Maternal embryonic leucine zipper kinase/murine protein serine-threonine kinase 38 is a promising therapeutic target for multiple cancers

Maternal Embryonic Leucine Zipper Kinase/Murine Protein

Serine-Threonine Kinase 38 Is a Promising Therapeutic

Target for Multiple Cancers

Daniel Gray,1Adrian M. Jubb,

2Deborah Hogue,

1Patrick Dowd,

1Noelyn Kljavin,

1

Sothy Yi,1Wei Bai,

2Gretchen Frantz,

2Zemin Zhang,

3Hartmut Koeppen,

2

Frederic J. de Sauvage,1and David P. Davis

1

Departments of 1Molecular Biology, 2Pathology, and 3Bioinformatics, Genentech, Inc., South San Francisco, California

Abstract

To identify genes that could serve as targets for novel cancertherapeutics, we used a bioinformatic analysis of microarraydata comparing gene expression between normal and tumor-derived primary human tissues. From this approach, we havefound that maternal embryonic leucine zipper kinase (Melk),a member of the AMP serine/threonine kinase family, exhibitsmultiple features consistent with the potential utility of thisgene as an anticancer target. An oligonucleotide microarrayanalysis of multiple human tumor samples and cell linessuggests that Melk expression is frequently elevated in cancerrelative to normal tissues, a pattern confirmed by quantitativereverse transcription-PCR and Western blotting of selectedprimary tumor samples. In situ hybridization localized Melkexpression to malignant epithelial cells in 96%, 23%, and 13%of colorectal, lung, and ovarian tissue tumor samples,respectively. Expression of this gene is also elevated in spon-taneous tumors derived from the ApcMin and Apc1638N murinemodels of intestinal tumorigenesis. To begin addressingwhether Melk is relevant for tumorigenesis, RNA interfer-ence–mediated silencing within human and murine tumor celllines was done. We show that Melk knockdown decreasesproliferation and anchorage-independent growth in vitro aswell as tumor growth in a xenograft model. Together, theseresults suggest that Melk may provide a growth advantage forneoplastic cells and, therefore, inactivation may be therapeu-tically beneficial. (Cancer Res 2005; 65(21): 9751-61)

Introduction

Progress toward effective disease management in the clinic hasbeen achieved by an understanding of the relevant signalingpathways. The clinical benefit derived from rationally designed,targeted therapies, such as trastuzumab (1, 2), STI571 (3), gefitinib(4, 5), cetuximab (6), and erlotinib (7, 8), has shown the valueof defining the molecular phenotypes of a given tumor type.Therefore, we have sought to identify additional genes that serve avital role in the growth and maintenance of a given tumor, therebyhopefully revealing novel therapeutic targets. In addressing thissubject, we propose that maternal embryonic leucine zipper kinase

(Melk), an AMP-activated protein kinase (AMPK)–related serine/threonine kinase, may serve a key functional role within multiplecancers.The AMPK family comprises two isoforms of AMPK (a1 and a2)

and 12 AMPK-related kinases (9). Although the AMPK isoformshave been labeled the cellular ‘‘fuel gauge’’ because of their abilityto respond to slight changes in the ATP-to-AMP ratio (10), thefunctional significance of the AMPK-related members is not as wellcharacterized. Melk is conserved among multiple species [pEg3,Xenopus (11); KIAA0175, human (12); murine protein serine-threonine kinase 38/Melk, murine (13, 14)] and was initiallyidentified as a maternal message in both mouse and Xenopusoocytes (11, 14). Although little is known concerning themechanisms of Melk regulation or activity in the cell, recentstudies have suggested a role in mitosis. Melk expression andkinase activity have been shown to be maximal during mitosis inXenopus embryos and mammalian cells (15, 16). The identificationof potential Melk substrates has provided additional links to thecell cycle and some hints with respect to its signaling pathway.First, Melk has been shown to phosphorylate CDC25B on Ser323

in vitro (16), a critical 14-3-3 binding site (17, 18). Binding of 14-3-3proteins to CDC25 is thought to negatively regulate CDC25phosphatase activity during the cell cycle (19). Additional reportedMelk substrates include ZPR9, a novel zinc finger–like protein (20),and NIPP1, a splicing factor involved in spliceosome assembly (21).Both proteins were initially discovered to associate with Melkthrough yeast two-hybrid screens and build on the likelyinvolvement of Melk in the cell cycle. For example, Seong et al.(20) showed that Melk phosphorylates ZPR9 in vitro and promotesits nuclear localization in vivo . In agreement with its predicted roleas a transcription factor, ZPR9 was subsequently shown to interactwith and enhance the transcriptional activity of B-MYB (22),a protein whose activity is tightly regulated by the cell cycle (23).Finally, Vulsteke et al. (21) found that the interaction between Melkand NIPP1 is largely dependent on the presence of a phosphor-ylated Thr478 within the COOH terminus of Melk. This associationbetween Melk and NIPP1 was maximal during mitosis andprevented spliceosome assembly in cell extracts. Interestingly, thebinding of NIPP1 to Melk, as well as the resulting inhibition ofspliceosome assembly, did not seem to require an active Melkkinase (21). Although it is unclear whether NIPP1 is a substrate ofthe kinase activity of Melk, the interaction between these twoproteins again supports a close link between Melk and the cellcycle.We have identified Melk as a potential anticancer target from a

bioinformatics analysis of oligonucleotide microarray data com-paring gene expression between human tumor and normal tissues.

Note: Supplementary data for this article are available at Cancer Research Online(http://cancerres.aacrjournals.org/).

Requests for reprints: David P. Davis, Department of Molecular Biology,Genentech, Inc., 1 DNA Way, South San Francisco, CA 94080. Phone: 650-225-6129;E-mail: [email protected].

I2005 American Association for Cancer Research.doi:10.1158/0008-5472.CAN-04-4531

www.aacrjournals.org 9751 Cancer Res 2005; 65: (21). November 1, 2005

Research Article

Research. on February 19, 2016. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

The correlation between Melk expression and cancer is supportedby quantitative reverse transcription-PCR (qRT-PCR), in situhybridization, and Western analyses of tumor samples and celllines. Whereas the most consistent increase in expression wasobserved in colon tumors, elevated Melk levels were found in abroad range of cancer types. Using RNA interference (RNAi), weshow that Melk knockdown results in an accumulation of cells atthe G2-M transition. Furthermore, Melk knockdown decreased thetransformed phenotype of multiple tumor cells lines as measuredby both in vitro (proliferation, anchorage-independent growth) andin vivo (xenograft) assays. Together, these results suggest that Melkis required for tumorigenesis and, therefore, targeting this serine/threonine kinase with a small molecule inhibitor may serve as aneffective cancer therapy.

Materials and Methods

Cell lines and tissue samples. All cell lines used in this study were

obtained from American Type Culture Collection (Manassas, VA) and were

maintained under recommended conditions. Anonymized fresh-frozen andformalin-fixed, paraffin-embedded human tissues were obtained from the

Genentech pathology archives. Tissue microarrays were constructed as

described previously (24, 25). ApcMin and Apc1638N mice (26) were

euthanized at f3 months of age. At autopsy, the intestines were removed,washed with PBS, and either snap frozen or formalin fixed and paraffin

embedded.

Microarray data. Melk was identified from a bioinformatics screen of

the Gene Logic (Gaithersburg, MD) expression database of Affymetrix HG-U133 data, representing 3,600 normal and 1,701 neoplastic human tissue

samples. Probe set 204825_at was chosen to represent Melk expression.

Microarray analysis was done on fresh-frozen normal tissues from fiveregions of normal mucosa from each ApcMin mouse (n = 3) and two from

each Apc1638N mouse (n = 2), representing the full length of the small and

large intestines. In addition, seven fresh-frozen intestinal tumors were

selected from each ApcMin mouse (two duodenum, nine jejunum, andten ileum) and three from each Apc1638N mouse (two duodenum and four

jejunum). RNA was extracted using the RNeasy Micro kit (Qiagen, Valencia,

CA), amplified, labeled, and hybridized to Affymetrix MOE430A v.2

GeneChip as described previously (27). Probeset 1416558_at was chosento represent Melk expression.

