Antibiotics, Magic Pill or Overkill?
Easy PCR
Teacher Materials
Students will analyze the DNA from different strains of bacteria
to determine if they carry the gene for ampicillin resistance.
Students will use PCR to amplify the ampicillin resistance (ampR)
gene from a strain known to be resistant to ampicillin (control)
and from an unknown strain (test). The results of the PCR reaction
will be determined by agarose gel electrophoresis.
Learning Goals, Objectives, and
Skills…………………………………………………………………………………….2
Instructor Planning
Guide…………………………………………………………………………………………….………. 3
Instructor Preparation
Guide…………………………………………………………………………………………………5
Instructions for ordering PCR
Primers…………………………………………………………………………………….8
Answers to Student
Questions……………………………………………………………………………………………….9
Standards
Alignments…………………………………………………………………………………………………………..12
Calculation Tool for ordering NEB
Reagents………………………………………………………………….………15
Antibiotics, Magic Pill or Overkill?
Learning Goals
Student Learning Goals:
· Students will understand what an antibiotic is, where it comes
from and what it is used for.
· Students will understand what a plasmid is and its
relationship to antibiotic resistance.
· Students will understand the process of agarose gel
electrophoresis.
· Students will understand the process of PCR.
· Students will understand how to use PCR to determine if
bacteria carry a plasmid with an antibiotic resistance gene.
Student Learning Objectives:
· Students will plan an experiment implying positive and
negative controls.
· Students will use PCR as a biotechnology tool.
· Students will perform the technique of agarose gel
electrophoresis.
· Students will estimate DNA fragment sizes from agarose gel
data.
· Students will analyze the results of the molecule separation
by gel electrophoresis.
· Students will identify antibiotic resistance in different
bacterial strains.
Scientific Inquiry Skills:
· Students will pose questions and form hypotheses.
· Students will design and conduct scientific
investigations.
· Students will use experimental data to make conclusions about
the initial question and to support or to refute the stated
hypothesis.
· Students will follow laboratory safety rules and
regulations.
Laboratory Technical Skills:
· Students will demonstrate proper use of micropipettes.
· Students will consider safety considerations when working with
an electric current.
· Students will demonstrate proper use of gel electrophoresis
and PCR equipment.
· Students will prepare and pour agarose gels.
· Students will perform PCR.
Antibiotics, Magic Pill or Overkill?
Instructor Planning Guide
Experimental Timing:
From start to finish this lab takes 90-120 minutes. However,
there are many good stopping points in this protocol that make it
possible to complete the lab in a series of 45-50 minute
periods.
· Pre-lab discussion (20 min)
· PCR – setup (20 min)
· PCR reaction cycles (~20 to 60 minutes)*
· Stopping Point – After PCR has been performed, reaction tubes
can be placed in the refrigerator overnight or in the freezer
indefinitely. Tubes can be stored in the freezer until you are
ready to perform the gel electrophoresis.
· Preparation of agarose gels and buffer (30 minutes)**
· Electrophoresis of DNA (20 minutes)***
· Visualization and interpretation of gels (10-15 min)
*PCR reaction time will depend on the thermocycler used
**Instructors may choose to prepare gels and buffer ahead of
time to reduce lab time.
***Time required for electrophoresis may vary depending on the
type of equipment and voltage used
Specialized Equipment needed for Lab:
· p20 micropipettes
· thermocycler (each student group will set up 3 PCR
samples)
· gel electrophoresis units with power supplies (each student
group will run 3 samples and each gel must also have a lane
available for DNA ladder)
· transilluminator or other UV light source
· centrifuge (optional)
Ordering information:
This lab was developed using DNA oligonucleotide primers and
other products ordered through Fisher Scientific, and plasmids and
DNA ladder from New England BioLabs.
*The reagents from New England BioLabs can be ordered (at no
cost) by going to their website (https://www.neb.com). A
calculation tool for ordering NEB Reagents for this lab can be
found on the final page of this document.
