Management of ticks and tick-borne disease in a Tennessee ...

University of Tennessee, KnoxvilleTrace: Tennessee Research and CreativeExchange

Masters Theses Graduate School

12-2010

Management of ticks and tick-borne disease in aTennessee retirement communityJessica Rose HarmonUniversity of Tennessee - Knoxville, [email protected]

This Thesis is brought to you for free and open access by the Graduate School at Trace: Tennessee Research and Creative Exchange. It has beenaccepted for inclusion in Masters Theses by an authorized administrator of Trace: Tennessee Research and Creative Exchange. For more information,please contact [email protected].

Recommended CitationHarmon, Jessica Rose, "Management of ticks and tick-borne disease in a Tennessee retirement community. " Master's Thesis,University of Tennessee, 2010.https://trace.tennessee.edu/utk_gradthes/805

brought to you by COREView metadata, citation and similar papers at core.ac.uk

provided by University of Tennessee, Knoxville: Trace

To the Graduate Council:

I am submitting herewith a thesis written by Jessica Rose Harmon entitled "Management of ticks andtick-borne disease in a Tennessee retirement community." I have examined the final electronic copy ofthis thesis for form and content and recommend that it be accepted in partial fulfillment of therequirements for the degree of Master of Science, with a major in Entomology and Plant Pathology.

Carl J. Jones, Major Professor

We have read this thesis and recommend its acceptance:

Graham J. Hickling, Marcy J. Souza, Reid R. Gerhardt

Accepted for the Council:Carolyn R. Hodges

Vice Provost and Dean of the Graduate School

(Original signatures are on file with official student records.)

To the Graduate Council:

I am submitting herewith a thesis written by Jessica Rose Harmon entitled ―Management of ticks

and tick-borne disease in a Tennessee retirement community.‖ I have examined the final

electronic copy of this thesis for form and content and recommend that it be accepted in partial

fulfillment of the requirements for the degree of Master of Science, with a major in Entomology

and Plant Pathology.

Carl J. Jones, Major Professor

We have read this thesis and recommend its acceptance:

Graham J. Hickling

Marcy J. Souza

Reid R. Gerhardt

Accepted for the Council:

Carolyn R. Hodges

Vice Provost and Dean of the Graduate School

(Original signatures are on file with official student records.)

Management of ticks and tick-borne disease

in a Tennessee retirement community

A Thesis Presented for the

Master of Science Degree

The University of Tennessee, Knoxville

Jessica Rose Harmon

December 2010

ii

ACKNOWLEDGEMENTS

First and foremost, I thank the UT Agricultural Research Experiment Station, the Entomology

and Plant Pathology Department, and the Center for Wildlife Health for providing the necessary

funding for this research. Thank you to Dr. Carl Jones for your continuing support and encouragement

throughout this experience and for urging me to never stop learning and to always move toward bigger

and better things. I am also incredibly thankful to Dr. Graham Hickling for the hours upon hours of

help setting up the field site, for statistics and editing assistance, and for all of the celebrations we have

had along the way. Dr. Jones and Dr. Hickling allowed this research to be fun and exciting in addition

to exceedingly educational. Thank you to Dr. Marcy Souza for all of the in-depth and thoughtful

feedback on the project and thesis and to Dr. Reid Gerhardt for his plethora of knowledge about all

things tick-related.

I am forever grateful to Cathy Scott for teaching me the inner workings of the lab and spending

countless hours working with me on the various techniques we used, for helping me set up field sites

and collect ticks, and overall for being an incredible mentor and friend. This process would not have

been nearly as successful or enjoyable without her knowledge, friendship, and dedication. I am also

thankful to Michelle Rosen for peaking my interest and excitement about ticks and the research that

involves them.

I thank Ellen Baker for her friendship and assistance in the lab and field and for being

incredibly organized, her contribution to this research is invaluable and greatly appreciated. Thank you

to Dave Paulson for all of your hard work sifting through tons of ticks and larvae covered lint sheets. I

also thank Nick Hendershot for helping to analyze our enormous stack of camera trap pictures.

iii

Finally, I thank the most amazing family and friends a person could ever have. To my parents

and brothers, your love and support has been a continuing source of inspiration for me throughout my

life and I am fortunate to have such incredible people to look up to every day. To my wonderful

friends, thank you for helping to make me a well-rounded person by ensuring that I make time to play

in the midst of working and follow the path that makes me happiest. You all have had a greater impact

on me than you will ever know.

iv

ABSTRACT

Human Monocytic Ehrlichiosis (HME) is an emerging disease first described in 1987 and is

transmitted by the bite of Amblyomma americanum. Over the past 10 years, the CDC has documented

increasing ehrlichiosis case reports nationwide. Our study site is a golf-oriented retirement community

located in the Cumberland Plateau of Tennessee. In 1993, four men at the study site had symptoms

consistent with HME which prompted a CDC outbreak investigation and led community managers to

mitigate ticks feeding on deer. The objectives of this study were to measure the efficacy of current tick

mitigation attempts, to determine the level of infection and composition of tick-borne disease in the

study area, and to assess which wildlife species are potentially acting as reservoirs for disease.

Ticks were sampled in the community at eight sites of ‗4-poster‘ acaricide applicator utilization

and at seven untreated sites. Close to the ‗4-poster‘ devices, larval, nymphal, and adult tick abundances

were reduced by 90%, 68% and 49% respectively (larval p<0.001, nymphal p<0.001, adult p=0.005)

relative to the untreated areas. We extracted DNA from A. americanum ticks collected at the treatment

and non-treatment sites and tested for Ehrlichia spp. infections. Of 253 adult and nymphal

A. americanum tested, we found 1.2% to be positive for Ehrlichia chaffeensis, 4.7% positive for

Ehrlichia ewingii, and 1.6% positive for Panola Mountain Ehrlichia; in combination this prevalence is

similar to that reported in other Ehrlichia-endemic areas of the eastern U.S.. We also performed blood

meal analysis on DNA from A. americanum ticks and the results suggest that the most significant

reservoir hosts for Ehrlichia spp. are white-tailed deer, turkeys, grey squirrels, and Passeriformes.

We conclude that while the ‗4-poster‘ acaricide applicators reduce the number of ticks close to

treatment, at the density at which they are currently being used (8 applicators per 52.6 km2, average

distance between applicators = 6.6km) they will have no large-scale effect on the community‘s tick

v

population. In order to accomplish area-wide reduction of A.americanum and Ehrlichia spp. in this

locale, community managers should develop an integrated management strategy that utilizes other

techniques in addition to ‗4-poster‘ devices.

vi

TABLE OF CONTENTS

1 INTRODUCTION ....................................................................................................................... 1

1.1 Abstract ............................................................................................................................. 2

1.2 Background and Significance ........................................................................................... 2

1.2.1 Tick-borne disease and associated ticks of relevance for the Tennessee Cumberland

Plateau study site ....................................................................................................... 2

1.2.2 Options for managing tick-borne disease ................................................................ 10

1.2.3 Managing Hosts ....................................................................................................... 13

1.2.4 Landscape alteration ................................................................................................ 15

1.2.5 Managing Human Exposure .................................................................................... 16

1.3 History of management strategies used at the study site ................................................ 18

2 EVALUATION OF ‘4-POSTER’ ACARACIDE APPLICATORS TO MANAGE TICKS

AND TICK-BORNE DISEASES IN A TENNESSEE RETIREMENT COMMUNITY .... 20

2.1 Abstract ........................................................................................................................... 21

2.2 Methods ........................................................................................................................... 24

2.2.1 Study area and selection of sampling sites .............................................................. 24

2.2.2 Trail Camera Monitoring ......................................................................................... 26

2.2.3 Statistical analysis .................................................................................................... 26

2.3 Results and Discussion.................................................................................................... 27

3 MOLECULAR IDENTIFICATION OF EHRLICHIA SPP. AND HOST BLOODMEAL

SOURCE IN AMBLYOMMA AMERICANUM ....................................................................... 39

3.1 Abstract ........................................................................................................................... 40

3.2 Introduction ..................................................................................................................... 40

3.3 Methods ........................................................................................................................... 43

3.3.1 Sampling method ..................................................................................................... 43

3.3.2 Ehrlichia Assays ...................................................................................................... 44

3.3.3 Blood Meal Analysis: .............................................................................................. 45

3.3.4 Statistical analysis .................................................................................................... 46

3.4 Results and Discussion.................................................................................................... 47

4 CONCLUSION .......................................................................................................................... 56

4.1 Utilization of ‗4-poster‘ acaricide applicators as a sole method of tick mitigation in a large-

scale community ............................................................................................................................ 57

4.2 Implications of Ehrlichia and Blood meal analysis ........................................................ 58

4.3 Future Research Direction .............................................................................................. 61

REFERENCES ..................................................................................................................................... 63

APPENDICES ....................................................................................................................................... 71

vii

5.4 Appendix 1: Resident awareness and concern about tick-borne disease at the site of a previous

ehrlichiosis outbreak ...................................................................................................................... 72

5.4.1 Introduction .............................................................................................................. 72

5.4.2 Methods ................................................................................................................... 72

5.4.3 Results and Discussion ............................................................................................ 73

5.5 Amplification of Ehrlichia sp. GroEL operon fragment (Takano et al., 2009) ............... 81

5.6 Appendix 3.3: Ehrlichia spp. PCR Protocol ................................................................... 83

5.7 Appendix 3.4: Panola Mountain Ehrlichia PCR Protocol (Loftis et al., 2006) .............. 86

5.8 Appendix 3.5: DNA Purification Protocol ...................................................................... 89

5.9 Appendix 3.6: RLB bloodmeal analysis Protocol ........................................................... 90

VITA….. ................................................................................................................................................ 97

viii

LIST OF FIGURES

Figure 1.1 Average annual incidence of ehrlichiosis (caused by Ehrlichia chaffeensis) by state, as

reported to CDC, 2001-2002 (Brady et al., 1988). ................................................................................... 6

Figure 1.2 Age-specific incidence of ehrlichiosis (caused by Ehrlichia chaffeensis), reported to CDC

2001-2002 through NETSS (Brady et al., 1988). ..................................................................................... 9

Figure 2.1 Mean counts of nymphal and adult A. americanum at 14 sites within the study area. Adult

means are for the period March 24 – June 16, 2009; nymphal means are for the period May 11 – July

27, 2009. (T=treatment site, UT=untreated site) .................................................................................... 29

Figure 2.2 Seasonal variation in nymphal and adult tick abundance. Nymphs peak slightly before adult

ticks and tick abundance at treated sites is less than at untreated sites in almost every month. ............. 30

Figure 2.3 Distance effect of '4-poster' acaricide applicators on adult and nymphal tick abundance per

100m2; at alpha = 0.05, starred bars indicate tick abundance that significantly differs from untreated

sites (UNT; nymphal p<0.001, adult p=0.005). ...................................................................................... 32

Figure 2.4 Distance effect of '4-poster' acaricide applicators on larval tick abundance per 100m2. At

alpha = 0.05, tick abundance significantly differs from untreated sites up to 400m from ‗4-poster‘

acaricide applicators. Starred bars indicate statistical significance (p<0.001). ...................................... 33

ix

Figure 2.5 Trail camera picture of a squirrel, a woodchuck, and a deer utilizing a ‗4-poster‘ acaricide

applicator. ............................................................................................................................................... 36

Figure 3.1 Comparison of Ehrlichia spp. infection prevalence in ticks from our retirement community

study area and from Henry Horton State Park. Comparisons are for all Ehrlichia species combined, E.

chaffeensis alone, E. ewingii alone, and Panola Mountain Ehrlichia alone. NS = not statistically

significant; no significant differences were seen between the study area and the comparison site for any

of the tested Ehrlichia species. ............................................................................................................... 50

Fig. 3.2 Observed-to-expected ratio of Ehrlichia spp. infection in A. americanum ticks that fed on the

most common bloodmeal hosts. Ratios greater than 1 represent higher Ehrlichia infection rates than

are expected for that host group, indicating potential for that wildlife species to act as a reservoir for

Ehrlichia. ................................................................................................................................................ 54

Figure 5.1.1 Resident questionnaire consent form ................................................................................. 76

Figure 5.1.2 Page one of questionnaire distributed to residents of the retirement community .............. 77

Figure 5.1.3 Page two of questionnaire distributed to residents of the retirement community .............. 78

1 INTRODUCTION

2

1.1 Abstract

The current status of tick-borne disease (TBD) in the southeastern U.S. is challenging to

define due to the presence of emerging pathogens, uncertain tick/host relationships, and changing

TBD case definitions. In recent years, reports of TBDs such as Lyme Disease, Rocky Mountain

Spotted Fever and Ehrichiosis have been on the rise in Tennessee (TDH 2008). In an attempt to

lessen the human risk of TBD, management officials have begun trying to decrease the number

of ticks to reduce transmission of pathogens. This literature review aims to clarify the current

status of ticks and tick-borne disease in Tennessee and compare the various techniques for

managing those tick species and the pathogens they can transmit.

1.2 Background and Significance

1.2.1 Tick-borne disease and associated ticks of relevance for the Tennessee Cumberland

Plateau study site

Four tick species are commonly encountered by humans in Tennessee: blacklegged/deer

ticks (Ixodes scapularis Say), lone star ticks (Amblyomma americanum L.), gulf coast ticks

(Amblyomma maculatum Koch) and American dog ticks (Dermacentor variabilis Say). In

Tennessee and nearby in Kentucky, three military bases send all ticks that bite personnel for

identification and pathogen testing. From 2004 to 2008, 885 ticks were submitted for

identification; of these 86.6% were A. americanum, 11.2% were D. variabilis, 1.8% were A.

maculatum and only 0.3% were I. scapularis (E. Stromdahl, Entomologist in the Tick-borne

Disease Laboratory with US Army Public Health Command, pers. comm., July 2009). Each of

these species of tick is responsible for carrying different pathogen(s) that can lead to infection

and disease in humans.

3

1.2.1.1 Blacklegged ticks and associated pathogens

Blacklegged ticks feed on various hosts, including mammals, birds, and reptiles, with

primary blood meal hosts being white-footed mice and deer (Anderson et al., 2006). Blacklegged

ticks are vectors for Borrelia burgdorferi, the causative agent for Lyme Disease (LD). LD, also

known as Lyme borreliosis, is the most commonly reported vector-borne disease in the United

States, with around 20,000 new cases reported each year (CDC, 2007). Early signs of infection

include fever, headache, fatigue, and erythema migrans. Without treatment, patients can

experience symptoms involving the joints, heart, and nervous system. In the past, Tennessee has

had very few reported cases of LD (Apperson et al., 1993) but these have recently increased to

an average of 30 case reports a year from 2003-2005 (CDC, 2007). Borrelia burgdorferi has

been identified in ticks and small mammals in some southern states but transmission to humans

has not yet been documented as reported cases are often a result of travelling or misdiagnosis

(Barbour, 1996). Surveys from the University of Tennessee have failed to find Borrelia

burgdorferi in ticks from the state, but have found Borrelia myamotoi, which is of unknown

health significance (Rosen, 2009). Blacklegged ticks are also known to carry Anaplasma

phagocytophilum, the pathogen responsible for Human Granulocytic Anaplasmosis, although as

yet, no cases of this illness have been reported in Tennessee.

1.2.1.2 Lone star ticks and associated pathogens

In a recent study from North Carolina, the lone star tick made up 99.6% of over 6,000

collected specimens from suburban landscapes, making it the most widely distributed tick in the

state (Apperson et al., 2008). At Henry Horton State Park in middle Tennessee, similar results

have been shown with the lone star tick comprising 92% of ticks collected by dragging (Rosen,

4

2009). Lone star ticks are vectors for Ehrlichia chaffeensis, which is the causative agent of

Human Monocytic Ehrlichiosis (HME) (Landaas et al., 1988), Ehrlichia ewingii which is the

causative agent of Ehrlichia ewingii Ehrlichiosis (Buller et al., 1999), and Panola Mountain

Ehrlichia which has been shown to cause mild infection in humans (Reeves, 2008). E. ewingii is

generally thought to produce a milder form of disease than E. chaffeensis, however anemia,

thrombocytopenia, polyarthritis, and neurological sequelae have been reported (Nicholson,

2010). Lone star ticks have also been shown to carry Borrelia lonestari and Rickettsia

amblyommii but the human health implications of these bacterial agents are unclear (Apperson et

al., 2008; Bacon et al., 2003; Billeter et al., 2007; Burkot et al., 2001; James et al., 2001; Mixson

et al., 2006; Moore et al., 2003; Paddock and Yabsley, 2007; Schulze et al., 2005; Stegall-Faulk

et al., 2003; Stromdahl, 2008; Varela et al., 2004). From 1998-2005, a study conducted in several

southern states found overall prevalence for E. chaffeensis, R. amblyommii, and B. lonestari in

ticks to be 4.7%, 41.2%, and 2.5%, respectively (Mixson et al., 2006). Panola Mountain

Ehrlichia (PME), which is similar to Ehrlichia ruminatum, was recently discovered in Panola

Mountain State Park, GA, USA (Loftis et al., 2006). Further research determined that this

species of Ehrlichia is distributed throughout the range of Amblyomma americanum, suggesting

that PME is not a newly introduced pathogen in the United States (Loftis et al., 2008). White-

tailed deer and goats act as reservoir hosts for PME (Loftis et al., 2006; Yabsley et al., 2008) and

human illness has also been associated with PME (Reeves, 2008). All life stages of lone star

ticks feed on humans and animals such as deer, cattle, horses, and dogs (Burgdorfer, 1969).

Clinical symptoms of HME in humans rarely involve a rash and commonly involve fever,

headache, malaise, and muscle aches. Tennessee is considered endemic for ehrlichiosis, with

5

annual incidence rates of 4+ cases per 100,000 population (Figure 1.1)(Brady et al., 1988). The

risk of HME appears to be greater in older people, and those with HME tend to be older than

patients that have other tick-borne diseases (Eng et al., 1990).

Southern Tick Associated Rash Illness (STARI) is linked to the bite of lone star ticks but

the causative agent is currently unknown; Borrelia lonestari and Rickettsia amblyommii have

been suggested as causative agents for STARI, but definitive results have yet to emerge

(Apperson et al., 2008; Billeter et al., 2007; Burkot et al., 2001; James et al., 2001; Moore et al.,

2003; Varela et al., 2004). Borrelia lonestari was not detected in a study of skin biopsies and

serum samples from patients presenting with erythema migrans after the bite of a lone star tick,

leading researchers to look to other agents as the cause of STARI (Stromdahl, 2008).

6

Figure 1.1 Average annual incidence of ehrlichiosis (caused by Ehrlichia chaffeensis) by

state, as reported to CDC, 2001-2002 (Brady et al., 1988).

