Mediating effect of ROS on mtDNA damage and low ATP content induced by arsenic trioxide in mouse oocytes

Toxicology in Vitro 25 (2011) 979–984

Contents lists available at ScienceDirect

Toxicology in Vitro

journal homepage: www.elsevier .com/locate / toxinvi t

Mediating effect of ROS on mtDNA damage and low ATP content inducedby arsenic trioxide in mouse oocytes

Wenya Zhang, Yingxia Liu, Zhen An, Dejun Huang, Yongmei Qi, Yingmei Zhang ⇑School of Life Sciences, Lanzhou University, Lanzhou 730000, China

a r t i c l e i n f o a b s t r a c t

Article history:Received 1 December 2010Accepted 14 March 2011Available online 17 March 2011

Keywords:As2O3

Mouse oocytemtDNA damageROS

0887-2333/$ - see front matter � 2011 Elsevier Ltd. Adoi:10.1016/j.tiv.2011.03.009

Abbreviations: ATP, adenosine triphosphates; DCcein-diacetate; eCG, equine Chronic Gonadotropin;metaphase II; mtDNA, mitochondrial DNA; nDNA, nCysteine; ROS, reactive oxygen species; As2O3, arseni⇑ Corresponding author. Tel.: +86 13919123067; fa

E-mail address: [email protected] (Y. Zhang).

Mitochondria provide most of the adenosine triphosphates (ATP) necessary for the maturation of oocytes.Various environmental toxicants would lead damage to mitochondrial DNA (mtDNA) and hence interferewith oocytes development. In the current study, the effect of arsenic trioxide (As2O3) on the common3867 bp deletion and the copy number of mtDNA in mitochondria of mouse oocytes in vivo or in vitro,as well as the molecular pathway leading to the damage were investigated. PCR strategy was used todetect the damage of mtDNA. Reactive oxygen species (ROS) and ATP content in oocytes were checkedto determine the influence of As2O3 on oxidative stress and activity of mitochondria. The results showedthat As2O3 could obviously decrease the copy number of mtDNA and cause severe 3867 bp deletion inmitochondria together with elevated ROS level, while ATP content was decreased. Co-treatment withN-Acetyl-Cysteine (NAC) efficiently eliminated ROS induced by As2O3, lessened the mtDNA damageand enhanced ATP content in mouse oocytes both in vivo and in vitro. Taken together, the present studyrevealed that As2O3 could cause severe mtDNA damage and decrease ATP content by inducing excessiveROS, and this damage would then probably restrain the further development of mouse oocytes.

� 2011 Elsevier Ltd. All rights reserved.

1. Introduction after fertilization (Kaneda et al., 1995; May-Panloup et al., 2007).

Mitochondria provide the majority of energy in eukaryotic cellsby generating most of the adenosine triphosphates (ATP) necessaryfor energy-dependent biological processes, such as cellular ener-getic metabolism, homeostasis, and death (Chiaratti et al., 2010).Each mitochondrion carries its own multicopy genome coding for13 essential subunits of the respiratory enzyme complexes (May-Panloup et al., 2005). The mitochondrial DNA (mtDNA), which ex-ists inside the organelle with high oxidative stress, exhibits greatlyhigher mutation rate compared with nuclear DNA (nDNA) for thelack of protective histones (Partridge et al., 2007; Witt et al.,1998). Mitochondria function is strongly associated with theamount of mtDNA and the copy number of mtDNA may vary fromhundreds to thousands among different cell types in which oocyteswere reported to contain the largest mtDNA copy number (Mi-chaels et al., 1982).

Mammal mitochondria are normally inherited exclusively fromthe oocytes as paternal mitochondria are specifically eliminated

ll rights reserved.

FH-DA, 20 ,70-dichlorofluores-GV, germinal vesicle; MII,

uclear DNA; NAC, N-Acetyl-c trioxide.x: +86 931 8913631.

The activity of mitochondria mainly affected by the mtDNA copynumber in oocytes is conversely correlated with maternal agingand reproductive success (Zhang et al., 2006). The importance ofthe quantity of the mtDNA for the development of oocytes andearly embryos is highlighted and wide variability in mtDNA copynumber is present in fully developed oocytes (Chiaratti et al.,2010). The mtDNA copy number is suggested to be an indicatorof oocytes competence as a critical threshold of approximately100,000 copies in the mature oocytes has been proposed for mouseand human (Spikings et al., 2007). Low mtDNA content in humanoocytes as well as high incidence of mtDNA deletion of 4977 bp,truncated from 8470 to 13,459 in mtDNA genome, detected at highfrequencies in various aging tissues and oocytes, are intimately re-lated to poor development ability of embryos (Sun et al., 2009).