Small interfering RNA synthesis and preparation. The target

sequences within Melk to which the RNA oligonucleotides were designedare the following: AACCCAAGGGTAACAAGGA (si1); CAGGCAAACAATG-

GAGGAT (si2); and TACTCACTACGCCAAATCG (si3). The control small

interfering RNAs (siRNA) were designed against green fluorescent protein

(GFP) with target sequences of: GCAAGCTGACCCTGAAGTTCAT (siC) andAAGATCCGCCACAACATCGA (siC_2). From the target sequences, 21-

nucleotide RNAs were chemically synthesized in-house using TOM-RNA

phosphoramidites and 2V-deoxynucleotides (Glen Research, Sterling, VA).

Oligonucleotides were deprotected, gel-purified, and annealed as 10 Amol/Ldouble-stranded RNA by incubating in annealing buffer [100 mmol/L

potassium acetate, 30 mmol/L HEPES-KOH (pH 7.4), and 2 mmol/L mag-

nesium acetate] for 1 minute at 90jC followed by 1 hour at 37jC. siRNAswere designed according to published guidelines (28, 29) and analyzed by

Basic Local Alignment Search Tool (National Center for Biotechnology

Information, Bethesda, MD) to confirm sequence specificity.

Small interfering RNA transfection and phenotypic analysis. Cellswere plated at a density to achieve 80% confluence and then transfected

8 hours later with the appropriate siRNA (30 nmol/L) using LipofectAMINE

2000 (Invitrogen, Carlsbad, CA) according to the recommendations of

the manufacturer. To analyze the effect of knockdown on anchorage-independent growth, cells were collected 12 to 15 hours posttransfection,

suspended in medium with 0.3% agar (Difco, Franklin Lakes, NJ), and plated

in replicates of six using six-well tissue culture plates. 3-(4,5-Dimethylth-

iazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich Corp.,

St. Louis, MO) was added 15 to 30 days postplating at a final concentration

of 300 Ag/mL and the number of colonies was visualized. Colony number

was documented with a Fluorchem 8900 digital camera (Alpha Innotech,

San Leandro, CA) and quantified using the autocount feature of the

accompanying AlphaEase software. The effect of gene knockdown on cell

proliferation was determined by plating cells 12 to 15 hours post–siRNA

transfection at 2,000 per well of 96-well tissue culture plate in replicates of

six for each time point. Cell growth was quantified by addition of MTT (590

Ag/mL, final) at the appropriate time point. After at least 4 hours at 37jC,cells were then lysed with 7.5% SDS/3.7 N HCl and A570/690 nm was

determined. Following assay setup, the remaining cells were replated and

subsequently collected 72 hours posttransfection for real-time qRT-PCR and

Western immunoblot confirmation of Melk knockdown. To analyze the

effect of knockdown on cell cycle, cells were transfected in the middle of a

double thymidine block as described by Hirota et al. (30). Briefly, after

treating cells with 2 mmol/L thymidine for 18 hours, fresh medium was

added and cells were allowed to recover for 3 hours before transfecting with

the appropriate siRNA as described above. Four hours post–siRNA

transfection, fresh medium containing 2 mmol/L thymidine was added

and cells were cultured for an additional 14 hours at 37jC. Cells were then

harvested and washed 24 hours after the final release, fixed with 70%

ethanol, and resuspended in PBS with 3% fetal bovine serum and 40 Ag/mL

propidium iodide (Sigma-Aldrich). The effect of Melk overexpression on cell

cycle was analyzed by cotransfection of HeLa cells with a Melk expression

construct or empty vector mixed at a 5:1 molar ratio with pEGFP-C1

(Clontech, Palo Alto, CA). Cells were dispersed with trypsin 24 hours

posttransfection, replated, and cultured for an additional 24 hours and then

harvested as above for cell cycle analysis except for the addition of a 5-

minute incubation with 0.5% paraformaldehyde before fixation with 70%

ethanol. Cell cycle status was collected using a Coulter Epics XL-MCL

(Beckman Coulter, Hialeah, FL) and data were analyzed with ModFit LT

(Verity Software House, Topsham, ME).Real-time quantitative reverse transcription-PCR (Taqman). RNA

was isolated from human tumor cell lines and fresh-frozen tissues using the

RNeasy Mini kit (Qiagen) according to the recommendations of the

manufacturer. Samples were subjected to on-column DNase treatmentduring purification to remove genomic DNA contamination. For real-time

qRT-PCR assays, 100 ng/well of total RNA was used as a template using the

One-Step qRT-PCR kit (Qiagen). Probes consisted of a 5V-FAM reporter and3V-Black Hole quencher. Duplicate wells were assayed for Melk expression

( forward primer: 5V-AGAAGTGTGCCAGCTTCAAA-3V; reverse primer:

5V-CTAGATAGGATGTCTTCCACTAATCTTT-3V; probe: 5V-CCAGGCAT-CGCCCTTAAGCC-3V) using SDS7700 (Applied Biosystems, Foster City, CA)and the relative abundance of Melk transcript was normalized to RPL19

levels ( forward primer: 5V-GCGGATTCTCATGGAACACA-3V; reverse primer:

5V-GGTCAGCCAGGAGCTTCTTG-3V; probe: 5V-AAGCTGAAGGCAGA-CAAGGCCC-3V) using the 2�DDCt method (31). Tumor RNA from xenograftsamples was isolated and amplified similarly but after tissue homogeniza-

tion and by using primers for the murine orthologue of Melk ( forward

primer: 5V-CAGAGACCTGACGTGGTAGGC-3V; reverse primer: 5V-CAC-TAATCTCTTGTAAACCCAGGCAT-3V; probe: 5V-ACCCTTCAGCCGCTG-TCTCCGG-3V) and murine RPL19 ( forward primer: 5V-TTCTTGGT-CTCTTCCTCCTTG-3V; reverse primer: 5V-ATGTATCACAGCCTGTACCTG-3V;probe: 5V-GGTCTAAGACCAAGGAAGCACGCAA-3V). Analysis was done usingSDS software (version 1.7; Applied Biosystems).

Polyclonal antibody generation and Western blotting. A rabbit

polyclonal antibody generated and affinity purified against the keyhole

limpet hemocyanin (KLH)–conjugated peptide CSQGYAHRDLKPENLLFD(corresponding to amino acids 125-137 of Melk) was used for Western blot

analysis. Cell lysates were prepared by addition of 50 mmol/L HEPES (pH

7.4), 100 mmol/L NaCl, 50 mmol/L NaF, 5 mmol/L h-glycerophosphate,2 mmol/L EGTA, 1 mmol/L Na vanadate, 1% Triton X-100 to a cell pellet,resolved on a 4% to 12% acrylamide gel, and transferred to a polyvinylidene

difluoride (PVDF) membrane (VWR). Fresh-frozen primary human tissue

samples were prepared for Western analysis by the following method.Frozen samples were homogenized in liquid nitrogen with a mortar and

pestle until tissue was a fine powder. Tissue powder was resuspended in

Cancer Research

Cancer Res 2005; 65: (21). November 1, 2005 9752 www.aacrjournals.org



0.1 mol/L h-mercaptoethanol, 4 mol/L guanidium thiocyanate, 25 mmol/LNa citrate, and 0.5% N-laurylsarcosine. Samples were then layered over 5.7

mol/L CsCl/50 mmol/L EDTA and centrifuged at 280,000 � g in a SW55 Ti

rotor (Beckman Coulter, Fullerton, CA) for 24 hours. Protein was recovered

from the resulting supernatant by first incubating for 3 minutes at 90jC inthe presence of 0.1 mol/L DTT and 2% SDS followed by precipitation with

acetone (85% v/v) for 15 minutes at room temperature. The resulting

protein pellet was resuspended in SDS sample buffer before being resolved

on a 4% to 12% acrylamide gel and transferred to a PVDF membrane.Membranes were blocked in 10% powdered milk [made up in TBS with 0.1%

