MAI MUUTTUNUT PILU MULUT MOONHITI

MAI MUUTTUNUT PILU MULUT MOONHITI US009943555B2

( 12 ) United States Patent Falb et al .

( 10 ) Patent No . : US 9 , 943 , 555 B2 ( 45 ) Date of Patent : * Apr . 17 , 2018

( 54 ) BACTERIA ENGINEERED TO REDUCE HYPERPHENYLALANINEMIA

2014 / 0079701 Al 2015 / 0238545 A1 2015 / 0359894 Al

3 / 2014 Miller et al . 8 / 2015 Borody

12 / 2015 Weinrich et al . ( 71 ) Applicant : Synlogic , Inc . , Cambridge , MA ( US ) FOREIGN PATENT DOCUMENTS ( 72 ) Inventors : Dean Falb , Sherborn , MA ( US ) ;

Vincent M . Isabella , Cambridge , MA ( US ) ; Jonathan W . Kotula , Somerville , MA ( US ) ; Paul F . Miller , Salem , CT ( US ) ; Yves Millet , Newton , MA ( US ) ; Sarah Rowe , Somerville , MA ( US )

CN WO WO WO WO WO WO WO

1154845 A WO 2009 / 004595 A2 WO 2013 / 192543 A2 WO 2014 / 018832 A1 WO 2014 / 066945 Al WO 2014 / 138324 AL WO 2016 / 183532 AL WO 2016 / 210373 A2

7 / 1997 1 / 2009

12 / 2013 1 / 2014 5 / 2014 9 / 2014 11 / 2016 12 / 2016 ( 73 ) Assignee : Synlogic , Inc . , Cambridge , MA ( US )

OTHER PUBLICATIONS ( * ) Notice : Subject to any disclaimer , the term of this patent is extended or adjusted under 35 U . S . C . 154 ( b ) by 0 days . This patent is subject to a terminal dis claimer .

( 21 ) Appl . No . : 15 / 260 , 211

( 22 ) Filed : Sep . 8 , 2016

( 65 ) Prior Publication Data US 2017 / 0014457 A1 Jan . 19 , 2017

Related U . S . Application Data ( 63 ) Continuation of application No . 15 / 154 , 934 , filed on

May 13 , 2016 . ( 60 ) Provisional application No . 62 / 161 , 137 , filed on May

13 , 2015 , provisional application No . 62 / 256 , 052 , filed on Nov . 16 , 2015 .

Coban et al Screening of phenylpyruvic acid producers and opti mization of culture conditions in bench scale bioreactors Bioprocess Biosyst Eng ( 2014 ) 37 : 2343 - 2352 . * Xingyuan et al . 2000 New Strategeutics of Gene Therapy for Hyperphenylalaninemia Rats Beijing Red - Cross Chaoyang Hospi tal , Capital University of Medical Sciences Beijing , 100020 ; China . Translation . * Xingyuan et al . , A new strategeutics of gene therapy for hyperphenylalaninemia rats , Beijing Red Cross Chaoyang Hospital , Capital University of Medical Sciences Beijing , 100020 China Abstract . * IMarbach et al ac operon induction in Escherichia coli : Systematic comparison of IPTG and TMG induction and influence of the transacetylase LacA Journal of Biotechnology 157 ( 2012 ) 82 - 88 . * Chen et al High - level Expression of Phenylalanine Ammonia - lyase in Lactococcus lactis via Synthesized Sequence Based on Bias Codons Chinese Journal of Biotechnology , Mar . 2006 , vol . 22 , No . 2 , pp . 187 - 190 ( translation ) . * Pascalle et al Controlled Gene Expression Systems for Lactococcus lactis with the Food - Grade Inducer Nisin Applied and Environmen tal Microbiology , Oct . 1996 , p . 3662 - 3667 . * Folling et al The discovery of phenylketonuria Acta Paldlatr Suppl 407 : 4 - 10 . 1994 . * Xingyuan et al . A New Strategeutics of Gene Therapy for Hyperphenylalaninemia RatsBeijing Red - Cross Chaoyang Hospi tal , Capital University of Medical Sciences Beijing , 100020 ; China . * Marbach et al ac operon induction in Escherichia coli : Systematic comparison of IPTG and TMG induction and influence of the transacetylase LacA Journal of Biotechnology 157 ( 2012 ) 82 - 88 . * Al Hafid , N and J . Christodoulou ( Oct . 2015 ) “ Phenylketonuria : a review of current and future treatments " Transl Pediatr , 4 ( 4 ) : 304 317 . Albiniak , A . M . et al . ( 2013 ) “ High - level secretion of a recombinant protein to the culture medium with a Bacillus subtilis twin - arginine translocation system in Escherichia coli ” FEBS J , 280 : 3810 - 3821 . Altenhoeffer et al . ( Apr . 9 , 2004 ) “ The probiotic Escherichia coli strain Nissle 1917 interferes with invasion of human intestinal epithelial cells by different enteroinvasive bacterial pathogens ” FEMS Immunol Med Microbiol , 40 ( 3 ) : 223 - 229 .

( Continued )

( 51 ) Int . Cl . A61K 35 / 741 ( 2015 . 01 ) CO7K 14 / 245 ( 2006 . 01 ) C12R 1 / 19 ( 2006 . 01 ) A61K 35 / 74 ( 2015 . 01 ) C12N 9 / 88 ( 2006 . 01 ) C12N 9 / 06 ( 2006 . 01 ) C12N 15 / 70 ( 2006 . 01 ) A61K 35 / 00 ( 2006 . 01 )

( 52 ) U . S . CI . CPC . . . . . . . . . . . A61K 35 / 74 ( 2013 . 01 ) ; COZK 14 / 245

( 2013 . 01 ) ; C12N 9 / 0014 ( 2013 . 01 ) ; C12N 9 / 0022 ( 2013 . 01 ) ; C12N 9 / 88 ( 2013 . 01 ) ; C12N 15 / 70 ( 2013 . 01 ) ; C12Y 104 / 03002

( 2013 . 01 ) ; C12 Y 403 / 01024 ( 2013 . 01 ) ; A61K 2035 / 11 ( 2013 . 01 )

( 58 ) Field of Classification Search CPC . . . . . . . A61K 35 / 741 ; CO7K 14 / 245 ; C12R 1 / 19 See application file for complete search history . Primary Examiner — Maria G Leavitt

( 74 ) Attorney , Agent , or Firm — Finnegan , Henderson , Farabow , Garrett & Dunner LLP ( 56 ) References Cited

U . S . PATENT DOCUMENTS 5 , 589 , 168 A 5 , 989 , 463 A 6 , 203 , 797 B1 6 , 835 , 376 B1 7 , 731 , 976 B2

12 / 1996 Allen et al . 11 / 1999 Tracy et al . 3 / 2001 Perry

12 / 2004 Neeser et al . 6 / 2010 Cobb et al .

( 57 ) ABSTRACT Genetically engineered bacteria , pharmaceutical composi tions thereof , and methods of modulating and treating dis eases associated with hyperphenylalaninemia are disclosed .