An additional complication of diagnosis is that antibodies to R. amblyomii have been

found in sera from patients diagnosed with probable Rocky Mountain Spotted Fever (RMSF)

cases (Apperson et al., 2008), suggesting that RMSF tests are cross-reactive with R. amblyomii.

Furthermore, the presence of R. amblyommii in humans could simply be a consequence of high

prevalence of the agent in ticks and not necessarily pathogenicity in humans. Clinicians and

researchers continue to be plagued by the question of what role, if any, Borrelia lonestari and

Rickettsia amblyommii play in rashes associated with the bite of the lone star tick. The rash

associated with STARI is similar to that of LD; the rash presents as a lesion around the site of a

tick bite and usually occurs within seven days of the bite. STARI can be associated with fatigue,

7

fever, headache, muscle and joint pains, but is quickly resolved with oral antibiotics (CDC,

2008). Currently, no tests are available to detect STARI in patients with tick bite associated

illnesses.

1.2.1.3 American dog ticks and associated pathogens

American dog ticks most commonly parasitize dogs and medium-sized mammals but will

also feed readily on birds and large mammals including humans (Kollars et al., 2000). Unlike in

other TBD systems where a blood meal must occur for infection, American dog ticks are

reservoirs as well as vectors for Rickettsia rickettsii and have shown 100% transmission to

oocytes (Kollars and Kengluecha, 2001). However, the infection results in negative effects on the

tick such as decreased production of eggs by an affected female and few of the infected larvae

mature through the adult stage (Dumler and Walker, 2005). These harmful effects may explain

the very low (1%) infection rate generally found in American dog ticks (Kollars and Kengluecha,

2001). Within the past decade, incidence of reported Rocky Mountain Spotted Fever (RMSF) in

the south has been on the rise, with the rate of RMSF in Tennessee increasing by 42% from 2004

to 2005 and by 63% from 2005 to 2006 (Dumler and Walker, 2005). RMSF symptoms include

fever, headache, myalgia, and a petechial rash. Early diagnosis is crucial, as a delayed diagnosis

often results in severe illness or death (Dumler and Walker, 2005).

1.2.1.4 Gulf coast ticks and associated pathogens

Rickettsia parkeri belongs to the spotted fever group rickettsiae and was isolated from

gulf coast ticks in 1939. Rickettsia parkeri has been detected in ticks from Florida, Georgia,

Kentucky, Mississippi, Oklahoma, and South Carolina (Sumner JW, 2007). In 2004, clinical

disease caused by R. parkeri was confirmed in a 40-year old man from southeast Virginia; the

8

disease manifested as a mild, febrile illness accompanied by scabs or sloughs on the skin and

rash (Paddock et al., 2004). R. parkeri is cross-reactive to most available RMSF tests, so the

occurrence of infection due to this and other spotted fever group rickettsiae may be greater than

is currently perceived (Ono et al., 1988). However, while gulf coast ticks are considered

prevalent in Gulf Coast states, they are not considered to be established within Tennessee;

sporadic records of these ticks in the state are likely the result of immature life stages being

transported into the state on migrating birds (Durden, 1992).

1.2.1.5 Ticks and tick-borne disease history at the Cumberland Plateau study site

In 1993, four men at our study site were hospitalized with an illness matching the

symptoms of HME. Serum specimens from two men showed the presence of elevated IgG

antibody to E. chaffeensis and positive polymerase chain reaction (PCR) tests of blood

specimens from all four men confirmed the diagnosis of acute HME. Additionally, 12.5 percent

of surveyed residents had serologic evidence of past E. chaffeensis infection (Standaert et al.,

1995). The Tennessee Department of Health has reported 13 cases of Rocky Mountain Spotted

Fever, 11 cases of ehrlichiosis, and 8 cases of Lyme Disease in Cumberland County from 1995-

2006 (http://health.state.tn.us/Ceds/WebAim/WEBAim_criteria.aspx). However, these reports

should be taken cautiously, as they do not include information on patient travel history or test

specificity. Consequently, little is known about the pathogen prevalence and TBD risk in this

retirement community and in the state of Tennessee.

The high prevalence of lone star ticks at the study site suggests that ehrlichiosis and

STARI are the TBDs that are most likely to be a risk to residents in the area. Unlike other TBDs,

incidence of ehrlichiosis has been shown to increase with age, with the highest reported

9

incidence and severity seen among those 60+ years of age (Figure 1.2), making this TBD a

significant concern within a retirement community such as our study site (Brady et al., 1988). At

the beginning of this assessment the presence of Ehrlichia spp. in Tennessee ticks was

unconfirmed, however E. chaffeensis and E. ewingii have been recently found in several A.

americanum ticks from the state (Meyers et al., 1988).

Figure 1.2 Age-specific incidence of ehrlichiosis (caused by Ehrlichia chaffeensis), reported

to CDC 2001-2002 through NETSS (Brady et al., 1988).

10

1.2.2 Options for managing tick-borne disease

There are several available options for managing ticks and therefore tick-borne disease.

These mitigation methods include managing ticks on host wildlife species and domestic animals,

biological control using fungi, altering or treating the landscape and vegetation, managing hosts

through exclusion or hunting, and prevention of tick-human contact. The following section

considers these options in more detail.

1.2.2.1 Managing Ticks

1.2.2.2 Managing Ticks on Hosts

Blacklegged, lone star, and dog ticks are all known to feed on deer, making deer a way to

target the tick species that are of most concern to human health. ‗4-poster‘ feeders (developed by

USDA-ARS researchers) are devices that pinpoint deer in an attempt to alter the population of

ticks feeding on those deer (Pound et al., 2000b). Whole kernel corn is used to attract deer to the

devices where, as they feed, they rub their head, neck, and ears against paint rollers soaked with

an acaracide. Each device has two feeding and application stations with bait and rollers. Control

of A. americanum exceeded 91-96% under trial conditions with the use of one ‗4-poster‘ device

per every 20 ha. (Pound et al., 2000a). The devices appear to be slightly less effective for Ixodes

scapularis, with control estimates of 82-85% (Schulze et al., 2008). Several researchers have

shown effective and increasing control of ticks over time using these devices (Bloemer et al.,

1990; Brei et al., 2009; Carroll and Kramer, 2003; Carroll et al., 2009; Hoen et al., 2009; Miller

et al., 2009; Pound et al., 2000a; Pound et al., 2000b; Schulze et al., 2008; Schulze et al., 2007;

Solberg et al., 2003; Stafford et al., 2009). However, using ‗4-posters‘ in a large scale

community is expensive and time-consuming. Devices are required to be >100 meters from the

11

nearest residence and nearly 200 ‗4-posters‘ would be required to meet the recommended

application density in an area the size of our study site. It is important to recognize that the

majority of studies documenting significant reductions in ticks have been on deer populations

within fenced-in areas, on islands, or in other small areas (Bloemer et al., 1990; Carroll and

Kramer, 2003; Pound et al., 2000b; Pound et al., 1996; Solberg et al., 2003).

In addition to the four-posters used for deer, host-based tick control methods have been

developed for other wildlife, including small rodents and birds. Rodents are an important part of

tick management because they are preferred hosts for nymphal and larval life stages of several

different tick species. A three year study in Connecticut utilized commercial bait boxes to deliver

acaracide to white-footed mice in an effort to control immature stages of blacklegged ticks

(Dolan et al., 2004); infestations by nymphal and larval ticks were reduced by 68% and 84%,

respectively. After three years of treatment, the number of questing adults and infection rates of

Borrelia burgdorferi in ticks also decreased. Another study took advantage of nesting behavior

by distributing permethrin-impregnated cotton for white-footed mice (Deblinger and Rimmer,

1991). Significant decreases in nymphal ticks were seen, although these results were not

repeatable for all studies (Wilson, 1993). An adult female tick can deposit several thousand eggs

in a month, so management strategies that target immature stages rather than adult stages are

retroactive and may not be the best type of control as a stand-alone method.

Norcross looked for a solution to colony abandonment by brown pelicans as a result of

excessive tick infestations (Norcross, 2002). Treated nests were sprayed three times with

Permectrin dilutions during the nesting season. Fewer immature tick stages were observed in

treated nests and no colony abandonment was observed in those nests. This study is especially

12

important for tick management consideration because birds have the ability through migration to

disperse ticks and their respective pathogens across hundreds of miles (Morshed et al., 2005). By

adapting tick control for birds, researchers can improve the fitness of a wild bird population

while also improving public health.

Perhaps the most well-known tick control methods are those used for the protection of

companion animals. Topical acaracides and collars that can be applied to the necks of dogs and

cats are easily accessible, fast acting, and relatively inexpensive. Preventic® Tick Collars (active

ingredient Amitraz) prevent ticks from attaching to dogs, kill existing ticks within 48 hours, and

last for 3 months (Kranzfelder et al., 1988). Frontline Plus® is a topical product produced by

Merial (active ingredients Fipronil and S-methoprene) that kills fleas within 12 hours and ticks

within 48 hours of coming into contact with a dog or cat (Kranzfelder et al., 1988). In a study

comparing the efficacy of Frontline®, Scalibor®, Advantix®, and Preventic®, the lowest tick

counts were reported with the Preventic® Amitraz collar (Estrada-Pena and Bianchi, 2006).

Revolution® (Active ingredient Selamectin) is also a topical acaracide, is manufactured by

Pfizer, and controls the American Dog Tick, fleas, mites, and heartworms. Preventic® Collars,

Frontline Plus®, and Revolution® are all waterproof and available for purchase from a

veterinarian. These products should be used year-round as certain species of ticks are more

active during colder months (Blagburn and Dryden, 2009). Flea and tick shampoos for dogs and

cats vary in price and kill fleas and ticks for one to four weeks. Shampoos can be bought over-

the-counter at any pet store. It is important to note that the use of collars, topical treatments, and

shampoos do not replace the need for thorough tick checks, especially for hunting dogs and those

pets that spend a lot of time outdoors. Additonally, a Lyme Disease prevention vaccine has been

13

available for dogs since 1990 (LymeVax, Fort Dodge Animal Health) and has shown a high

efficacy level when administered to young at-risk dogs before they have come into contact with

potentially infected ticks (Beier, 1988b). As is the case in humans, the most economical way to

prevent disease in pets is to check for ticks after the animal has been outdoors. This can be

accomplished easily in indoor/outdoor pets by brushing and grooming once a day.

1.2.2.3 Biological control

Biological control of ticks involves the use of an entomopathogenic fungus,

Metarhizum anisopliae. M. anisopliae is lethal to engorged blacklegged tick larvae and adult

female blacklegged ticks (Zhioua et al., 1997). This fungus has been shown to reduce

engorgement weight as well as egg mass weight in ovipositing females and causes 52% mortality

in questing females (Hornbostel et al., 2004). American dog tick nymphs have been shown to be

more susceptible to entomopathogenic fungi than their corresponding adults, but other species do

not have variations in susceptibility between life stages (Kirkland et al., 2004). With all species,

in order for effective penetration of the tick‘s cuticle and subsequent death, spore density must

reach a certain threshold (Zhioua et al., 1997). Unfortunately, fungal spores applied with a spray

tower also cause significant non-target effects leading to mortality in beetles and crickets

(Ginsberg, 2002).

1.2.3 Managing Hosts

1.2.3.1 Exclusion and Hunting

White-tailed deer are the species most commonly targeted for management by exclusion

and hunting. Exclusion has been used as a solo method as well as in combination with additional

14

procedures in an effort to manage tick numbers and reduce disease risk (Bloemer et al., 1990;

Ginsberg and Zhioua, 1999; Zhang et al., 2006). Ginsberg et al. (2002) utilized a fencing type

which allowed small and medium-sized mammals to pass through the fence while excluding

adult deer. The researchers observed a 48% reduction in ticks and concluded that movement of

ticks on birds and small and medium-sized mammals diminishes the effects of fencing and

therefore the potential for management of ticks using that method. To remedy this problem,

fencing that also restricts medium-sized mammals or exclusion in combination with other

techniques could be used for greater reduction and control of ticks. Bloemer et. al (1990)

determined that overall deer exclusion is more economical than techniques such as acaricide

treatment or management of vegetation, because this method requires minimal annual

maintenance and lasts for 20+ years.

Hunting deer in an effort to manage ticks in residential areas has historically been a very

controversial method which causes conflicts between animal welfare advocates, hunters, the

general public, and wildlife agencies. This conflict is due to the necessity for deer to be nearly

eradicated before significant reductions in the numbers of ticks are observed (Jordan et al.,

2007). Reducing tick populations using deer control methods are most effective in

geographically isolated areas such as islands and peninsulas where deer from elsewhere cannot

re-inhabit the area easily. As is the case with exclusion fencing, this method is best used in

combination with other mitigation techniques as small and medium-sized mammals and birds are

capable of maintaining the tick population if deer are not reduced below a certain level.

15

1.2.4 Landscape alteration

Prescribed burning has become a common management practice throughout the United

States to enhance pine timber production, facilitate turnover of nutrients, and influence plant

community structure, all factors that benefit various wildlife species (Jacobson and Hurst, 1979).

This method has also been investigated as a control technique for A. americanum (Allan, 2009;

Cully, 1999; Davidson et al., 1994; Hoch et al., 1972; Jacobson and Hurst, 1979). These studies

demonstrated high initial reduction of tick abundance using controlled burns, however Allan

(2009) found >6 times higher abundance of larval A. americanum 2 years after burning which the

author believed to be an effect of the attraction of wildlife hosts to recently burned habitats.

Hoch et al. (1972) concluded that A. americanum descend into the forest floor underlitter during

burns which may allow large proportions to survive, as only 1% of the underlitter is destroyed

compared to 70% of leaf litter. Overwintering larvae are the most vulnerable life stage to

prescribed burns, however in years between burns, larval abundance can increase to levels equal

to or greater than the preborn abundance (Davidson et al., 1994). It has therefore been concluded

that consistent prescribed burns can lead to suppression in tick abundance, given that burns are

considered a yearly component of tick and wildlife management and are not used sporadically

throughout years.

An additional technique for landscape alteration is mechanical removal of vegetation in

areas where risk of coming into contact with ticks is high. Clearing of both undergrowth and

over story cover in combination with pesticide or herbicide has been shown to effectively reduce

the number of ticks within a 1-acre plot at a much greater rate than vegetation clearing alone

(Mountz et al., 1988). Significant reductions have also been seen with combinations of various

16

types of vegetative management using over story reduction, understory reduction, and regular

mowing of grasses to <15cm in height (Beier, 1988a). At Land Between the Lakes in Tennessee,

96% reduction in the number of ticks was reported with the use of acaricide applications,

vegetation management and host management together, with lower levels of reduction seen with

the use of any other combination of these methods (Bloemer et al., 1990). Therefore it is ideal to

use either several different types of vegetation clearing in an area or use vegetation clearing in

conjunction with additional tick mitigation techniques, such as acaricide treatment or host

management.

1.2.5 Managing Human Exposure

The easiest way to protect oneself from exposure to TBD is to avoid recreational

activities in tick infested areas during times of peak activity. The ecology and spatiotemporal

patterns vary among tick species, but some basic principles for personal protection still apply.

Recreational exposure usually occurs in densely wooded areas with ground cover predominately

consisting of leaves with little to no surface vegetation. Avoiding brush and staying in the

central part of a path while hiking can reduce risk of tick contact. Golf handicap has also been

identified as a risk factor for ehrlichiosis, as retrieving golf balls from the rough brought golfers

into contact with increased numbers of ticks (Standaert et al., 1995).

There are several other techniques that can be used if it is not possible to avoid

recreational areas when ticks are present. Whenever feasible, people participating in outdoor

activities should wear light colored long sleeves tucked into long pants tucked into tall socks.

Light colors increase the visibility of ticks once on the clothing and the time needed for a tick to

come into contact with the skin, which increases the potential for finding the tick before

17

attachment. Many commercial tick repellants are available for use on clothing and skin. The

most commonly used repellants use either DEET or Permethrin as active ingredients. DEET has

been shown to have very little efficacy against A. americanum nymphs, with only 25% of A.

americanum repelled (Carroll et al., 2004). In comparison, Permethrin-impregnated clothing

showed 100% knockdown of hard ticks, even after laundering (Faulde et al., 2003). Regardless

of repellant use, thorough ―tick checks‖ of both the clothing and skin should be performed often.

Any attached ticks should be promptly removed using forceps and should be pulled straight up to

keep the head intact. Ticks should be kept for submission to a doctor in the event that a rash or

illness develops in the weeks following the bite. By correctly identifying the tick species, health

care professionals will be better able to determine what illness the patient may be infected with

and therefore the best method of treatment.

Proponents of disease prevention vaccines state decreased likelihood for both antibiotic

resistance development and overuse, ease of application, and decreased costs as advantages.

However, developing a vaccine for humans in the US has proven difficult. GlaxoSmithKline

manufactured a recombinant vaccine for Lyme Disease known as LYMErix. The vaccine was

found to protect 76% of adults and 100% of children from infection with Borrelia burgdorferi

(Hoch et al., 1972). However, many recipients of the vaccine began reporting autoimmune

illness as a side effect. Class action suits were filed prompting an investigation by CDC and FDA

which concluded that no evidence existed to substantiate these claims (Cully, 1999). The

negative publicity resulted in decreased sales leading ultimately to the vaccine being removed

from the market. Currently, there are no human vaccines available to prevent tick-borne disease

in the United States.

18

The most important aspect of managing human exposure is educating the public on risk

of infection and the most efficient ways of protecting themselves. It is essential that members of

the community know what to do in the event of a tick bite, and especially if a subsequent rash or

illness develops. The easiest way to prevent transmission of tick-borne illnesses is working

proactively to prevent tick bites.

1.3 History of management strategies used at the study site

The 1993 outbreak of ehrlichiosis at our study site prompted collaboration between the

retirement community and The Medical Entomology Laboratory at the University of Tennessee

Entomology and Plant Pathology Department. Initial research at the area of the outbreak

involved an experimental permit to supplement deer with Ivermectin treated corn to affect the

reproductive capacity of the lone star tick (Marsland, 1997). Corn was treated at a rate of 50.0 ml

pour on insecticide (5mg/ml, Merck) per 22.7 kg of whole kernel cleaned corn. The study

resulted in reduction in the reproductive viability of females, determined by fewer larval masses

being found in the treated versus untreated areas. A follow up study found that the number of

lone star ticks increased over time after removing treated corn (Morris, 1999). Unfortunately, the

United States Department of Agriculture subsequently reached a determination that feeding

acaracide to deer carries too much risk for residues in hunter harvested deer and the method was

not approved for widespread use.

The retirement community that was the focus of our study has been using ‗four-poster‘

feeders to manage the tick population within the area. In 2009, four ‗4-posters were located in

the northern half of the community and four were located in the southern half. The north is

perceived to have higher tick abundance and disease risk due to the community‘s northern border

19

with a wildlife management area and the resulting higher presence of wildlife in that area. We

aimed to clarify the efficacy of the retirement community‘s current tick and tick-borne disease

mitigation efforts as well as provide possible options for improvement of existing methods.