Tween 20 (pH 7.4)], incubated with the anti-Melk antibody followed by

probing with a horseradish peroxidase–conjugated goat anti-rabbit IgG

(DakoCytomation, Carpinteria, CA), and visualized with a Fluorchem 8900digital camera (Alpha Innotech). Blots were subsequently probed with an

antitubulin antibody (Santa Cruz Biotechnology, Santa Cruz, CA) as a

loading control.Expression constructs. A cDNA encoding full-length human Melk was

generated by PCR amplification from a pool of 107 cDNA libraries from

various human tissues and cell lines. Based on sequences obtained from

Genbank (accession number NM_014791), sense (5V-CCAAATAAACTTG-CAAGAGGACTATGAAAGATTATGAT-3V) and antisense (5V-CCATCAATTA-TACCTTGCAGCTAGATAGGATGTCTT-3V) primers were designed to

produce a PCR product of 1,986 bp using 200 ng of the pooled cDNA

library as template. The amplification reaction was catalyzed by Pfu turboDNA polymerase (Stratagene, La Jolla, CA) for 35 cycles under the following

conditions: denaturing at 94jC for 1 minute, annealing at 65jC for 4

minutes, and extension at 72jC for 1 minute. The amplified product wasthen ligated into the pcDNA3.1 V5-HIS-TOPO Vector using TA-Cloning

strategy (Invitrogen). This construct was then PCR amplified using sense

primer (5V-CCACCATGAAAGATTATGATGAACTTCTCAAATAT-3V) and an-

tisense primer (5V-TTACTTGTCATCGTCATCCTTGTAGTCTACCTTGCAGC-TAGATAGGATGTCTTCCACTA-3V) to allow the addition of a Kozak

consensus sequence and COOH-terminal FLAG tag, and TOPO-cloned into

the pcDNA3.1D.v5-His-TOPO vector (Invitrogen). A kinase-dead Melk was

created by mutation of the critical DFG motif, replacing the aspartic acid atamino acid 150 to an alanine. This mutation was created by a nested PCR

strategy using the overlapping 5V-GCTGATTGCCTTTG-GTCTC-3Vsense and5V-GAGACCAAAGGCAATCAGC-3Vantisense primers to introduce this mu-tation into the above wild-type Melk construct. Inactivation of Melk kinase

activity by this D150A mutation has been shown by Vulsteke et al. (21).4

In situ hybridization and microdissection. cDNA templates were

generated by PCR amplification with the Advantage polymerase kit(Clontech) using the sense (5V-CGCCAAATCGTTACACTACACCC-3V) and

antisense (5V-CCGCTGCCTCCTGATACCC-3V) primers for human Melk

(NM_014791) and the sense (5V-CGCCAGCACCACTCCAAAG-3V) and anti-

sense (5V-AGCGCAGTGAGAACCTTATCCAG-3V) primers for murine Melk(NM_010790). Sense and antisense 33P-labeled riboprobes were transcribed

in vitro from cDNA templates for human and murine Melk. Detailed

methods for in situ hybridization have been previously described (24, 25).

Formalin-fixed, paraffin-embedded whole sections and tissue microarraycores hybridized to antisense riboprobes were visualized by bright/dark field

microscopy and scored positive or negative for Melk expression. Sense

riboprobes were used to assess the specificity of hybridization.To analyze RNA levels within isolated human colonic crypts, a fresh-

frozen normal colon tissue sample was sectioned, fixed in ethanol, and

stained with H&E. Microdissection of colonic crypts (luminal, middle, and

basal thirds) was done with the SLA-cut instrument (Molecular Machinesand Industries AG, Glattbrugg, Switzerland). RNA was extracted using the

Picopure RNA kit (Arcturus, Mountain View, CA) and amplified with the

MessageAmp II kit (Ambion, Austin, TX) according to the instructions of

the manufacturer. qRT-PCR was done as described above with 10 ng ofamplified RNA.

In vivo tumor growth assays. To study the effect of Melk knockdown on

the in vivo growth of transformed cells, we created a doxycycline-regulated

short hairpin RNA (shRNA) expression construct.5,6 Briefly, this vectorsystem is comprised of a H1 promoter (32, 33) containing the tetracycline

operator 2 (TetO2; ref. 34) inserted between the TATA box and the

transcriptional start site. The modified H1 promoter and hairpin cassette

was then combined with a RNA polymerase II promoter cassetteexpressing the wild-type tetracycline repressor (35) on a retroviral

backbone. To generate stable Melk knockdown cell lines, the sense 5V-GATCCCGAGATTAGTGGAAGATATCTTCAAGAGAGATATCTTCCACTAA-

TCTCTTTTTTGGAAA-3V and antisense 5V-AGCTTTTCCAAAAAAGAGAT-TAGTGGAAGATATCTCTCTTGAAGATATCTTCCACTAATCTCGG-

3Voligonucleotides targeting murine Melk were annealed and cloned into

the above-described vector with BglII and HindIII. The resulting sequence-

confirmed plasmid was transfected into the Phoenix Retroviral packagingcell line (Orbigen, Inc., San Diego, CA) according to the instructions of the

manufacturer. Viral supernatant was harvested 48 hours posttransfection

and added to SVT2 cells (SV40-transformed 3T3). Stable integrants wereselected with 5 Ag/mL puromycin (Sigma-Aldrich) and cloned by limiting

dilution. Individual clones identified by qRT-PCR with at least 90%

knockdown in Melk RNA after 72-hour incubation with 1 Ag/mL

doxycycline (Clontech) were selected and expanded. For in vivo tumorgrowth analysis, CB17 severe combined immunodeficient mice (Charles

River Laboratories, Hollister, CA) were maintained in accordance to

Guidelines for the Care and Use of Laboratory Animals. Select SVT2 clones

with regulated Melk knockdown were injected s.c. into the right flank (1 �106 cells per mouse). Thirteen days after injection, mice were grouped into

two treatment groups. Group A (consisting of three mice per clone) received

5% sucrose in their water, whereas group B (consisting of two mice perclone) received 2 mg/mL doxycycline and 5% sucrose in their water. Tumor

volumes were measured and water was refreshed, with appropriate

treatment twice weekly. At the end of the study, the animals were

euthanized by CO2 inhalation and the tumors were harvested to determineMelk RNA levels by qRT-PCR.

Results

Melk expression in cancer. Using the recently collated genecollection representing a complete listing of human kinases (thekinome; ref. 9), we first selected kinases with at least a 2-fold higherexpression in one of the major tumor types compared withcorresponding normal tissues. Data were analyzed by geneexpression profiling in silico , a previously described expressedsequence tag–based, expression analysis tool (36). This gene listwas then surveyed against a microarray data set comparing RNAlevels between normal and cancer samples by hybridization to theAffymetrix HG-U133 GeneChip. As shown in Fig. 1A , Melk RNAlevels were consistently increased in neoplastic tissues comparedwith nondiseased samples of the same organ. To confirm thisfinding, a qRT-PCR analysis of selected tissues was done. Figure 1Billustrates a 5- to 50-fold increase in Melk message from colon,breast, ovary, and lung tumor samples. In agreement with dataderived from the microarray and RT-PCR analyses, an in situhybridization analysis of human tumors scored the following aspositive for Melk expression: 96% of colorectal adenocarcinomas(65 of 68 samples), 5% ductal breast carcinomas (3 of 57 samples),23% lung cancers (4 of 40 adenocarcinomas, 6 of 26 squamous cellcarcinomas, and 2 of 25 neuroendocrine tumors), 7% pancreaticadenocarcinomas (4 of 60 samples), and 13% of ovarian cancers(3 of 25 samples). Where present, the Melk in situ hybridizationsignal localized to areas of malignant epithelium as opposed to thesurrounding stroma (Fig. 2). Analysis of normal tissues found low