It is well accepted that the production of reactive oxygen spe-cies (ROS) is the main reason for oxidative damage of DNA (Bhas-kar et al., 2008; Cavallo et al., 2003). As a rich source of ROS,mitochondria are located in the environment with high oxidativepressure and lack the DNA repair mechanism, thus contributingto mtDNA mutation accumulation (Haghdoost et al., 2005; Wanget al., 2009). Moreover, the oxidative phosphorylation within mito-chondria provides a major source needed for oocytes maturationfrom germinal vesicle (GV) stage to mature metaphase II (MII),identified by the appearance of the first polar body, whichconsume high levels of ATP (Dumollard et al., 2008). Over produc-

980 W. Zhang et al. / Toxicology in Vitro 25 (2011) 979–984

tion of ROS, however, cannot generate but consume ATP as ROSwould damage the ATP synthase so that ATP content within oo-cytes decreases and therefore leading to mitochondria dysfunction(Lawlor and Tezara, 2009; Van Blerkom et al., 1995).

Arsenic is an abundant toxicant in ground water and soil aroundareas with extractive industries, mostly with higher levels than thecurrently approved 10 lg/L maximum contaminant level (Myerset al., 2010; Parvez et al., 2006). Arsenic pollution in drinking waterhas been linked to defective placental vasculogenesis, develop-mental defects and miscarriage (He et al., 2007). However, theunderlying mechanism was perplexing.

Using a PCR approach, the present study detected the effect ofarsenic trioxide (As2O3) on mtDNA copy number, common deletion(3867 bp relative to human 4977 bp) as well as ATP content ofmouse oocytes cultured from GV to MII in vitro or in GV stagein vivo, with the hypothesis that excessive ROS induced by As2O3

was the cause of the damage to mtDNA. To the best of our knowl-edge, this study is the first one to appreciate the role of ROS inmtDNA mutation induced by As2O3 in oocytes.

2. Materials and methods

2.1. Animals

In all experiments, female Kunming mice obtained from theExperimental Animal Center of Lanzhou University (Lanzhou, Chi-na) were used and acclimated in the laboratory for 2 weeks beforethe experiments. Mice were housed in groups in stainless steelcages in an environmentally controlled room at 22–24 �C with a12/12 h light/dark photoperiod with food and water available adlibitum. Before ovary removal, mice were killed by cervical disloca-tion (American Veterinary Medical Association, 2001) under anes-thesia. All mice received humane care in compliance with theInstitutional Animal Care and Use Committee guidelines.

2.2. Oocytes collection and culture (in vitro assay)

For in vitro assay, the ovaries were removed from 20 to 24 gmice that had been administered 5 IU equine Chronic Gonadotro-pin (eCG, Sansheng Pharmaceutical, China) 46 h earlier, and trans-ferred to pre-warmed medium. The GV oocytes were carefullydenuded and put in culture as previously described (Brunet et al.,2003) with different doses of As2O3 (0, 0.5, 1, 2, 4 lM) + N-Acet-yl-Cysteine (NAC) (0, 1, 5 mM), 20 oocytes in each treatment, and3 replicates were set for each group. The oocytes were then cul-tured for 20 h for the release of the first polar body in all treatedgroups. Afterward, the oocytes that extruded the first polar bodywould be arrested at MII.

Fig. 1. Sample chart for 3867 bp deletion in mtDNA of mouse oocyte.

2.3. Establishment of mouse model (in vivo assay)

Female mice (18–22 g) were randomly divided into 10 groups(8 mice in each group) as follows: the control group was adminis-tered normal saline and the mice in other experimental groups re-ceived different doses of As2O3 (0.5, 1, 2 mg/kg bw/day) + NAC (0,100, 200 mg/kg bw/day), respectively, by intraperitoneal injection.The dose levels of As2O3 selected for the study were based on WHOguidelines (WHO, 1996) according to which LD50 of arsenous oxidein rats is 180 mg/kg and the minimum lethal dose for humans is2 mg/kg. After 30 days, all mice were sacrificed by cervical disloca-tion under anesthesia, the ovaries in each group were quickly ex-cised, and the GV oocytes were carefully denuded and put inculture as previously described, the related experiments were doneafterward.