14 Claims , 90 Drawing Sheets

US 9 , 943 , 555 B2 Page 2

( 56 ) References Cited

OTHER PUBLICATIONS Andersen P . S . et al . ( Apr . 1995 ) “ Uracil uptake in Escherichia coli K - 12 : isolation of uraA mutants and cloning of the gene ” J Bacteriol , 177 ( 8 ) : 2008 - 2013 . Arai et al . ( Aug . 28 , 1995 ) “ Expression of the nir and nor genes for denitrification of Pseudomonas aeruginosa reguires a novel CRP / FNR - related transcriptional regulator , DNR , in addition to ANR ” FEBS Lett , 371 ( 1 ) : 73 - 76 . Argos , P . ( 1989 ) “ A possible homology between immunodeficiency virus p24 core protein and picornaviral VP2 coat protein : prediction of HIV p24 antigenic sites ” EMBO J , 8 ( 3 ) : 779 - 785 . Arthur et al . ( Oct . 5 , 2012 ) “ Intestinal inflammation targets cancer inducing activity of the microbiota ” Science , 338 ( 6103 ) : 120 - 123 . NIH Public Access Author Manuscript : available in PMC May 6 , 2013 ( 11 pages ) . Baek , J . O . et al . ( Apr . 2011 ) " Expression and characterization of a second L - amino acid deaminase isolated from Proteus mirabilis in Escherichia coli ” J Basic Microbiol , 51 : 129 - 135 . Bifulco , D . et al . ( 2013 ) “ A thermostable L - aspartate oxidase : a new tool for biotechnological applications " Appl Microbiol Biotechnol , 97 : 7285 - 7295 . Boysen , A . et al . ( Apr . 2010 ) “ Translational Regulation of Gene Expression by an Anaerobically Induced Small Non - coding RNA in Escherichia coli ” J Biol Chem , 285 ( 14 ) : 10690 - 10702 . Callura et al . ( Sep . 7 , 2010 ) “ Tracking , tuning , and terminating microbial physiology using synthetic riboregulators ” Proc Natl Acad Sci USA , 107 ( 36 ) : 15898 - 15903 . Castiglione et al . ( Sep . 2009 ) “ The transcription factor DNR from Pseudomonas aeruginosa specifically reguires nitric oxide and haem for the activation of a target promoter in Escherichia coli ” Microbiology , 155 ( Pt 9 ) : 2838 - 2844 . Chang ( 2007 ) “ Use of Enzyme Artificial Cells for Genetic Enzyme Defects ” In Artificial Bells : Biotechnology , Nanomedicine , Regen erative Medicine , Blood Substitutes , Bioencapsulation , and Cell / Stem Cell Therapy . Regenerative Medicine , Artificial Cells and Nanomedicine - vol . 1 . Singapore : World Scientific Publishing , pp . 147 - 159 . Clarkson et al . ( 1971 ) “ Diaminopimelic Acid and Lysine Auxotrophs of Pseudomonas aeruginosa 8602 " J Gen Microbiol , 66 : 161 - 169 . Collinson , I . et al . ( 2015 ) “ Channel crossing : how are proteins shipped across the bacterial plasma membrane ? ” Philos Trans R SOC B , 370 : 20150025 [ online ] . Retrieve from : http : / / rstb . royalsocietypublishing . org / , on Jun . 16 , 2016 ( 13 pages ) . Costa , T . R . D . et al . ( May 2015 ) " Secretion systems in Gram negative bacteria : structural and mechanistic insights ” Nat Rev Microbiol , 13 ( 6 ) : 343 - 359 . Cuevas - Ramos et al . ( Jun . 22 , 2010 ) “ Escherichia coli induces DNA damage in vivo and triggers genomic instability in mamma lian cells " Proc Natl Acad Sci USA , 107 ( 25 ) : 11537 - 11542 . Danino , T . et al . ( May 2015 ) “ Programmable probiotics for detec tion of cancer in urine ” Sci Transl Med , 7 ( 289 ) : 289ra84 [ online ] . Retrieved from : www . sciencetranslational medicine . org , Jul . 30 , 2015 ( 11 pages ) . Deutscher ( Apr . 2008 ) “ The mechanism of carbon catabolite repres sion in bacteria ” Curr Opin Microbiol , 11 ( 2 ) : 87 - 93 . Dinleyici et al . ( Nov . 2014 ) " Saccharomyces boulardii CNCM 1 - 745 in different clinical conditions ” Expert Opin Biol Ther , 14 ( 11 ) : 1593 - 1609 . Dobbelaere , D . et al . ( 2003 ) “ Evaluation of nutritional status and pathophysiology of growth retardation in patients with phenylketonuria ” J Inherit Metab Dis , 26 ( 1 ) : 1 - 11 . Duerre , J . and S . Chakrabarty ( Feb . 1975 ) “ L - Amino Acid Oxidases of Proteus rettgeri ” J Bacteriol , 121 ( 2 ) : 656 - 663 . Durand , S . and G . Storz ( Mar . 2010 ) “ Reprogramming of Anaerobic Metabolism by the FnrS Small RNA ” Mol Microbiol , 75 ( 5 ) : 1215 1231 . NIH Public Access Author Manuscript ; available in PMC Sep . 17 , 2010 ( 28 pages ) .

Eiglmeier et al . ( Jul . 1989 ) “ Molecular genetuc analysis of FNR dependent promoters ” Mol Microbiol , 3 ( 7 ) : 869 - 878 . Estrem , S . T . et al . ( Aug . 1998 ) “ Identification of an UP element consensus sequence for bacterial promoters " Proc Natl Acad Sci USA , 95 ( 17 ) : 9761 - 9766 . Galimand et al . ( Mar . 1991 ) “ Positive FNR - like control of anaerobic arginine degradation and nitrate respiration in Pseudomonas aeruginosa ” J Bacteriol , 173 ( 5 ) : 1598 - 1606 . Gardner et al . ( 2000 ) “ Construction of a genetic toggle switch in Escherichia coli ” Nature , 403 : 339 - 342 . GenBank Database Accession No . AA86752 ( Feb . 3 , 1996 ) “ amino acid deaminase [ Proteus mirabilis HI4320 ” [ online ] . National Cen ter for Biotechnology Information ( NCBI ) , U . S . National Library of Medicine ; http : / / www . ncbi . nlm . nih . gov / protein / AAA86752 ( 1 page ) . GenBank Database Accession No . AAH26251 . 1 ( Jul . 15 , 2006 ) “ Phenylalanine hydroxylase [ Homo sapiens ] ” [ online ] . National Center for Biotechnology Information ( NCBI ) , U . S . National Library of Medicine ; http : / / www . ncbi . nlm . nih . gov / protein / AAH26251 ( 2 pages ) . GenBank Database Accession No . ABA23593 . 1 ( Jan . 28 , 2014 ) “ histidine ammonia - lyase [ Anabaena variabilis ATCC 29413 ] ” [ online ] . National Center for Biotechnology Information ( NCBI ) , U . S . National Library of Medicine ; http : / / www . ncbi . nlm . nih . gov / protein / ABA23593 ( 2 pages ) . GenBank Database Accession No . ACD36582 . 1 ( Aug . 15 , 2011 ) “ L - amino acid deaminase [ Proteus mirabilis ) ” [ online ] . National Center for Biotechnology Information ( NCBI ) , U . S . National Library of Medicine ; http : / / www . ncbi . nlm . nih . gov / protein / ACD36582 ( 1 page ) . GenBank Database Accession No . BAA90864 . 1 ( Feb . 18 , 2000 ) “ L - amino acid deaminase [ Proteus vulgaris ] ” [ online ] . National Center for Biotechnology Information ( NCBI ) , U . S . National Library of Medicine ; http : / / www . ncbi . nlm . nih . gov / protein BAA90864 ( 1 page ) . GenBank Database Accession No . CAE15566 . 1 ( Feb . 27 , 2015 ) “ Histidine ammonia - lyase ( histidase ) [ Photorhabdus luminescens subsp . laumondii TT01 ] ” [ online ] . National Center for Biotechnol ogy Information ( NCBI ) , U . S . National Library of Medicine ; http : / / www . ncbi . nlm . nih . gov / protein / CAE15566 ( 2 pages ) . GenBank Database Accession No . EDV65095 . 1 ( Jun . 20 , 2008 ) " arromatic amino acid transport protein AroP [ Escherichia coli F11 ] ” [ online ] . National Center for Biotechnology Information ( NCBI ) , U . S . National Library of Medicine ; http : / / www . ncbi . nlm . nih . gov / protein / EDV65095 ( 2 pages ) . GenBank Database Accession No . EU669819 . 1 ( Aug . 15 , 2011 ) “ Proteus mirabilis L - amino acid deaminase gene , complete cds ” [ online ] . National Center for Biotechnology Information ( NCBI ) , U . S . National Library of Medicine ; http : / / www . ncbi . nlm . nih . gov / nuccore / EU669819 ( 2 pages ) . GenBank Database Accession No . U35383 . 1 ( Feb . 3 , 1996 ) “ Proteus mirabilis amino acid deaminase ( aad ) gene , complete cds ” [ online ] . National Center for Biotechnology Information ( NCBI ) , U . S . National Library of Medicine ; http : / / www . ncbi . nlm . nih . gov / nuccore / U35383 ( 2 pages ) . Gerdes et al . ( Oct . 2006 ) “ Essential genes on metabolic maps ” Curr Opin Biotechnol , 17 ( 5 ) : 448 - 456 . Gilbert , H . J . et al . ( Jan . 1985 ) “ Molecular cloning of the phenyl alanine ammonia lyase gene from Rhodosporidium toruloides in Escherichia coli K - 12 ” Bacteriol , 161 ( 1 ) : 314 - 320 . Görke and Stülke . ( Aug . 2008 ) “ Carbon catabolite repression in bacteria : many ways to make the most out of nutrients ” Nat Rev Microbiol , 6 ( 8 ) : 613 - 624 . Hasegawa et al . ( Sep . 15 , 1998 ) “ Activation of a consensus FNR dependent promoter by DNR of Pseudomonas aeruginosa in response to nitrite ” FEMS Microbiol Lett , 166 ( 2 ) : 213 - 217 . He , G . et al . ( Apr . 13 , 1999 ) “ Noninvasive measurement of ana tomic structure and intraluminal oxygenation in the gastrointestinal tract of living mice with spatial and spectral EPR imaging ” Proc Natl Acad Sci USA , 96 ( 8 ) : 4586 - 4591 . Hoeks , M . P . et al . ( Jan . 2009 ) “ Adult issues in phenylketonuria ” Neth J Med , 67 ( 1 ) : 2 - 7 .