5 D. Gray et al., in preparation.6 K. Hoeflich et al., submitted for publication.4 Our unpublished observations.

Melk Expression and Transformed Phenotype of Cells




levels of Melk expression detectable only within epithelial cells ofthe lower portions of colonic crypts. However, expression at thebase of normal crypts was barely detectable compared with theeasily detected Melk signal within areas of malignant cells (seeSupplementary Fig. S1).Next, we investigated Melk expression in normal and neoplastic

samples from a murine model of intestinal cancer. Samples werecollected from histologically normal and spontaneous intestinaltumors that had developed within the ApcMin or Apc1638N

heterozygotic mouse models. In both cases, one allele of the Apc

gene has been truncated because of a nonsense mutation at codon850 (ApcMin) or by insertion of the neomycin gene in the oppositeorientation of the Apc transcription after codon 1638 (Apc1638N;ref. 26). Tumors that arise in either strain exhibit a loss ortruncation of the wild-type Apc allele. RNA was harvested fromnormal and neoplastic intestine and hybridized to the AffymetrixMouse Genome 430A GeneChip. As shown in Fig. 3A , relativeexpression for Melk is 2- to 6-fold higher in tumors from bothApcMin–and Apc1638N–derived mice compared with normal intes-tine. This finding was confirmed by qRT-PCR of selected samples

Figure 1. Melk RNA levels are increased in cancer. A, oligonucleotide microarray analysis of RNA purified from 3,600 normal (open columns ) and 1,701 cancertissues (filled columns ) shows elevated expression of Melk in cancer. The Affymetrix data for Melk were generated from the U133 probe set ID 204825_at.Columns, mean average difference in expression values for multiple tissue categories; bars, SE. B, expression profiling was confirmed in multiple tumors(ovary n = 10, lung n = 9, colon n = 8, and breast n = 9) by qRT-PCR. Data are presented as the fold increase relative to a single matched normal samplefor each tissue. ad, adrenal; br, breast; ce, cervix; cn, central nervous system; co, colorectal; en, endometrium; es, esophagus; hn, head and neck; ki, kidney;li, liver; lu, lung; ly, lymphoid; ov, ovary; pa, pancreas; pr, prostate; sk, skin; si, small intestine; st, soft tissue; te, testis; th, thyroid.

Figure 2. Melk in situ hybridization signal (A-C, silver grains in the dark-field illumination) localizes to malignant epithelial cells but not to benign stromal cells(D-E, bright-field H&E stain). Examples of positive signal for a colorectal adenocarcinoma (A, D ), a non–small cell lung cancer (B, E ), and a ductal breast carcinoma(C, F ). Magnification, �20. Sense riboprobes did not show appreciable hybridization above background.

Cancer Research




(data not shown). Finally, an in situ hybridization inspection offormalin-fixed, paraffin-embedded tissues found the Melk signal tobe restricted to the proliferating regions of the crypts in normaljejunum with increased expression in corresponding cancersamples (Fig. 3B-E). Interestingly, analysis of microdissectednormal human colon tissue found a graded increase in Melkexpression with descent into the crypt (Fig. 3F-G). Together, thesefindings suggest that Melk may play some role in the proliferationand/or self-renewal of progenitor cells that reside in the basal

region of the crypt. This role may not be unique to the colon, asMelk expression has been shown to coincide with other stem cell–specific genes within neuronal tumors (37).To confirm that Melk expression can also be detected at the

protein level within tumor samples, a rabbit polyclonal antibodywas generated and affinity purified against the KLH-conjugatedpeptide CSQGYAHRDLKPENLLFD (corresponding to amino acids125-137 of Melk). Primary human tumor and normal tissue sampleswere resolved on 4% to 12% gradient gels and Western blotted with

Figure 3. Melk expression in human and murine intestine. A to E, tumors derived from the ApcMin and Apc1638N background exhibit elevated Melk expression.A, RNA was harvested from normal (N) and spontaneous intestinal tumors (T ) that formed in the ApcMin or Apc1638N murine tumor model. An oligonucleotide microarraywas then used to compare gene expression. Data are presented in arbitrary units; dashed line, background. B to E, expression of Melk RNA shown by in situhybridization in areas of normal (B, C ) and neoplastic (D, E ) small intestinal mucosa. Magnification, �20. In normal mucosa, a signal is seen in the proliferative, basalzone of the mucosa; on the other hand, fully differentiated, noncycling cells in the apical zone are negative. A diffuse strong signal is seen in areas of neoplasticgrowth. F and G, analysis of RNA levels harvested from microdissected normal human colonic crypts (luminal, middle, and basal thirds) illustrates increased Melkexpression within the basal regions of the crypts. F, representative pictures of microdissection. G, fold increase in Melk RNA (normalized against RPL19,relative to luminal third of the sample) was assessed by qRT-PCR. Bars, F1 SD. However, expression at the base of normal human crypts was barely detectablecompared with the easily detected Melk signal within areas of malignant human cells (see Supplementary Fig. S1).





the polyclonal anti-Melk antibody. Figure 4 shows the presence of aband in the majority of lung, breast, and ovarian tumors that hasthe same mobility as a recombinant Flag-tagged Melk (Fig. 4B andC , lanes IP). The specificity of this antibody was further shown bythe ability of the immunizing peptide to effectively competeagainst the anti-Melk but not an antitubulin antibody (Supple-mentary Fig. S2).A comparison of Melk expression between primary tumor and

normal samples derived from lung, breast, and ovary tissues (Fig.4A-C) was then done. A representative Western blot for each tissuetype with the densitometric ratio of Melk to tubulin within eachsample listed at the top of every lane is shown. These data showthat, on average, there is a 2-fold increase in Melk protein withinprimary lung- and breast-derived tumors as opposed to normalmatched tissue (Fig. 4A and B), whereas expression levels withinthe ovary-derived samples are more closely matched betweentumor and normal (Fig. 4C). Although the increased proteinexpression may not be as large as what would be expected from theelevated Melk mRNA levels (Figs. 1-3), we believe that this apparentdiscordance is a characteristic phenomenon surrounding theregulation of many other genes. In these cases, posttranscriptionalmechanisms may also be simultaneously regulating expressiondepending on the cellular context. Examples include the effect ofthe 5Vuntranslated region on the translational efficiencies of c-myc

and fibroblast growth factor-2 (38), cell cycle–dependent changesin translational efficiency (p27Kip ; refs. 39, 40) or proteindegradation (Aurora ; ref. 41), and differential polyribosomalrecruitment of specific mRNA subsets following activation of Rasand Akt signaling (42). Similar mechanisms may be at play here,limiting the steady-state level of Melk protein visible within theprimary tumor samples (Fig. 4).Further supporting the notion of posttranscriptional mecha-

nisms regulating Melk expression, we observed the presence of aslower migrating version of Melk isolated from multiple primarytumor samples (mainly lung; Fig. 4A). This is consistent withhyperphosphorylation of Melk, a posttranslational modificationthat has been shown to correlate with increased Melk kinaseactivity (16).4 Finally, it is interesting to note that an additionalfaster migrating band is present at the same intensity as Melkwithin the representative normal ovary samples (Fig. 4C). Thisband is consistent with a previously described, ovary-specific, andalternative spliced form of Melk (43). Although the authors foundthat the splicing event removed a portion of the kinase catalyticdomain, the effect on activity has not been determined. However,it is intriguing that the ratio of full-length to truncated Melk seemsto be skewed from an approximately equal molar ratio withinnormal ovary to a more predominant expression of the full-lengthversion of Melk within ovarian tumor samples (Fig. 4C). Although

Figure 4. Melk is expressed in primary human tumor samples as determined by Western blotting. Lysates from normal and tumor-derived tissue samplesof lung (A ), breast (B), and ovarian (C ) origin were analyzed by probing with an anti-Melk polyclonal antibody. The blots were subsequently probed with antitubulinas a loading control. Shown is a representative Western blot for each tissue type with the densitometric ratio of Melk to tubulin (M/T ) within each sample listedat the top of every lane. FLAG-tagged Melk, precipitated with FLAG-agarose beads (IP ), was included as a size marker. The specificity of the anti-Melk antibodywas further shown by competition with the immunizing Melk-derived peptide (see Supplementary Fig. S2). *An anti-Melk reactive band present in the normalovary tissue samples consistent in size with a previously described alternatively spliced form of Melk (43).

