 7
0 . 0
3
0 . 0
4
0 . 8
3
7
< 0 . 0
0 1
0 . 7
8
1
0
. 0
1 . 0
0 0
N S
1
0 . 4
5 3
N S
1
1 6 . 5
< 0 . 0
0 1
0 . 1
2
7
< 0 . 0
0 1
0 . 1
8
1
2 9 . 4
< 0 . 0
0 1
0 . 0
5
0 . 0
3
0 . 9
5
7
< 0 . 0
0 1
0 . 9
2
1
1
. 2
0 . 2
8 0
N S
1
0 . 1
2 9
N S
1
1 5 . 7
< 0 . 0
0 1
0 . 0
2
7
< 0 . 0
0 1
0 . 0
4
1
3
. 4
0 . 0
7 0
0 . 0
3
0 . 0
4
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
29/35
Table 2. The variance in mean difference of average respiration rate between control
microcosms and microcosms undergoing each of the three environmental treatments, as well as
Bartlett's K-squared test statistic for homogeneity of variances. A smaller K-squared value
corresponds to more homogenous variances between groups.
565
Treatment
Mean Difference
Variance
Bartlett's
K-squared Probability
Reduced Moisture 1.38 0.01 0.926
Elevated Nitrogen 6.65 5.99 0.014
Elevated Temperature 1.49 2.92 0.087
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
30/35
Figure Legends570
Figure 1. Non-metric multidimensional scaling (NMDS) ordination based on Bray Curtis
similarities depicting fungal community composition. The samples inoculated with the same
initial microbial community are displayed in the same symbol color (8 communities total). The
shape of the symbols represent the environmental treatment, either control conditions (filled
squares), reduced moisture (open squares), elevated nitrogen (diamonds), and increased575
temperature (triangles). The initial microbial inoculum (stars) is also plotted but excluded from
analyses. N = 3 per community and treatment combination.
Figure 2. Daily microbial respiration rates for all microbial communities averaged over 60 days
for each environmental treatment. Blue boxes represent microcosms in control conditions,580
yellow in reduced moisture microcosms, red in elevated temperature microcosms, and green in
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
31/35
Figure 4. Correlation of all community and functional responses to each of the three
environmental treatments. Each point represents the percent of taxa in a given community that
had significantly different relative abundances when exposed to a perturbation treatment and the
corresponding percent change in average respiration rate compared to the control treatment. The595
percent of significant taxa responses to the environmental treatments were moderately correlated
with the corresponding change in average community respiration ( R
2
=0.16, p=0.05), but this was
largely driven by the nitrogen addition treatment ( R2=0.22, p=0.24). Each point is labeled by
community and represents the average of a given community-environment combination.
600
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
32/35
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
33/35
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
34/35
8/9/2019 Microbial composition alters the response of litter decomposition to environmental change
35/35