US 9 , 943 , 555 B2 Page 3

( 56 ) References Cited OTHER PUBLICATIONS

Hoeren et al . ( Nov . 15 , 1993 ) “ Sequence and expression of the gene encoding the respiratory nitrous - oxide reductase from Paracoccus denitrificans ” Eur J Biochem , 218 ( 1 ) : 49 - 57 . Hosseini et al . ( May 2011 ) " Propionate as a health - promoting microbial metabolite in the human gut ” Nutr Rev , 68 ( 5 ) : 245 - 258 . Hou , Y . et al . ( Oct . 2015 ) “ Production of phenylpyruvic acid from L - phenylalanine using an L - amino acid deaminase from Proteus mirabilis : comparison of enzymatic and whole - cell biotransforma tion approaches " Appl Microbiol Biotechnol , 99 ( 20 ) : 8391 - 8402 . Isabella et al . ( Jan . 20 , 2011 ) “ Deep sequencing - based analysis of the anaerobic stimulon in Neisseria gonorrhoeae ” BMC Genomics , 12 : 51 ( 24 pages ) . Ivanovaska , V . et al . ( 2014 ) “ Pediatric Drug Formulations : A Review of Challenges and Progress ” Pediatrics , 134 : 361 - 372 . Kobe , B . et al . ( Jun . 1997 ) “ Regualtion and crystallization of phosphorylated and dephosphorylated forms of truncated dimeric phenylalanine hydroxylase ” Protein Sci , 6 ( 6 ) : 1352 - 1357 . Kwok , S . C . et al . ( Jan . 29 , 1985 ) “ Nucleotide sequence of a full - length complementary DNA clone and amino acid sequence of human phenylalanine hydroxylase ” Biochemistry , 24 ( 3 ) : 556 - 561 . Lee , D . H . et al . ( 2011 ) " Cumulative Number of Cell Divisions as a Meaningful Timescale for Adaptive Laboratory Evolution of Escherichia coli ” PLOS ONE , 6 : e26172 , http : / / dx . doi . org / 10 . 1371 / journal . pone . 0026172 ( 8 pages ) . Leonard , “ Disorders of the urea cycle and related enzymes " in Inborn Metabolic Diseases , 4th ed . Heidelberg : Springer Medizin Verlag , 2006 ; pp . 263 - 272 . Longo , N . et al . ( Jul . 5 , 2014 ) “ Phase 1 Trial of Subcutaneous rAVPAL - PEG in Subjects with Phenylketonuria ” Lancet , 384 ( 9937 ) : 37 - 44 . HHS Public Access Author Manuscript ; available in PMC Jul . 5 , 2015 ( 18 pages ) . Lopez and Anderson ( Dec . 2015 ) " Synthetic Auxotrophs with Ligand - Dependent Essential Genes for a BL21 ( DE3 ) Biosafety Strain " ACS Synthetic Biology , 4 ( 12 ) : 1279 - 1286 . MacDonald , M . J . and G . B . D ' Cunha ( 2007 ) “ A modern view of phenylalanine ammonia lyase ” Biochem Cell Biol , 85 ( 3 ) : 273 - 282 . MacLeod , E . L . et al . ( Jun . 2010 ) “ Nutritional Management of Phenylketonuria " Ann Nestle Eng , 68 ( 2 ) : 58 - 69 . Meadow , P . and W . Work ( 1959 ) “ Biosynthesis of diaminopimelic acid and lysine in Escherichia coli ” Biochem J , 72 ( 3 ) : 396 - 400 . Moffitt , M . C . et al . ( Jan . 30 , 2007 ) “ Discovery of two cyanobacterial phenylalanine ammonia lyases : kinetic and structural characteriza tion ” Biochemistry , 46 ( 4 ) : 1004 - 1012 . Moore et al . ( Nov . 3 , 2006 ) “ Regulation of FNR dimerization by subunit charge repulsion ” J Biol Chem , 281 ( 44 ) : 33268 - 33275 . Nougayrede et al . ( Aug . 11 , 2006 ) “ Escherichia coli induces DNA double - strand breaks in eukaryotic cells ” Science , 313 ( 5788 ) : 848 851 . Olier et al . ( Nov . - Dec . 2012 ) “ Genotoxicity of Escherichia coli Nissle 1917 strain cannot be dissociated from its probiotic activity ” Gut Microbes , 3 ( 6 ) : 501 - 509 . Pelmont , J . et al . ( 1972 ) “ L - aminoacide oxydases des enveloppes de Proteus mirabilis : propriétés générales ( L - amino acid oxidases of Proteus mirabilis : general properties ) ” Biochimie 54 ( 10 ) : 1359 1374 ( French ; English summary on p . 1359 ) . Pi , J . et al . ( Jun . 1991 ) " Cloning and sequencing of the phep gene , which encodes the phenylalanine - specific transport system of Escherichia coli ” J Bacteriol , 173 ( 12 ) : 3622 - 3629 . Pi , J . et al . ( Nov . 1998 ) “ Functional consequences of changing proline residues in the phenylalanine - specific permease of Escherichia coli ” J Bacteriol , 180 ( 21 ) : 5515 - 5519 . Pi , J . and J . Pittard ( May 1996 ) “ Topology of the phenylalanine specific permease of Escherichia coli ” J Bacteriol ; 178 ( 9 ) : 2650 2655 . Pugsley , A . P . ( Mar . 1993 ) “ The complete general secretory pathway in gram - negative bacteria ” Microbiol Rev , 57 ( 1 ) : 50 - 108 . Purcell , O . et al . ( 2013 ) “ Towards a whole - cell modeling approach for synthetic biology ” Chaos , 23 ( 2 ) : 025112 ( 8 pages ) .

Ray et al . ( Nov . 15 , 1997 ) “ The effects of mutation of the anr gene on the aerobic respiratory chain of Pseudomonas aeruginosa ” FEMS Microbiol Lett , 156 ( 2 ) : 227 - 232 . Reeves , A . Z . et al . ( Apr . 2015 ) “ Engineering E . coli into a protein delivery system for mammalian cells ” ACS Synth Biol , Just Accepted Manuscript , DOI : 10 : 1021 / acssynbio . 5b00002 [ online ] . Retrieved from : http : / / pubs . acs . org , on Apr . 20 , 2015 ( 26 pages ) . Final publication in vol . 5 , pp . 644 - 654 . Reister et al . ( Oct . 10 , 2014 ) “ Complete genome sequence of the Gram - negative probiotic Escherichia coli strain Nissle 1917 ” J Biotechnol , 187 : 106 - 107 . Rembacken et al . ( Aug . 21 , 1999 ) “ Non - pathogenic Escherichia coli versus mesalazine for the treatment of ulcerative colitis : a randomised trial ” Lancet , 354 ( 9179 ) : 635 - 639 . REFSEQ Database Accession No . NP _ 415108 . 1 ( Dec . 16 , 2014 ) “ phenylalanine transporter [ Escherichia coli str . K - 12 substr . MG16551 ” [ online ] . National Center for Biotechnology Information ( NCBI ) , U . S . National Library of Medicine ; http : / / www . ncbi . nlm . nih . gov / protein / NP _ 415108 ( 3 pages ) . REFSEQ Database Accession No . WP _ 011146484 . 1 ( May 24 , 2013 ) “ histidine ammonia - lyase [ Photorhabdus luminescens ) ” [ online ] . National Center for Biotechnology Information ( NCBI ) , U . S . National Library of Medicine ; http : / / www . ncbi . nlm . nih . gov / protein / WP _ 011146484 ( 1 page ) . Rigel , N . W . and Braunstein ( 2008 ) “ A new twist on an old path way — accessory secretion systems ” Mol Microbiol , 69 ( 2 ) : 291 - 302 . Saier Jr . , M . H . ( 2006 ) “ Protein Secretion and Membrane Insertion Systems in Gram - Negative Bacteria ” J Membrane Biol , 214 : 75 - 90 . Saier Jr . , M . H . ( 2006 ) “ Protein Secretion Systems in Gram - Nega tive Bacteria . Gram - negative bacteria possess many protein secre tion - membrane insertion systems that apparently evolved indepen dently ” Microbe , 1 ( 9 ) : 414 - 419 . Salmon , K . et al . ( Aug . 8 , 2003 ) “ Global gene expression profiling in Escherichia coli K12 . The effects of oxygen availability and FNR ” J Biol Chem , 278 ( 32 ) : 29837 - 29855 . Sarkissian , C . N . et al . ( Mar . 1999 ) “ A different approach to treat ment of phenylketonuria : Phenylalanine degradation with recom binant phenylalanine ammonia lyase ” Proc Natl Acad Sci USA , 96 ( 5 ) : 2339 - 2344 . Sarkissian , C . N . et al . ( Jun . 2007 ) “ Quantitation of phenylalanine and its trans - cinnamic , benzoic and hippuric acid metabolites in biologival fluids in a single GC - MS analysis ” J Mass Spectrom , 42 ( 6 ) : 811 - 817 . Sarkissian , C . N . et al . ( Nov . 2011 ) “ Evaluation of orally adminis tered PEGylated phenylalanine ammonia lyase in mice for the treatment of Phenylketonuria ” Mol Genet Metab , 104 ( 3 ) : 249 - 254 . NIH Public Access Author Manuscript ; available in PMC Nov . 1 , 2012 ( 15 pages ) . Sat et al . ( Mar . 2003 ) “ The Escherichia coli mazEF suicide module mediates thymineless death ” J Bacteriol , 185 ( 6 ) : 1803 - 1807 . Sawers ( Jun . 1991 ) " Identification and molecular characterization of a transcritional regulator from Pseudomonas aeruginosa PAO1 exhibiting structural and functional similarity to the FNR protein of Escherichia coli ” Mol Microbiol , 5 ( 6 ) : 1469 - 1481 . Schultz ( Jul . 2008 ) “ Cinical use of E . coli Nissle 1917 in inflam matory bowel disease ” Inflamm Bowel Dis , 14 ( 7 ) : 1012 - 1018 . Silhavy , T . J . et al . ( 2010 ) “ The bacterial cell envelope ” Cold Spring Harb Perspect Biol , 2 , a000414 ( 17 pages ) . Sonnenborn and Schulze ( 2009 ) “ The non - pathogenic Escherichia coli strain Nissle 1917 _ features of a versatile probiotic ” Microbial Ecology in Health and Disease , 21 : 122 - 158 . Stanley , S . A . et al . ( Oct . 2003 ) “ Acute infection and macrophage subversion by Mycobacterium tuberculosis require a specialized secretion system ” PNAS , 100 ( 22 ) : 13001 - 13006 . Steele , R . D . ( Jun . 1986 ) “ Blood - brain barrier transport of the alpha - keto acid analogs of amino acids ” Fed Proc , 45 ( 7 ) : 2060 2064 . Trunk et al . ( Jun . 2010 ) “ Anaerobic adaptation in Pseudomonas aeruginosa : definition of the Anr Dnr regulons ” Environ Microbiol , 12 ( 6 ) : 1719 - 1733 .