Cancer Research




the significance of these posttranslation modifications on Melkactivity within cancer cells will need to be determined, it seemsthat Melk protein expression may be deregulated at multiple levelswithin cancer cells.Due to the strong association between elevated Melk expression

and primary cancer samples described above, we next inspectedMelk expression in tumor cell lines. As it has been reported thatMelk is regulated during the cell cycle, we analyzed RNA and protein

levels of asynchronous and nocadazole-induced, mitoticallyarrested cells (Fig. 5; Supplementary Fig. S3). Upon mitotic arrest,we observed an increase in Melk at both the protein (Fig. 5A) andRNA levels (Fig. 5B). Interestingly, the level of Melk expression alsoseems to correlate with the transformed phenotype of the cell.Tumor-derived cell lines, such as HCT116 and Panc-1, consistentlydisplay increased Melk expression compared with IMR90 andWi-38,both nontransformed diploid fibroblasts (Fig. 5A ; SupplementaryFig. S3). Similarly, an increase in Melk expression is observed withV12N H-Ras–transformed NIH3T3 cells (3T3-Ras; Fig. 5A) comparedwith vector control cells (3T3-EV; Fig. 5A). These results provideadditional evidence that elevated Melk expression correlates withthe transformed phenotype of both murine and human cells.Effect of Melk knockdown. The above association between

Melk expression and cancer suggests that this kinase may berelevant for the growth and/or maintenance of a cancer cell.Conversely, the observed expression profile may simply besymptomatic of tumorigenesis with no ascribable functionalconsequence. If the latter scenario were true, inhibition of Melkexpression would not be expected to hinder tumor growth. Tobegin distinguishing between these possibilities, we used RNAi tosilence Melk expression in human tumor cell lines. Four 21-mersiRNA duplexes were designed and prepared according to previousreports (28, 29). The duplexes were transfected as described inMaterials and Methods and the degree of silencing was assessed.Melk targeting duplexes si1 and si2 reduced RNA levels >80%, withsi2 exhibiting the most prolonged reduction in Melk message(Fig. 6A). A minor, transient reduction in message was seen withsi3, whereas no detectable effect was observed with a control GFP-targeting duplex (siC; Fig. 6A). Melk depletion was also confirmedby Western blot analysis. Therefore, significant knockdown of Melkprotein was observed with si1 and si2, whereas si3 did not alterprotein levels relative to the control siRNA. The lack of appreciableknockdown with si3, however, enables its use as an additionalnegative control.Using these siRNA reagents, we sought to determine the

consequence of Melk silencing within the cell. Because Melk

Figure 5. Melk expression is increased in mitotically arrested cells. A, theindicated cell lines were cultured 15 hours in the absence (�) or presence (+) of500 ng/mL nocadazole (noc ). The cell lysates were then resolved on a 4% to12% acrylamide gel and probed with anti-Melk polyclonal antibody followed byantitubulin as a loading control. B, nocadazole-induced mitotic arrest isassociated with an increase in Melk RNA levels. HCT116 cells were treated with(+) and without (�) 500 ng/mL nocadazole for 18 hours. Melk RNA levels werethen assessed by qRT-PCR with expression normalized relative to RPL19.Shown is the fold increase relative to nontreated (asynchronous) cells.

Figure 6. Assessment of Melk expression in 293 cellstransfected with siRNA oligonucleotides. Cells weretransfected with 30 Amol/L of siRNA oligonucleotides asdescribed in Materials and Methods. A, qRT-PCR analysis ofMelk RNA levels at 1, 2, and 3 days posttransfection.B, Western blot analysis of Melk expression 3 daysposttransfection with the indicated Melk-specific siRNAoligonucleotide. The blot was probed with anti-Melk andantitubulin. C, nocadazole-induced Melk expression isinhibited in cells pretreated with Melk-specific siRNAoligonucleotides. HCT116 cells were transfected with theindicated siRNA oligonucleotides for 24 hours and thencultured with 500 ng/mL nocadozole for an additional18 hours. Lysates were prepared and analyzed by Westernblotting for Melk and tubulin. A similar result was seen inadditional cell lines (see Supplementary Fig. S4).





expression (Fig. 5) and activity (15, 16) are regulated by the cellcycle, the effect of RNAi-mediated knockdown on cell proliferationwas quantified. As shown in Fig. 7A-D , the growth rates of HEK293,PANC-1, BT549, and HCT116 cells were all inhibited whentransfected with si1 and si2 duplexes, whereas the si3 duplexhad little or no effect on growth relative to siC or mock-transfectedcells. This result agrees with the level of Melk knockdown in Fig.6B ; the greatest level of silencing was consistently observed withsi1 and si2, whereas a more modest and transient level of silencingwas observed with si3. To determine if the decreased proliferationwith Melk knockdown corresponds to an alteration of the cellcycle, the effect of silencing Melk on cell cycle progression wasassessed. HeLa cells were transfected with siRNA duplexes in themiddle of a double thymidine block as described in Materials andMethods. The cells were harvested 24 hours after release from thefinal thymidine block and the cell cycle status was determined by apropidium iodide–based fluorescence-activated cell sorting (FACS)analysis. An increase in the G2-M population was observed with si1and si2 Melk targeting duplexes, whereas little or no effectwas seen with si3 relative to two control duplexes (Fig. 7E ;Supplementary Fig. S5). This result agrees with the degree ofsilencing observed for these duplexes, indicating that thephenotype is the result of Melk knockdown.

We next explored the effect of Melk overexpression on the cellcycle. To this end, HeLa cells were cotransfected with a wild-typeor a kinase-dead (D150A) Melk mixed with a GFP expressionconstruct at a 5:1 molar ratio. Forty-eight hours posttransfection,the cell cycle status of GFP-expressing cells was determined by apropidium iodide–based FACS analysis. As shown in Fig. 7F, wefound an increase in the G2-M peak of cells overexpressingwild-type or D150A Melk compared with cells transfected withempty vector. This apparent G2-M delay upon overexpression ofwild-type Melk (and to a lesser extent overexpression of a K40Rinactive Melk) has been previously reported (16). It is intriguingto note that both Melk knockdown as well as overexpression ofwild-type or kinase-dead Melk result in a G2-M delay in cellcycle progression. Because of the relative low resolution of FACS-based cell cycle analysis, a possible reconciliation of these datais that Melk may be required for progression through a G2-Mcheckpoint but once the cell has overcome this checkpoint,Melk expression and/or activity becomes inhibitory. In this way,a similar G2-M delay phenotype could result from both RNAiknockdown and forced overexpression of wild-type or a kinase-dead Melk mutant. Further work will be required to test thishypothesis and determine how Melk regulates this phase of thecell cycle.

Figure 7. Melk expression regulates proliferationand cell cycle progression. A to D, RNAi-mediatedMelk knockdown inhibits proliferation. Cellswere transfected with the following RNA duplexes:si1 (n), si2 (E), si3 (o), siC (d, dashed line )or mock transfected (d, solid line ). Cells wereplated (2,000 per well of a 96-well plate) inreplicates of six for each time point andproliferation was determined at the indicated timeby MTT viability. A representative experimentfor HEK293 (A), HCT116 (B ), BT549 (C ), andPANC-1 cells (D ) is shown. E, RNAi-mediatedMelk knockdown increases G2-M cell population.HeLa cells were transfected with siRNAoligonucleotides during the release of a doublethymidine block as described in Materials andMethods. Twenty-four hours after the secondthymidine block (48 hours post–siRNAtransfection), cells were collected and analyzed forcell cycle by FACS. The percentage of cellsin G1, S, and G2-M was determined usingCellQuest Pro Cell Cycle modeling software. Eachcell cycle phase was normalized relative to thevalues determined for the control oligonucleotide(siC ). An additional control oligonucleotide(siC_2) is shown for comparison (done intriplicate). A representative kinetic experimentfurther supporting a G2-M delay with Melkknockdown as well as an example of Melkknockdown in HeLa cells are shown inSupplementary Figs. S4 and S5. F,overexpression of wild-type or kinase-dead Melkdelays G2-M progression. HeLa cells werecotransfected with wild-type (wt) or a kinase-dead(D150A ) Melk in the presence of GFP at a 5:1molar ratio. Cotransfection of an empty vector(vector ) plus GFP was used as a control.The cells were split at a 1:2 ratio by trypsinization24 hours posttransfection. Cell cycle status ofGFP-expressing cells was determined by apropidium iodide–based FACS analysis48 hours posttransfection. A representativeexperiment is shown.