20

2 EVALUATION OF ‘4-POSTER’ ACARACIDE APPLICATORS TO MANAGE

TICKS AND TICK-BORNE DISEASES IN A TENNESSEE RETIREMENT

COMMUNITY

21

2.1 Abstract

In 1993, four residents of a retirement community in a forested area of middle Tennessee

were hospitalized with symptoms of ehrlichiosis. This case cluster triggered a CDC outbreak

investigation and led community managers to implement mitigation methods to reduce tick

numbers. For the past four years, the community has utilized ‗4-poster‘ acaricide applicators that

aim to reduce disease risk to residents by killing ticks that feed on deer in the periphery of the

community. To determine the efficacy of this technique, we assessed Amblyomma americanum

abundance in the vicinity of the feeders by dragging a series of 400m vegetation transects once

per month while ticks were active. In 2009, adult tick activity peaked in May, nymphal tick

activity peaked slightly later in June, and larval activity peaked in September. Close to the ‗4-

poster‘ acaricide applicators, larval, nymphal and adult tick abundances were reduced by 91%,

68% and 49% respectively (larval p<.001, nymphal p<.001, adult p=0.005) relative to nearby

untreated areas. No significant reduction in nymphal or adult A. americanum ticks was evident

>300m from the ‗4-poster‘ acaricide applicators, however a ~90% reduction in larvae was

observed out to the limit of our sampling (400m from the applicators). The effect of the

applicators is likely to increase after consecutive years of utilization, nevertheless we conclude

that at the density at which these feeders are currently being used (8 per 52.6 km2, average

distance between feeders = 6.6km) they will have no large-scale effect on the tick population. A

much higher density of acaricide applicators would be necessary to have a community-scale

effect on tick abundance. This study calls into question the feasibility and affordability of the ‗4-

poster‘ acaricide applicator as a stand-alone strategy for tick management in a large residential

area.

22

Introduction

We investigated the process of managing Amblyomma americanum with ‗4-poster‘

acaricide applicators in a golf-oriented retirement community of roughly 6,000 residents located

in the Cumberland Plateau of Tennessee. The heavily forested area contains abundant wildlife

that support large tick populations. In 1993, an outbreak of ehrlichiosis occurred in the

community (Standaert et al., 1995) and managers consequently implemented measures to attempt

to control ticks and reduce human disease risk. Acaricide treatment of white-tailed deer was

suggested as a viable method to reduce tick populations and therefore lower the risk of tick-

borne disease in the treatment area (Pound et al., 1996). Initial research at the site involved an

experimental permit to supplement deer with Ivermectin treated corn to affect the reproductive

capacity of A. americanum (Marsland, 1997). Corn was treated at a rate of 50.0 ml pour-on

insecticide (5mg/mL) per 22.7 kg of whole kernel cleaned corn. The study resulted in reduction

in the reproductive success of A. americanum, determined by fewer larval masses being found in

the treated versus untreated areas. In a follow-up study, the number of lone star ticks increased

over time after removal of Ivermectin treated corn from the treatment area (Morris, 1999).

Unfortunately, the potential risk of chemical residues in hunter harvested deer was deemed to be

too high with this method and it was therefore not approved by the USDA for widespread use

beyond the initial experimental permit.

In recent years, residents and local health professionals have voiced increasing concerns

that these tick populations may be continuing to transmit zoonotic pathogens to the local human

population. Currently, ‗4-poster‘ devices (developed by USDA-ARS) are being utilized to

manage the tick population within the area. The ‗4-poster‘ acts by attracting deer to a corn bait

23

source where the head, neck, and ears come into contact with paint rollers treated with acaricide

(Pound et al., 2000). Significant reductions in ticks have been achieved using this technique;

however studies documenting such reductions have focused primarily on deer populations within

fenced-in areas or on a small community scale (Bloemer et al., 1990; Carroll and Kramer, 2003;

Pound et al., 2000a). The Northeast Area-wide Tick Control Project evaluated the ‗4-poster‘

acaricide applicator for reducing the abundance of Ixodes scapularis ticks in Rhode Island,

Connecticut, New York, New Jersey, and Maryland (Brei et al., 2009; Carroll et al., 2009; Hoen

et al., 2009; Miller et al., 2009; Solberg et al., 2003). These studies found high variation in level

of control in the first year of treatment with nymphal tick numbers decreasing in subsequent

years by as much as 71% in 5.14km2 treatment sites. For this study we focused on the application

of ‗4-poster‘ devices in a large 52.6km2 community where heavily human populated areas border

heavily wooded areas and the density of devices is limited by financial considerations, available

manpower, and regulations constraining the use of ‗4-poster‘ devices in close proximity to

residences.

This study aimed to clarify the efficacy of the retirement community‘s current tick

mitigation efforts as well as provide data for the design of improved integrated management

options. We evaluated the percent reduction of tick populations at set distances from the ‗4-

poster‘ devices through comparison with non-treatment sites where ‗4-poster‘ devices have never

been used. Finally, we sought to determine the gradient of control of ‗4-poster‘ acaricide

applicators in this area by assessing the level of tick reduction at increasing distances from the

devices.

24

2.2 Methods

2.2.1 Study area and selection of sampling sites

Our study site is a golf-oriented retirement community of roughly 6,000 residents which

encompasses 5,260 ha. of heavily wooded land on the Cumberland Plateau in Tennessee. The

community‘s attractions consist of championship golf courses, tennis courts, swimming, lakes

for boating and fishing, horseback riding, sightseeing, trails, and shopping. The border along the

north end of the community is adjacent to a 32,370 ha wildlife management area and as a result,

white-tailed deer and other wildlife are common throughout the community. The northern part of

the community has a higher tick abundance and disease risk, presumably because of this shared

border (R.Gerhardt, pers. comm., October 2010). The fragmentation of the community as a result

of interspersed fairways, woodlands, and residences provides ample wildlife habitat, and

therefore the opportunity for tick populations to thrive.

Community Services Management at the retirement community selected eight sites for

deployment of ‗4-poster‘ acaricide applicators based on previous treatment locations, proximity

to inhabited areas, and areas of known high tick abundance. Four ‗4-posters‘ are located in the

northern half of the community and four are located in the southern half. ‗4-poster‘ usage

regulations prohibit use of these devices within 100 yards of any residence or area where

unsupervised children may be present, leading to difficulty of utilization within a residential

community such as our study site. This was the first year of treatment using ‗4-poster‘ acaricide

applicators at transects 1, 7, 8, and 9 whereas ‗4-poster‘ treatment has been used for at least two

years at transects 4, 5, 12, and 13. Mitigation techniques had never been attempted at the six non-

treatment sites (2, 3, 6, 10, 11, and 14) (Fig. 2.1).

25

Sampling method

Ticks were collected by ‗dragging‘ vegetation (Falco and Fish, 1992) at approximately 4-

week intervals during the ticks‘ active season to determine seasonal changes in population

density and distribution in the community. Researchers dragged a white 1x1 meter corduroy

cloth along 400m transects at the eight ‗4-poster‘ acaricide applicator sites and at six additional

non-treatment sites where no applicator was present. At ‗4-poster‘ sites, the transect began at the

applicator and nymphal and adult ticks that attached to the drag cloth were accumulated and

placed into separate vials of 70% ethanol at 40m, 100m, 200m, 300m, and 400m distance from

the applicator. Larval ticks were collected from drag cloths using lint roller sheets and labeled

by transect and distance, matching the corresponding ethanol vials. This allowed for subsequent

analysis of tick abundance versus distance from the feeder. Sampling at non-treatment sites

consisted of two 200m transects through equivalent habitat with all adults and nymphs collected

per transect accumulated into a single vial and larval ticks collected on a single lint roller sheet.

To avoid any effect of tick removal on consecutive abundance estimates, transects were adjusted

5-10 meters to the left or right of the previous transect each subsequent month. Ticks were

brought to the University of Tennessee‘s Medical and Veterinary Entomology laboratory, where

they were identified to species, life stage, and sex. Larval tick lint roller sheets were analyzed by

overlaying a 7x9 grid on each used sheet. A random number generator allowed for assignment of

half of the grids for subsequent tick identification. The counts were then doubled to estimate the

number of larvae collected on each sheet.

26

2.2.2 Trail Camera Monitoring

Bushnell trail cameras (Bushnell Corporation, Overland Park, KS) were utilized for 1-

week intervals on three occasions in May-July 2010 at sites where ‗4-poster‘ acaricide

applicators were located. These motion-triggered cameras took a picture after each 10 seconds

of animal activity. Analysis of trail camera photos involved counting individuals of each species

present in each photograph. Due to difficulty in determining one individual from another, every

animal was counted in every photo regardless of whether or not it was present in previous

photographs. Our counts of wildlife therefore represent the level of activity of each wildlife

species at the sites rather than abundance of each species at the sites (Jennelle et al., 2002;

Oliveira-Santos et al., 2010).

2.2.3 Statistical analysis

To correct for differences in sampling effort, all larval, nymphal, and adult counts were

converted to counts per 100m of dragging. For statistical analysis, these corrected counts were

then double-log transformed to normalize their variance structure and reduce the influence of

outliers. When reporting results, means and standard errors for these transformed data were

back-transformed so that plots and tables could be presented in units of tick counts per 100m2

dragged.

As a measure of the abundance of questing nymphal and adult ticks that community

residents are exposed to during the summer, we constructed a map showing average counts for

the three peak months of nymphs and adults (April through June for adults; May through July for

nymphs) at each of our sampling sites. Seasonal phenology was determined for adult, nymphal,

and larval A. americanum ticks at treated and untreated sites from March 2009-May 2010 by

27

calculating the mean number of collected ticks by visit for each transect and plotting these means

versus week of visit. Differences in the abundance of nymphs and adults at treatment sites versus

control sites were analyzed using separate General AOV models in Statistix 8 (Analytical

Software, Tallahassee, FL) to assess TREATMENT, VISIT, and TREATMENT*VISIT effects.

Interaction terms were non-significant, so they were removed and the models re-run.

Counts of ticks at specific distance intervals from the 4-poster applicators were compared

using a General AOV model to assess DISTANCE, VISIT, and DISTANCE*VISIT effects, with

the non-treatment area counts treated as a dummy distance category. Non-significant interactions

were removed, and a post hoc Hsu‘s Multiple Comparisons test was run using Statistix 8 to

assess the significance of differences of the tick counts at each distance interval versus tick

counts at the non-treatment sites.

Treatment transect 5 was excluded from the phenology and distance analysis described

above because it had abnormally high adult A. americanum densities that were a significant

outlier from densities observed at all other sites (See Fig. 2.1). Transect 5 is also the site of a

growing feral pig population and distance flagging was removed several times, presumably by

residents living in the area. These complications resulted in difficulty collecting samples from

the transect, analyzing transect data, and comparing that transect to other sites.

2.3 Results and Discussion

The great majority of collected ticks (99.43%) were A. americanum followed by

Dermacentor variabilis (0.47%) and Ixodes scapularis (0.10%). We excluded D. variabilis and I.

scapularis from further analysis as their low abundance suggests they present minimal risk to

28

humans in this community. In contrast, we found the A. americanum population to be

widespread throughout the community, with all life stages of A. americanum ticks collected from

all 14 sampling sites (Fig. 2.1). Our data confirmed the perception of community managers that

A. americanum numbers are highest in the northern part of the community. Sites in the northern

half had an estimated 91% higher nymphal A. americanum population density and 35% higher

adult A. americanum population density than sites in the southern half of the community

(Fig.2.1; p<0.001 for both comparisons). During the period of peak larval questing (August -

October) the average abundance of larvae was 2.4 times higher on the northern transects than on

the southern transects (p=0.0011). A strong seasonal effect was detected with adults peaking

slightly earlier in the year than nymphs. The observed seasonality is the same in the treatment

and non-treatment areas, although there are fewer ticks overall at the treatment sites than at the

non-treatment sites (Fig. 2.2).

29

Figure 2.1 Mean counts of nymphal and adult A. americanum at 14 sites within the study

area. Adult means are for the period March 24 – June 16, 2009; nymphal means are for

the period May 11 – July 27, 2009. (T=treatment site, UT=untreated site)

30

Figure 2.2 Seasonal variation in nymphal and adult tick abundance. Nymphs peak slightly

before adult ticks and tick abundance at treated sites is less than at untreated sites in

almost every month.

31

We observed a proximity effect of the ‗4-poster‘ treatment on tick populations, with the

treatment effect becoming non-significant for nymphs and adults at >300m from the ‗4-poster‘.

Therefore the diameter of measurable effect around the ‗4-poster‘ acaricide applicators is 600m

(Figure 2.3). Treatment effects were more evident for nymphs than for adults, with an observed

68% reduction of nymphs and 49% reduction of adults within 40m2 of the ‗4-poster‘ devices

(nymphal p<0.001, adult p=0.005). A 90.1% percent reduction of larval A. americanum ticks

was detected at treatment transects and is highly significantly different from non-treatment sites

for the entire sampled distance (Fig. 2.4). These treatment effects exist at sites in the first year of

treatment as well as sites in the second year of treatment, and the difference in effect for the two

treatment classes is not significant. Time constraints and community set-up hindered our ability

to test farther than the original 400m transect distance, therefore the extent of ‗4-poster‘ device

distance effect on A. americanum larvae is unclear.

32

Figure 2.3 Distance effect of '4-poster' acaricide applicators on adult and nymphal tick

abundance per 100m2; at alpha = 0.05, starred bars indicate tick abundance that

significantly differs from untreated sites (UNT; nymphal p<0.001, adult p=0.005).

33

Figure 2.4 Distance effect of '4-poster' acaricide applicators on larval tick abundance per

100m2. At alpha = 0.05, tick abundance significantly differs from untreated sites up to

400m from ‘4-poster’ acaricide applicators. Starred bars indicate statistical significance

(p<0.001).

34

We obtained a total of 4,070 photographs from trail cams consisting of the following

image counts for each species: 4,787 of deer, 1,694 of squirrels, 438 of raccoons, 285 of turkeys,

94 of crows, 54 of woodchucks, 50 of wild hogs, and one of a grey fox. Variation was seen with

as few as 56 photos taken during a session at one site and as many as 997 photographs taken

during the same sampling period at another site.

The relative abundance of collected tick species was highly skewed, so focusing tick

mitigation strategies in this area specifically on management of A. americanum is appropriate.

With limited resources for tick management, concentrating mitigation in the northern portion of

the community may be favorable for better overall tick control. For long term mitigation of ticks,

management officials would likely benefit from investing in exclusion techniques to keep

wildlife species from the bordering wildlife management area from coming into the community.

In a similar area of Tennessee, this method in combination with vegetation management and

acaricide application led to significant overall reduction of A. americanum compared to each

mitigation method used alone (Bloemer et al., 1990).

The lower observed reduction in adults is likely a result of how long the devices have

been used at each site; half have been in use for only one year and thus have not had adequate

time to impact the number of questing adults (i.e. adult ticks before they feed on deer). For that

reason, we expect to see fewer nymphs in the second season of ‗4-poster‘ utilization. It is also

expected that a third year of treatment with ‗4-poster‘ acaricide applicators will yield a larger

percent reduction in the adult ticks. However, the lack of significance between the two treatment

classes suggests that the decrease in ticks may be a result of a high density of non-target wildlife

hosts near the ‗4-poster‘ devices rather than the acaricide treatment itself. Where high abundance

35

of wildlife hosts exists, greater proportions of ticks are able to find hosts, decreasing the ability

of drag sampling to accurately assess tick population density (Ginsberg and Zhioua, 1999). Trail

cams demonstrated that the ‗4-poster‘ acaricide applicators were routinely used by non-target

wildlife species often without those species coming into contact with the acaricide treated paint

rollers (Figure 2.4). The high number of photographed non-target wildlife species at ‗4-poster‘

acaricide applicator sites supports the hypothesis that the observed decrease in ticks is a result of

questing ticks having readily available hosts and therefore not being draggable near acaricide

applicators. This observed high wildlife activity in close proximity to ‗4-poster‘ devices also

results in increased corn consumption and therefore higher costs of ‗4-poster‘ maintenance,

while also increasing the risk for potential wildlife disease outbreaks. By baiting individuals of

several different species to a centralized feeding site, there is an increased capacity for a ‘4-

poster‘ to become a fomite for any number of wildlife diseases. This is especially disconcerting

in this area because of the community‘s proximity to a wildlife management area where the

target species (deer) and many of the non-target species (turkey, hog, raccoon, and squirrel) are

hunter harvested. In several photographic series, certain species (primarily raccoons and hogs)

also chased deer away from the acaricide applicators and therefore prevented the target species

from feeding and self-treating with acaricide. Future studies should assess whether being chased

from ‗4-poster‘ acaricide applicators has detrimental effects on deer self-treatment or whether

deer simply return to the devices at a later time.

36

Figure 2.5 Trail camera picture of a squirrel, a woodchuck, and a deer utilizing a ‘4-poster’

acaricide applicator.

Given the very small treatment area of the devices and the relative overall size of the

study area, it is clear that eight devices are not sufficient to reduce the risk of tick-borne disease

in the community as a whole. Additionally, because the majority of ‗4-poster‘ acaricide

applicators in this area are located on the perimeter of the community, a high likelihood exists

that deer in the interior part of the community may never come into contact with the devices.

Again, these results emphasize the necessity for the community managers to consider integrated

techniques rather than solely using acaricide self-treatment of deer for tick mitigation efforts.

Considerable uncertainty exists among the community managers about the mode of action of the

‗4-poster‘ acaricide applicators. One ‗4-poster‘ was utilized in close proximity to a golf course

37

and had to be moved elsewhere due to resident complaints of deer-vehicle collisions on a nearby

road. Half of the ‗4-poster‘ devices were moved to new sites at the beginning of our survey and

almost all had been moved in the previous year. At the start of the 2010 treatment season, seven

of the eight ‗4-poster‘ acaricide applicators were moved to new sites due to concern of poachers

potentially using the devices to illegally hunt deer in the community. The high significance in

reduction of A. americanum larvae in treatment sites in contrast to the significant, but less

extensive reduction seen in nymphs and adults, demonstrates the importance of leaving ‗4-

poster‘ devices at a site long enough to affect the tick population as a whole rather than just

affecting one life stage. This result raises the question of whether a 90% percent reduction of

A. americanum larvae in one year necessarily means the same reduction will be seen in nymphs

in the following year. Small mammals have been shown to replenish early stage ticks at deer-

focused tick management sites (Ginsberg and Zhioua, 1999), raising the possibility that the

attraction of non-target species to ‗4-poster‘ acaricide applicators could lead to re-infestation of

nymphal or adult ticks, despite removal of the local larvae.