US 9 , 943 , 555 B2 Page 4

( 56 ) References Cited

OTHER PUBLICATIONS

Ukena et al . ( Dec . 12 , 2007 ) “ Probiotic Escherichia coli Nissle 1917 inhibits leaky gut by enhancing mucosal integrity ” PLoS One , 2 ( 12 ) : e1308 . [ online ] DOI : 10 . 1371 / journal . pone . 0001308 ( 11 pages ) . Unden et al . ( Jul . 4 , 1997 ) “ Alternative respiratory pathways of Escherichia coli : energetics and transcritional regulation in response to electron acceptors ” Biochim Biophys Acta , 1320 ( 3 ) : 217 - 234 . UniProtKB / Swiss - Prot Database Accession No . Q3M5Z3 . 1 ( Nov . 11 , 2015 ) “ RecName : Full - Phenylalanine ammonia - lyase ” National Center for Biotechnology Information ( NCBI ) , U . S . National Library of Medicine , http : / / www . ncbi . nlm . nih . gov / pro tein / Q3M5Z3 ( 7 pages ) . Vockley , J . et al . ( Feb . 2014 ) “ Phenylalanine hydroxylase defi ciency : diagnosis and management guideline ” Genet Med , 16 ( 2 ) : 188 - 200 . Wanner , L . A . et al . ( Jan . 1995 ) “ The phenylalanine ammonia - lyase gene family in Arabidopsis thaliana ” Plant Mol Biol , 27 ( 2 ) : 327 338 . Williams , J . S . et al . ( Aug . 2005 ) “ The gene stlA encodes a phenyl alanine ammonia - lyase that is involved in the production of a stilbene antibiotic in Photorhabdus luminescens TT01 ” Microbiol ogy , 151 ( Pt 8 ) : 2543 - 2550 . Winteler et al . ( Mar . 1996 ) “ The homologous regulators ANR of Pseudomonas aeruginosa and FNR of Escherichia coli have over lapped but distinct specificities for anaerobically inducible promot ers ” Microbiology , 142 ( Pt 3 ) : 685 - 693 . Wright et al . ( Mar . 20 , 2015 ) “ GeneGuard : A modular plasmid system designed for biosafety ” ACS Synth Biol , 4 ( 3 ) : 307 - 316 . Wu et al . ( Oct . 7 , 2015 ) “ Direct regulation of the natural compe tence egulator gene tfoX by cyclic AMP ( CAMP ) and CAMP receptor protein in Vibrios ” Sci Rep , 5 : 14921 ( 15 pages ) . Xiang , L and B . S . Moore ( Jun . 2005 ) “ Biochemical characterization of a prokaryotic phenylalanine ammonia lyase ” J Bacteriol , 187 ( 12 ) : 4286 - 4289 . Zhang and Lin ( 2009 ) “ DEG 5 . 0 , a database of essential genes in both prokaryotes and eukaryotes ” Nucl Acids Res , 37 ( suppl . 1 ) : D455 - D458 . U . S . Appl . No . 62 / 183 , 935 , filed Jun . 24 , 2015 , by Kotula et al . U . S . Appl . No . 62 / 184 , 811 , filed Jun . 25 , 2015 , by Falb et al . U . S . Appl . No . 62 / 263 , 329 , filed Dec . 4 , 2015 , by Kotula et al .

Becker , S . et al . ( Aug . 1996 ) “ O , as the Regulatory Signal for FNR - Dependent Gene Regulation in Escherichia coli ” J Bacteriol , 178 ( 15 ) : 4515 - 4521 . Blau , N . and N . Longo ( 2015 ) “ Alternative therapies to address the unmet medical needs of patients with phenylketonuria ” Expert Opin Pharmacother , 16 ( 6 ) : 791 - 800 . Braat , H . et al . ( 2006 ) “ A Phase I Trial With Transgenic Bacteria Expressing Interleukin - 10 in Crohn ' s Disease ” Clin Gastroenterol Hepatol , 4 : 754 - 759 Christodoulou , J . et al . ( Nov . 2012 ) “ Enzyme substitution therapy for phenylketonuria delivered orally using a genetically modified probiotic : Proof of principle ” 62nd Annual Meeting of the American Society of Human Genetics , Nov . 6 - 10 , 2012 , San Francisco , CA ; Program No . 166 , Nov . 8 , 2012 . Huibregtse , I . L . et al . ( 2012 ) “ Genetically Modified Lactococcus lactis for Delivery of Human Interleukin - 10 to Dendritic Cells " Gastroenterol I Res Pract , vol . 2012 , Article ID 639291 ( 7 pages ) . International Patent Application No . PCT / US2016 / 032562 , filed May 13 , 2016 , by Synlogic , Inc . : International Search Repeat arid Written Opinion : dated Aug . 22 , 2016 . International Patent Application No . PCT / US2016 / 062369 , filed Nov . 16 , 2016 , by Synlogic , Inc . : International Search Report and Written Opinion ; dated Mar . 10 , 2017 . Kang , T . S . et al . ( 2010 ) “ Converting an injectable protein thera peutic into an oral form : Phenylalanine ammonia lyase for phenylketonuria ” Mol Genet Metabol , 99 : 4 - 9 . Liu , J . et al . ( 2002 ) “ Study on a Novel Strategy to Treatment of Phenylketonuria ” Art Cells , Blood Subs , and Immob Biotech , 30 ( 4 ) : 243 - 257 . Mengesha , A . et al . ( 2006 ) “ Development of a flexibie and potent hypoxiainducible promoter for tumor - targeted gene expression in attenuated Salmonella ” Cancer Biology & Therapy , 5 ( 9 ) 1120 - 1128 . Sleator , R . D . and C . Hill ( 2009 ) “ Rational Design of Improved Pharmabiotics ” J Biomed Biotechnol , vol . 2009 , Article ID 275287 ( 7 pages ) . Steidler , L . at al . ( Jul . 1 , 2003 ) “ Biological containment of geneti cally modified Lactococcus lactis for intestinal delivery of human interleukin 10 " Nat Biotechnol , 21 ( 7 ) : 785 - 789 . Strauch . K . L . et al . ( Feb . 1985 ) “ Oxygen Regulation in Salmonella typhimurium ” J Baceriol , 161 ( 2 ) : 673 - 680 . Unden , G . et al . ( 2002 ) “ Control of FNR Function of Escherichia coli by O2 and Reducing Conditions ” J Mol Microbiol Biotechnol , 4 ( 3 ) 263 - 268 .