Cancer Research




Finally, we asked whether Melk expression is required for thetransformed phenotype of tumor cell lines. We first usedanchorage-independent growth, an in vitro assay that has beenshown to serve as a good indicator of tumor growth in vivo(44, 45). Tumor-derived human cell lines were transfected withMelk-targeting siRNA duplexes and then plated on agar. Two tofour weeks postplating, the number of viable colonies wascounted. Figure 8A shows that colony formation is decreased byat least 50% in cells transfected with the si2 duplex relative to thesi3 duplex or mock-transfected cells. Interestingly, except for a30% reduction in colony number with BT549 cells, the si1 duplexdid not inhibit PANC-1 or HEK293 colony formation. This resultsuggests that whereas the level of knockdown mediated by the si1duplex is adequate to inhibit proliferation and cell cycleprogression, it is not sufficient to prevent anchorage-independentgrowth.To determine whether Melk expression is relevant for tumor

growth in a more in vivo setting, we have created pHUSH, a H1 orU6 shRNA expression vector.5 As described in Materials andMethods, pHUSH is comprised of a modified H1 promoter(containing the TetO2 operon; ref. 34) with a RNA polymerase IIpromoter-tetracycline repressor expression cassette (35) on a singleretroviral plasmid. With this vector, we can easily obtain stableclones with at least 90% knockdown of a target gene upon culturingcells with doxycycline. To study the effect of Melk knockdown, weselected the SVT2 (SV40-transformed 3T3) murine cell line due toits robust growth as a xenograft model and the fact that Melk RNAlevels in these cells are f6-fold higher than nontransformed 3T3cells (data not shown). Individual clones containing pHUSH with aMelk-targeting hairpin were generated. Those with at least 90%knockdown in Melk RNA after 72-hour incubation with 1 Ag/mLdoxycycline were selected for phenotypic analysis. As shown inFig. 8B , tumor growth is reduced upon addition of doxycycline tothe drinking water relative to mock treated (sucrose only) ortumors derived from cells containing the pHUSH vector with nohairpin oligonucleotide insert (EV). As with transient Melkknockdown in the human tumor lines described above, we havealso observed decreased proliferation and anchorage-independent

growth in vitro after doxycycline-induced Melk knockdown in theSVT2 clones (data not shown). Therefore, Melk expression seems tobe relevant for the transformed phenotype of both human andmurine tumor cell lines.

Discussion

As part of an effort to identify novel drugable targets, we havefound that Melk , an AMPK-related serine/threonine kinase, isoverexpressed in multiple tumor types. Originally discoveredthrough an analysis of microarray data, we have confirmed thispattern of expression using qRT-PCR, in situ hybridization, andWestern analyses of human and mouse tumor samples. We provideevidence that Melk plays an important role in cell division as RNAiknockdown inhibited proliferation and slowed the transition ofcells through the G2-M phase of the cell cycle. This result, togetherwith the finding that RNAi-mediated Melk knockdown inhibitedcolony formation as well as tumor growth in vivo , suggests thatMelk expression may be relevant with respect to establishing and/or maintaining certain types of cancer.Other members of the AMPK family have also recently been

shown to provide a vital function within cancer cells. First, numer-ous reports have suggested an important link between AMPKand the ability of a cell to survive a hypoxic challenge. ActivatedAMPK signaling within endothelial cells was shown to be requiredfor initiating an angiogenic response to hypoxia, includingphosphorylation of epithelial nitric oxide synthase and nitric oxideproduction (46, 47). In addition, hypoxic activation of AMPK hasbeen shown to positively regulate hypoxia-inducible factor 1 trans-criptional activity (48). AMPK activation has also been correlatedwith the ability of tumor cells to survive nutrient withdrawal (49).Finally, signaling via ARK5/NUAK1, a more recently discoveredAMPK-related kinase, has been suggested to play a role in tumorsurvival and invasion. ARK5 was originally identified as a com-ponent of the Akt signaling pathway (50). Its expression seems tobe elevated in colon tumors where it may play a positive role inAkt-stimulated tumor cell invasion (51, 52). Whether Melk impingeson any of the signaling pathways mentioned above remains to be

Figure 8. Melk knockdown inhibits anchorage-independent colony formation in vitro as well as in vivo tumor growth. A, to assess colony formation, cells wereplated in soft agar 15 hours posttransfection and the number of colonies was scored at the appropriate time point. Colony numbers from triplicate wells wereaveraged and normalized as a percentage of mock-transfected cells. BT549 (black columns , 28 days postplating), HEK293 (gray columns , 14 days postplating),and PANC-1 (white columns , 17 days postplating). B, SVT2 clones (A3, B3, B5 , and B8 ) with at least 90% Melk knockdown upon addition of doxycycline weregenerated as described in Materials and Methods and Supplementary Fig. S6. An additional cell line containing the pHUSH vector lacking a hairpin oligonucleotideinsert (EV ) was generated as a control. Tumor studies were initiated by injecting 1 � 106 of cells s.c. into CB17 severe combined immunodeficient mice. Thirteendays postinjection (100% of injected mice formed tumors), the mice were grouped into two treatment arms as described in Materials and Methods for Fdoxycycline(dox ) treatment. Tumor volumes were measured and averaged between animals within a treatment arm for each cell line. Shown is a time course of tumor growthafter doxycycline addition for EV and clone B5 (left ) and average tumor size 4 days after doxycycline addition for multiple clones (right ). At the end of the study,RNA was harvested from the tumors and Melk knockdown was shown (by qRT-PCR) to correlate with treatment and phenotype (see Supplementary Fig. S6).





determined. Interestingly, a recent study provided evidence that thetumor suppressor LKB1 may serve as a master activating kinase forall AMPK family members except Melk (53). This result suggeststhat Melk activity is regulated by a distinct mechanism relative tothe other AMPK members.In addition to our current results showing Melk expression in

multiple tumor types, previous studies have reported elevatedexpression in pediatric brain tumors (37, 54, 55). Hemmati et al. (37)went on to show that Melk expression correlated not only with thepresence of other stem cell–specific genes but also depended on themultipotency of the explanted primary tumor. From their findings,the authors suggested that pediatric brain tumors may arise fromprogenitor cells with multipotent stem cell–like attributes. Thepossibility that Melk may be a stem cell marker for other cell typesis consistent with our analysis of Melk expression between normaland tumor-derived colon tissue from both humans and mice. Asshown in Fig. 3, we found that Melk is expressed within sponta-neous tumors as well as the basal regions of crypts within normalgastrointestinal epithelium. The basal crypt region is the stemcell compartment for the normal colon, providing the necessarymultipotency and regenerative capacity to replace the differentiatedcells found along the crypt walls and lumen. Although it is unclearwhether colon tumors arise primarily from the basal crypts or mayalso derive from differentiated cells found higher up the crypt wall orwithin the luminal surface, intestinal tumors are frequently found tocontain a high proportion of cells with an undifferentiated, crypt-like morphology and gene expression profile (26). Therefore, thepresence of Melk within normal stem cells of the basal crypt regionas well as intestinal tumor cells supports the hypothesis that thiskinase plays a stem cell–specific role. If this model is correct, theability to target and inhibit Melk activity may be an effective methodfor eliminating tumor cell progenitors.The function of Melk within normal or tumorigenic stem cells