2.4. Measurement of ATP and ROS in oocytes in vivo and in vitro

The measurement of intracellular ATP was performed using anFlx800 luminometer (Biotek, USA) and a commercial assay kit(Beyotime Institute of Biotechnology, China) based on the lucif-erin–luciferase reaction following the manufacturer’s recommen-dations. A standard curve was calculated using the formuladerived from the linear regression of the standard curve.

The measurement of intracellular ROS was determined using20,70-dichlorofluorescein-diacetate (DCFH-DA) according to themanufacturer’s recommendations (Beyotime). DCFH-DA can becleaved by esterases to a nonfluorescent form DCFH, which couldthen be oxidized to fluorescent compound DCF by ROS. ROS con-tent was detected with LS55 fluorescence spectrophotometer (Per-kin–Elmer, USA) using filter settings at excitation and emissionwavelengths of 488 and 525 nm (Dong et al., 2009).

2.5. DNA extraction

DNA in oocytes was extracted using a genomic/mitochondrialDNA preparation kit (Occam Biolabs, USA) according to the manu-facturer’s recommendations. After extraction, the DNA was main-tained at �20 �C for use. The extraction efficiency, assessed asdescribed elsewhere (Reynier et al., 2001) was >90%.

2.6. Determination of copy number of mtDNA in oocytes

The iCycler iQ5 real time fluorescent quantitative PCR instru-ment (Bio-Rad Laboratories, USA) was used to determine themtDNA copy number using SYBR Green Quantitative PCR kit (Taka-ra, China) following the manufacture’s protocol. Amplification wascarried out in a total volume of 25 ll as follows: initial denaturingat 95 �C for 30 s and 40 cycles of 5 s at 95 �C and 25 s at 57 �C. Sam-ples were run in triplicate, with a good reproducibility. The SYBRGreen fluorescence was read at the end of each extension step. Amelting curve was analyzed in order to check the specificity ofPCR product. For each run, a standard curve (log of the initial tem-plate copy number on the abscissa, and the cycle number at thecrossing point on the ordinates) was generated by using five 10-fold serial dilutions (100–1,000,000 copies) of the external stan-dard. This curve allowed the determination of the starting copynumber of mtDNA in each sample. The primers for qPCR were frag-ments outside the hotspot of deletion area (forward primer:CCCGCTCTACCTCACCAT; reverse primer: GCCCATTTCTTCCCATTT).

2.7. Detection of 3867 bp deletion

To detect the 3867 bp deletion (Fig. 1), a semiquantitative PCRstrategy was applied. Oligonucleotide sequences were taken frommtDNA sequence analysis by Akimoto et al. (2005). PrimersM12893 (GCCATTCCTAACAGGGTTCTACTCA) and M14213

Fig. 2. Effects of As2O3 on ROS, ATP content and mtDNA copy number of mouse oocytes in vitro. (A) Effects of As2O3 on ROS level. (B) Effects of As2O3 on ATP content andmtDNA copy number. ⁄p < 0.05 compared with control.

Fig. 3. Effects of As2O3 + NAC on ROS, ATP content, mtDNA copy number and 3867 bp deletion of mtDNA in mouse oocytes in vitro. (A) Effects of As2O3 + NAC on ROS level. (B)Effects of As2O3 + NAC on ATP content and mtDNA copy number. (C) Effects of As2O3 + NAC on 3867 bp deletion of mtDNA in mouse oocytes: (a) shows the PCR productsamplified by primers inside the 3867 bp deletion which stands for common mtDNA without deletion and (b) shows the PCR products amplified by primers outside the3867 bp deletion which stands for mtDNA with deletion. ⁄p < 0.05 compared with control, #p < 0.05 compared with 0.5 lM As2O3.