Procedure Tips:
1. Before starting the experiment, ask students to check their
materials list to make sure they have everything.
2. Keep template DNA, primers and OneTaq® on ice at all
times.
3. Demonstrate how to pipet very small volumes of liquid.
· First, pipet the water into each tube.
· After withdrawing a small amount of liquid from the stock
tube, visually inspect the very end of the pipette tip. You should
see a small amount of liquid.
· Insert the pipette tip containing the small amount of liquid
into the tube so that it is partially submerged in the water and
expel the liquid from the pipette tip.
· Remove pipette from tube and inspect the tip again to confirm
that you have successfully transferred the small volume into the
tube.
· Gently flick the tube to mix the solution. You want to avoid
making bubbles.
4. Remind students to use a fresh pipette tip between each
addition.
5. If your gel units have a blue light to visualize the DNA,
remind students to turn off the light while they run the gel. DNA
stains are light sensitive, and it is possible to bleach the stain
during the run making it difficult to visualize the DNA. If this
accidently happens, you can soak the gel after running in buffer
with 2X GelGreen™ for 30 minutes and then visualize the gel.
Teaching Tips:
1. The protocol for preparing the electrophoresis gels is not
included in this version of the lab. You can download “A Guide to
Agarose Gel Electrophoresis” document from the website
(https://www.massbioed.org/educators/curriculum), adapt it to your
equipment and insert it in the lab.
2. Many students may have already done the classic antibiotic
resistance lab – culturing E.coli on LB plates with antibiotic
disks. Discuss with students why you would perform PCR to test for
antibiotic resistance rather than a bacterial culture. Have them
think about the time it took to get results from the bacterial
cultures as compared to the PCR.
3. As written, all students will PCR the same “test” DNA using
the dilute plasmid. However, you may choose to set up the lab so
that some groups PCR “test” DNA that is just water and will give a
negative result. If you choose to set the lab up with multiple
“test” bacteria make sure that you have students write down which
test DNA they have (e.g. T1, T2, or T3).
Safety Considerations:
· Gloves, lab coats and eye protection should be used whenever
possible, as a part of good laboratory practice.
· Practice sterile techniques whenever possible, to avoid
contamination of reagents.
· Exercise caution when heating and/or melting reagents during
gel preparation.
· Exercise caution when working with electrical equipment.
· UV protective shields and/or glasses must be used if
visualizing gels with a UV light source
· Always wash hands thoroughly after handling biological
materials or reagents.
· Obtain the Material Safety Data Sheets (MSDS) available from
the suppliers and follow all safety precautions and disposal
directions as described in the MSDS.
· Check with your school’s lab safety coordinator about proper
disposal of all reagents and gels containing DNA stains.
Antibiotics, Magic Pill or Overkill?
Instructor Preparation Guide
Materials: This guide assumes 30 students, working in groups of
two, for a total of 15 groups.
Materials for Advanced Teacher Preparation:
1 tube
plasmid DNA with the ampicillin resistance gene, ampR. Options
are: pMAL-c5X plasmid (NEB# N8108S), pSNAPf plasmid (NEB# N9183S),
pGLO (BioRad) pUC19 (NEB# N3041S), etc. Diluted to a concentration
of 0.2 ng/L▲
1 tube
ampR forward primer (see primer ordering and suspending
information)▲
1 tube
ampR reverse primer (see primer ordering and suspending
information) ▲
1 tube
OneTaq® Quick Load 2X Master Mix with Standard Buffer (NEB#
M0486S). 1 tube is sufficient for 100 PCR reactions. ▲
1 tube
DNA Ladder: Quick-Load® Purple 100 bp DNA Ladder (NEB# N0551S).