Carroll et al. (2003) estimated the cost of maintaining a ‗4-poster‘ to be $20 per device

per week including costs of labor, corn, and acaricide. Using this estimate, the cost of

maintaining the eight ‗4-poster‘ devices currently utilized at our study site is $640/month, or

$3,840 for the six-month period in which the devices are deployed each year. Estimations of the

cost of treatment for Ehrlichia infections are unavailable, so Lyme Disease estimates are used

here for cost comparison. The estimated median total cost of diagnosis and treatment for Lyme

Disease patients in the early stage is approximately $397, increasing to approximately $923 for

clinically defined late-stage Lyme Disease (Zhang et al., 2006). It is important to assess whether

38

the decrease in tick numbers seen in this community is worth the amount of money necessary for

maintenance of the ‗4-poster‘ devices and the potential increased risk to wildlife health.

Recommendations of one ‘4-poster‘ for every 20 hectares (Schulze et al., 2007; Solberg

et al., 2003) suggest that in order to manage ticks in an area of this extent, roughly 200 ‗4-poster‘

acaricide applicators would need to be employed. Suitable sites for ‗4-poster‘ acaricide

applicators and necessary funding are the limiting factors for complete management of ticks in

this community by utilization of ‗4-poster‘ acaricide applicators alone. Because of regulations on

‗4-poster‘ devices, most being used in the community are in areas with a low likelihood of

human presence. Given the history of tick-borne disease in the community, the ideal mitigation

technique would be to create a buffer zone around golf courses where most residents are exposed

to ticks. Spraying around golf courses with acaricide would likely work well to accomplish this

goal, but further investigation into affordability of this technique should be investigated.

Vegetation management such as overstory and understory reduction one to two times per year in

high human populated areas in combination with ‗4-poster‘ utilization in the more heavily

wooded areas and exclusion fencing along the wildlife management area border is one option for

controlling the tick population within this community. However, managing the tick population in

the community does not automatically equate to mitigating tick-borne disease and while it is

important not to make people paranoid or scare them away from participating in outdoor

activities, investing money into resident education may be the most economical and efficient way

to reduce disease risk for this residential area.

39

3 MOLECULAR IDENTIFICATION OF EHRLICHIA SPP. AND HOST

BLOODMEAL SOURCE IN AMBLYOMMA AMERICANUM

40

3.1 Abstract

The current status of tick-borne disease (TBD) in the southeastern United States is

challenging to define due to emerging pathogens, uncertain tick/host relationships, and changing

disease case definitions. A golf-oriented retirement community on the Cumberland Plateau in

Tennessee experienced an ehrlichiosis outbreak in 1993 that triggered a CDC outbreak

investigation (Standaert et al., 1995). Anecdotal reports indicate that residents of the outbreak

community have perceived resurgence in tick-related infections in recent years. Amblyomma

americanum is by far the most abundant tick species in the study area; of 253 adult and nymphal

A. americanum tested, we found two positive for Ehrlichia chaffeensis (0.86%), 14 positive for

Ehrlichia ewingii (6.03%), and four positive for Panola Mountain Ehrlichia (1.72%; this is the

first confirmation of Panola Mountain Ehrlichia in the state of Tennessee). The rate of Ehrlichia

spp. infection in ticks from this community is broadly similar to recently reported rates in other

Ehrlichia-endemic areas. Blood meal analysis (BMA) was used to determine the wildlife hosts

on which ticks in this community feed. Our results suggest that the most significant reservoir

hosts for Ehrlichia spp. are deer, wild turkeys, squirrels, and Passeriformes. Clarification of the

species that act as reservoirs for pathogens in the community is the first step toward targeted

management strategies to mitigate the disease risk for residents.

3.2 Introduction

In 1993, an ehrlichiosis outbreak occurred among residents of a golf oriented retirement

community located in the Cumberland Plateau of Tennessee. The Centers for Disease Control

conducted an outbreak investigation using patient history, serology, and PCR testing for

Ehrlichia chaffeensis. From this study, 10 cases of ehrlichiosis were reported from the retirement

41

community, indicating an attack rate of 330 per 100,000 and 12.5 percent of surveyed residents

had serologic evidence of past E. chaffeensis infection (Standaert et al., 1995). The researchers

concluded that the high rate of E. chaffeensis was due to a bordering wildlife management area

and human risk factors for infection included tick bites, exposure to wildlife, golfing, and lack of

insect repellant use. The community is heavily forested and fragmentation due to residential

development and golf courses provides ideal habitat for certain wildlife species and therefore

ticks. Since the time of this outbreak, knowledge about Ehrlichia species has greatly improved,

primarily with the understanding that E. chaffeensis is not the only Ehrlichia species that is

capable of causing disease in humans and other animals. Ehrlichia ewingii, originally identified

as the causative agent of canine granulocytic ehrlichiosis (Anderson et al., 1992a) was later

recognized as an agent of human ehrlichiosis as well (Buller et al., 1999). In 2006, Panola

Mountain Ehrlichia (PME), similar to Ehrlichia ruminatum, was discovered in a goat from

Panola Mountain State Park in Atlanta, GA (Loftis et al., 2006). Subsequent studies determined

that PME is widely distributed along the range of Amblyomma americanum (Loftis et al., 2008)

and that it may cause tick-borne illness in humans (Reeves, 2008). With this increased

knowledge, it is important to revisit the site of the previous outbreak investigation and determine

whether Ehrlichia species other than E. chaffeensis could be contributing to the pathogen status

of this community.

Historically, the primary methods for determining wildlife hosts and reservoirs for ticks

and tick-borne disease have been field trapping and xenodiagnosis. These methods require

extensive field research, extra laboratory and field technicians, and approval from the

Institutional Animal Care and Use Committee (IACUC), yet are very limited in the breadth of

42

species that can be covered. Most published tick xenodiagnosis papers are based on small

mammal and rodent species that can easily be reared in a laboratory setting. Published field

ecology papers are limited by which wildlife species can feasibly be trapped and handled,

primarily birds, mice and other small mammals, raccoons, and opossums. Studies assessing ticks

on hunter harvested species (i.e. turkey and deer) are restricted to the hunting season which does

not correspond to the active questing season of certain tick species (i.e. A. americanum) and

therefore cannot give a complete picture of what wildlife hosts those tick species prefer. Blood

meal analysis allows for questing ticks to be collected and analyzed in the lab to determine host

bloodmeal source. Molecular methods using immunological techniques, multiplex PCR, and

sequencing to determine host bloodmeal have been extensively used for mosquitoes, black flies,

and tsetse flies which have a large amount of available fresh bloodmeal (Beier et al., 1988;

Boakye et al., 1999; Hunter and Bayly, 1991; Kent and Norris, 2005; Ngo and Kramer, 2003;

Tempelis, 1975). In contrast, free-living ticks have molted since taking a bloodmeal and could be

questing for months to find a new host. As a result, the remaining testable bloodmeal in ticks is

very low in quantity and of poor quality; highly sensitive methods are imperative for detection.

In 2007, a molecular technique known as the Reverse Line Blot (RLB) method was developed in

Switzerland to detect host bloodmeal source of questing ticks (Humair et al., 2007).

The goals of this project were to develop an assay to detect host bloodmeal for ticks from

the southeastern United States and assess the wildlife species that are acting as hosts for ticks

collected from the site of the original 1993 outbreak investigation in the Cumberland Plateau of

Tennessee. Additionally, we sought to determine the profile of Ehrlichia species infecting ticks

from this site and by matching up results of both assays, assess the wildlife hosts that are most

43

likely to be reservoirs for Ehrlichia spp. in this area. To assess whether this community may be a

hot spot for Ehrlichia species, Ehrlichia and bloodmeal determinations for ticks from the

retirement community were compared with ticks tested from another site located in middle

Tennessee.

3.3 Methods

3.3.1 Sampling method

Ticks were collected from vegetation by drag sampling once a month from March 2009-

October 2009 and in May and June of 2010. Researchers pulled a 1x1 meter corduroy cloth

along 400m transects at fourteen sites within the retirement community. Additional tested ticks

were collected from Henry Horton State Park (HHSP) in Chapel Hill, Tennessee, using similar

techniques. Ticks from HHSP were collected by dragging 500m transects at six different sites

within the park. A random sample of 100 ticks collected from March 2008-July 2008 at HHSP

was used for comparison with the ticks tested from the Cumberland Plateau site to assess any

differences of Ehrlichia infection rates and host bloodmeal sources of ticks between the two

areas.

Ticks were brought to the University of Tennessee‘s Medical and Veterinary Entomology

laboratory, where they were identified and separated by species, life stage, and sex. Total DNA

was extracted from adult and nymphal ticks as described by Beati and Keirans (2001) using a

DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA).

44

3.3.2 Ehrlichia Assays

Half of the DNA from each extracted sample was assayed for Ehrlichia species using

nested PCR for the GroEL operon fragment. Visualization was performed using gel

electrophoresis. DNA from all positive bands was isolated using a Zymoclean Gel DNA

Recovery Kit (Zymo Research Corporation, Orange, CA) and sequenced using ABI Big-Dye

cycle sequencing mix on a 3130 analyzer (Applied Biosystems, Carlsbad, CA). Sequences were

analyzed using BioEdit software and BLASTed for species identification. Positive samples that

did not match a GenBank sequence for GroEL were subsequently amplified for the gltA (citrate

synthase) gene. For GroEL amplification, we used the primary forward and reverse

oligonucleotide primers 5‘ GAAGATGC(A/T)GT(A/T)GG(A/T)TGTAC(T/G)GC-3‘ and 5‘

AG(A/C)GCTTC(A/T)CCTTC(A/T)AC(A/G)TC(C/T)TC-3‘ and the nested forward and reverse

primers 5‘ ATTACTCAGAGTGCTTCTCA(A/G)TG 3‘ and 5‘

TGCATACC(A/G)TCAGT(C/T)TTTTCAAC-3‘ (Takano et al., 2009). Primary forward and

reverse oligonucleotide primers used for gltA amplification were 5‘

GCCACCGCAGATAGTTAGGGA 3‘ and 5‘ TTCGTGCTCGTGGATCATAGTTTT 3‘ and the

nested forward and reverse primers 5‘ TGTCATTTCCACAGCATTCTCATC 3‘ and 5‘

TGAGCTGGTCCCCACAAAGTT 3‘ (Loftis et al., 2006). Negative and positive controls were

included in each Ehrlichia spp. PCR. A subset of 16 ticks were tested for E. chaffensis and E.

ewingii via 16S nested PCR as described by Yabsley (2005), however observed cross-reactivity

between species and high presence of detected Rickettsia amblyommii led to sole utilization of

the GroEL and gltA PCR techniques.

45

3.3.3 Blood Meal Analysis:

The remaining half of the DNA from each extracted sample underwent touchdown PCR

amplification for the 12S rDNA mitochondrial gene followed by blood meal analysis using the

reverse line blot (RLB) hybridization method (Cadenas et al., 2007; Humair et al., 2007).

Oligonucleotide probes were developed exclusively for New World species that allowed for

determination of host blood meal source from ticks in the southeastern United States (Table 1).

Probe verification was done using tissue and blood samples collected from mammalian, avian,

and reptilian species that are known to be or have potential to be blood meal hosts for A.

americanum. Samples were received from throughout the southeastern US, were fresh, frozen, or

preserved in alcohol, and DNA was promptly extracted from collected samples using

QiagenDNeasy Blood and Tissue Kit. Forty-three oligonucleotide probes were coupled to a

Biodyne C nylon membrane that may be stripped of PCR products and reused up to 40 times.

Forty-three PCR products were hybridized to the membrane and then treated with a streptavidin-

peroxidase conjugate. The membrane was incubated in electrochemiluminescence (ECL)

detection liquid and exposed to X-ray film for visualization.

For the purpose of reducing potential contamination, DNA was extracted from ticks in

one hood and Ehrlichia outer PCR amplification and RLB PCR amplification was performed in

another hood in the Medical Entomology laboratory. In the Center for Wildlife Health

laboratory, we performed Ehrlichia nested PCR amplification in a designated hood, gel

electrophoresis and analysis, and RLB hybridization and visualization. All laboratory fume

hoods were equipped with built-in UV lamps and were thoroughly sanitized between reactions.

46

3.3.4 Statistical analysis

Fisher Exact tests were used to compare the prevalence of E. chaffeensis, E. ewingii, and

Panola Mountain Ehrlichia between the sites and to compare bloodmeal host determination

between sites, life stages, and wildlife host species. Binomial confidence intervals for prevalence

comparisons were calculated using http://statpages.org/confint.html. The observed-to-expected

ratio was calculated for Ehrlichia spp. infection by wildlife host for the top four host species.

47

3.4 Results and Discussion

Ticks from our retirement community field site were infected with Ehrlichia spp. at

similar values found in other Ehrlichia endemic areas. Of 232 adult and nymphal A. americanum

tested from our study site, we found two positive for E. chaffeensis (0.86%), fourteen positive for

E. ewingii (6.03%), and four positive for Panola Mountain Ehrlichia (1.72%). Of the positives,

there were one adult male and one adult female positive for E. chaffeensis, nine adult males, four

adult females, and one nymph positive for E. ewingii, and two adult males and two nymphs

positive for Panola Mountain Ehrlichia. The gltA sequences for Panola Mountain were identical

to the reported PME sequence reported by Loftis et al (2008) (GenBank: DQ363995). Of 82 ticks

tested from HHSP, two were positive for E. chaffeensis (2.4%), one was positive for E. ewingii

(1.2%), and two were positive for Panola Mountain Ehrlichia (2.4%). These results were not

significantly different, although a higher prevalence of E. ewingii was found in our primary site

than at HHSP (Fig. 1).

Bloodmeal source was successfully determined for 47.7% of tested ticks from our

primary study site (n=281) and for 63.4% of ticks from HHSP (n=82). This difference in

detected blood meal by site was statistically significant (p<0.001). The proportion of successful

determination for tested adults (48.3%; n=268) was significantly higher than for tested nymphal

ticks (30.4%; n=56; p=0.018). A range of wildlife species contributed to A. americanum

bloodmeals (Table 2). Wild turkeys were the most common bloodmeal source for both larval and

nymphal ticks at both sites. Considering only successful bloodmeal determinations, turkeys were

fed on by 15.1% of tested ticks at our primary study site and 40.4% at HHSP. Deer were an

important host bloodmeal source at both sites (11.2% at the study site and 21.2% at HHSP),

48

however at the primary site 93% of the deer bloodmeals were detected in adult ticks and at

HHSP 82% of the deer bloodmeals were detected in nymphal ticks; the difference was highly

statistically significant (p<0.001). Based on our results, turkeys and squirrels are the two primary

bloodmeal sources in the retirement community and are also implicated as reservoirs for all three

of the causative agents of ehrlichiosis. This is the first report of Panola Mountain Ehrlichia in the

state of Tennessee and it was found at both the primary study site in the Cumberland Plateau and

in Henry Horton State Park in middle Tennessee. Of the successfully detected bloodmeals from

our primary study site, 10% were from squirrels whereas we detected no squirrel bloodmeal in

ticks from the comparison site. The retirement community is highly fragmented and the state

park comparison site is not, so there may be increased density of squirrels in forested areas of the

community due to home range compaction (Sterzik et al., 1988). Squirrels were also routinely

seen feeding at and around the ‗4-poster‘ acaricide applicators in the retirement community but

rarely came into contact with permethrin treated paint rollers. Panola Mountain Ehrlichia was

detected in nymphal ticks that fed as larvae on squirrels and turkeys, implicating both as

reservoirs for PME in this community.

49

Table 3.1 List of oligonucleotide sequences of primers and probes used to analyze blood

meal source for Amblyomma americanum in the southeastern United States.

50

Figure 3.1 Comparison of Ehrlichia spp. infection prevalence in ticks from our retirement

community study area and from Henry Horton State Park. Comparisons are for all

Ehrlichia species combined, E. chaffeensis alone, E. ewingii alone, and Panola Mountain

Ehrlichia alone. NS = not statistically significant; no significant differences were seen

between the study area and the comparison site for any of the tested Ehrlichia species.

One reason for the lower observed detection of deer and turkeys as bloodmeal hosts at the

primary study site is that community managers have been utilizing ‗4-poster‘ acaricide

applicators (Chapter 2) to kill ticks feeding on deer in an attempt reduce the tick and tick-borne

disease risk to residents in the area. Trail cameras have documented turkeys feeding from ‗4-

poster‘ devices as well, although they do not appear to be treated by the devices (Chapter 2).

However, despite treatment efforts in this community, ticks feeding on deer still have the highest

observed-to-expected ratio of Ehrlichia spp. infection of the top detected wildlife bloodmeal

sources (Fig. 2). The proportion of ticks feeding on feral pigs is also much higher in the

retirement community than in the comparison site, likely due to the growing population of hogs

51

found within the community. However, of ticks that fed on feral pigs, none tested positive for

Ehrlichia species.

52

Table 3.2 Ehrlichia results by each detected bloodmeal host for site one, a retirement

community in the Cumberland Plateau of Tennessee. X(neg,A,B,C) where x= number of

BMA hits; neg=number negative for Ehrlichia spp. A=number E. chaffeensis +ve;

B=number E. ewingii +ve; C=number Panola Mountain Ehrlichia +ve. Forty-seven adult

female A. americanum ticks were tested for bloodmeal host but not Ehrlichia spp. infection.