W. Zhang et al. / Toxicology in Vitro 25 (2011) 979–984 981

(GGGTAGGTCAATGAATGAGTGGTT) inside the common deletion re-gion in 3867 bp were used for amplification of a 1321 bp product inundeleted mtDNA. Primers M8859 (TCCTATTCATCGTCTCGGAAG-

TAT) and M14213 (GGGTAGGTCAATGAATGAGTGGTT) outside thedeletion region were used to detect the 3867 bp deletion in oocyteswith the production of 1587 bp as the 3867 bp deletion would then

982 W. Zhang et al. / Toxicology in Vitro 25 (2011) 979–984

bring the primers closer to each other. Each PCR mixture was madeto a final volume of 25 ll containing 1 ll of each primer, 4 ll ofdNTP mixture, 5 ll of 10 � PCR buffer, 0.25 U of Taq polymeraseand 2.5 ng kDNA. The initial denaturation step was performed at95 �C for 5 min. This was followed by 45 cycles of denaturation at94 �C for 30 s, annealing at 58 �C for 30 s, elongation at 72 �C for1 min and a final extension at 72 �C for 10 min. The PCR productswere separated on 1% agarose gel stained with ethidium bromide.

2.8. Statistical analysis

Data were analyzed by Student’s t-test and one way analysis ofvariance (ANOVA) by SPSS 16.0. The criterion of statistical differ-ence was taken as p < 0.05.

3. Results

3.1. Effects of As2O3 on ROS, ATP content and mtDNA copy number ofmouse oocytes in vitro

In in vitro assay, As2O3 increased ROS level in mouse oocytes in adose dependent manner, meanwhile, both ATP content as well asmtDNA copy number in oocytes decreased sharply (p < 0.05)(Fig. 2). Besides, all doses of As2O3 used in the present study didnot affected the survivability of oocytes as judged by morphologi-cal appearance and trypan blue exclusion as described elsewhere(Didion et al., 1990) (data not shown).

Fig. 4. Effects of As2O3 + NAC on ROS, ATP content, mtDNA copy number and 3867 bp delEffects of As2O3 + NAC on ATP content and mtDNA copy number. (C) Effects of As2O3 +amplified by primers inside the 3867 bp deletion which stands for common mtDNA w3867 bp deletion which stands for mtDNA with deletion. ⁄p < 0.05 compared with contr

3.2. Effects of As2O3 + NAC on ROS, ATP content and mtDNA copynumber of mouse oocytes in vitro

As shown in Fig. 3(A) and (B), use of NAC efficiently eliminatedexcessive ROS induced by As2O3 and elevated mtDNA copy numberin mouse oocytes sharply compared to oocytes treated with As2O3

alone (p < 0.05). Besides, co-treatment with high dose of NAC(5 mM) increased ATP content more significantly than low doseof NAC (1 mM) (p < 0.05). Moreover, single use of both doses ofNAC (1, 5 mM) in the present study did not affect ATP or mtDNAintegrity (p > 0.05, data not shown).

3.3. Effects of As2O3 + NAC on 3867 bp deletion of mtDNA in mouseoocytes in vitro

Obvious 3867 bp deletion in mtDNA of mouse oocytes treatedby As2O3 was shown in in vitro assay. Co-treatment with NAChighly efficiently lightened the 3867 bp deletion caused by As2O3

(Fig. 3C (a and b)).

3.4. Effects of As2O3 + NAC on ROS, ATP content and mtDNA damage inmouse oocytes in vivo

Similar to the results in in vitro assay, high doses of As2O3 (1,2 mg/kg bw/day) greatly improved ROS level in mouse oocytesin vivo, meanwhile, ATP content as well as mtDNA copy numberdecreased compared to control (p < 0.05). However, low dose ofAs2O3 (0.5 mg/kg bw/day) didn’t cause any significant changes tothese parameters (p > 0.05) except the decreased ATP content.

etion of mtDNA in mouse oocytes in vivo. (A) Effects of As2O3 + NAC on ROS level. (B)NAC on 3867 bp deletion of mtDNA in mouse oocytes: (a) shows the PCR productsithout deletion and (b) shows the PCR products amplified by primers outside theol, #p < 0.05 compared with 1 mg/kg bw/day As2O3.

W. Zhang et al. / Toxicology in Vitro 25 (2011) 979–984 983

Co-treatment with NAC (100, 200 mg/kg bw/day) efficiently scav-enged excessive ROS caused by As2O3 in mouse oocytes in vivo,ATP content and mtDNA copy number were recovered simulta-neously (p < 0.05) (Fig. 4(A and B)). PCR bands also showed thathigh doses of As2O3 (1, 2 mg/kg bw/day) has lead to 3867 bp dele-tion in mtDNA, while use of NAC lessened the deletion (Fig. 4C (aand b)).