1 tube will have 1.25 mL of DNA at 50 g/mL▲
3 mL
sterile distilled water
100
microcentrifuge tubes (1.5 mL)
45
thin-walled PCR tubes (size will depend on the thermocycler you
are using)
1
p20 micropipette and tips
1
p200 micropipette and tips
1
p1000 micropipette and tips
2-3
microcentrifuge tube racks
1
centrifuge (optional)
1
ice bucket with crushed ice
1
ultrafine point permanent marker
all
reagents and equipment to prepare gels for gel electrophoresis
*see Teaching Tips
Materials for each Student Workstation:
Materials for Common Workstation:
1 tube
control DNA with 5 L dilute plasmid ▲
Thermocycler
1 tube
test DNA with 5 L dilute plasmid ▲
UV or blue light source (optional)
1 tube
primer mix with 20 L forward and reverse primers for ampR
gene
centrifuge (optional)
1 tube
OneTaq Quick-Load® with 85 L 2X Master Mix ▲
1X electrophoresis buffer
1 tube
DNA Ladder with 12 L Quick Load ® Purple 100 bp ▲
1 tube
dHsO with 100 L sterile distilled water
1
agarose gel (1.5%) with DNA stain
1
p20 micropipette and tips
3
thin-walled PCR tubes
1
microcentrifuge tube rack
1
microcentrifuge tube float
1
ice bucket or Styrofoam cup with crushed ice
1
ultrafine point permanent marker
1
waste container
1
gel electrophoresis unit with power supply
▲ Caution: OneTaq, re-suspended primers and DNA are heat
sensitive. Keep them on ice at all times while working. Store in
freezer long-term.
Easy substitutions:
· Demonstrate for students how you can easily and accurately
measure 21 L by dispensing 10 L + 11 L. Tip: Micropipettes tend to
be less accurate at the extreme low or high end of their range.
· If you do not have a centrifuge, have students gently tap the
PCR tubes on the lab bench to collect all the reagents at the
bottom of the tube.
Set-up Calendar:
2 weeks before lab:
· Order PCR primers (See “Instructions for Ordering Primers” for
more information)
· Re-suspend primers to concentration of 100 M, and use to make
a working stock primer mix
1. Primers (also called Oligos) are shipped as dried DNA. The
first step is to add distilled water or TE buffer (Tris pH 8.0, 1mM
EDTA) to re-suspend the DNA. Primers are slightly more stable in TE
buffer, but perform well for many years if re-suspended in water
and stored in a -20°C freezer.
2. Calculate the amount of water (or TE buffer) that is required
to bring each primer concentration to 100 M. Find the number of
nmoles of each primer that was shipped. Each primer will be sent in
slightly different amounts. This can be found on the primer tube
itself or the paperwork that was sent with the primers. Note- g and
nmoles are different. Use nmoles for calculations.
· Example calculation: If you are sent 12.1 nmoles, add 121 L of
water to bring concentration to 100 M. (12.1X 10-9 moles/121X10-6
Liters = 100X10-6M)
· Another Example calculation: If you are sent 58.6 nmoles, add
586 L of water to bring concentration to 100 M. (58.6 10-9
moles/586 X 10-6 Liters = 100 X 10-6M)
· The trick is to move the decimal over 1 place (58.6 to 586.0)
and add that number of L of water or TE buffer.
3. Vortex the re-suspended primers (with lids on tightly) and
let sit at room temperature for 10 minutes. Vortex again.Reminder:
These are your reserve stocks that you will store in the freezer
long term.
4. Once you have made the initial 100 M stock primer solutions,
you will combine some of the two different ampR primers to make a
1X working stock of primer mix. The 1X working primer stock will be
1.5 M of each primer.
· In a 1.5 mL tube, add 485 L of water (or TE buffer).
· Add 7.5 L of ampR forward primer to tube
· Add 7.5 L of ampR reverse primer to tube
· Label tube: ampR primer Mix (1.5 uM)
Note: The 1X working stock will be provided to each group of
students. Each group will use 4 L of the primer mix in a 50 L
reaction. Thus the final concentration of each primer is = 0.12 M,
for a total of 0.24 M primer. (4 L X 1.5 M /50 L = 0.12 M)
Reminder: Store primers in refrigerator at 4°C for short-term
storage. For long-term storage, primers should be kept in the
freezer at -20°C
· Order or choose any plasmid with the ampR gene and make a PCR
stock by diluting plasmid to a concentration of 0.2ng/L.
