Manifestations of a Code Genes, genomes, bioinformatics and cyberspace – and the promise they hold for biology education
Dec 28, 2015
Manifestations of a Code
Genes, genomes, bioinformatics and cyberspace – and the promise they
hold for biology education
The iPlant CollaborativeVision
www.iPlantCollaborative.org
Enable life science researchers and educators touse and extend cyberinfrastructure
A GENOME is all of a living thing’s genetic material.
The genetic material is DNA (DeoxyriboNucleic Acid)
DNA, a double helical molecule, is made up of four nucleotide “letters”:A-- G--
T-- C--
What is a genome?
Slide: JGI, 2009
Just as computer software is rendered in long strings of 0s and 1s, the GENOME or “software” of life is represented by a string of the four nucleotides, A, G, C, and T.
To understand the software of either - a computer or a living organism - we must know the order, or sequence, of these informative bits.
What is sequencing?
Slide: JGI, 2009
¢0.57
¢0.19
¢0.35
Sequ
ence
pro
ducti
on (B
illio
ns o
f bas
es/m
onth
)Se
quen
ce p
rodu
ction
(Bill
ions
of b
ases
/mon
th)
¢0.50¢0.50
¢1 ¢1
00
Cost: Cents per baseCost: Cents per base
1.01.0
00
2.02.0
3.03.0
19891989 19911991 19931993 19951995 19971997 19991999 20032003 2005200520012001
¢0.46
¢0.08
20072007
Human Genome completed
Economics of Scale
Human Genome launched
> ¢0.05
Slide: JGI, 2009
•1986 DOE announces Human Genome Initiative-- $5.3 million to develop technology.
•1990 DOE & NIH present their HGP plan to Congress.
1997 Escherichia coli genome published
•1997 Yeast genome published
•2000 Fruit fly (Drosophila) genome published.
•2000 Working draft of the human genome announced.
•2000 Thale cress (Arabidopsis) genome published (2x).
•2002 Rice genome published (2x).
•2003 Human genome published.
•2006 First tree genome published in Science.
•2007 First metagenomics study published
Important Dates in Genomics
Another angle
Slide: Stein, 2010
Coming into the Genome Age
For the first time in the history of science students can work with the same data and tools that are used by researchers.
Learning by posing and answering question.
Students generate new knowledge.
Workshop Objectives
Illustrate the evolving concept of “gene.” Conceptualize a “big picture” of complex, dynamic
genomes. Guide students to address real problems through modern
genome science. Use educational and research interfaces for bioinformatics. Work with “real” genome sequences gathered by students
– in the lab or online.
Exciting?
>mouse_ear_cress_1080 GAAATAATCAATGGAATATGTAGAGGTCTCCTGTACCTTCACAGAGATTCTAGGCTGAGAGCAGTGCATATAGATATCTTTCGTACTCATCTGCTTTTTCTGGTCTCCATCACAAAAGCCAACTAGGTAATCATATCAATCTCTCTTTACCGTTTACTCGACCTTTTCCAATCAGGTGCT TCTGGTGTGTCTACTACTATCAGTTTTAGGTCTTTGTATACCTGATCTTATCTGCTACTG AGGCTTGTAAAAGTGATTAAAACTGTGACATTTACTCTAAGAGAAGTAACCTGTTTGATGCATTTCCCTAATATACCGGTGTGGAAAAGTGTAGGTATCTGTACTCAGCTGAAATGGTGGACGATTTTGAAGAAGATGAACTCTCATTGACTGAAAGCGGGTTGAAGAGTGAAGATGGCGTTATTATCGAGATGAATGTCTCCTGGATGCTTTTATTATCATGTTTGGGAATTTACCAAGGGAGAGGTATCAGAATCTATCTTAGAAGGTTACATTTAGCTCAAGCTTGCATCAACATCTTTACTTAGAGCTCTACGGGTTTTAGTGTGTTTGAAGTTTCTTAACTCCTAGTATAATTAGAATCTTCTGCAGCAGACTTTAGAGTTTTGGGATGTAGAGCTAACCAGAGTCGGTTTGTTTAAACTAGAATCTTTTTATGTAGCAGACTTGTTCAGTACCTGAATACCAGTTTTAAATTACCGTCAGATGTTGATCTTGTTGGTAATAATGGAGAAACGGAAGAATAATTAGACGAAACAAACTCTTTAAGAACGTATCTTTCAGTTTTCCATCACAAATTTTCTTACAAGCTACAAAAATCGAACTATATATAACTGAACCGAATTTAAACCGGAGGGAGGGTTTGACTTTGGTCAATCACATTTCCAATGATACCGTCGTTTGGTTTGGGGAAGCCTCGTCGTACAAATACGACGTCGTTTAAGGAAAGCCCTCCTTAACCCCAGTTATAAGCTCAAAGTTGTACTTGACCTTTTTAAAGAAGCACGAAACGAAAAACCCTAAAATTCCCAAGCAGAGAAAGAGAGACAGAGCAAGTACAGATTTCAACTAGCTCAAGATGATCATCCCTGTTCGTTGCTTTACTTGTGGAAAGGTTGATATTTTCCCCTTCGCTTTGGTCTTATTTAGGGTTTTACTCCGTCTTTATAGGGTTTTAGTTACTCCAAATTTGGCTAAGAAGAGATCTTTACTCTCTGTATTTGACACGAATGTTTTTAATCGGTTGGATACATGTTGGGTCGATTAGAGAAATAAAGTATTGAGCTTTACTAAGCTTTCACCTTGTGATTGGTTTAGGTGATTGGAAACAAATGGGATCAGTATCTTGATCTTCTCCAGCTCGACTACACTGAAGGGTAAGCTTACAATGATTCTCACTTCTTGCTGCTCTAATCATCATACTTTGTGTCAAAAAGAGAGTAATTGCTTTGCGTTTTAGAGAAATTAGCCCAGATTTCGTATTGGGTCTGTGAAGTTTCATATTAGCTAACACACTTCTCTAATTGATAACAGAAGCTATAAAATAGATTTGCTGATGAAGGAGTTAGCTTTTTATAATCTTCTGTGTTTGTGTTTTACTGTCTGTGTCATTGGAAGAGACTATGTCCTGCCTATATAATCTCTATGTGCCTATCTAGATTTTCTATACAATTGATATTTGATAGAAGTAGAAAGTAAGACTTAAGGTCTTTTGATTAGACTTGTGCCCATCTACATGATTCTTATTGGACTAATCATTCTTTGTGTGAAAATAGAATACTTTGTCTGAACATGAGAGAATGGTTCATAATACGTGTGAAGTATGGGATTAGTTCAACAATTTCGCTATTGGAGAAGCAAACCAAGGGTTAATCGTTTATAGGGTTAAGCTAATGCTCTGCTCTTTATATGTTATTGGAACAGACTATTGTTGTGCCTATCTTGTTTAGTTGTAGATTCTATCTCGACTGTTATAAGTATGACTGAAGGCTTGATGACTTATGATTCTCTTTACACCTGTAGAAGGATTTAAGCTTGGTGTCTAGATATTCAATCTGTGTTGGTTTTGTCTTTCTTTTGGCTCTTAGTGTTGTTCAATCTCCTCAATAGGTATGAAGTTACAATATCCTTATTATTTTGCAGGGACGCACTTGATGCACTCCAGCTAGTCAGATACTGCTGCAGGCGTATGCTAATGACCTTGCATCAACATCTTTACTTAGAGCTCTACGGGTTTTAGTGTGT
This better?
FindGene Families
Generate mathematical
evidence
Analyze large data amounts
Browse in context
Build gene models
Gatherbiological evidence
Annotation workflow
Get DNA sequence
Walk or…
Early concept (2009)
DNA Subway 2014
Molecular biology and bioinformatics conceptsRepeatMasker• Eukaryotic genomes contain large amounts of repetitive DNA.• Transposons can be located anywhere.• Transposons can mutate like any other DNA sequence.
FGenesH Gene Predictor• Protein-coding information begins with start, followed by codons, ends in stop.• Codons in mRNA (AUG, UAA,…) have sequence equivalents in DNA (ATG, TAA,…).• Most eukaryotic introns have “canonical splice sites,” GT---AG (mRNA: GU---AG).• Gene prediction programs search for patterns to predict genes and their structure.• Different gene prediction programs may predict different genes and/or structures.
Multiple Gene Predictors• The protein coding sequence of a mRNA is flanked by untranslated regions (UTRs).• UTRs hold regulatory information.
BLAST Searches• Gene or protein homologs share similarities due to common ancestry. • Biological evidence is needed to curate gene models predicted by computers.• mRNA transcripts and protein sequence data provide “hard” evidence for genes.
What is a gene?
• Can we define a gene?• Has the definition of a gene changed?• How can we find genes?
Views
• Genes as “independent hereditary units (1866), Mendel• Genes as “beads on strings” (1926), Morgan• One gene, one enzyme (1941), Beadle & Tatum• DNA is molecule of heredity (), Avery• DNA > RNA > Protein (1953), Crick, Watson, Wilkins
More Views
• Transposons (1940s-50s), McClintock• Reverse transcription (1970), Temin & Baltimore• Split genes (1977), Roberts & Sharp• RNA interference (1998), Fire and Mello
Sequence & course material repository
http://gfx.dnalc.org/files/evidenceDon’t open items, save them to your computer!!
• Annotation (sequences & evidence)• Manuals (DNA, Subway, Apollo, JalView)• Presentations (.ppt files)• Prospecting (sequences)• Readings (Bioinformatics tools, splicing, etc.)• Worksheets (Word docs, handouts, etc.)• BCR-ABL (temporary; not course-related)