remains to be elucidated. The work described herein, as well asother studies, suggests a role in maintaining proper progressionduring meiosis and mitosis. First, Heyer et al. (43) proposed thatMelk has a sex-specific role in meiotic maturation of the oocytebased on expression profiling. Second, the finding that Melkexpression and kinase activity is maximal in Xenopus embryos andmammalian cells during mitosis (15, 16), as well as its interactionwith reported putative substrates (16, 20, 21), further implicatesMelk as an important player within the cell cycle. Finally, we showthat Melk is expressed in a number of primary tumors and tumor-

derived cell lines, consistent with an established elevated mitoticindex for these cells. This correlation agrees with the recent reportthat expression of Melk and other mitotic-specific genes is ahallmark of retinoblastoma loss (56). We have provided additionalevidence for a functional connection to the cell cycle by showingthat RNAi-mediated Melk knockdown decreases the proliferativecapacity and delays G2-M progression of tumor cell lines.Interestingly, we show that forced overexpression of either wild-type or a kinase-dead mutant of Melk also results in a G2-M delay.Although these results seem to be in apparent disagreement, apossible reconciliation of the data is that Melk expression and/orkinase activity regulates both G2-M progression and exit. Melk maybe required for progression through a G2-M checkpoint but oncethe cell has overcome this checkpoint, Melk expression or activitybecomes inhibitory. In this way, a similar G2-M delay phenotypecould result from both RNAi knockdown and forced overexpressionof wild-type or a kinase-inactive mutant Melk. Further work will berequired to determine whether these checkpoints exist andhow Melk regulates this phase of the cell cycle. Regardless of themechanism of action, it is becoming clear that Melk has afunctional role in the cell cycle. Our expression analysis, combinedwith in vitro and in vivo siRNA knockdown studies, suggests thatthis activity is functionally maintained in many cancer cells.Therefore, blocking Melk-related signaling may provide a thera-peutic advantage in cancer treatment.In summary, we have provided evidence that links Melk

expression to cancer, the first step in evaluating the potential ofthis kinase as a therapeutic target. The apparent role ofMelk withinhighly proliferative tumor cells (and possibly tumor stem cells) mayprovide a therapeutic benefit by targeting not only the proliferatingtumor cells but also the progenitors from which they are derived.Further studies will be required to explore these possibilities indetail and to determine whether a small molecule should bedeveloped that targets the kinase-active site or inhibits via anallosteric mechanism.

Acknowledgments

Received 1/13/2005; revised 8/2/2005; accepted 8/19/2005.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

We thank James Cupp for expert help with cell cycle analysis of FACS data, RonSmits for providing RNA samples fom APCMin and APC1638N mice, and Mark Vasser forthe synthesis of DNA and siRNA oligonucleotides.

References

1. Vogel CL, Cobleigh MA, Tripathy D, et al. Efficacy andsafety of trastuzumab as a single agent in first-linetreatment of HER2-overexpressing metastatic breastcancer. J Clin Oncol 2002;20:719–26.

2. Slamon DJ, Leyland-Jones B, Shak S, et al. Use ofchemotherapy plus a monoclonal antibody againstHER2 for metastatic breast cancer that overexpressesHER2. N Engl J Med 2001;344:783–92.

3. Druker BJ. Perspectives on the development of amolecularly targeted agent. Cancer Cell 2002;1:31–6.

4. Lynch TJ, Bell DW, Sordella R, et al. Activatingmutations in the epidermal growth factor receptorunderlying responsiveness of non-small-cell lung cancerto gefitinib. N Engl J Med 2004;350:2129–39.

5. Paez JG, Janne PA, Lee JC, et al. EGFR mutations inlung cancer: correlation with clinical response togefitinib therapy. Science 2004;304:1497–500.

6. Cunningham D, Humblet Y, Siena S, et al. Cetuximab

monotherapy and cetuximab plus irinotecan in irinote-can-refractory metastatic colorectal cancer. N Engl JMed 2004;351:337–45.

7. Pao W, Miller V, Zakowski M, et al. EGF receptor genemutations are common in lung cancers from ‘‘neversmokers’’ and are associated with sensitivity of tumorsto gefitinib and erlotinib. Proc Natl Acad Sci U S A2004;101:13306–11.

8. Huang S, Armstrong EA, Benavente S, Chinnaiyan P,Harari PM. Dual-agent molecular targeting of theepidermal growth factor receptor (EGFR): combininganti-EGFR antibody with tyrosine kinase inhibitor.Cancer Res 2004;64:5355–62.

9. Manning G, Whyte DB, Martinez R, Hunter T,Sudarsanam S. The protein kinase complement of thehuman genome. Science 2002;298:1912–34.

10. Hardie DG, Carling D. The AMP-activated proteinkinase-fuel gauge of the mammalian cell? Eur J Biochem1997;246:259–73.

11. Paris J, Osborne HB, Couturier A, Le Guellec R,

Philippe M. Changes in the polyadenylation of specificstable RNA during the early development of Xenopuslaevis . Gene 1988;72:169–76.

12. Nagase T, Seki N, Ishikawa K, Tanaka A, Nomura N.Prediction of the coding sequences of unidentifiedhuman genes. V. The coding sequences of 40 newgenes (KIAA0161-KIAA0200) deduced by analysis ofcDNA clones from human cell line KG-1. DNA Res1996;3:17–24.

13. Gil M, Yang Y, Lee Y, Choi I, Ha H. Cloning andexpression of a cDNA encoding a novel protein serine/threonine kinase predominantly expressed in hemato-poietic cells. Gene 1997;195:295–301.

14. Heyer BS, Warsowe J, Solter D, Knowles BB,Ackerman SL. New member of the Snf1/AMPK kinasefamily, Melk, is expressed in the mouse egg andpreimplantation embryo. Mol Reprod Dev 1997;47:148–56.

15. Blot J, Chartrain I, Roghi C, Philippe M, Tassan JP.Cell cycle regulation of pEg3, a new Xenopus protein

Cancer Research




kinase of the KIN1/PAR-1/MARK family. Dev Biol2002;241:327–38.

16. Davezac N, Baldin V, Blot J, Ducommun B, TassanJP. Human pEg3 kinase associates with and phos-phorylates CDC25B phosphatase: a potential role forpEg3 in cell cycle regulation. Oncogene 2002;21:7630–41.

17. Mils V, Baldin V, Goubin F, et al. Specific interactionbetween 14-3-3 isoforms and the human CDC25Bphosphatase. Oncogene 2000;19:1257–65.

18. Forrest A, Gabrielli B. Cdc25B activity is regulated by14-3-3. Oncogene 2001;20:4393–401.

19. Bulavin DV, Higashimoto Y, Demidenko ZN, et al.Dual phosphorylation controls Cdc25 phosphatases andmitotic entry. Nat Cell Biol 2003;5:545–51.

20. Seong HA, Gil M, Kim KT, Kim SJ, Ha H. Phosphor-ylation of a novel zinc-finger-like protein, ZPR9, bymurine protein serine/threonine kinase 38 (MPK38).Biochem J 2002;361:597–604.

21. Vulsteke V, Beullens M, Boudrez A, et al. Inhibitionof spliceosome assembly by the cell cycle-regulatedprotein kinase MELK and involvement of splicingfactor NIPP1. J Biol Chem 2004;279:8642–7.

22. Seong HA, Kim KT, Ha H. Enhancement of B-MYBtranscriptional activity by ZPR9, a novel zinc fingerprotein. J Biol Chem 2003;278:9655–62.

23. Sala A, Watson R. B-Myb protein in cellularproliferation, transcription control, and cancer: latestdevelopments. J Cell Physiol 1999;179:245–50.