· If you ordered pUC19 (NEB# N3041S) it comes at a concentration
of 1,000 μg/1 mL for a total of 50 μg of plasmid DNA in 50 μL of
solution. You will need only a tiny amount to make enough template
DNA for thousands of reactions.
· Dilute 1 μL of plasmid in 5 mL of sterile distilled water or
TE.
Reminder: Store template DNA in the freezer at -20°C
· Check supplies and order any needed materials.
· If making any substitutions to the supply list, edit the
student protocol accordingly.
1 day before lab:
· Set up student lab stations with durable materials according
to the materials listed above.
· Prepare 1X TAE or similar electrophoresis buffer.
· Prepare 1.5% agarose gels with DNA Stain. (Each group will run
three samples plus a ladder.)
Tip: Gels can be prepared ahead of time. If you pour the gels
several days before the lab, they should be stored in a plastic
container/bag with a damp paper towel to keep them from drying out.
Gels should be stored in a cool location.
▲ Caution: DNA stains such as GelGreen are light sensitive. Gels
should be stored in an opaque container in the dark.
· Aliquot out the DNA ladder, dH2O, master mix.
· Aliquot 12 L of Quick Load® 100 bp Ladder into tubes labeled
Ladder. Prepare one tube per lab group.
· Aliquot 100 L of sterile distilled water into tubes labeled
dH2O. Prepare one tube per lab group.
· Aliquot 20 L of 1X forward and reverse primer mix into tubes
labeled Primers. Prepare one tube per lab group.
· Aliquot 85 L of OneTaq Quick-Load® 2X Master Mix with Standard
Buffer into tubes labeled OneTaq. Prepare one tube per lab
group.
▲ Caution: OneTaq Master mix, and DNA are heat sensitive. Keep
enzymes, buffers and DNA on ice at all times while working.
▲ Caution: Store OneTaq and DNA ladder in freezer overnight.
Morning of lab:
· Set up Common Workstation according to the materials list.
· Aliquot out the plasmid DNA to make control and template
tubes.
· Aliquot 5 L of dilute plasmid into tubes labeled Test DNA.
Prepare one tube per lab group.
· Aliquot 5 L of dilute plasmid into tubes labeled Control DNA.
Prepare one tube per lab group.
· Set up ice buckets for each student workstation.
· Set out reagents at each student workstation according to
materials list.
▲ Caution: Keep template DNA, primers and OneTaq® on ice at all
times.
Antibiotics, Magic Pill or Overkill?
Instructions for ordering primers from Fisher Scientific
1. Go to fishersci.com.
2. Under the “Shop products” drop down menu, navigate to:
a. “RNAi, Oligos, Assays, Gene Editing & Gene Synthesis
Tools” link.
i. Find the “Oligos and RNAi Tools” section
· Then choose “Eurofins MWG Operon Oligo Tool”. You will see the
following
· Click “Start shopping”
3. Fill in form.
a. Sequence Name: ampR forward
b. Sequence 5’: atttccgtgtcgcccttattccc (Sequence length should
automatically input with 23)
c. Do not add any modification
d. Scale: 10nmole
e. Purification: Salt-free
f. Oligo Quantity: 1
g. Order Reverse Complement: No
h. Normalization Requested: No
4. Click “Add to order” and input 2nd Oligo.
5. Fill in form.
a. Sequence Name: ampR reverse
b. Sequence 5’: gctcaccggctccagatttatc (Sequence length should
automatically input with 22)
c. Do not add any modification
d. Scale: 10nmole
e. Purification: Salt-free
f. Oligo Quantity: 1
g. Order Reverse Complement: No
h. Normalization Requested: No
6. Click “Review Pricing”- the total should be around $10.
7. Click “Add to cart” and checkout.
Antibiotics, Magic Pill or Overkill?