4. Discussion

High mtDNA copy number in the mature oocytes is responsiblefor early postimplantation embryo development and successivereproduction (Wai et al., 2010). The incidences of mtDNA rear-rangement are inversely related to oocytes development, andimmature oocytes with high mtDNA deletion would not developfurther (Chan et al., 2005). In the present study, obvious 3867 bpdeletion and low copy number of mtDNA were shown in mouseoocytes treated both in vivo and in vitro with relatively low concen-trations of As2O3 compared to environmental pollution levels.Meanwhile, ROS level increased dramatically while ATP contentdecreased in all treated groups in in vitro assay in a dose-depen-dent manner (Fig. 2). All these indicate that As2O3 would damagemtDNA and hence decrease oocytes activities such as energy statusand metabolic activity by the judge of ATP content. However, co-treatment with NAC efficiently eliminated the damage caused byAs2O3 through the scavenging of excessive ROS and recoveredATP content in mouse oocytes in vitro (Fig. 3). Moreover, no celldeath was found as judged by morphological appearance and try-pan blue exclusion, suggesting that ROS was directly responsiblefor the damage of mtDNA in oocytes. In in vivo assay, only highdoses of As2O3 (1, 2 mg/kb bw/day) displayed the similar effectsas mentioned above (Fig. 4). Low dose of As2O3 (0.5 mg/kb bw/day) did not cause significant decrement in mtDNA copy number,and it was obvious that the mtDNA content of the in vivo-As2O3-treated oocytes was significantly higher than that of the in vitro-As2O3-treated oocytes except for control. These may be contrib-uted to different stages of oocytes, in in vivo assay, the oocyteswere at the GV stage, while in in vitro assay, oocytes have devel-oped into MII stage. As was reported, the mtDNA copy numberper oocyte was greater at the MII stage than that at the GV stagebecause oocytes would produce more mitochondria as develop-ment proceeds (Jiao et al., 2007). However, in oocytes treated withAs2O3, the susceptibility towards toxicants may differ at differentdevelopmental stages. In addition, despite the paucity of protectivehistones in mtDNA, in vivo mitochondria own the ability to repairlow mitochondria damage as mitochondria are confirmed to con-tain all the enzymes required for base excision repair (Mandavilliet al., 2002). Severe mtDNA damage that can not be repaired wouldlead to the disruption of electron transport chain and production ofmore ROS which further lead to the damage of mtDNA. Besides, adecrease in ATP level was shown in in vitro assay in As2O3 + NAC-treated oocytes compared to the groups treated with 0.5 As2O3

(Fig. 3(B)), this may be contributed to high ATP consumption inmature MII oocytes (Dumollard et al., 2004), compared to As2O3-treated oocytes, co-treatment with NAC availably scavengedredundant ROS and lifted mtDNA copy number, thus, the oocyteswould be more sufficient for the maturation and would consumemore ATP for the preparation of the following development. Com-pared to the results in vivo, the oocytes in vitro lack the compensa-tion response, which would reduce ATP level and mtDNA copynumber.

Oocytes containing impaired mtDNA are less competent to sup-port further embryo development because of the postulated pres-ence of a ‘bottleneck’, limiting the number of transmitted mtDNA(Brenner et al., 1998). Moreover, sufficient ATP content in oocytes

is the precondition for the following fertilization and preimplanta-tion (Wang et al., 2009). Thus, the oocytes with damaged mtDNAcaused by As2O3 in the present study would probably be inade-quate to undergo further development.

In conclusion, results of the present study demonstrated thatenvironmental relevant concentrations of As2O3 could causemtDNA damage like high 3867 bp deletion and low copy numberin mouse oocytes and result in low ATP content through the induc-tion of ROS, which would then impact the further development ofoocytes. Also, this study verified that clearance of excessive ROS in-duced by toxic substance could be an efficacious way in protectingimpaired oocytes as well as other tissues.

5. Conflict of interest statement

The authors declare that there is no conflict of interest involvedin this study.

Acknowledgements

This work was financially supported by the Natural ScienceFoundation of Gansu Province, China (No. 1010RJZA107) and Na-tional Natural Science Foundation of China (No. 20907019).