* cited by examiner

Phenylalanine

t - Cinnamic acid

atent

High affinity uptake

t - Cinnamic acid

Apr . 17 , 2018

www . phenylalanine

FNR FNR ) | Pher

( FNR XFNR ) | PAL3

Sheet 1 of 90

PAL = Phenylalanine Ammonia Lyase PheP = High Affinity Phenylalanine Transporter Fig . 1

US 9 , 943 , 555 B2

US 9 , 943 , 555 B2

V2 : 8 ! 4

Sheet 2 of 90

w

www .

Apr . 17 , 2018

BERELLO LUPUS

* * * * * * * * * * * * * * * * * *

RAK

BejkxOSPX sujuejekian . X

ujajoxd * mil

au soit

Jujuejejávald

SURP * * ) Elepo

dajold Kilimo

antspokeo UBICCITUSPÁLENI

atent

atent

Plantation in

coo

PAH

Apr . 17 , 2018

potrete perare

preferens

?????????????????? ; a

W

MN * H

ontre

HxN * H

L - Phe

BHA 4 - 01 - BH , OH

. . . .

L - Tyr

Sheet 3 of 90

Fig . 2B

US 9 , 943 , 555 B2

US 9 , 943 , 555 B2

O7813

Sheet 4 of 90

pioe oueuujo - sues

a4d - 1

Apr . 17 , 2018

N NH

- - -

www V

* p * * * * * * * * *

* *

* * * *

opi .

* *

* * * * *

atent

atent

???????????? : ???????

Apr . 17 , 2018

?? ????? ?????

?? ?? ???????

???? ?????????

?

??? NE Phenylalanine

Phenylpyruvate

Sheet 5 of 90

Fig . 2D

US 9 , 943 , 555 B2

US 9 , 943 , 555 B2

Fig . 3

• Phep = high affinity phenylalanine transporter

• PAL = phenylalanine ammonia lyase from an Enterobacteriaciae species

wwwwww .

minnes

ruimtes . * * * * *

* * - - - *

www .

Toxin

123 - - -

- 1

O200 D

0 . 0000C

* * * *

*

* * * * * * * * *

Sheet 6 of 90

. ???????????????????????????????

rispondentes de

* *

*

BB 3

Daisissa wiririiniinin * *

* * *

vari

* * *

Apr . 17 , 2018

* * * varivoorras

190 . 00 star

-

Phenylalanine .

- Cinnamic Acid

atent

8 - Cinnamic Acid

???????? { A & ????

Plasma Membrane

Outer Membrane

atent Apr . 17 , 2018

arabinose

LAADI

arac arac Para

| ParaBAD

Sheet 7 of 90

Phenylalanine —

Phenylpyruvate -

LAAD = L - amino acid deaminase

Phenylpyruvate

Phenylalanine

Fig . 4

US 9 , 943 , 555 B2

Phenylalanine

t - cinnamic acid

Plasma Membrane Outer Membrane

atent

High affinity uptake

t - cinnamic acid

Apr . 17 , 2018

Phenylalanine FNR XFNR

phep

FNRY FNR FNR

PAL3 PAL37

arabinose arabinose | aractv | LAAD Parac Parabad arac

LAAD

Sheet 8 of 90

Phenylalanine

Phenylpyruvate LAAD = L - amino acid deaminase PAL = Phenylalanine Ammonia Lyase Phep = High Affinity Phenylalanine Transporter

Fig . 5

Phenylalanine

US 9 , 943 , 555 B2

Tetr

atent

500

tetr / tetan Sjejowalay

500

es and leader regis tet operator tet operator

M13 fwd

luminescens PAL3 Photorhabdus

Apr . 17 , 2018

1000 ?

4000

AmpR promoter

High copy Tet - PAL3 09 ( 865

Sheet 9 of 90

within of 3500

lac promoter

Ampo

CAP binding Silk 011

XM13 rev Lac operator

000 ? 1

Ori

13000

Fig . 6

US 9 , 943 , 555 B2

2500

atent Apr . 17 , 2018 Apr 17 , 2018 Sheet 10 of 90 US 9 , 943 , 555 B2

M13 rev Lac operator 0007 1000 meter lac pro

po binding site CAP binal ter Photorhabdus luminescens PAL3 we

NarG FNR prome M13 fwd Low copy FNR - PALS dQ2585 Rep101 00091

promoter Ampk promo DSC101 Ori 2

ydurv e tradem 50007 1000

Fig . 7

1000e AmpR promoter

tR

atent

RBS and leader region

M13 fwa

. . .

tet

1000

AmpR

Petriteta promoter far tet operator

luminescens PAL3 Photorhabdus

Apr . 17 , 2018

soos

Low copy Tet - PAL3 6456 bp

2000 .

PSC101 ori

Sheet 11 of 90

CAP Dinding sites 0 promoter 1011

060 * . .

Rep101

M13 rev Lac operator

Fig . 8

US 9 , 943 , 555 B2

500 500

1000 1000

1500 1500

atent

2000

TetR TetR

L - aad proteus mirabilis

Apr . 17 , 2018

tetR / teta promoters tetrihtoters

RBS |

and leader region

tet operator

tet operator

Sheet 12 of 90

Fig . 9

US 9 , 943 , 555 B2


2007 ?

atent

* *

FRT CMR

phep

lacz

DONDE * *

le

rrnB1 terminator rrnB2 terminator

“

X

lacz lacz tetRo phep + KIKO fragment lacz Nissle chromosome Ix !

cat

TetR / TETA promoters

Apr . 17 , 2018

operator

promoter FRT ( minimal )

lacz

tetR

tet operator ret

lacz

lacz

kiko 6794 bp

111

TetR

Nissle chromosome post - recombineering

M13 fwd

ROKY

Sheet 13 of 90

AmpR promoter AmpR

0009

lacz 60

Fig . 10

US 9 , 943 , 555 B2

atent

500 500

1000 1000

1500 1500

2000 2000

TetR

phep

Apr . 17 , 2018

M13 forward

tetR / teta promoters RBS and leader region

tet operator te

' tet operator

Sheet 14 of 90

Fig . 11

US 9 , 943 , 555 B2

atent Apr . 17 , 2018 Sheet 15 of 90 US 9 , 943 , 555 B2

RBS and leader region 1000 ) 0002

Photorhabdus luminescens PAL3 S

fnrs promoter Low copy kanamycin resistant FNR - PAL3 6104 bp 3000 Rep101

Neo / KanR 5000 PSC101 ori

met het 4000

Fig . 12A

500

1500

atent

Pins Pin by

1000 Escherichia coli Phep Escherichia coli Phep

?

– lacz 448kb

Apr . 17 , 2018 Sheet 16 of 90

Nissle chromosome

sim

u

Fig . 12B

US 9 , 943 , 555 B2

atent

Pas - pheP ( Phel gene from Escherichia coli )

500 500

1000 1000 1500K

Escherichia coli phep

PfnrSRBS and leader region

Pfars - PAL ( PAL3 gene from Photorhabdus luminescens ) 500 1000 1500

L PAL3

PAL3

Pfnrs !

lacz


448kb

malE / K 4 , 687kb

Apr . 17 , 2018

. : : .

02

Ori - -

Nissle chromosome

Sheet 17 of 90

agal / rsmi 3 , 645kb

http : .

500

mana

1000 Pfars - PAL ( PAL3 gene from Photorhabdus luminescens ) * * *

1500

TT PAL3 RBS and leader region

Fig . 13A

PAL3

Pfnrs

US 9 , 943 , 555 B2

Pos - pheP ( Phee gene from Escherichia coli )

500

1000

15001

Escherichia coli pheP RBS and leader region

Phep - lacz 448kb

atent

Pfnrs PAL - malE / K 4 , 687kb

PAL - yics / nepl 4 , 240kb

Oria

, 000 ,

5

PAL - cea 1 , 141kb

Apr . 17 , 2018

1

Nissle chromosome

Sheet 18 of 90

PAL - agal / rsmi 3 , 645kb

Fig . 13B

1000

1500

Penrs - PAL ( PAL3 gene from Photorhabdus luminescens ) 500

NT

PAL3 PAL3

Pfnrs


US 9 , 943 , 555 B2

U . S . Patent atent

Ptnrs

Pas - phep ( Phee gene from Escherichia coli ) 500m 1000

1500N

DO Escherichia coli phep RBS and leader region

pheP ( lacZ )

PAL ( malE / K )

( - 448 kbp )

( - 4688 kbp )

5Mb 5 . 4M

Apr . 17 , 2018

PAL ( yicS / n

1 Mb PAL ( cea )

( - 4240 kbp ) y SYN - PKU511 ( ~ 1141 kbp ) orilt 4Mb Integration Map

PAL ( malP / T ) 4Mb ( ~ 3908 kbp )

PAL ( agal / rsm 3Mb ( ~ 3645 kbp ) /

AthyA ( - 3209 kbp )

Pfines - PAL ( PAL3 gene from Photorhabdus luminescens ) 500 1000 1500

TTPAL3 Pfnrs ! RBS and leader region

Sheet 19 of 90

Fig . 130

PAL3

US 9 , 943 , 555 B2

atent

500

1000 000

1500 1500

2000

500

???