24. Jubb AM, Pham TQ, Hanby AM, et al. Expression ofvascular endothelial growth factor, hypoxia induciblefactor 1a, and carbonic anhydrase IX in humantumours. J Clin Pathol 2004;57:504–12.

25. Jubb AM, Landon TH, Burwick J, et al. Quantitativeanalysis of colorectal tissue microarrays by immunoflu-orescence and in situ hybridization. J Pathol 2003;200:577–88.

26. Fodde R, Smits R, Clevers H. APC, signal transduc-tion and genetic instability in colorectal cancer. Nat RevCancer 2001;1:55–67.

27. Yang S, Toy K, Ingle G, et al. Vascular endothelialgrowth factor-induced genes in human umbilical veinendothelial cells: relative roles of KDR and Flt-1receptors. Arterioscler Thromb Vasc Biol 2002;22:1797–803.

28. Elbashir SM, Martinez J, Patkaniowska A, LendeckelW, Tuschl T. Functional anatomy of siRNAs formediating efficient RNAi in Drosophila melanogasterembryo lysate. EMBO J 2001;20:6877–88.

29. Caplen NJ, Parrish S, Imani F, Fire A, Morgan RA.Specific inhibition of gene expression by smalldouble-stranded RNAs in invertebrate and vertebratesystems. Proc Natl Acad Sci U S A 2001;98:9742–7.

30. Hirota T, Kunitoku N, Sasayama T, et al. Aurora-Aand an interacting activator, the LIM protein Ajuba, arerequired for mitotic commitment in human cells. Cell2003;114:585–98.

31. Livak KJ, Schmittgen TD. Analysis of relativegene expression data using real-time quantitativePCR and the 2(-DDC(T)) method. Methods 2001;25:402–8.

32. Myslinski E, Ame JC, Krol A, Carbon P. An unusuallycompact external promoter for RNA polymerase IIItranscription of the human H1RNA gene. Nucleic AcidsRes 2001;29:2502–9.

33. Brummelkamp TR, Bernards R, Agami R. A systemfor stable expression of short interfering RNAs inmammalian cells. Science 2002;296:550–3.

34. Hillen W, Schollmeier K, Gatz C. Control ofexpression of the Tn10-encoded tetracycline resistanceoperon. II. Interaction of RNA polymerase and TETrepressor with the tet operon regulatory region. J MolBiol 1984;172:185–201.

35. Yao F, Svensjo T, Winkler T, Lu M, Eriksson C,Eriksson E. Tetracycline repressor, tetR, ratherthan the tetR-mammalian cell transcription factorfusion derivatives, regulates inducible gene expres-sion in mammalian cells. Hum Gene Ther 1998;9:1939–50.

36. Zhang Y, Eberhard DA, Frantz GD, et al. GEPIS—quantitative gene expression profiling in normal andcancer tissues. Bioinformatics 2004;20:2390–8.

37. Hemmati HD, Nakano I, Lazareff JA, et al. Cancerousstem cells can arise from pediatric brain tumors. ProcNatl Acad Sci U S A 2003;100:15178–83.

38. Willis AE. Translational control of growth factor andproto-oncogene expression. Int J Biochem Cell Biol1999;31:73–86.

39. Hengst L, Reed SI. Translational control of p27Kip1accumulation during the cell cycle. Science 1996;271:1861–4.

40. Agrawal D, Hauser P, McPherson F, Dong F, Garcia A,Pledger WJ. Repression of p27kip1 synthesis by platelet-derived growth factor in BALB/c 3T3 cells. Mol Cell Biol1996;16:4327–36.

41. Fukuda T, Mishina Y, Walker MP, DiAugustine RP.Conditional transgenic system for mouse aurora akinase: degradation by the ubiquitin proteasomepathway controls the level of the transgenic protein.Mol Cell Biol 2005;25:5270–81.

42. Rajasekhar VK, Viale A, Socci ND, Wiedmann M, HuX, Holland EC. Oncogenic Ras and Akt signalingcontribute to glioblastoma formation by differentialrecruitment of existing mRNAs to polysomes. Mol Cell2003;12:889–901.

43. Heyer BS, Kochanowski H, Solter D. Expression of

Melk, a new protein kinase, during early mousedevelopment. Dev Dyn 1999;215:344–51.

44. Shin SI, Freedman VH, Risser R, Pollack R. Tumor-igenicity of virus-transformed cells in nude mice iscorrelated specifically with anchorage independentgrowth in vitro . Proc Natl Acad Sci U S A 1975;72:4435–9.

45. Macpherson I, Montagnier L. Agar suspensionculture for the selective assay of cells transformed bypolyoma virus. Virology 1964;23:291–4.

46. Nagata D, Mogi M, Walsh K. AMP-activated proteinkinase (AMPK) signaling in endothelial cells is essentialfor angiogenesis in response to hypoxic stress. J BiolChem 2003;278:31000–6.

47. Morrow VA, Foufelle F, Connell JM, Petrie JR,Gould GW, Salt IP. Direct activation of AMP-activatedprotein kinase stimulates nitric-oxide synthesis inhuman aortic endothelial cells. J Biol Chem 2003;278:31629–39.

48. Lee M, Hwang JT, Lee HJ, et al. AMP-activatedprotein kinase activity is critical for hypoxia-induciblefactor-1 transcriptional activity and its target geneexpression under hypoxic conditions in DU145 cells.J Biol Chem 2003;278:39653–61.

49. Kato K, Ogura T, Kishimoto A, et al. Critical roles ofAMP-activated protein kinase in constitutive toleranceof cancer cells to nutrient deprivation and tumorformation. Oncogene 2002;21:6082–90.

50. Suzuki A, Kusakai G, Kishimoto A, et al. Identifi-cation of a novel protein kinase mediating Akt survivalsignaling to the ATM protein. J Biol Chem 2003;278:48–53.

51. Suzuki A, Lu J, Kusakai G, Kishimoto A, Ogura T,Esumi H. ARK5 is a tumor invasion-associated factordownstream of Akt signaling. Mol Cell Biol 2004;24:3526–35.

52. Kusakai G, Suzuki A, Ogura T, et al. ARK5 expressionin colorectal cancer and its implications for tumorprogression. Am J Pathol 2004;164:987–95.

53. Lizcano JM, Goransson O, Toth R, et al. LKB1 is amaster kinase that activates 13 kinases of the AMPKsubfamily, including MARK/PAR-1. EMBO J 2004;23:833–43.

54. Easterday MC, Dougherty JD, Jackson RL, et al.Neural progenitor genes. Germinal zone expression andanalysis of genetic overlap in stem cell populations. DevBiol 2003;264:309–22.

55. Geschwind DH, Ou J, Easterday MC, et al. A geneticanalysis of neural progenitor differentiation. Neuron2001;29:325–39.

56. Black EP, Huang E, Dressman H, et al. Distinct geneexpression phenotypes of cells lacking Rb and Rb familymembers. Cancer Res 2003;63:3716–23.





2005;65:9751-9761. Cancer Res Daniel Gray, Adrian M. Jubb, Deborah Hogue, et al. Target for Multiple CancersSerine-Threonine Kinase 38 Is a Promising Therapeutic Maternal Embryonic Leucine Zipper Kinase/Murine Protein

Updated version

http://cancerres.aacrjournals.org/content/65/21/9751

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2005/10/28/65.21.9751.DC1.html

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/65/21/9751.full.html#ref-list-1

This article cites 56 articles, 27 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/65/21/9751.full.html#related-urls

This article has been cited by 23 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

[email protected] at

To request permission to re-use all or part of this article, contact the AACR Publications


http://cancerres.aacrjournals.org/content/65/21/9751

http://cancerres.aacrjournals.org/content/suppl/2005/10/28/65.21.9751.DC1.html

http://cancerres.aacrjournals.org/content/65/21/9751.full.html#ref-list-1

http://cancerres.aacrjournals.org/content/65/21/9751.full.html#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

mailto:[email protected]


Maternal embryonic leucine zipper kinase/murine protein serine-threonine kinase 38 is a promising therapeutic target for multiple cancers

Documents