Site

One: Species All ticks Nymphs Adult F AM

turkey 27(20,0,1,1) 8(7,0,0,1) 12(6,0,1,0) 7(7,0,0,0)

squirrel 16(13,1,1,1) 6(4,0,1,1) 4(3,1,0,0) 6(6,0,0,0)

deer 15(3,0,2,0) 1(1,0,0,0) 12(2,0,0,0) 2(0,0,2,0)

pig 12(9,0,0,0) 6(6,0,0,0) 5(2,0,0,0) 1(1,0,0,0)

Passeriformes 10(7,0,2,1) 3(3,0,0,0) 2(2,0,0,0) 5(2,0,2,1)

opossum 10(10,0,0,0) 3(3,0,0,0) 1(1,0,0,0) 6(6,0,0,0)

passerine 7(5,0,1,0) 2(2,0,0,0) 3(1,0,1,0) 2(2,0,0,0)

raccoon 6(5,0,0,0) 2(2,0,0,0) 1(0,0,0,0) 3(3,0,0,0)

shrew 5(5,0,0,0) 0(0,0,0,0) 0(0,0,0,0) 5(5,0,0,0)

white footed mouse 5(5,0,0,0) 2(2,0,0,0) 2(2,0,0,0) 1(1,0,0,0)

thrush/robin 5(5,0,0,0) 3(3,0,0,0) 0(0,0,0,0) 2(2,0,0,0)

bird 4(3,0,0,0) 0(0,0,0,0) 3(2,0,0,0) 1(1,0,0,0)

cow 4(3,0,0,0) 1(1,0,0,0) 3(2,0,0,0) 0(0,0,0,0)

small rodent 3(3,0,0,0) 1(1,0,0,0) 1(1,0,0,0) 1(1,0,0,0)

mole 2(2,0,0,0) 1(1,0,0,0) 0(0,0,0,0) 1(1,0,0,0)

red fox 2(1,0,0,0) 0(0,0,0,0) 1(0,0,0,0) 1(1,0,0,0)

rabbit 2(1,0,0,0) 0(0,0,0,0) 1(1,0,0,0) 1(1,0,0,0)

chipmunk 1(0,1,0,0) 0(0,0,0,0) 0(0,0,0,0) 1(0,1,0,0)

Felids 1(1,0,0,0) 0(0,0,0,0) 0(0,0,0,0) 1(1,0,0,0)

wood rat 1(1,0,0,0) 0(0,0,0,0) 0(0,0,0,0) 1(1,0,0,0)

woodchuck 1(1,0,0,0) 0(0,0,0,0) 0(0,0,0,0) 1(1,0,0,0)

turtle 1(0,0,0,0) 0(0,0,0,0) 1(0,0,0,0) 0(0,0,0,0)

skinks 1(0,0,0,0) 0(0,0,0,0) 1(0,0,0,0) 0(0,0,0,0)

unknown 147(117,0,7,1) 34(34,0,0,0) 53(29,0,2,0) 60(54,0,5,1)

Total: 288(212,2,14,4) 73(70,0,1,2) 106(54,1,4,0) 109(97,1,9,2)

53

Table 3.3 Ehrlichia results by each detected bloodmeal host for site two, Henry Horton

State Park in middle Tennessee. X(neg,A,B,C) where x= number of BMA hits; neg=number

negative for Ehrlichia spp. A=number E. chaffeensis +ve; B=number E. ewingii +ve;

C=number Panola Mountain Ehrlichia +ve.

Site

Two: Species All ticks N AF AM

turkey 21(20,1,0,0) 7(7,0,0,0) 7(6,1,0,0) 7(7,0,0,0)

deer 10(10,0,0,0) 9(8,0,0,0) 0(0,0,0,0) 2(2,0,0,0)

passerine 6(6,0,0,0) 0(0,0,0,0) 1(1,0,0,0) 5(5,0,0,0)

Passeriformes 2(2,0,0,0) 2(2,0,0,0) 0(0,0,0,0) 0(0,0,0,0)

pig 2(0,1,1,0) 1(0,1,0,0) 0(0,0,0,0) 1(0,0,1,0)

Felids 2(2,0,0,0) 1(1,0,0,0) 0(0,0,0,0) 1(1,0,0,0)

small rodent 2(2,0,0,0) 1(1,0,0,0) 0(0,0,0,0) 1(1,0,0,0)

opossum 1(1,0,0,0) 1(1,0,0,0) 0(0,0,0,0) 0(0,0,0,0)

white footed mouse 1(1,0,0,0) 1(1,0,0,0) 0(0,0,0,0) 0(0,0,0,0)

raccoon 1(1,0,0,0) 1(1,0,0,0) 0(0,0,0,0) 0(0,0,0,0)

Other bird 1(1,0,0,0) 0(0,0,0,0) 0(0,0,0,0) 1(1,0,0,0)

gray fox 1(1,0,0,0) 0(0,0,0,0) 1(1,0,0,0) 0(0,0,0,0)

rabbit 1(1,0,0,0) 0(0,0,0,0) 0(0,0,0,0) 1(1,0,0,0)

skunk 1(1,0,0,0) 0(0,0,0,0) 0(0,0,0,0) 1(1,0,0,0)

unknown 31(29,0,0,2) 5(5,0,0,1) 14(14,0,0,0) 11(10,0,0,1)

Total: 83(78,2,1,2) 29(27,1,0,1) 23(22,1,0,0) 31(29,0,1,1)

The ability to detect bloodmeals from adult ticks much more efficiently than from

nymphal ticks is likely a direct result of the amount of bloodmeal that is taken by larval ticks

compared to nymphal ticks. However, comparison of bloodmeal source to Ehrlichia infection in

adult ticks leads to difficulty assessing species that are acting as pathogen reservoirs as there is

no certainty that the tick acquired the infection from the wildlife host fed on during the nymphal

life stage. By refining an extraction protocol specifically for nymphal ticks, it may be possible to

increase the number of successful bloodmeal results for that life stage.

54

Fig. 3.2 Observed-to-expected ratio of Ehrlichia spp. infection in A. americanum ticks that

fed on the most common bloodmeal hosts. Ratios greater than 1 represent higher Ehrlichia

infection rates than are expected for that host group, indicating potential for that wildlife

species to act as a reservoir for Ehrlichia.

The prevalence of Ehrlichia spp. infections in A. americanum is not significantly

different between the two study sites, which implies that the retirement community is not

currently a uniquely ―hot‖ spot for Ehrlichia infection in Tennessee. However, the primary

bloodmeal sources differ between the two sites, as squirrels and feral pigs play a more significant

role as bloodmeal hosts in the retirement community and deer and turkeys play a more

significant role at the comparison site. Based on the observed-to-expected ratio of Ehrlichia spp.

per bloodmeal host, deer, squirrels, Passeriform birds, and turkeys are the most prominent

species acting as reservoir hosts for Ehrlichia infections (Fig. 3.2). This clarification of the

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

4.0

Deer Squirrel Birds Turkey Other Pig

O/E

rati

o

Host bloodmeal source

Observed-to-expected ratio of Ehrlichia spp. infection in

A.americanum ticks by bloodmeal host

55

species that are acting as reservoirs for pathogens in Tennessee is the first step in developting

targeted management strategies to mitigate the disease risk for residents.

56

4 CONCLUSION

57

4.1 Utilization of ‘4-poster’ acaricide applicators as a sole method of tick mitigation in a

large-scale community

There are several benefits of the use of ‗4-poster‘ acaricide applicators to manage ticks

and tick-borne disease. In just one year, it is possible to have an approximately 90% reduction of

larval ticks at treatment sites. With additional treatment years, significant reductions of nymphal

and adult life stages are also possible. Self-treatment of wildlife species is a simple way to

manage ticks without having to handle and treat wildlife species or perform extensive acaricide

applications that can result in non-target effects. However, this type of treatment is best used in

a small area or at a site that does not have a high density of non-target wildlife species. In our

large retirement community study site utilization of ‗4-poster‘ acaricide applicators as a sole

method for managing ticks cannot efficiently reduce the numbers of ticks or the risk of tick-

borne disease to community residents. Regulations on placement of ‗4-poster‘ devices in

proximity to houses and areas where children may be present greatly limit the area in a

community where acaricide applicators can be used. Resident concerns about deer-vehicle

collisions due to deer being baited to particular areas of the community lead to additional limits

for device placement. Even if community managers were able to afford the cost of buying and

maintaining enough ‗4-poster‘ acaricide applicators for an area of this size, it is likely that they

would be unable to evenly distribute them throughout the community while also maintaining

adequate distance from residences and main roads.

Rapid development in the community has led to areas of urbanized land that border

heavily wooded land. This fragmented habitat allows several wildlife species to thrive which

provides abundant bloodmeal sources for ticks. Many of these wildlife species are also attracted

58

to the corn supplemented by ‗4-poster‘ acaricide applicators but few come into contact with

treated paint rollers as readily as deer. The presence of non-target species at ‗4-poster‘ sites

decreases the efficacy of the devices, as nymphal and adult ticks are likely to be re-deposited by

untreated wildlife. Increased maintenance costs can also be expected with the presence of non-

target wildlife species due to greater corn consumption and an increase in necessary repairs, for

example, repairing paint rollers broken by feral pigs and holes that squirrels chew in the main

storage compartment. The attraction of many different wildlife species to these centralized

devices also increases the risk that individual ‗4-poster‘ devices will become fomites for wildlife

disease. In the event of a disease outbreak in this area, the affected wildlife population could be

drastically affected by indirect transmission of infection via a ‗4-poster‘ acaricide applicator.

In relatively small areas, ‗4-poster‘ acaricide applicators appear to effectively reduce the

number of questing ticks within the treatment area. However, for a large residential community

such as our study site, integrated techniques will likely be necessary to successfully reduce the

tick population as management using ‗4-poster‘ devices alone is limited by available space and

costs of maintenance.

4.2 Implications of Ehrlichia and Blood meal analysis

We have reported the first identification of Panola Mountain Ehrlichia (PME) in A.

americanum ticks in the state of Tennessee. This report is not surprising given the widespread

distribution of PME in the eastern United States as determined by Loftis et al. (2008), but

important to note as this species could be contributing to tick-borne illness within the state.

While the prevalence of each species of Ehrlichia is not significantly different from Henry

Horton State Park (HHSP), the prevalence of Ehrlichia ewingii was higher in the retirement

59

community than in HHSP (Chapter 3). Continued surveillance of the prevalence of these

Ehrlichia species in A. americanum in the community is important for rapid response to any

increases in infection rates. It is also imperative that managers educate the residents about their

risk of tick-borne disease in the community and how to properly protect themselves to avoid

ehrlichiosis outbreaks in the future. Based on a questionnaire survey done by The Human

Dimensions Research Lab at the University of Tennessee, 33% of women and 20% of men in

Tennessee do not participate in outdoor recreation more often due to concern about tick related

diseases (Mark Fly, Human Dimensions Research Lab Director, pers. comm.). Through

investments into resident education about prevention of tick-borne illnesses, the community

would potentially see an increase in participation in outdoor activities and therefore increased

economic gains for course memberships, gear rentals, etc. Resident education needs to be a

primary focus of tick-borne disease mitigation in the community, as the greatest gain would

likely be seen from this investment.

The wildlife host species that are potentially acting as reservoirs for Ehrlichia (turkeys,

deer, and squirrels) are species that thrive in fragmented areas like our study site (Chapter 3).

These are also species of particular importance to hunters from the nearby wildlife management

area. The high populations of wildlife observed within and in proximity to this community

results in greater difficulty managing ticks on hosts in an area of this size. Exclusion fencing

along the border of the retirement community and the wildlife management area may serve to

reduce the density of wildlife that are currently moving freely into and out of the community.

Community managers should assess the cost-benefit ratio of using integrated techniques to

60

manage the tick-borne disease risk in the community as a whole in order to develop a system that

best suits their needs.

61

4.3 Future Research Direction

To determine if Panola Mountain Ehrlichia is widespread across Tennessee and to assess

the prevalences of the Ehrlichia species across the state, A. americanum should be collected and

tested from various regions of Tennessee. Understanding the distribution of these agents across

the state allows for assessment of high-risk areas or potential ‗hot‘ spots for disease. This

widespread testing could also lead to comparisons of the effects of different habitat types in

Tennessee on both the number of A.americanum and prevalence of Ehrlichia infection in ticks.

Knowledge of what habitat types and conditions are ideal for ticks and the pathogens they carry

can provide insight into the best types of landscape management to pursue as means to reduce

the number of ticks within the community.

Additional development and optimization of the Reverse Line Blot method of blood meal

analysis should be performed, starting with testing different methods of DNA extraction that

could reduce contamination issues. The most ideal method of DNA extraction would involve

very little opening and closing of sample tubes, as is the case with bead beater methods, however

A. americanum that have been stored in ethanol need long bead beating times for the tick to be

efficiently broken up. Extensive bead beating can potentially lead to shearing of DNA and

therefore compromise detection of bloodmeal hosts, so determining a better method is needed to

efficiently break up ticks without damaging available DNA or allowing contamination into tubes.

Optimization of the DNA extraction technique would likely solve the issues that we were unable

to address through modification of PCR and hybridization protocols.

Community managers would likely benefit from focusing mitigation attempts in certain

parts of the community, either in areas where tick densities are highest or where humans are

62

most likely to come into contact with ticks. Consideration should be made into more integrated

approaches to manage ticks in areas where 4-posters aren‘t a feasible option, such as near

residences, golf courses, or busy roads. Investments into field mitigation techniques should

supplement an education effort to teach residents how best to protect themselves from ticks and

tick-borne disease. Future research projects are needed to assess how several different mitigation

techniques work together to reduce tick density as well as tick-borne disease risk to residents. A

follow-up questionnaire survey should be done to determine resident concern about ticks at a

larger community scale than what was achieved by our questionnaire survey (Appendix 1). An

increase in response rate can be achieved through direct distribution of questionnaires to

residents and sending out reminders about completion. Pre-addressed envelopes could also

increase the response rate, as residents would then not be required to personally take completed

questionnaires to the community center. A more comprehensive questionnaire would provide

more insight into concern of the community as a whole rather than a small subset of the

community members, and could allow community managers to determine topics that should be

the focus of resident education efforts.

63

REFERENCES

64

Allan B.F. (2009) Influence of Prescribed Burns on the Abundance of Amblyomma americanum (Acari:

Ixodidae) in the Missouri Ozarks. Journal of Medical Entomology 46:1030-1036.

Anderson B.E., Sumner J.W., Dawson J.E., Tzianabos T., Greene C.R., Olson J.G., Fishbein D.B.,

Olsenrasmussen M., Holloway B.P., George E.H., Azad A.F. (1992a) Detection of the etiologic

agent of human ehrlichiosis by polymerase chain-reaction. Journal of Clinical Microbiology

30:775-780.

Anderson B.E., Sumner J.W., Dawson J.E., Tzianabos T., Greene C.R., Olson J.G., Fishbein D.B., Olsen-

Rasmussen M., Holloway B.P., George E.H., et al. (1992b) Detection of the etiologic agent of

human ehrlichiosis by polymerase chain reaction. J Clin Microbiol 30:775-80.

Anderson J.M., Swanson K.I., Schwartz T.R., Glass G.E., Norris D.E. (2006) Mammal diversity and

infection prevalence in the maintenance of enzootic Borrelia burgdorferi along the western

Coastal Plains of Maryland. Vector Borne Zoonotic Dis 6:411-22. DOI: 10.1089/vbz.2006.6.411.

Apperson C.S., Levine J.F., Evans T.L., Braswell A., Heller J. (1993) Relative utilization of reptiles and

rodents as hosts by immature Ixodes scapularis (Acari: Ixodidae) in the coastal plain of North

Carolina, USA. Exp Appl Acarol 17:719-31.

Apperson C.S., Engber B., Nicholson W.L., Mead D.G., Engel J., Yabsley M.J., Dail K., Johnson J.,

Watson D.W. (2008) Tick-Borne Diseases in North Carolina: Is "Rickettsia amblyommii" a

Possible Cause of Rickettsiosis Reported as Rocky Mountain Spotted Fever? Vector-Borne and

Zoonotic Diseases 8:1-10. DOI: 10.1089/vbz.2007.0271.

Bacon R.M., Gilmore R.D., Jr., Quintana M., Piesman J., Johnson B.J. (2003) DNA evidence of Borrelia

lonestari in Amblyomma americanum (Acari: Ixodidae) in southeast Missouri. J Med Entomol

40:590-2.

Barbour A.G. (1996) Does Lyme disease occur in the south?: a survey of emerging tick-borne infections

in the region. Am J Med Sci 311:34-40.

Beati L., Keirans J.E. (2001) Analysis of the systematic relationships among ticks of the genera

Rhipicephalus and Boophilus (Acari : Ixodidae) based on mitochondrial 12S ribosomal DNA

gene sequences and morphological characters. Journal of Parasitology 87:32-48.

Beier B.R. (1988a) Genetic testing and the right of self determination: the experience in the Federal

Republic of Germany. Hofstra Law Rev 16:601-14.

Beier J.C., Perkins P.V., Wirtz R.A., Koros J., Diggs D., Gargan T.P., 2nd, Koech D.K. (1988)

Bloodmeal identification by direct enzyme-linked immunosorbent assay (ELISA), tested on

Anopheles (Diptera: Culicidae) in Kenya. J Med Entomol 25:9-16.

Beier W. (1988b) [Theoretical longevity and biological functional time]. Z Gerontol 21:110-5.

Billeter S.A., Blanton H.L., Little S.E., Levy M.G., Breitschwerdt E.B. (2007) Detection of Rickettsia

amblyommii in association with a tick bite rash. Vector Borne Zoonotic Dis 7:607-10. DOI:

10.1089/vbz.2007.0121.

Blagburn B.L., Dryden M.W. (2009) Biology, treatment, and control of flea and tick infestations.

Veterinary Clinics of North America, Small Animal Practice 39:1173-1200.

Bloemer S.R., Mount G.A., Morris T.A., Zimmerman R.H., Barnard D.R., Snoddy E.L. (1990)

Management of lone star ticks (Acari: Ixodidae) in recreational areas with acaricide applications,

vegetative management, and exclusion of white-tailed deer. J Med Entomol 27:543-50.

Boakye D.A., Tang J., Truc P., Merriweather A., Unnasch T.R. (1999) Identification of bloodmeals in

haematophagous Diptera by cytochrome B heteroduplex analysis. Med Vet Entomol 13:282-7.

Brady J.T., Montelius D.A., Beierschmitt W.P., Wyand D.S., Khairallah E.A., Cohen S.D. (1988) Effect

of piperonyl butoxide post-treatment on acetaminophen hepatotoxicity. Biochem Pharmacol

37:2097-9. DOI: 0006-2952(88)90562-X [pii].

Brei B., Brownstein J.S., George J.E., Pound J.M., Miller J.A., Daniels T.J., Falco R.C., Stafford K.C.,

Schulze T.L., Mather T.N., Carroll J.F., Fish D. (2009) Evaluation of the United States

65

Department of Agriculture Northeast Area-Wide Tick Control Project by Meta-Analysis. Vector-

Borne and Zoonotic Diseases 9:423-430. DOI: 10.1089/vbz.2008.0150.

Buller R.S., Arens M., Hmiel S.P., Paddock C.D., Sumner J.W., Rikihisa Y., Unver A., Gaudreault-

Keener R., Manian F.A., Liddell A.M., Schmulewitz N., Storch G.A. (1999) Ehrlichia ewingii, A

newly recognized agent of human ehrlichiosis. New England Journal of Medicine 341:148-155.

Burgdorfer W. (1969) Ecology of tick vectors of American spotted fever. Bull World Health Organ

40:375-81.

Burkot T.R., Mullen G.R., Anderson R., Schneider B.S., Happ C.M., Zeidner N.S. (2001) Borrelia

lonestari DNA in adult Amblyomma americanum ticks, Alabama. Emerg Infect Dis 7:471-3.

Cadenas F.M., Rais O., Jouda F., Douet V., Humair P.F., Moret J., Gern L. (2007) Phenology of Ixodes

ricinus and infection with Borrelia burgdorferi sensu lato along a north- and south-facing

altitudinal gradient on Chaumont Mountain, Switzerland. J Med Entomol 44:683-93.