???

Apr . 17 , 2018

arac arac

]

[

Laad prote L - aad proteus mirabilis


Sheet 20 of 90

Fig . 14

US 9 , 943 , 555 B2

o & Phenylalanine ( mM )

B L M ? ? ?

PAL1 LC ??????????????????????????????????????????????????????????????????????? ????????????????????????????????????????? ????????????????????????????????????

????????????????????????????????????????? ?

PAL1 HC ??????????????????????????? ???????????????? ????????????

??? ???????????????? ????????????? ??????????????????

Fig . 15A j0 hours Z24 hours 23 hours

? ? ? ???????????????????????????? ? ???? PAL3 LC ??????????????????????????????????

??????????? ??????????????????????????? ?????????????????????????????????

PAL3 HC ?????????????????????

z8 SSSEt66 Sn 06 J0 Iz 100?S 8I07 CLI adv 1???

?

atent

? ?

Apr . 17 , 2018 wawcow -

trans - cinnamate ( mm ) ?

- - - - - - - - - - - - - - - - -

? ??

ZZLI2222222222

Sheet 22 of 90

? ?

PAL1 L

PAL1 HC PAL3 LC PAL3 HC

Z 4 hours 23 hours Fig . 15B

US 9 , 943 , 555 B2

Phenylalanine ( mm ) å vänä ? en 2222222222211111111111111LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL ????????????????????????????

???????????????????????? ZZZZZZZZZZZZZZ22222222222

LC - PAL1 . HC - PAL1 LC - PAL3 HC - PAL3

pheP + HC - PAL1 / pheP + LC - PAL1 / pheP + .

| HC - PAL3 / pheP + | LC - PAL3 / pheP +

? 22222222222222222222LILLLLLLLLLLL L LLL ? ?????????????????????

22222222222222 L LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL

Fig . 16A 222 LLLLLLLLLLLLLLLLLLLL L L

LLLLLLLLLLLLLL22222222222222222222222ZZZZZZ ?????????????????????????????

212 LLLLLLLL LLLLLLLLLLL LLLLLLLLLL

? ???????????????????????????

12112212112112112112112212112112112112112112112112212112112112112212 LLLLLLLLLLLLLLLLLLLL LLLLLLLLL2222222222222222222222222222222222LLLLL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL

??? ?????????????????????????????????????????

ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ 1 LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL ZUZAZIZZIUZULU

2222222ZZZZZ LLLLLLLLLLLLLLLLLLLL 12 ??

14hr 22hr Ohr

za SSS?€ + 6 * 6 SN 06 JO ET J??US 810Z ' LI ady jual

atent Apr . 17 , 2018

Cinnamate Produced ( MM ) a gaña o

- - -

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

- - - - - - - - - - - - - - - - - - - -

2hr N 4hr

LC - PAL1 . HC - PAL1 .

HC - PAL1 / pheP + "

LC - PAL3 HC - PAL3

pheP + LC - PAL1 / pheP +

| LC - PAL3 / pheP + HC - PAL3 / pheP +

Sheet 24 of 90

?

Fig . 16B

US 9 , 943 , 555 B2

ENR

FNR

FNR

FNR

atent 1

* ° ( E ) 5•2• Im

x 8 . 01 I have

Apr . 17 , 2018

PAL PAL

Phen

FNR prom FNR promoter

FNR promoter

Fig . 17A Fig . 17A

Sheet 25 of 90 Sheet 25 at oo

FNR

FNR

ENR

ENR

PAL

PheP PheP

-

FNR promoter

FNR promoter Fig . 17B

US 9 , 943 , 555 B2


35000

30000

25000

20000 Miller Units 11111111111111111111111111 15000

10000 1111111111111 111111111111111

Pfnr - 1 Pfnr - 2 Pfnr - 3 Pfnr - 4 Pfnr - 5 N 0 * - 02

Fig . 18

atent

Suufd

500

1500 .

1000 lacz

Ha ENR 1 binding - 10 site

Apr . 17 , 2018


lacZpal 1812 bp

Sheet 27 of 90

Fig . 19A

US 9 , 943 , 555 B2


45000 .

40000 IZ

35000

30000 ZY

TI

27

12212 Miller Units Jl IYYYYLILLLLLLLLLLLLL ULUUUUUUU

4 227

22

21 112

1 . 2222

10000 212

1 . 2222 222

5000 12 . 1

12 12227 2212

0 1 2 3 4 5 6 24

Time ( hrs ) 1 + 02 9 - 02

Fig . 19B

U . S . Patent

SYNPKU - 904 + O2 - 1

SYNPKU - 904 + O2 - 2

SYNPKU - 904 - 02 - 1

* * * * * *

SYNPKU - 904 02 - 2

10

Apr . 17 , 2018

00900

Sheet 29 of 90

0 . 1

0

3

8

13

18

23

28

Fig . 19C

Time ( hrs )

US 9 , 943 , 555 B2

Fig 20 o © - 8 A 6 _ n

?????????????????????? ? ? ? ? ? ? ? ? ? ?

: Nissle | | | 1 |

| | |

| |

1 |

1 |

1 1 1 1 1 1 1 1 1 1 I I 1 1 1 1 1 1 1 1 1 1 1 | | | | | | 1

| 1 |

1 |

1 |

1 |

IIIIIIIII | 1 1 1 1 1 1 1 1 1 1 | | | | | | | | | | | | | | | | | | | | | | | | II I II I II 1 1 1 1 1 1 1 1 1

( Ptet SNNPKU - 302 ? ????????

? ??????? ????? ?????????? ?????????????????????? VAL3 Ptet - phep

|

???????????? ?????

Nissle fnrS - PAL3 1 1 1 1 1 1 1 1 1 1 1 1 | 1 1

| 1

1 1 1

1 1

1 1

1 1

1 1

1 1

1 1

1 1

1 1

1 1

1 1 1 1 1 1

????????????????????????????? ?????

Nissle ??B - PAL3 ?

E ? ?????????????????????? ????????????????? ???????????????

" " " "

Aerobic ??????????????????? ????????? ????????

????

Nissle ydfZ - PAL3 # 1 1 1 1 1 1 1 1 1 1

??? ???????????????????????????????? : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : ?????? ? ??? ???????? ? ?

??????? Msgen? * ????????????????

| | | | | | | 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 | | | | | | | | | |

IIIIIIIIIIII

??? ?

???????? ? ???? ? ? ? ? ? ? ????????????????????

??????????????????????????????????????? ????????????????????? ????????????????

| NisslepheP + TirB - lac? . LLL ILL FILL ILL LLLLL LL ALL LL LLLLL L LLLL LLL LL ? .

|

" . . . . . . ' 1 . . ' . . . . . . . . . .

??? ? ? ? ?

NisslepheP + ydt - PAL3 | 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 | 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

?? 24 hr E3 4 hr A2 hr 10 hr

US 9 , 943 , 555 B2 Sheet 30 of 90 Apr . 17 , 2018 atent

Fig . 20B

w o ú?nä w ? ?? ? ? II III

1722ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ ??

222222222222222222222222222222222222222222222222222222222222 2222222222 2222222 2117

UUUUUUUUUU UUUUUUUUUUUUUUUUU 1UUIIIIIIIIIIIIIIIIII DUUUUUUUU

Nissle SYNPKU - 302 S3 , Ptet - phep

Nissle 222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222 fnrS - PAL3

U UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU 111111111111111111111111111111111111111111111

UUUUUUUUUUUUUUUUUUUUUU

2222222222

Nissle nir B - PAL3

IIIIIIIIIIIIIIIII UUUUUUU

Anaerobic + 20 mM Nitrate z zzZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ LL LLLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLLL 2222 22LLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLL 2222222222222222222222222222222222222222

zzzzzZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ222222 LLLLLLLLLLLLLLLLLL222222 22222222222222222222222222ZZZZ

Nissle ydfZ - PAL3 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU

11111111111 ??