Answers to Student Questions
Pre-Lab:
1. An antibiotic is any small molecule that inhibits the growth
of bacteria. Antibiotics are naturally produced by many organisms,
most often other soil fungi and bacteria.
2. Antibiotic resistance as applied to bacterial cells means
that certain cells are no longer killed or inhibited by the
application of antibiotics. Antibiotic resistant cells have
acquired a gene that encodes a protein that breaks down the
antibiotic before it can kill or inhibit the cell.
3. PCR requires: Template DNA, two primers, DNA polymerase, and
dNTPS.
4. A PCR cycle includes:
a. Melting (or denaturation): a high temperature step where the
two strands of the template DNA are separated into single
strands.
b. Annealing: Usually occurs at temperatures between 50 and
65°C. The temperature is determined by the sequence of the primers
and the type of DNA polymerase used. At this step, the primers bind
to the template DNA.
c. Elongation: Usually occurs at temperatures between 68 and
72°C, depending upon the type of DNA polymerase used. At this step,
the DNA polymerase binds to the primer/template complex and copies
the template strand by elongating the primers.
5. Agarose, a mixture of two polysaccharides, is melted in a
buffered solution and used to cast a solid gel that serves as a
sieving agent. By applying an electric field to the gel, molecules
are moved through the matrix of agarose. Negatively charged
molecules migrate toward the positive electrode, while positively
charged molecules migrate toward the negative electrode. In
general, smaller molecules move faster and migrate farther than
longer molecules because they can move more easily through the
matrix of polymerized polysaccharides.
6. A plasmid that allows cells to live and reproduce in the
presence of the tetracycline must carry the tetracycline resistance
gene. This gene encodes a protein that modifies and inactivates
tetracycline or transports tetracycline out of the cell before it
can kill the cell.
7. If the infection is caused by a bacterial strain that is
resistant to ampicillin and you treat the infection with ampicillin
or ampicillin-related drugs, then you will not cure the infection.
If you test the bacterial strain before starting treatment and
determine that it carries the ampicillin resistance gene, then you
would know to try some other antibiotic to cure your dog’s
infection.
Data Collection and Post-Lab:
Sample Gel:
C1 C2 T
1. A band on the gel represents many DNA molecules of the same
size.
2. Analyze results
· Students may or may not see bands in the control lanes. We
expect that the C1 lane would not have a band, and the C2 lane
would have a single band of approximately 700 bp.
· C1 was a negative control. The purpose of the control 1 is to
make sure that none of your reagents were contaminated with
template DNA.
· C2 was a positive control. It has the ampR gene and should be
amplified by the primers. The purpose of the control 2 is to make
sure that your primers are correct, the DNA polymerase and master
mix is working, and the PCR reaction occurred.
3. Assume that you see a band in the C1 lane.
· Answers here will vary. Presence of a band in the C1 lanes
indicates that there is DNA containing the ampR gene in the
reaction mix. It could be that one of the other reagents was
contaminated with DNA or that a dirty pipette tip was used.
· There should NOT be a band in the C1 lane, and if there is,
then there is no way to know if a positive result with the test DNA
is valid. If there is a band in the C1 lane, you cannot conclude
that a band in the test lane means that the test bacteria are
ampicillin resistant.
4. Assume that you do not see a band in the C2 lane.
· There SHOULD be a band in the C2. If you do not see a band in
the C2 lane it could be because you did not put all of the reagents
into the reaction tube or that the PCR machine did not function
correctly.
· The absence of a band in the C2 lane matters most if there is
also no band in the test lane. If there is no band in the C2 lane,
then the absence of a band in the test lane is inconclusive. You
cannot conclude that the absence of a band in the test lane means
that the test bacteria are ampicillin sensitive.