Carbone C., Christie S., Conforti K., Coulson T., Franklin N., Ginsberg J.R., Griffiths M., Holden J.,

Kawanishi K., Kinnaird M., Laidlaw R., Lynam A., Macdonald D.W., Martyr D., McDougal C.,

Nath L., O'Brien T., Seidensticker J., Smith D.J.L., Sunquist M., Tilson R., Shahruddin W.N.W.

(2001) The use of photographic rates to estimate densities of tigers and other cryptic mammals.

Animal Conservation 4:75-79.

Carroll J.F., Kramer M. (2003) Winter activity of Ixodes scapularis (Acari: Ixodidae) and the operation of

deer-targeted tick control devices in Maryland. J Med Entomol 40:238-44.

Carroll J.F., Solberg V.B., Klun J.A., Kramer M., Debboun M. (2004) Comparative activity of deet and

AI3-37220 repellents against the ticks Ixodes scapularis and Amblyomma americanum (Acari:

Ixodidae) in laboratory bioassays. J Med Entomol 41:249-54.

Carroll J.F., Hill D.E., Allen P.C., Young K.W., Miramontes E., Kramer M., Pound J.M., Miller J.A.,

George J.E. (2009) The Impact of 4-Poster Deer Self-Treatment Devices at Three Locations in

Maryland. Vector-Borne and Zoonotic Diseases 9:407-U64. DOI: DOI 10.1089/vbz.2008.0165.

CDC. (2007) Lyme disease-United States, 2003-2005. MMWR 56:53-576.

CDC. (2008) Southern Tick-Associated Rash Illness. http://www.cdc.gov/ncidod/dvbid/stari/.

Clay K., Klyachko O., Grindle N., Civitello D., Oleske D., Fuqua C. (2008) Microbial communities and

interactions in the lone star tick, Amblyomma americanum. Mol Ecol 17:4371-81.

Cully J.F. (1999) Lone star tick abundance, fire, and bison grazing in tallgrass prairie. Journal of Range

Management 52:139-144.

Davidson W.R., Siefken D.A., Creekmore L.H. (1994) Influence of Annual and Biennial Prescribed

Burning during March on the Abundance of Amblyomma-Americanum (Acari, Ixodidae) in

Central Georgia. Journal of Medical Entomology 31:72-81.

Deblinger R.D., Rimmer D.W. (1991) Efficacy of a permethrin-based acaricide to reduce the abundance

of Ixodes dammini (Acari: Ixodidae). J Med Entomol 28:708-11.

Dolan M.C., Maupin G.O., Schneider B.S., Denatale C., Hamon N., Cole C., Zeidner N.S., Stafford K.C.,

3rd. (2004) Control of immature Ixodes scapularis (Acari: Ixodidae) on rodent reservoirs of

Borrelia burgdorferi in a residential community of southeastern Connecticut. J Med Entomol

41:1043-54.

Dumler J.S., Walker D.H. (2005) Rocky Mountain spotted fever--changing ecology and persisting

virulence. N Engl J Med 353:551-3. DOI: 353/6/551 [pii]

10.1056/NEJMp058138.

Durden L.A.K., T.M. Jr. (1992) An annotated list of the ticks (Acari:Ixodoidea) or Tennessee with

records of four exotic species for the United States. Bull. Soc. Vector Ecol. 17:125-131.

Eng T.R., Harkess J.R., Fishbein D.B., Dawson J.E., Greene C.N., Redus M.A., Satalowich F.T. (1990)

EPIDEMIOLOGIC, CLINICAL, AND LABORATORY FINDINGS OF HUMAN

66

EHRLICHIOSIS IN THE UNITED-STATES, 1988. Jama-Journal of the American Medical

Association 264:2251-2258.

Estrada-Pena A., Bianchi J.M.V. (2006) Efficacy of several anti-tick treatments to prevent the

transmission of Rickettsia conorii under natural conditions, in: K. E. Hechemy, et al. (Eds.),

Century of Rickettsiology: Emerging, Reemerging Rickettsioses, Molecular Diagnostics, and

Emerging Veterinary Rickettsioses, Blackwell Publishing, Oxford. pp. 506-508.

Falco R.C., Fish D. (1992) A comparison of methods for sampling the deer tick, Ixodes-dammini, in a

Lyme-disease endemic area. Experimental & Applied Acarology 14:165-173.

Faulde M.K., Uedelhoven W.M., Robbins R.G. (2003) Contact toxicity and residual activity of different

permethrin-based fabric impregnation methods for Aedes aegypti (Diptera : Culicidae), Ixodes

ricinus (Acari : Ixodidae), and Lepisma saccharina (Thysanura : Lepismatidae). Journal of

Medical Entomology 40:935-941.

Ginsberg H.S., Zhioua E. (1999) Influence of deer abundance on the abundance of questing adult Ixodes

scapularis (Acari : Ixodidae). Journal of Medical Entomology 36:376-381.

Ginsberg H.S.L., Roger A.; Heyer,Klaus; Zhioua,Elyes. (2002) Potential Nontarget Effects of

Metarhizium anisopliae (Deuteromycetes) Used for Biological Control of Ticks (Acari:

Ixodidae). Environmental Entomology 31:1191-1196.

Herrington J.E. (2004) Risk perceptions regarding ticks and Lyme disease - A national survey. American

Journal of Preventive Medicine 26:135-140. DOI: DOI 10.1016/j.amepre.2003.10.010.

Hoch A.L., Barker R.W., Semtner P.J., Hair J.A. (1972) Preliminary Observations on Controlled Burning

for Lone Star Tick Ixodidae) Control in Woodlots. Journal of Medical Entomology 9:446-&.

Hoen A.G., Rollend L.G., Papero M.A., Carroll J.F., Daniels T.J., Mather T.N., Schulze T.L., Stafford

K.C., Fish D. (2009) Effects of Tick Control by Acaricide Self-Treatment of White-Tailed Deer

on Host-Seeking Tick Infection Prevalence and Entomologic Risk for Ixodes scapularis-Borne

Pathogens. Vector-Borne and Zoonotic Diseases 9:431-438. DOI: 10.1089/vbz.2008.0155.

Hornbostel V.L., Ostfeld R.S., Zhioua E., Benjamin M.A. (2004) Sublethal effects of Metarhizium

anisopliae (Deuteromycetes) on engorged larval, nymphal, and adult Ixodes scapularis (Acari:

Ixodidae). J Med Entomol 41:922-9.

Humair P.F., Douet V., Cadenas F.M., Schouls L.M., Van de Pol I., Gern L. (2007a) Molecular

identification of bloodmeal source in Ixodes ricinus ticks using 12S rDNA as a genetic marker.

Journal of Medical Entomology 44:869-880.

Hunter F.F., Bayly R. (1991) ELISA for identification of blood meal source in black flies (Diptera:

Simuliidae). J Med Entomol 28:527-32.

Jacobson H.A., Hurst G.A. (1979) Prevalence of Parasitism by Amblyomma-Americanum on Wild

Turkey Poults as Influenced by Prescribed Burning. Journal of Wildlife Diseases 15:43-47.

James A.M., Liveris D., Wormser G.P., Schwartz I., Montecalvo M.A., Johnson B.J.B. (2001) Borrelia

lonestari infection after a bite by an Amblyomma americanum tick. Journal of Infectious Diseases

183:1810-1814.

Jennelle C.S., Runge M.C., MacKenzie D.I. (2002) The use of photographic rates to estimate densities of

tigers and other cryptic mammals: a comment on misleading conclusions. Animal Conservation

5:119-120. DOI: Doi 10.1017/S1367943002002160.

Jordan R.A., Schulze T.L., Jahn M.B. (2007) Effects of reduced deer density on the abundance of Ixodes

scapularis (Acari: Ixodidae) and Lyme disease incidence in a northern New Jersey endemic area.

J Med Entomol 44:752-7.

Kent R.J., Norris D.E. (2005) Identification of mammalian blood meals in mosquitoes by a multiplexed

polymerase chain reaction targeting cytochrome B. Am J Trop Med Hyg 73:336-42. DOI:

73/2/336 [pii].

67

Kirkland B.H., Westwood G.S., Keyhani N.O. (2004) Pathogenicity of entomopathogenic fungi

Beauveria bassiana and Metarhizium anisopliae to Ixodidae tick species Dermacentor variabilis,

Rhipicephalus sanguineus, and Ixodes scapularis. J Med Entomol 41:705-11.

Kocan A.A., Levesque G.C., Whitworth L.C., Murphy G.L., Ewing S.A., Barker R.W. (2000) Naturally

occurring Ehrlichia chaffeensis infection in coyotes from Oklahoma. Emerg Infect Dis 6:477-80.

Kollars T.M., Kengluecha A. (2001) Spotted Fever Group Rickettsia in Dermacentor variabilis (Acari:

Ixodidae) Infesting Raccoons (Carnivora: Procyonidae) and Opossums (Marsupialia:

Didelphimorphidae) in Tennessee. Journal of Medical Entomology 38:601-602.

Kollars T.M., Jr., Oliver J.H., Jr., Masters E.J., Kollars P.G., Durden L.A. (2000) Host utilization and

seasonal occurrence of Dermacentor species (Acari:Ixodidae) in Missouri, USA. Exp Appl

Acarol 24:631-43.

Kong F., Gilbert G.L. (2006) Multiplex PCR-based reverse line blot hybridization assay (mPCR/RLB)--a

practical epidemiological and diagnostic tool. Nat Protoc 1:2668-80.

Kranzfelder D., Beier H.J., Albert P. (1988) [A full-term tubal pregnancy with survival of mother and

child]. Geburtshilfe Frauenheilkd 48:369-71. DOI: 10.1055/s-2008-1035995.

Landaas S., Juell A., Beier R. (1988) [Determination of leukocytes and thrombocytes by hematocrit

centrifugation. A new method of interest for primary health care]. Tidsskr Nor Laegeforen

108:1211-4.

Loftis A.D., Reeves W.K., Spurlock J.P., Mahan S.M., Troughton D.R., Dasch G.A., Levin M.L. (2006)

Infection of a goat with a tick-transmitted Ehrlichia from Georgia, USA, that is closely related to

Ehrlichia ruminantium. Journal of Vector Ecology 31:213-223.

Loftis A.D., Mixson T.R., Stromdahl E.Y., Yabsley M.J., Garrison L.E., Williamson P.C., Fitak R.R.,

Fuerst P.A., Kelly D.J., Blount K.W. (2008) Geographic distribution and genetic diversity of the

Ehrlichia sp. from Panola mountain in Amblyomma americanum. BMC Infectious Diseases 8:(23

April 2008).

Marchesi J.R., Sato T., Weightman A.J., Martin T.A., Fry J.C., Hiom S.J., Dymock D., Wade W.G.

(1998) Design and Evaluation of Useful Bacterium-Specific PCR Primers That Amplify Genes

Coding for Bacterial 16S rRNA. Appl Environ Microbiol 64:2333.

Marsland E.J. (1997) Tick Control and Tick Transmitted Disease Monitoring in Eastern Tennessee. A

Thesis Presented for the Master of Science Degree; The University of Tennessee, Knoxville.

Meyers L.L., Beierschmitt W.P., Khairallah E.A., Cohen S.D. (1988) Acetaminophen-induced inhibition

of hepatic mitochondrial respiration in mice. Toxicol Appl Pharmacol 93:378-87.

Miller N.J., Thomas W.A., Mather T.N. (2009) Evaluating a deer-targeted acaricide applicator for area-

wide suppression of blacklegged ticks, Ixodes scapularis (Acari: Ixodidae), in Rhode Island.

Vector Borne Zoonotic Dis 9:401-6. DOI: 10.1089/vbz.2008.0164.

Mixson T.R., Campbell S.R., Gill J.S., Ginsberg H.S., Reichard M.V., Schulze T.L., Dasch G.A. (2006)

Prevalence of Ehrlichia, Borrelia, and Rickettsial agents in Amblyomma americanum (Acari:

Ixodidae) collected from nine states. J Med Entomol 43:1261-8.

Moore V.A., Varela A.S., Yabsley M.J., Davidson W.R., Little S.E. (2003) Detection of Borrelia

lonestari, putative agent of southern tick-associated rash illness, in white-tailed deer (Odocoileus

virginianus) from the southeastern United States. Journal of Clinical Microbiology 41:424-427.

DOI: Doi 10.1128/Jcm.41.1.424-427.2003.

Morris C.G. (1999) Adjacent Habitat at Distribution and Management of the Lone Star Tick in Tennessee.

A Thesis Presented for the Master of Science Degree; The University of Tennessee, Knoxville.

Morshed M.G., Scott J.D., Fernando K., Beati L., Mazerolle D.F., Geddes G., Durden L.A. (2005)

Migratory songbirds disperse ticks across Canada, and first isolation of the Lyme disease

spirochete, Borrelia burgdorferi, from the avian tick, Ixodes auritulus. J Parasitol 91:780-90.

Mountz J.M., Stafford-Schuck K., McKeever P.E., Taren J., Beierwaltes W.H. (1988) Thallium-201

tumor/cardiac ratio estimation of residual astrocytoma. J Neurosurg 68:705-9.

68

Ngo K.A., Kramer L.D. (2003) Identification of mosquito bloodmeals using polymerase chain reaction

(PCR) with order-specific primers. J Med Entomol 40:215-22.

Nicholson W.L., Allen, Kelly E., McQuiston, Jennifer H., Breitschwerdt, Edward B., Little, Susan E.

(2010) The increasing recognition of rickettsial pathogens in dogs and people. Trends in

Parasitology in press.

Norcross N.L.B., Eric G. (2002) Effectiveness of nest treatments on tick infestations in the eastern brown

pelican. The Wilson Bulletin 114:73-78.

Oliveira-Santos L.G.R., Zucco C.A., Antunes P.C., Crawshaw P.G. (2010) Is it possible to individually

identify mammals with no natural markings using camera-traps? A controlled case-study with

lowland tapirs. Mammalian Biology 75:375-378. DOI: 10.1016/j.mambio.2009.08.005.

Ono M., Beiersdorfer P., Bell R., Bernabei S., Cavallo A., Chmyga A., Cohen S., Colestock P., Gammel

G., Greene G.J., Hosea J., Kaita R., Lehrman I.I., Mazzitelli G., Mazzucato E., McNeill D., Sato

K., Stevens J., Timberlake J., Wilson J.R., Wouters A. (1988) Effects of high-power ion

Bernstein waves on a tokamak plasma. Phys Rev Lett 60:294-297.

Paddock C.D., Yabsley M.J. (2007) Ecological havoc, the rise of white-tailed deer, and the emergence of

Amblyomma americanum-associated zoonoses in the United States. Curr Top Microbiol

Immunol 315:289-324.

Paddock C.D., Sumner J.W., Comer J.A., Zaki S.R., Goldsmith C.S., Goddard J., McLellan S.L.,

Tamminga C.L., Ohl C.A. (2004) Rickettsia parkeri: a newly recognized cause of spotted fever

rickettsiosis in the United States. Clin Infect Dis 38:805-11. DOI: 10.1086/381894

CID32198 [pii].

Pound J.M., Miller J.A., George J.E. (2000a) Efficacy of amitraz applied to white-tailed deer by the '4-

poster' topical treatment device in controlling free-living lone star ticks (Acari : Ixodidae).

Journal of Medical Entomology 37:878-884.

Pound J.M., Miller J.A., George J.E., Lemeilleur C.A. (2000b) The '4-poster' passive topical treatment

device to apply acaricide for controlling ticks (Acari : Ixodidae) feeding on white-tailed deer.

Journal of Medical Entomology 37:588-594.

Pound J.M., Miller J.A., George J.E., Oehler D.D., Harmel D.E. (1996) Systemic treatment of white-

tailed deer with ivermectin-medicated bait to control free-living populations of lone star ticks

(Acari: Ixodidae). Journal of Medical Entomology 33:385-394.

Reeves W.K., Loftis, A. D., Nicholson, W. L., and Czarkowski, A. G. (2008) The first report of human

illness associated with the Panola Mountain Ehrlichia species: a case report. Journal of Medical

Case Reports 2. DOI: 10.1186/1752-1947-2-139.

Rijpkema S.G., Molkenboer M.J., Schouls L.M., Jongejan F., Schellekens J.F. (1995) Simultaneous

detection and genotyping of three genomic groups of Borrelia burgdorferi sensu lato in Dutch

Ixodes ricinus ticks by characterization of the amplified intergenic spacer region between 5S and

23S rRNA genes. J Clin Microbiol 33:3091-5.

Rosen M.E. (2009) Investigating the Maintenance of the Lyme Disease Pathogen, Borrelia burgdorferi,

and its Vector, Ixodes scapularis, in Tennessee. A Thesis Presented for the Master of Science

Degree; The University of Tennessee, Knoxville.

Schulze L., Jordan R.A., Dolan M.C., Dietrich G., Healy S.P., Piesman J. (2008) Ability of 4-poster

passive topical treatment devices for deer to sustain low population levels of Ixodes scapularis

(Acari: Ixodidae) after integrated tick management in a residential landscape. J Med Entomol

45:899-904.

Schulze T.L., Jordan R.A., Schulze C.J., Mixson T., Papero M. (2005) Relative encounter frequencies and

prevalence of selected Borrelia, Ehrlichia, and Anaplasma infections in Amblyomma americanum

and Ixodes scapularis (Acari : Ixodidae) ticks from central New Jersey. Journal of Medical

Entomology 42:450-456.

69

Schulze T.L., Jordan R.A., Schulze C.J., Healy S.P., Jahn M.B., Piesman J. (2007) Integrated use of 4-

Poster passive topical treatment devices for deer, targeted acaricide applications, and Maxforce

TMS bait boxes to rapidly suppress populations of Ixodes scapularis (Acari: Ixodidae) in a

residential landscape. J Med Entomol 44:830-9.

Shadick N.A., Daltroy L.H., Phillips C.B., Liang U.S., Liang M.H. (1997) Determinants of tick-avoidance

behaviors in an endemic area for Lyme disease. American Journal of Preventive Medicine

13:265-270.

Solberg V.B., Miller J.A., Hadfield T., Burge R., Schech J.M., Pound J.M. (2003) Control of Ixodes

scapularis (Acari : Ixodidae) with topical self-application of permethrin by white-tailed deer

inhabiting NASA, Beltsville, Maryland. Journal of Vector Ecology 28:117-134.

Stafford K.C., 3rd, Denicola A.J., Pound J.M., Miller J.A., George J.E. (2009) Topical treatment of white-

tailed deer with an acaricide for the control of Ixodes scapularis (Acari: Ixodidae) in a

Connecticut Lyme borreliosis hyperendemic Community. Vector Borne Zoonotic Dis 9:371-9.

DOI: 10.1089/vbz.2008.0161.