Nissle / phe fnrS - PAL3 2222222222222

22222222222222 2 . 2222222

??????????????????????????????????????????????????????

212 LLLLLLLLLLLLL LLLLLLLLLLL LLLLLL22112112222222222222222222222222 222222222 2 22222

NisslepheP + nirB - lacz UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU

1UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU

222222222222222222222222222 22222 2 22LLLLLLL2Z222222222222ZZZZZZZZZZZ NisslepheP + ydfZ - PAL3 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIIIIIIIIII JUU IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

24 hr 3 4hr 2hr 10hr

US 9 , 943 , 555 B2 Sheet 31 of 90 Apr . 17 , 2018 atent


10 mins ZZ30 mins [ 60 mins E # 90 mins ® 120 mins [

' ' ' ' ' ' ' ' ' ' ' ' ' ' ' '

' ' ' '

' ' ' '

• •

' ' ' ' ' '

' ' ' ' ' '

• - -

' '

' '

-

' '

' '

-

' ' ' '

' ' ' '

' '

' '

' ' ' '

' ' ' '

• '

" -

' '

' •

' '

' •

' '

' •

' ' ' ' '

' ' • • •

' ' '

' ' •

' '

' •

' '

' •

' '

' -

' '

' -

' ' ' '

' ' -

' ' ' '

' ' - -

' '

' -

' '

' -

' '

' -

' '

' -

' ' ' '

' ' - -

' '

' -

' '

' -

' '

' -

' ' '

-

' '

' -

•

' ' ' ' ' '

' ' ' - - -

" " "

' '

' -

"

' '

' -

' '

' -

"

' '

' -

' '

' -

' ' ' '

' ' - -

' ' ' '

' ' - -

" "

'

' '

' -

'

' '

' -

"

' '

' -

'

' '

' -

' ' ' ' '

' ' - - -

' '

" -

' '

' -

' ' ' ' ' ' • - - - ,

" " | | | | | | | | | |

1 |

| 1

| 1

| 1

| 1

| 1

| 1

| 1

| 1

| 1

| 1

| |

| |

| | 1

| | I

1 | I '

In '

1 | 1

| | I I | | I I 1 1 1 1 1 I 1 1 1 1 1 1 1 1 1 1 1 1 1

• ' . SYNPKU - 307 ( SYNPK? - 304

with no PheP ) ??????????????????????????? ???????????????????

???????????????????????????????????????????? ????????????????????????????????????????????????????????????? ????????????????????????????????????????? ???????????????????????????????????????????????????

Without phep on the Nissle chomosome ' ' '

- '

- '

- -

' -

' -

-

' -

' -

-

' -

' -

-

' - '

- -

'

' - -

' - -

-

' ' -

' ' -

- -

' - '

- -

' - -

' - -

-

' - '

- -

' -

-

'

' - -

' - -

-

' -

' -

-

'

' ' - - -

' ' - - -

- -

' ' - -

' ' - -

- -

'

' - '

- -

' - -

' - -

-

' - '

- -

' - -

' - -

-

' - '

- -

' ' - -

' ' - -

- - [

' -

' -

- ]

' -

' -

-

' -

' -

- [

' -

' -

-

' -

' - -

- I

' -

' -

-

' - '

- -

' -

' -

-

' - '

- -

' ' •

' ' - -

- -

' •

' -

-

' •

' -

-

' ' • •

' ' - -

- -

' •

' -

-

' • •

' - -

-

' •

' -

-

'

' •

' -

-

' •

' -

-

' •

' -

-

' ' ' '

- - -

' ' '

- -

' '

' -

' ' ' ' ' '

' ' ' - - -

- - -

' ' '

-

' '

' -

-

' ' '

' - -

- -

' ' '

- -

' ' '

' - -

- - -

- - - - - - - - - - - - - -

1 1 1

1 1

1 1 | 1 1 1 1

| 1 1

1 1 1

1 1

| 1 1 1 1 1

??????????????? ?????????????????????????????????????????????? ???????????????????????????????????????????????? :

( SYNPKU - 305 with no Phep )

SYNPK0 - 305 | SYNPKU - 308 - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

' -

' -

' -

' -

' -

' -

' -

' -

' -

' -

' -

' -

' -

' -

' -

' -

' -

' -

' -

' -

' -

' ' ' ' ' ' ' ' ' '

' ' ' ' ' " " " " " " " " " " " " " " " " " " " " " " " " " " "

?

1 | | | | | I I 1 1 1 1

I I I 1 1 1 [ [ [ [ [ [ LL

| 1

1 1 1 1 1 1 1 [ [ [ [ [ [ [

L IL

| II | | | | II | | | I 1 1 | | | IIIIII | | | | | | | | hhl With phep on the Nissle chomosome ' ' ' ' ' ' ' ' '

- - - ' ' '

- '

• •

' -

' •

•

' ' - -

' ' • •

• •

' -

' •

•

' - -

' • •

•

'

' -

' •

•

' -

' •

•

' - '

• •

' -

' •

•

'

' -

' •

•

' ' - - ' '

• • • •

'

' -

' •

•

' -

' •

•

' ' - -

' ' • •

• •

' -

' •

' -

' •

•

' -

' •

•

' - '

, •

' -

' ,

•

' -

' ,

•

' -

' ,

•

' -

' , ,

•

' -

' ,

•

'

' -

' ,

•

' -

' ,

•

'

' -

' ,

•

' '

' ,

•

' ' '

' ' ,

'

' '

' ,

•

' ' '

, •

'

' ' ' '

' ' , ,

• •

' '

' ,

•

'

' ' '

' , ,

•

' • • • , , ,

• • • •

|

| | | | | | | | | | | | 1 1 1 1 1 1 1 1 1 1

" " " SYNPKU - 304 ?

????????????????????????????? ????????????????????????????????????????????????????????????????? ? ? ? ? ? ? ? ???????????????????????????????????

???????????????????????????????????????????????????????? ???????????????????

? ? ? ????????????

6 A ? ? ? ? Phe ( mM )

Fig . 21

ã w

w

w wwwwwwwwwww

wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww w

wwwwwwwwwwwwwwwwwwwww

IZS - NXONAS

atent

SYNPKU - 520

ã

SYNPKU - 518

- TCA ( MM )

Apr . 17 , 2018

SYNPKU - 523

Å

Sama mee en

home annen for

sammen new to

Sheet 33 of 90

i o 0

20

40 60 Time ( min )

80

100

Fig . 22

US 9 , 943 , 555 B2

ö

5

SYNPKU - 511

atent

N

SYNPKU - 512 SYA SYNPKU - 704 SYNPKU - 524

ö TCA ( mM )

-

Apr . 17 , 2018

: :

SYNPKU - 702 SYNPKU - 705 SYNPKU - 701 SYNPKU - 703

- - - - - - - - SYNPKU - 703

Z

Sheet 34 of 90

ó o

20

40 60 Time ( min )

80

100

Fig . 23

US 9 , 943 , 555 B2

atent

Phe ( mm )

Apr . 17 , 2018

SYNPKU - 511 ( whole cells ) • In vitro activity of cells : Sumol / hr / 1e9

cells

Sheet 35 of 90

Fig . 24

US 9 , 943 , 555 B2

atent

w Phe ( mm )

1111 Apr . 17 , 2018 Sheet 36 of 90

SYNPKU - 401 unc A

SYNPKU - 401 unc B

SYNPKU - 401 20x uncA

SYNPKU - 401 20x uncB ~ 2e8cfu / mL

- 5e7 cfu / mL

Fig . 25A

US 9 , 943 , 555 B2


• |

???? ? ??? _ en | ?

' ' ' '

?

• ' '

' • '

' '

' '

' ' ' ' |

|

|

|

|

I II ' ' ' _ N

| '

? | | I ' 1 1 1 " " " "

Phe ( mM ) [ [ ] l

' "

'

' "

'

' "

'

' "

' "

1 ' [ [ [ [ [ [ m

' ' ' " ' ' ' ' ••• "

' ' '

' ' ' " '

? ' ' ' '

I II ' ' ' '

" • "

I | | III " " " "

[ I " " " "

| | | • ' ' '

1 1

' " " " 1

?? ?? ?

| ? 1 1

|

1

?? ?? I II

[ [ ] ?? ' ' ' '

_ o ???

??

? ?? ' ' " ' ' l

aerobic micro anaerobic ?

Fig . 258

Pre - and Post - Feeding Levels in Female PKU Mice - Plasma

1 . 50

jual

1 . 45

Nissle Z SYNPKU - 302

1 . 40 1 . 35 1 . 30

810Z ' LI ady

1 . 25 1 . 20 1 . 15

Phe in plasma ( mm )

1 . 10 1 . 05

06 JO 8€ v??YS

1 . 00 0 . 95

22 .