5. Answers here will vary. The expected results are: no band in
the C1 lane and a single band of about 700 bp in both the C2 and
the unknown lane. If the students see what is expected (see above),
then they should conclude that the test bacteria contain the
ampicillin resistance gene.
6. The primers were designed to amplify the ampicillin
resistance gene.
7. Given your results, circle all of the media on which the test
bacteria will grow.
A. Growth media without antibiotics √
B. Growth media with Ampicillin √
C. Growth media with Tetracycline
Antibiotics, Magic Pill or Overkill?
Standards Alignments
MA Science and Technology/Engineering Standards – High School
(2016)
Biology
HS-LS1-1. Construct a model of transcription and translation to
explain the roles of DNA and RNA that code for proteins that
regulate and carry out essential functions of life.
HS-LS4-4. Research and communicate information about key
features of viruses and bacteria to explain their ability to adapt
and reproduce in a wide variety of environments.
Chemistry
HS-PS1-3. Cite evidence to relate physical properties of
substances at the bulk scale to spatial arrangements, movement, and
strength of electrostatic forces among ions, small molecules, or
regions of large molecules in the substances. Make arguments to
account for how compositional and structural differences in
molecules result in different types of intermolecular or
intramolecular interactions.
HS-PS1-11(MA). Design strategies to identify and separate the
components of a mixture based on relevant chemical and physical
properties.
HS-PS2-6. Communicate scientific and technical information about
the molecular-level structures
of polymers, ionic compounds, acids and bases, and metals to
justify why these are
useful in the functioning of designed materials.
Physics
HS-PS3-5. Develop and use a model of magnetic or electric fields
to illustrate the forces and changes in energy between two
magnetically or electrically charged objects changing relative
position in a magnetic or electric field, respectively.
NRC Practices
· Asking questions and defining problems
· Planning and carrying out investigations
· Analyzing data
· Mathematical and computational thinking
· Constructing explanations and designing solutions
· Engaging in argument from evidence
· Obtaining, evaluating, and communicating information
Next Generation Science Standards – High School (2013)
Life Sciences
HS-LS1-1. Construct an explanation based on evidence for how the
structure of DNA determines the structure of proteins which carry
out the essential functions of life through systems of specialized
cells.
Chemistry
HS-PS1-3. Cite evidence to relate physical properties of
substances at the bulk scale to spatial arrangements, movement, and
strength of electrostatic forces among ions, small molecules, or
regions of large molecules in the substances. Make arguments to
account for how compositional and structural differences in
molecules result in different types of intermolecular or
intramolecular interactions.
HS-PS2-6. Communicate scientific and technical information about
the molecular-level structures
of polymers, ionic compounds, acids and bases, and metals to
justify why these are
useful in the functioning of designed materials.
Physics
HS-PS3-5. Develop and use a model of magnetic or electric fields
to illustrate the forces and changes in energy between two
magnetically or electrically charged objects changing relative
position in a magnetic or electric field, respectively.
Common Core State Standards Connections:
ELA/Literacy -
RST.9-10.7Translate quantitative or technical information
expressed in words in a
text into visual form (e.g., a table or chart) and translate
information expressed visually or mathematically (e.g., in an
equation) into words.
RST.9-10.8Assess the extent to which the reasoning and evidence
in a text support
the author’s claim or a recommendation for solving a scientific
or technical problem.
RST.11-12.1Cite specific textual evidence to support analysis of
science and technical
texts, attending to important distinctions the author makes and
to any gaps or inconsistencies in the account.
RST.11-12.7Integrate and evaluate multiple sources of
information presented in
diverse formats and media (e.g., quantitative data, video,
multimedia) in order to address a question or solve a problem.
RST.11-12.8Evaluate the hypotheses, data, analysis, and
conclusions in a science or
technical text, verifying the data when possible and
corroborating or challenging conclusions with other sources of
information.