Standaert S.M., Dawson J.E., Schaffner W., Childs J.E., Biggie K.L., Singleton J., Jr., Gerhardt R.R.,

Knight M.L., Hutcheson R.H. (1995) Ehrlichiosis in a golf-oriented retirement community. N

Engl J Med 333:420-5.

Stegall-Faulk T., Clark D.C., Wright S.M. (2003) Detection of Borrelia lonestari in Amblyomma

americanum (Acari: Ixodidae) from Tennessee. Journal of Medical Entomology 40:100-102.

Sterzik K., Rosenbusch B., Sasse V., Terinde R., Wolf A., Beier H.M., Lauritzen C. (1988) [Experiences

and successes with intravaginal fertilization and culture of human oocytes]. Geburtshilfe

Frauenheilkd 48:850-3. DOI: 10.1055/s-2008-1026639.

Stromdahl E.Y., Randolph M.P., O'Brien J.J., Gutierrez A.G. (2000) Ehrlichia chaffeensis (Rickettsiales:

Ehrlichieae) infection in Amblyomma americanum (Acari: Ixodidae) at Aberdeen Proving

Ground, Maryland. J Med Entomol 37:349-56.

Stromdahl E.Y., Vince, M. A., Billingsley, P.M., Dobbs, N.A., Williamson, P.C. (2008) Rickettsia

amblyommii Infecting Amblyomma americanum Larvae. Vector Borne Zoonotic Dis 8:15-24.

DOI: 10.1089/vbz.2007.0138.

Sumner JW D.L., Goddard J, Stromdahl EY, Clark KL, Reeves WK, et al. . (2007) Gulf Coast ticks

(Amblyomma maculatum) and Rickettsia parkeri, United States. . Emerg Infect Dis.

Takano A., Ando S., Kishimoto T., Fujita H., Kadosaka T., Nitta Y., Kawabata H., Watanabe H. (2009)

Presence of a novel Ehrlichia sp in Ixodes granulatus found in Okinawa, Japan. Microbiology and

Immunology 53:101-106. DOI: 10.1111/j.1348-0421.2008.00093.x.

Tempelis C.H. (1975) Host-feeding patterns of mosquitoes, with a review of advances in analysis of

blood meals by serology. J Med Entomol 11:635-53.

Varela A.S., Luttrell M.P., Howerth E.W., Moore V.A., Davidson W.R., Stallknecht D.E., Little S.E.

(2004) First culture isolation of Borrelia lonestari, putative agent of southern tick-associated rash

illness. J Clin Microbiol 42:1163-9.

Wilson M.L. (1993) Avermectins in arthropod vector management - prospects and pitfalls. Parasitol

Today 9:83-7. DOI: 0169-4758(93)90210-7 [pii].

Yabsley M.J., Loftis A.D., Little S.E. (2008) Natural and experimental infection of white-tailed deer

(Odocoileus virginianus) from the United States with an Ehrlichia sp closely related to Ehrlichia

ruminantium. Journal of Wildlife Diseases 44:381-387.

Yabsley M.J., Davidson W.R., Stallknecht D.E., Varela A.S., Swift P.K., Devos J.C., Jr., Dubay S.A.

(2005) Evidence of tick-borne organisms in mule deer (Odocoileus hemionus) from the western

United States. Vector Borne Zoonotic Dis 5:351-62.

Zhang X.Z., Meltzer M.I., Pena C.A., Hopkins A.B., Wroth L., Fix A.D. (2006) Economic impact of

Lyme disease. Emerging Infectious Diseases 12:653-660.

70

Zhioua E., Browning M., Johnson P.W., Ginsberg H.S., LeBrun R.A. (1997) Pathogenicity of the

entomopathogenic fungus Metarhizium anisopliae (Deuteromycetes) to Ixodes scapularis (Acari:

Ixodidae). J Parasitol 83:815-8.

71

APPENDICES

72

4.4 Appendix 1: Resident awareness and concern about tick-borne disease at the site of

a previous ehrlichiosis outbreak

4.4.1 Introduction

Our study site is a golf-oriented retirement community located in the Cumberland Plateau

of Tennessee. In 1993, four men at the study site came down with symptoms consistent with

Human Monocytic Ehrlichiosis, a tick-borne disease transmitted by the bite of the Amblyomma

americanum tick. These cases prompted a CDC outbreak investigation and led community

managers to attempt mitigation of ticks feeding on deer. In recent years, management officials

and health care professionals have voiced concern over increased reports of tick-borne disease in

the community. Previous studies have found that a high level of concern about being bitten by

ticks is strongly associated with the use of preventive measures (Herrington, 2004).

Additionally, precautionary behavior has been correlated to the perception that the benefits of

prevention outweigh inconvenience as well as certainty about one‘s ability to find attached ticks

(Shadick et al., 1997). This questionnaire survey sought to determine residents‘ perceived level

of concern about tick and tick-borne disease risk in the community through a voluntary

questionnaire survey.

4.4.2 Methods

A short survey was conducted at the retirement community during the study period to

determine resident knowledge of, concern about, and level of exposure to, tick borne diseases.

Paper questionnaires were made available in the community center for pick-up on a voluntary

basis (Fig. 5.2 and 5.3). Residents were instructed to complete only one survey per person per

household. Completed questionnaires were returned to a locked box at the community center

73

where they were retrieved every second week by the principal investigator. Consent forms were

obtained for all questionnaire participants (Fig. 5.1) allowing respondents the option to

participate in a follow-up phone interview. Responses were analyzed using Epi Info software

(Centers for Disease Control, Atlanta, GA).

4.4.3 Results and Discussion

We received fifty-three responses to the questionnaire, all but one respondent are

permanent residents and twenty-eight reported having a rash or other illness associated with a

tick bite obtained in the retirement community. Seventy-eight percent of respondents who

reported a tick-bite associated illness also consider themselves avid golfers, and 89% walk or

hike regularly compared to 42% that boat or swim and 10% that play tennis (activities that are

associated with lower risk of exposure to ticks). Eighty-five percent of those reporting illnesses

subsequently sought medical advice. Nearly all participants expressed medium to high concern

about ticks and tick-borne disease and all reported seeing deer within 100m of their residences.

Sixty-three percent of respondents always checked for ticks after being outdoors and forty-two

percent reported usually wearing some form of repellant when going outside. The most

commonly utilized repellant was Deep Woods Off® for which DEET is the active ingredient.

Responses to the resident questionnaire indicate a high level of concern about ticks and

tick-borne disease in the retirement community. It is likely that the residents who chose to

respond to this survey are also those who have a particular interest in the subject, a fact that may

be represented by the high percentage of respondents who reported having tick bites associated

with rash or illness. Residents who have little to no concern about ticks and tick-borne disease

may be more likely to be indifferent about responding to this opportunistic questionnaire.

74

Response rates for residents of various levels of interest in the topic may have been higher had

individual questionnaires and follow ups been mailed to or directly delivered to residents.

Nonetheless, residents who did participate still represent high levels of concern among at least a

portion of people in the community.

All residents reported seeing deer within 100m of their households and several

commented that they have neighbors who routinely feed deer in their back yards. While many

residents report practicing methods to protect themselves from ticks and tick-borne disease, i.e.

using repellants and performing tick checks, some also attracted wildlife species into human

inhabited areas through feeding. It is important that community managers are vigilant in

educating the residents about the risk they incur when baiting wildlife species, particularly those

that are known to have high tick infestation rates. This resident behavior could also result in

fewer deer visiting ‗4-poster‘ acaricide applicators, effectively reducing the ability of those

devices to manage the ticks and tick-borne disease in this area.

Most respondents who reported using repellants when participating in outdoor activities

describe using a products containing DEET. DEET is arguably the most accessible insect

repellant, as it can be found in nearly any convenience store. However, DEET has been shown to

have very little efficacy against A. americanum nymphs, with only 25% of A. americanum

repelled (Carroll et al., 2004). Efforts are needed in publicizing the availability of alternative

repellant options, such as Permethrin, that are more effective against hard ticks.

While it is clear that at least a subset of the residents are knowledgeable and concerned

about the risk of ticks and tick-borne disease in this community, the low response rate to a tick

75

related questionnaire may represent apathy about the subject in other members of the

community. A relatively easy way to continue education of residents about ticks would be to

distribute flyers one to two times per year with tick and tick-borne disease information of

relevance along with the monthly community newsletter. This education method does not require

individuals to seek out the information in their community, as it is consistently delivered to their

door. Continued follow-up questionnaires after education campaigns could provide confirmation

of increased awareness about risk factors in this community.

76

Figure 5.1.1 Resident questionnaire consent form

77

Figure 5.1.2 Page one of questionnaire distributed to residents of the retirement community

78

Figure 5.1.3 Page two of questionnaire distributed to residents of the retirement

community

79

Appendix 3.2: Tick DNA Extraction Protocol

Modified from: Qiagen DNeasy Blood and Tissue Handbook: Protocol: Purification of Total

DNA from Animal Tissues (Spin-Column Protocol) Catalog No. 69506

Tick Prep:

1. Remove ticks from identification/measurement vials and blot dry on a Kimwipe.

2. Zero a clean 1.5ml centrifuge tube, labeled with extraction identification number.

3. Place 1 tick per vial and recorded tick extraction ID and weight.

4. Include 1 positive and 1 negative control tick per batch.

Phase 1- Lysis:

1. Turn on incubator and set to 56˚C. Put beaker for ATL/Pro-K solution and ATL solution in

incubator to warm.

2. Place each individual tick/vial into liquid Nitrogen without submerging the vial.

3. Use a pestle to pop and grind the tick in the vial. Leave the pestle in the vial until after the

lysis buffer has been added.*

4. Create a master mix of lysis solution. (180μL of Buffer ATL and 20μL Pro-K per sample).

Prepare enough for 5% extra ticks due to loss from transfer.

5. When samples have warmed (room temp), add 200μL of Buffer ATL and Pro-K solution to

each 1.5ml microcentrifuge tube.** Be careful not to shoot tick particles out of vial. This

can be prevented by directing the pipette tip to the side of the vial instead of straight

down.

6. Mix thoroughly by vortexing for 5-15 seconds and incubate at 56˚C overnight, rocking. Make

certain no tick pieces are stuck to the vial where the lysis buffer can‗t reach.

*Use a clean scalpel to position the tick for cutting within its vial if the tick does not pop with

liquid N2. Cut tick into several (at least 4) pieces, with attention to cutting open the

midgut.

** 20μl of additional ATL/pro-K can be added to large engorged ticks until the tick is

completely submerged.

80

Phase 2- Extraction

1. Place enough Buffer AE (provided) for final elution to 70˚C. (100ul per sample)

2. Pre-label 1 set of spin-columns and 2 sets of 1.5ml centrifuge tubes with final extraction ID.

3. Create a master mix of 200μl Buffer AL (provided) and 200μl of EtOH (95%-100%) per

sample.

4. Remove samples from incubator and vortex for 15 seconds

5. Add 400μl of Buffer AL/EtOH master mix to each sample and mix again thoroughly by

vortexing.

6. Pipette the sample mixture from step 5 (including any precipitate) in the corresponding spin-

column.

7. Centrifuge each spin-column at ≥6,000 x g (8,000rpm) for 1 min. Discard flow through

collection tube and place in a clean collection tube.

8. Add 500μl of Buffer AW1 and centrifuge at ≥6,000 x g (8,000rpm) for 1 min. Discard flow

through collection tube and place in a clean collection tube.

9. Add 500μl of Buffer AW2 and centrifuge at 20,000 x g (14,000rpm) for 3 min. Discard

flow through collection tube and place spin-column in the corresponding (final) 1.5

microcentrifuge tube. Incubate at 45˚C for 10 minutes.

10. Pipette 50μl of Buffer AE directly onto the spin-column membrane. Incubate at room

temperature for 10 min.

11. Centrifuge each sample at ≥6,000 x g (8,000rpm) for 1 min to elute.

12. Place spin-column in the second labeled microcentrifuge tube and repeat step 10.

13. Ensure all microcentrifuge tubes are properly labeled (elution 1 or 2, place a cardboard box

and stored in the freezer.

81

4.5 Amplification of Ehrlichia sp. GroEL operon fragment (Takano et al., 2009)

Nested PCR Primer sequences:

GRO607F - Primary forward GAA GAT GCW GTW GGW TGT ACK GC

GRO1294R - Primary reverse AGM GCT TCW CCT TCW ACR TCY TC

GRO677F - Nested forward ATT ACT CAG AGT GCT TCT CAR TG

GRO1121R - Nested reverse TGC ATA CCR TCA GTY TTT TCA AC

Amplification conditions:

Denaturation 5 min @ 95C

Denaturation 30 sec @ 95C

Annealing 30 sec @ 57C 40 cycles for primary PCR; 30-35 cycles for nested PCR

Elongation 30 sec @ 72C

Final elongation 3 min @ 72C

Starting DNA quantity 4 ul for primary PCR, 1-2 ul for nested PCR

82

1. For each reaction, add the following to a tube containing a PCR bead: Note: Do not mix the

tube contents until all the components (below) have been added to the tube containing the bead.

Forward 5pmol/μl 5μl

Reverse 5pmol/μl 5μl

Template DNA* 4 μl for primary 2 μl for nested

Water final volume of 25 μl 11 μl for primary 13 μl for nested

*Start with 50 pg for a simple template such as plasmid DNA, or 50 ng for a complex template

such as genomic DNA. Avoid template amounts > 1 μg. Sterile high-quality water

2. Snap the caps (provided) onto the tubes, pushing down firmly to ensure a tight fit. Mix the

tube contents by gently flicking the tube with a finger. Vortex gently and then centrifuge the tube

for a few seconds to bring the components to the bottom of the tube. The reaction is fully

dissolved and mixed when it appears clear.

3. Place the reaction mixtures on ice or in a cold block until ready for cycling. Minimize the

time on ice prior to cycling to prevent formation of background reaction products.

83

4.6 Appendix 3.3: Ehrlichia spp. PCR Protocol

Outer Ehrlichia PCR Primers Tm=about 53°c

16s forward (2) Ehrlichia outer(Cathy)-GCAAGCYTAACACATGCAAG

16s reverse Erhrlichia outer(Cathy)-GGGCAGTGTGTACAAGAC

Dilute primers to 10uM or 10pMoles/ µl - Add 10mM Tris to the concentration in nMoles on the

IDT sheet for stock concentration of 1nMol/ µl or 1mM. Dilute to 10pMoles/µl in Water.

Assemble an amount of FailSafe Master Mix corresponding to the total number

of reactions. Extra Master Mix may be required to offset losses caused by pipeting.

1. Prepare the FailSafe Master Mix. Thaw and thoroughly mix all of the reagents listed

below before dispensing; place on ice. Combine on ice, all of the following:

25 µl of E FailSafe PCR 2X PreMix

17.5 µl sterile water

1.0 µl 10 µM primer 1 (0.2 µM final concentration)

1.0 µl 10 µM primer 2 (0.2 µM final concentration)

0.5 µl FailSafe PCR Enzyme Mix (1.25 Units)

45 µl Total volume

2. Add 5 µl DNA Template to each tube (extracted using Qiagen DNeasy tissue kit) into

individual wells, using extraction controls as well as PCR controls (5 µl previously-

positive extract no-template control (NTC) for negative). Total Reaction volume 50 µl.

PCR Ehrlichia 1

a. 1 cycle as follows:

i. Denature: 2min at 95C

b. 10 touch down cycles annealing temper lowered by 1C each cycle

i. Denature: 20 sec at 94C

ii. Anneal: 30 sec at 60C

iii. Extend: 90 sec at 72C

c. 20 cycles

i. Denature: 20 sec at 94C

ii. Anneal: 30 sec at 52C

iii. Extend: 90 sec at 72C

d. Final extension: 7 min at 72C

e. 4C∞

84

Inner Species specific PCR primers (Stromdahl et al., 2000; Yabsley et al., 2005)- Dilute to 5

µM

HE1 E.chaffeensis(2nd)16SrRNA forward HE1 Anderson et al. (1992) (Anderson et al., 1992b)

CAATTGCTTATAACCTTTTGGTTATAAAT

HE3 E.chaffeensiiandE.ewingii(2nd)16SrRNAreverse HE3 Anderson et al. (1992)

TATAGGTACCGTCATTATCTTCCCTAT

EE5 E ewingii forward Oklahoma coyoteEE5 (Kocan et al., 2000)

CAATTCCTAAATAGTCTCTGACTATTTAG

Two separate reactions one containing HE1+ HE3 and another with HE3 +EE5.

1. Prepare the FailSafe Master Mix. Thaw and thoroughly mix all of the reagents listed

below before dispensing; place on ice. Combine on ice, all of the following:

12.5 µl of E FailSafe PCR 2X PreMix

8.25 µl sterile water

1.0 µl 5 µM primer 1 (0.2 µM final concentration)

1.0 µl 5 µM primer 2 (0.2 µM final concentration)

0.25 µl FailSafe PCR Enzyme Mix (0.75 Units)

23 µl Total volume

2. Add 2 µl of reaction from PCR I.

PCR Ehrlichia II

a. 1 cycle as follows:

Denature: 2min at 95C

b. 10 touch down cycles annealing temper lowered by 1C each cycle

i. Denature: 20 sec at 94C

ii. Anneal: 30 sec at 60C

iii. Extend: 30 sec at 72C

c. 20 cycles for Tick (20 for vertebrate DNA) as follows:

iv. Denature: 20 sec at 94C

v. Anneal: 30 sec at 50C

vi. Extend: 30 sec at 72C

d. Final extension: 7 min at 72C

e. 4C∞

3. Store samples at 4C until prepared for QIAxcel or gel electrophoresis

85

Outer 16s all bacteria primers from (Clay et al., 2008; Marchesi et al., 1998) modified to include

Ehrlichia.

16sall 63f CAGGCCTAACACATGCAAGTC

16sallrv (reverse compliment) 1387r GCCTTGTACACWCCGCCC

References

1. Yabsley, M.J., et al., Evidence of tick-borne organisms in mule deer (Odocoileus

hemionus) from the western United States. Vector Borne Zoonotic Dis, 2005. 5(4): p.

351-62.

2. Stromdahl, E.Y., et al., Ehrlichia chaffeensis (Rickettsiales: Ehrlichieae) infection in

Amblyomma americanum (Acari: Ixodidae) at Aberdeen Proving Ground, Maryland. J

Med Entomol, 2000. 37(3): p. 349-56.

3. Anderson, B.E., et al., Detection of the etiologic agent of human ehrlichiosis by

polymerase chain reaction. J Clin Microbiol, 1992. 30(4): p. 775-80.

4. Kocan, A.A., et al., Naturally occurring Ehrlichia chaffeensis infection in coyotes from

Oklahoma. Emerg Infect Dis, 2000. 6(5): p. 477-80.

5. Clay, K., et al., Microbial communities and interactions in the lone star tick, Amblyomma

americanum. Mol Ecol, 2008. 17(19): p. 4371-81.