References

Akimoto, M., Niikura, M., Ichikawa, M., Yonekawa, H., Nakada, K., Honma, Y.,Hayashi, J., 2005. Nuclear DNA but not mtDNA controls tumor phenotypes inmouse cells. Biochem. Biophys. Res. Commun. 327, 1028–1035.

American Veterinary Medical Association, 2001. 2000 Report of the AVMA Panel onEuthanasia. J. Am. Vet. Med. Assoc. 218, 669–696.

Bhaskar, A.S.B., Deb, U., Kumar, O., Lakshmana Rao, P.V., 2008. Abrin inducedoxidative stress mediated DNA damage in human leukemic cells and its reversalby N-acetylcysteine. Toxicol. In Vitro 22, 1902–1908.

Brenner, C.A., Wolny, Y.M., Barritt, J.A., Matt, D.W., Munne, S., Cohen, J., 1998.Mitochondrial DNA deletion in human oocytes and embryos. Mol. Hum. Reprod.4, 887–892.

Brunet, S., Pahlavan, G., Taylor, S., Maro, B., 2003. Functionality of the spindlecheckpoint during the first meiotic division of mammalian oocytes.Reproduction 126, 443–450.

Cavallo, D., Ursini, C.L., Setini, A., Chianese, C., Piegari, P., Perniconi, B., Iavicoli, S.,2003. Evaluation of oxidative damage and inhibition of DNA repair in an in vitrostudy of nickel exposure. Toxicol. In Vitro 17, 603–607.

Chan, C.C., Liu, V.W., Lau, E.Y., Yeung, W.S., Ng, E.H., Ho, P.C., 2005. MitochondrialDNA content and 4977 bp deletion in unfertilized oocytes. Mol. Hum. Reprod.11, 843–846.

Chiaratti, M.R., Bressan, F.F., Ferreira, C.R., Caetano, A.R., Smith, L.C., Vercesi, A.E.,Meirelles, F.V., 2010. Embryo mitochondrial DNA depletion is reversed duringearly embryogenesis in cattle. Biol. Reprod. 82, 76–85.

Didion, B.A., Pomp, D., Martin, M.J., Homanics, G.E., Markert, C.L., 1990. Observationson the cooling and cryopreservation of pig oocytes at the germinal vesicle stage.J. Anim. Sci. 68, 2803–2810.

Dong, S., Zhao, Y., Liu, H., Yang, X., Wang, K., 2009. Duality of effect of La3+ onmitochondrial permeability transition pore depending on the concentration.Biochem. Biophys. Res. Commun. 22, 917–926.

Dumollard, R., Marangos, P., Fitzharris, G., Swann, K., Duchen, M., Carroll, J., 2004.Sperm-triggered [Ca2+] oscillations and Ca2+ homeostasis in the mouse egg havean absolute requirement for mitochondrial ATP production. Development 131,3057–3067.

Dumollard, R., Campbell, K., Halet, G., Carroll, J., Swann, K., 2008. Regulation ofcytosolic and mitochondrial ATP levels in mouse eggs and zygotes. Dev. Biol.316, 431–440.

Haghdoost, S., Czene, S., Naslund, I., Skog, S., Harms-Ringdahl, M., 2005.Extracellular 8-oxo-dG as a sensitive parameter for oxidative stress in vivoand in vitro. Free Radic. Res. 39, 153–162.

He, W., Greenwell, R.J., Brooks, D.M., Calderon-Garciduenas, L., Beall, H.D., Coffin,J.D., 2007. Arsenic exposure in pregnant mice disrupts placental vasculogenesisand causes spontaneous abortion. Toxicol. Sci. 99, 244–253.

Jiao, F., Yan, J.B., Yang, X.Y., Li, H., Wang, Q., Huang, S.Z., Zeng, F., Zeng, Y.T., 2007.Effect of oocyte mitochondrial DNA haplotype on bovine somatic cell nucleartransfer efficiency. Mol. Reprod. Dev. 74, 1278–1286.

Kaneda, H., Hayashi, J., Takahama, S., Taya, C., Lindahl, K.F., Yonekawa, H., 1995.Elimination of paternal mitochondrial DNA in intraspecific crosses during earlymouse embryogenesis. Proc. Natl. Acad. Sci. USA 92, 4542–4546.