RST.11-12.9Synthesize information from a range of sources (e.g.,
texts, experiments,
simulations) into a coherent understanding of a process,
phenomenon, or concept, resolving conflicting information when
possible.
WHST.9-12.1Write arguments focused on discipline-specific
content.
WHST.9-12.2Write informative/explanatory texts, including the
narration of historical
events, scientific procedures/ experiments, or technical
processes.
WHST.9-12.5Develop and strengthen writing as needed by planning,
revising, editing,
rewriting, or trying a new approach, focusing on addressing what
is most significant for a specific purpose and audience.
WHST.9-12.7Conduct short as well as more sustained research
projects to answer a
question (including a self-generated question) or solve a
problem; narrow or broaden the inquiry when appropriate; synthesize
multiple sources on the subject, demonstrating understanding of the
subject under investigation.
WHST.9-12.9Draw evidence from informational texts to support
analysis, reflection,
and research.
SL.11-12.5Make strategic use of digital media (e.g., textual,
graphical, audio, visual,
and interactive elements) in presentations to enhance
understanding of findings, reasoning, and evidence and to add
interest.
Mathematics -
MP.2Reason abstractly and quantitatively.
MP.4Model with mathematics.
HSF-BF.A.1Write a function that describes a relationship between
two quantities.
HSF-IF.C.7Graph functions expressed symbolically and show key
features of the
graph, by hand in simple cases and using technology for more
complicated cases.
HSN.Q.A.1Use units as a way to understand problems and to guide
the solution of
multi-step problems; choose and interpret units consistently in
formulas; choose and interpret the scale and the origin in graphs
and data displays.
HSN.Q.A.2Define appropriate quantities for the purpose of
descriptive modeling.
HSN.Q.A.3Choose a level of accuracy appropriate to limitations
on measurement
when reporting quantities.
HSS-IC.A.1Understand statistics as a process for making
inferences about
population parameters based on a random sample from that
population.
HSS-IC.B.6Evaluate reports based on data.
Calculation tool for ordering NEB Reagents for:
Antibiotics, Magic Pill or Overkill: Easy PCR
Please keep in mind that NEB is a fantastic and generous partner
and will provide up to $1000 of reagents for each school. Please
check with your colleagues to coordinate your ordering to ensure
that your school plans ahead for ALL of the planned labs requiring
NEB reagents, and please, only order as much as you need. The
calculation tool below will help you determine how much of each
reagent to order. Importantly, the amount needed per group shown
below includes the extra needed in case of mistakes or when
aliquots are provided for each group.
Fill out the chart below to determine how many tubes of each of
the reagents you need to order.
The number of groups will vary depending on your classes and
equipment.
Calculation tool:
Example
NEB
Reagent
NEB
Catalog #
Amount of Reagent
In NEB Tube
Amount
Needed per Group
Total Number of Groups Doing the Lab
Total Amount You Will Need
# Tubes Needed
Reagent X
X0000
40 L
4 L
8
32 L
1
You fill this in
4 L X (# groups)
32 L < 40 L
NEB
Reagent
NEB
Catalog #
Amount of Reagent
In NEB Tube
Amount
Needed per Group
Total Number of Groups Doing the Lab
Total Amount You Will Need
# Tubes Needed
OneTaq Quick Load® 2X Master Mix with Standard Buffer
M0486S
2500 L
85 L
Quick-Load® Purple 100 bp DNA Ladder
N0551S
1250 L
12 L*
Because of the nature of PCR, each group needs only a tiny
amount of plasmid (4 ng). A single tube of plasmid will be enough
for thousands of reactions. Please note that any plasmid with the
ampicillin resistance gene can be use in this lab, so you may
already have a plasmid that can be used for this experiment.
pUC19, Vector
N3041S
50 μg =
50,000 ng
4 ng
*This is per gel. You may have more than one group per gel.
Once completed, you can submit your order here:
https://www.neb.com/forms/BioTeach
6/28/19
2