6. Marchesi, J.R., et al., Design and Evaluation of Useful Bacterium-Specific PCR Primers

That Amplify Genes Coding for Bacterial 16S rRNA. Appl Environ Microbiol, 1998.

64(6): p. 2333.

86

4.7 Appendix 3.4: Panola Mountain Ehrlichia PCR Protocol (Loftis et al., 2006)

Amplification of Panola Mountain Ehrlichia sp. gltA (citrate synthase) gene

Nested PCR

Primer sequences:

Ehr3CS-185F-Primary forward GCC ACC GCA GAT AGT TAG GGA

Ehr3CS-777R-Primary reverse TTC GTG CTC GTG GAT CAT AGT TTT

Amplification conditions:

Denaturation 3 min @ 95C

Denaturation 30 sec @ 95C

Annealing 30 sec @ 55C 40 cycles

Elongation 60 sec @ 72C

Final elongation 5 min @ 72C

Primer sequences

Ehr3CS-214F-Nested forward TGT CAT TTC CAC AGC ATT CTC ATC

Ehr3CS-619R-Nested reverse TGA GCT GGT CCC CAC AAA GTT

87

Amplification conditions:

Denaturation 3 min @ 95C

Denaturation 30 sec @ 95C

Annealing 30 sec @ 60C 40 cycles

Elongation 60 sec @ 72C

Final elongation 5 min @ 72C

Starting DNA quantity 4 ul for primary PCR, 1-2 ul for nested PCR

1. For each reaction, add the following to a tube containing a PCR bead: Note: Do not mix the

tube contents until all the components (below) have been added to the tube containing the

bead.

Forward 5pmol/μl 2.5μl

Reverse 5pmol/μl 2.5μl

Template DNA* 4 μl for primary 2 μl for nested

Water final volume of 25 μl 13.5 μl for primary 15.5 μl for nested

88

*Start with 50 pg for a simple template such as plasmid DNA, or 50 ng for a complex template

such as genomic DNA. Avoid template amounts > 1 μg. Sterile high-quality water

2. Snap the caps (provided) onto the tubes, pushing down firmly to ensure a tight fit. Mix the

tube contents by gently flicking the tube with a finger. Vortex gently and then centrifuge the tube

for a few seconds to bring the components to the bottom of the tube. The reaction is fully

dissolved and mixed when it appears clear.

3. Place the reaction mixtures on ice or in a cold block until ready for cycling. Minimize the

time on ice prior to cycling to prevent formation of background reaction products.

89

4.8 Appendix 3.5: DNA Purification Protocol

Modified from: Zymoclean Gel DNA Recovery Kit (Catalog No. D4001)

Materials Needed:

1.5μl Microcentrifuge tubes—weighed and final set for purified sample

Autoclaved (sterile) pure water (heated to 55C)

Razor blades

Sample Prep:

1. Weigh clean, dry, 1.5μl microcentrifuge tubes (number of samples to be excised)

2. Turn on hot plate to 55C

Purification:

1. Excise DNA fragments from the gel using a new razor blade or scalpel for each sample and

transfer samples to corresponding weighed microcentrifuge tube.

**Make sure to make the excision as precise as possible and to cut out as little gel as possible.**

2. Weigh microcentrifuge tubes and subtract original tube weight to obtain sample weight.

3. Add 3 volumes of ADB to each volume of agarose excised from the gel (i.e. for every 100μl

of gel, add 300μl of ADB)

4. Incubate at 55C for 5 to 10 minutes or until the gel is completely dissolved

5. Transfer the melted agarose solution to a Zymo-Spin I column in a collection tube

6. Centrifuge at ≥10,000 x g for 60 seconds. Discard flow-through and place in a new collection

tube

7. Add 200μl of Wash Buffer to the column and centrifuge at ≥10,000 x g for 30 seconds.

Discard flow through and place in a new collection tube.

8. Repeat step 7.

9. Spin samples for 30 seconds at ≥10,000 x g to remove any additional liquid. Discard

collection tube and place into final 1.5μl microcentrifuge labeled with sample name.

10. Add 20μl of sterile pure water to the column and incubate at room temperature for 1 minute.

11. Spin at ≥10,000 x g for 60 seconds to elute DNA.

12. Discard minicolumn and store sample at -20C or prepare for sequencing.

90

4.9 Appendix 3.6: RLB bloodmeal analysis Protocol

Physically separate areas for DNA extraction, preparationof reagents (including PCR master

mix) and storage, PC,post-PCR and RLB, to minimize contamination.

REAGENTS

Streptavidin-peroxidase conjugate

ECL chemiluminescence blotting substrate

Saline Sodium Phosphate–EDTA buffer (SSPE) NaCl–NaHPO4–EDTA

(BOWN) SSPE 20x for RLB store at rt for up to 1 year –more NaCl for specificity

Clear

Conc. Stock 1L

NaCl 3.6M

58.44g/M

210.24g

Na2HPO4

x2H2O

X7H2O

200mM 178.0g/M

268.2

35.6g

53.64g Only need one

EDTA (not sodium salt) 20mM 292.23g/M 5.84g

H2O mQ 800ml

adjust pH 7.4 by 10N NaOH. QS to 1L

SDS CRITICAL- SDS is a critical reagent. Some brands of ‗purity analysis‘ (p.a.) grade SDS

may destroy the signal on the blot or yield a completely black image of the membrane on the X-

ray. All reagents should be used before their expiry dates to ensure optimal performance.

10% (w/v) SDS! CAUTION Take great care when preparing SDS stock solution from powder,

which is corrosive—use a mask and an exhaust fan to prevent breathing in powder and do not

allow the solution to come into contact with the skin or eyes. In case of accidental splashing,

wash immediately with water.

1% SDS m CRITICAL Must be freshly prepared and used within a few hours.

16% (w/v) EDAC m CRITICAL Must be freshly prepared and used within a few hours.

0.1 M NaOH

0.5 M NaHCO3 (pH 8.4)

0.5 mM EDTA (pH 8.0)

20 mM EDTA

2x SSPE

2x SSPE/0.1% SDS

91

2x SSPE/0.5% SDS m CRITICAL For buffers 8–10, SSPE buffers with or without SDS should

be freshly prepared.

EQUIPMENT

Transparency film (Corporate Express, cat. no. 39547000)

Miniblotter (Immunetics, cat. no. MN100-45)

Foam cushions (Immunetics, cat. no. PC200)

Hybridization oven, rolling bottle

Rocking platform (Model: Belly Dancer, Pegasus Scientific, Inc.)

Imager or X-ray film exposure cassette (Sigma-Aldrich, cat. no. Z36,009-0) Film cartridge,X-ray

film developer

PCR

II. Take out all PCR components to thaw including template DNA (keep Taq DNA

polymerase on ice).

III. Prepare a mastermix. Using Invitrogen Taq DNA polymerase and primers.

Standardize primers such that 1uL contains 40pmol/µl.

New 2010 American 12s forward- 5‘ CTR GGA TTA GAT ACC CYA CTA TG-3‘

New 2010 American 12s reverse biotin- 5‘Biotin-ATT AYA GRA CAG GCT CCT

CTA-3‘

IV. Combine the mastermix reagents in order in a multi-channel pipettor boat. Mix

thoroughly. Using a multi-channel pipettor set to 30uL for tick or 45uL for

vertebrate, fill the appropriate number of well strips on ice. Account for number of

samples and controls plus a ~5% error buffer.

Example- 43 samples, then calculate for 45:

Taq DNA polymerase : 0.25 x 45 = 11.25µL

RV primer: 1 x 45 = 45µL

45reactions µl/Each Rxn

225 5.0 10x PCR buffer Qiagen

1293.75 28.75 Autoclaved milli-Q water

45 1.0 dNTP mixture 10mM

45 1.0 primer FW 40pmol/ul

45 1.0 primer RV 40pmol/ul

135 3.0 25mM MgCl2

11.25 0.25 Taq DNA polymerase Qiagen

add DNA template to each tube

10.0 DNA

50 total Rxn

92

V. Mix in 10uL (Carbone et al.) or 5ul (vertebrate) of each sample DNA (extracted using

Qiagen DNeasy tissue kit) into individual wells, using extraction controls as well as

PCR controls (no-template control (NTC) for negative).

VI. Run PCR program on thermocycler as follows:

Touch down PCR

a. Initial denature: 3 min at 94C,

b. 1 cycle as follows:

i. Denature: 20 sec at 94C

ii. Anneal: 30 sec at 65C

iii. Extend: 30 sec at 72C

c. 8 touch down cycles annealing temper lowered by 1C each cycle

i. Denature: 20 sec at 94C

ii. Anneal: 30 sec at 65C

iii. Extend: 30 sec at 72C

d. 30 cycles for Tick (20 for vertebrate DNA) as follows:

i. Denature: 20 sec at 94C

ii. Anneal: 30 sec at 53C

iii. Extend: 30 sec at 72C

e. Final extension: 7 min at 72C

f. 4C∞

VII. Store samples at 4C until prepared for hybridization on blot. 20C long term storage

Check mPCR result using gel electrophoresis (optional) or Qia-Axcel.

Covalent coupling of oligonucleotide probes to the membrane TIMING 3–4 h

Set Belly Dancer to 60⁰C – warm 2x SSPE/0.1% SDS

16% EDAC = 3.2g EDAC in 20 mL water

2x SSPE/0.1% SDS = 445 mL water + 50 mL SSPE + 5 mL SDS (ADD WATER FIRST!!)

2x SSPE = 50 mL SSPE in 450 mL water

1. Dilute the oligonucleotides in water to their optimal concentrations, ranging from

approximately 100-1000pmol (Cadenas et al., 2007; Humair et al., 2007b) add 10µl to

180 µl 0.5 M NaHCO3 (pH 8.4).

-Stock concentration 100pmol/µl- IDT sheet has original concentration in nMoles

-Working concentration 100-1000pmol (look at probe layout sheet). We want to

add 10µl so the working concentration will be /10. For example --horses

200pmol you want to make a 20pmol/µl working concentration, so you would

dilute the stock 1 to 5 in water.

93

CRITICAL STEP Make sure all required buffers for steps are warmed and incubators prepared

before starting the following procedures.

2. Cut the Biodyne C membrane to 15 cm2 size.

3. Fold one corner to help hold membrane during manipulation, write membrane identifier

along side in pencil for orientation.

4. Activate the Biodyne C membrane in a sealed plastic bag with 15 min incubation in 20

ml of freshly prepared 16% (w/v) EDAC, on a rocking platform, at room temperature

25°C.

CRITICAL STEP EDAC allows amine-labeled probes to bind covalently to the nylon

membrane. It is important that the 16% (w/v) EDAC is prepared just before use. (3.2g EDAC in

20 ml water)

5. Rinse the membrane with 250 ml milliQ water and place it on a support cushion in the

clean Miniblotter. Tighten the screws manually.

6. Remove residual fluid from the slots by aspiration.

7. Fill the slots of the Miniblotter with 170 ml of each of the diluted oligonucleotide

solutions.

8. The first and the last slots are filled with red and blue dye to allow for blot orientation.

CRITICAL STEP It is essential to avoid the formation of air bubbles in the slots because they

can cause loss of hybridization signal.

9. Incubate for 5 min at room temperature. Do not rock or shake the Miniblotter in this

step.

10. Remove excess oligonucleotide probe solutions by aspiration.

11. Remove the membrane from the Miniblotter and incubate it in 250 ml 0.1 M NaOH for 9

min on rocking platform to inactivate the membrane

CRITICAL STEP It is critical that incubation in 0.1 M NaOH be no longer than 10 min.

12. Briefly wash the membrane in a plastic container on the rocking platform in 250 ml 2x

SSPE, then incubate in 250 ml prewarmed 2x SSPE/0.1% SDS for 5 min at 60°C in

hybridization oven with rocking.

94

PAUSE POINT If the membrane is to be stored at this point, wash it in a plastic container on the

rocking platform in 250 ml 20 mM EDTA for 20 min at room temperature.

Seal it in a plastic sleeve containing about 10 ml 20 mM EDTA to avoid dehydration and store at

4⁰C until use. The properly labeled and sealed membranes can be kept for several years at 4⁰C

until use (proceed to Step 24).

CRITICAL STEP Make sure the membranes are properly sealed and stored; dehydration will

render them useless for further hybridization assays.

Hybridization and detection of PCR products TIMING About 5h

Heat tube block above 100⁰C; get ice for denaturation

Heat Belly Dancer to 60⁰C – warm 2x SSPE/ 0.1% SDS

Heat oven to 42⁰C and 55⁰C. Warm miniblotter in 55⁰C

2x SSPE/ 0.1% SDS = 222.5 mL water + 25 mL SSPE + 2.5 mL SDS (ADD WATER

FIRST!!)

2x SSPE/0.5% SDS = 850 mL water + 100 mL SSPE + 50 mL SDS (ADD WATER FIRST!!)

2x SSPE= 50 mL SSPE in 450 mL water

1. Prepare test samples by adding 10µl PCR products to 2x SSPE/0.1% SDS to obtain a

total volume of 190 ml. (The optimal concentration of SDS in the hybridization buffer

varies between 0.1 and 0.5% and should be determined experimentally. In our

experience, 0.1% SDS has been suitable for all assays. (0.1 SDS (Humair et al., 2007b))

2. Heat-denature the test samples in boiling water for 10 min--VORTEX and cool on ice

immediately for at least 5 min VORTEX. Vortexing periodically will insure strand

separation!

3. Block membrane for 7 minutes in Casein. Incubate the membrane in 250 ml prewarmed

2x SSPE/0.1% SDS in a plastic container for 5 min in a 62°C hybridization oven with

rocking.

4. Place the membrane in the Miniblotter on a support cushion, such that the slots are

perpendicular to the previously applied oligonucleotides.

5. Close the Miniblotter and remove residual fluid from the slots by aspiration. Fill the slots

with 170 ml of diluted PCR product whilst avoiding air bubbles and overloading. Any

empty slots should be filled with 150 ml 2x SSPE/0.1% SDS to prevent the membrane

from drying out and to prevent cross-flow between channels due to capillary action, ink

slots should be used for orientation.

CRITICAL STEP It is essential to avoid the formation of air bubbles in the slots because they

can cause loss of hybridization signal.

95

6. Hybridize for 30 minutes at 75°C then 60 min at 55°C on horizontal surface. Avoid

shaking the Miniblotter in this step to prevent cross-flow to the neighboring slots.

7. Remove excess PCR products by aspiration- wash 2-3x with 2x SSPE/0.5% SDS while

still in the miniblotter! Remove the membrane from the Miniblotter.

8. Wash the membrane twice in 250 ml prewarmed 2x SSPE/0.5% SDS for 10 min in a

62°C (Humair et al., 2007b) hybridization oven with rocking. Turn oven down to 42⁰.

9. During wash mix 15µl neutravidin in 50 ml prewarmed 2x SSPE/0.5% SDS. (1:4000)

10. Place the membrane onto streptavidin- peroxidase conjugate Tupperware container

incubate with constant mixing for 45–60 min at 42°C

11. Wash the membrane 2x in 250 ml prewarmed 2x SSPE/ 0.5% SDS for 10 min in a 42°C

hybridization oven with rocking. Use dedicated plastic containers. If stripping

membrane – turn belly dancer up to 75⁰C.

12. Wash the membrane 2x in 250 ml 2x SSPE for 5 min at room temperature on the rocking

platform.

13. For chemiluminescent detection, incubate the membrane in 20 ml

electrochemiluminescence (ECL) detection liquid (10 ml of each of detection reagents 1

and 2), to cover the membrane, for about 2 min, while gently rocking the solution by

hand.

14. Place membrane in a film cartridge between two overhead transparency sheets and

expose an X-ray film to the membrane for 5–30 min. If the signal is too weak or too

strong, the membrane can be used again directly to expose another film for a longer or

shorter period. However, it should be noted that the peak of light emission occurs 1 min

after incubation with the ECL substrate. After that the signal rapidly diminishes and

prolonged exposure may be required to obtain a significant signal. Therefore in the initial

stage of a new project, we recommend exposing two X-ray films for different periods to

determine the optimal exposure time

CRITICAL STEP Step 14 should be performed in a dark chamber or dark room.

Stripping of the membrane for reuse TIMING 1.25 h

Heat Belly Dancer to 75⁰C – microwave 1% SDS until bubbly

1% SDS = 50mL 10% SDS in 450 mL water

20mM EDTA = 100mL 100mM EDTA in 400 mL water

96

1. Wash the membrane twice in prewarmed 1% SDS at 80°C for 30 min with rocking.

2. Wash the membrane in 20 mM EDTA, for 15 min at room temperature on the rocking

platform.

3. Seal the membrane in a plastic bag with approximately 10 ml of 20 mM EDTA to avoid

dehydration.

4. Store at 4°C until reuse.(Cadenas et al., 2007; Kong and Gilbert, 2006; Rijpkema et al.,

1995)

Cadenas, F. M., O. Rais, F. Jouda, V. Douet, P. F. Humair, J. Moret, and L. Gern. 2007. Phenology of Ixodes ricinus and infection with Borrelia burgdorferi sensu lato along a

north- and south-facing altitudinal gradient on Chaumont Mountain, Switzerland. J Med

Entomol 44: 683-93.

Humair, P. F., V. Douet, F. M. Cadenas, L. M. Schouls, I. Van De Pol, and L. Gern. 2007. Molecular identification of bloodmeal source in Ixodes ricinus ticks using 12S rDNA as a

genetic marker. J Med Entomol 44: 869-80.

Kong, F., and G. L. Gilbert. 2006. Multiplex PCR-based reverse line blot hybridization assay

(mPCR/RLB)--a practical epidemiological and diagnostic tool. Nat Protoc 1: 2668-80.

Rijpkema, S. G., M. J. Molkenboer, L. M. Schouls, F. Jongejan, and J. F. Schellekens.

1995. Simultaneous detection and genotyping of three genomic groups of Borrelia

burgdorferi sensu lato in Dutch Ixodes ricinus ticks by characterization of the amplified

intergenic spacer region between 5S and 23S rRNA genes. J Clin Microbiol 33: 3091-5.

97

VITA

Jessica Harmon is originally from Germantown, TN. She earned her Bachelor of

Science degree in Animal Science with a specialization in Science and Technology at the

University of Tennessee, Knoxville. Her interest in wildlife research was peaked when

she participated in the Minority Health International Research Training (MHIRT)

program which sent her to Brazil to partake in a study on the effects of landscape

fragmentation on the carnivore species of Emas National Park. Prior to beginning

graduate school, she worked as a field and lab technician in the Center for Wildlife

Health lab at the University of Tennessee investigating the maintenance of Lyme Disease

and Ixodes scapularis in Tennessee. Jessica completed her Master of Science in

Entomology and Plant Pathology at the University of Tennessee, Knoxville in December

2010.