Lawlor, D.W., Tezara, W., 2009. Causes of decreased photosynthetic rate andmetabolic capacity in water-deficient leaf cells: a critical evaluation ofmechanisms and integration of processes. Ann. Bot. 103, 561–579.

984 W. Zhang et al. / Toxicology in Vitro 25 (2011) 979–984

Mandavilli, B.S., Santos, J.H., Van Houten, B., 2002. Mitochondrial DNA repair andaging. Mutat. Res. 509, 127–151.

May-Panloup, P., Chretien, M.F., Jacques, C., Vasseur, C., Malthiery, Y., Reynier, P.,2005. Low oocyte mitochondrial DNA content in ovarian insufficiency. Hum.Reprod. 20, 593–597.

May-Panloup, P., Chretien, M.F., Malthiery, Y., Reynier, P., 2007. Mitochondrial DNAin the oocyte and the developing embryo. Curr. Top. Dev. Biol. 77, 51–83.

Michaels, G.S., Hauswirth, W.W., Laipis, P.J., 1982. Mitochondrial DNA copy numberin bovine oocytes and somatic cells. Dev. Biol. 94, 246–251.

Myers, S.L., Lobdell, D.T., Liu, Z., Xia, Y., Ren, H., Li, Y., Kwok, R.K., Mumford, J.L.,Mendola, P., 2010. Maternal drinking water arsenic exposure and perinataloutcomes in inner Mongolia, China. J. Epidemiol. Community Health 64, 325–329.

Partridge, M.A., Huang, S.X., Hernandez-Rosa, E., Davidson, M.M., Hei, T.K., 2007.Arsenic induced mitochondrial DNA damage and altered mitochondrialoxidative function: implications for genotoxic mechanisms in mammaliancells. Cancer Res. 67, 5239–5247.

Parvez, F., Chen, Y., Argos, M., Hussain, A.Z., Momotaj, H., Dhar, R., van Geen, A.,Graziano, J.H., Ahsan, H., 2006. Prevalence of arsenic exposure from drinkingwater and awareness of its health risks in a Bangladeshi population: resultsfrom a large population-based study. Environ. Health Perspect. 114, 355–359.

Reynier, P., May-Panloup, P., Chretien, M.F., Morgan, C.J., Jean, M., Savagner, F.,Barriere, P., Malthiery, Y., 2001. Mitochondrial DNA content affects thefertilizability of human oocytes. Mol. Hum. Reprod. 7, 425–429.

Spikings, E.C., Alderson, J., St John, J.C., 2007. Regulated mitochondrial DNAreplication during oocyte maturation is essential for successful porcineembryonic development. Biol. Reprod. 76, 327–335.

Sun, M.J., Cheng, W.L., Wei, Y.H., Kuo, C.L., Sun, S., Tsai, H.D., Lin, H.M., Liu, C.S., 2009.Low copy number and high 4977 deletion of mitochondrial DNA in uterosacralligaments are associated with pelvic organ prolapse progression. Int.Urogynecol. J. Pelvic Floor Dysfunct. 20, 867–872.

Van Blerkom, J., Davis, P.W., Lee, J., 1995. ATP content of human oocytes anddevelopmental potential and outcome after in-vitro fertilization and embryotransfer. Hum. Reprod. 10, 415–424.

Wai, T., Ao, A., Zhang, X., Cyr, D., Dufort, D., Shoubridge, E.A., 2010. The role ofmitochondrial DNA copy number in mammalian fertility. Biol. Reprod. 83, 52–62.

Wang, L.Y., Wang, D.H., Zou, X.Y., Xu, C.M., 2009. Mitochondrial functions onoocytes and preimplantation embryos. J. Zhejiang Univ. Sci. B 10, 483–492.

WHO, 1996. World Health Organization: The WHO guidelines to classification ofpesticides by hazard.

Witt, A., Ahr, H.J., Brendler-Schwaab, S., Enzmann, H., Steinke, W., 1998. Carcinogen-induced mitochondrial DNA damage in the in ovo model. Toxicol. In Vitro 12,329–333.

Zhang, X., Wu, X.Q., Lu, S., Guo, Y.L., Ma, X., 2006. Deficit of mitochondria-derivedATP during oxidative stress impairs mouse MII oocyte spindles. Cell Res. 16,841–850.