12

2222

2222 . zzzzzz

222 22222222

122222222222222222222222LLLLLLLLLLLL izLLLLLLLLLLLLLLLLLLL LLLLLLLLLLLLLLLLLLLLLLLL LLLLLLLL

0 . 90 0 . 85

Fig . 26A 0 . 80

Pre - Feeding

Post - Feeding

za SSS?€ + 6 * 6 SN

% Change in Phe 6 H 8 9 8 7 6 7 8 9 8 o C

Males IIIIIIIIIIIII

SYNPKU - 302 Nissle .

?

22222222222222222222222222222222

?????

Fig . 26B Percent Changes in Phenylalanine in PKU mice Plasma Females

22LLLLLLLLLLLLLLL ? ????? 222222 LLLLLLLLL

za SSS?€ + 6 * 6 SN 06 JO 6E J??US 810Z ' LI ady jual


wwwwwwwww w wwwwwwww pomimmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmming

* * * wwwwwwwwwwwwww Website

22222222222 11122

177777777777777 42222

LLLLLLLL21 12 ( ww ) ( audy ( WW ) ( oudy

? 1111111111 LIITILIT 1122

27

HO SYN - PKU901 SYN - PKU303 H2O SYN - PKU901 SYN - PKU303

Fig . 27A


* * wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww

an h

ht

ZZZZZ TILLILITLLLLLLL

?????

wu ) ( oudly ( Nw ) ( audiv 2222222222 1111111111 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1 + 1

' o mmmm

H2O SYN - PKU901 SYN - PKU303 ?? 106nyd - NAS ???? » d - NAS

Fig . 27B

U . S . Paten atent Apr . 17 , 2018 Sheet 42 of 90 US 9 , 943 , 555 B2

. . . .

?????? ?????? 21ss A [ Phe ] ( mm )

ITT 1

TTT IIIIII

ITIT II I TIITTIIN IIIIIIII s

LLLLLLLLLLL IT IIIII

sssssssssss I IT

1 INDI TIT

I 1 TIT

?????? 11 . 0 . 0 - H2O SYN - PKU901 SYN - PKU303 SYN - PKU304

Fig . 28

2hrs

4hrs

* * *

*

* * * *

atent

* * * *

r

* * * * * *

??? * *

AIPhel { mM )

AIPhe ( mM )

ITH | LL IF

Apr . 17 , 2018

0 . 5

0 . 5

…

H . 0 SYN - PKU901 ? SYN - PKU303 ? | SYN - PKU304?

| H2O SYN - PKU901 ) | SYN - PKU303 ? | SYN - PKU304 \

Sheet 43 of 90

0 . 0

Fig . 29B

Fig . 29A

P - values : ANOVA with Tukey pairwise comparison * p < 0 . 05 , * * p < 0 . 01 . * * * p < 0 . 001 . * * * * p < 0 . 0001

US 9 , 943 , 555 B2

2 hrs

4 hrs

2 . 0

* * *

atent

*

* * * *

IL

I

* * * *

* * * *

1

* * *

* * *

* *

1 . 5

1 : : .

A [ Phe ] ( MM )

: : : : ?

A [ Phe ] ( mm )

:

11 . : ) > > > : .

Apr . 17 , 2018

: 1

:

0 . 5

-

,

H20 SYN - PKU901 SYN - PKU303 SYN - PKU304

H20 SYN - PKU901 SYN - PKU303 SYN - PKU304

Sheet 44 of 90

0 . 000

0 . 02

M Fig . 29C

Fig . 29D

P - values : ANOVA with Tukey pairwise comparison * p < 0 . 05 , * * p < 0 . 01 , * * * p < 0 . 001 , * * * * p < 0 . 0001

US 9 , 943 , 555 B2

atent

1 . 5mm

11111111111111111

A [ Phe ] ( MM )

1 . 0

Huiviviviviviviviviviviviviviviviviviviviviu

??????? ?????????????????? ?????? ???????????? ? ? ?

HOH HH HT

A [ Phe ) ( mm )

ZZZZZZZZZZZZZZZZZZZZZZZZZZZZ

Apr . 17 , 2018

HHHMMMMMMMMMMMMMMMMMMMMMMMMMM

IIIIIIIIIIIIIIIIIIIIIIIIIIII MUUUUUUUUUUUUUUUUUU

HIIH

0 . 5

Z

SYN - PKU901 2x109 CFUS SYN - PKU304 5x108 CFUS * SYN - PKU304 1x109 CFUS SYN - PKU304 2x10°CFUS

0 . 0m SYN - PKU901 2x109 CFUS SYN - PKU304 5x108 CFUS SYN - PKU304 1x10 CFUS SYN - PKU304 2x109 CFUS

H2O

o°H

Sheet 45 of 90

Fig . 30A

Fig . 30B

US 9 , 943 , 555 B2

PKU specific :

PAL specific : - CH2 - CH - COOH

atent

pad

- CH2 - CH - COOH NH2 Phenylalanine

Lacking in PKU

Phenylalanine PAL3

Apr . 17 , 2018

HOM

- CH2 - CH - COOH

CH2 - CH - COOH

Tyrosine Tyrosine NHL

Phenylpyruvic acid

trans - Cinnamic acid Liver enzymes

Sheet 46 of 90

_ CH2 - CH - COOH ?? Phenyllactic acid Fig . 31A

Hippuric acid

Fig . 31B

US 9 , 943 , 555 B2

U . S . Patent atent Apr . 17 , 2018 Sheet 47 of 90 US 9 , 943 , 555 B2

Water SYNPKU901

the SYNPKU304 There DPhe ( MM )

water SYNPKU901 SYNPKU304 Fig . 32A

Phe ! !

# water # SYNPKU901

SYNPKU304

WW

AK : #

Fig . 32B


Phenyi pyruvate Water SYN - PXU901 SYN - PKU304

WW

Fig . 320

Phenyl lactate

SYN - PKU901 SYN - PKU304 0 . 20

WU 0 . 05

0 . 00

Fig . 32D


TCA Water * SYN - PKU901 0 . 08

SYN - PKU304

0 . 06

0 . 04 . WW

0 . 024 - - - vw - 0 . 02

Fig . 32E

Hippurie neid Hippuric acid water SÝN - PKU901 a 0 . 08 # SYN - PKU304

0 . 06 *

Wu _ _ _

* * * *

LLLLLLLLS

Fig . 32F


den

DPhe ( mm ) ? ? * * * i

o

water SYN - PKU801 SYN - PKU517

Fig . 33A


Water

Phe SYN - PKU801

SYN - PKU517 1

r . é

Ww

CA

Fig . 33B


Water SYN - PKU801 Phenyl pyruvate SYN - PKQ517

??

r ? ????? ?

????? -

Fig . 33C


Water

Phenyl lactate SYN - PKU801 SYN - PKU517

0 . 257 .

0 . 20 4

0 . 15 WW 0 . 10

0 . 05

0 . 00

- 0 . 05

Fig . 33D


TCA Water SYN - PKU801 SYN - PKU517

0 . 087 wwwww

0 . 06

Ww 0 . 02

. . . mer * 0 . 004 vivivivivivi 0 . 02

Fig . 33E

U . S . Patent atent Apr . 17 , 2018 Sheet 55 of 90 US 9 , 943 , 555 B2

Water SYN - PKU801

A SYN - PKU517 Hippuric acid

wu

0 . 00 L

Fig . 33F


Phe

? ?i #

mM Se of

F

* water TO water SYN - PKU705 TO water 4h SYN - PKU901 4h SYN - PKU705 4h SYN - PKU901 TO

Fig . 34A


A [ Phe ]

# mM

water SYN - PKU901 SYN - PKU705

Fig . 34B


. . . . . . . . . . . . . .

0 . 015

0 . 0104 mm

0 . 005 < * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * . . . . . . . . .

0 . 000

water TO SYN - PKU705 TO SYN - PKU901 4h SYN - PKU705 4h SYN - PKU901 TO

Fig . 340


Phenylpyruvic acid

WW

0 . 0 .

Water TO SYN - PKU901 TO SYN - PKU705 TO

Water 4h SYN - PKU705 4h SYN - PKU901 4h

Fig . 34D


TCA 0 . 015

0 . 010

0 . 005

0 . 000 1111 . . .

Water TO SYN - PKU901 TO . . . .

was SYN - PKU705 TO Water 4h SYN - PKU901 4h SYN - PKU705 4h

Fig . 34E


Hippuric Acid

0 . 020 ,

0 . 015

0 . 010

0 . 005

0 . 000

Water TO 40 106nyd - NAS SYN - PKU705 4h Water 4h . SYN - PKU901 TO SYN - PKU 705 TO

Fig . 34F

atent

Statisttintson

styttiin Hotlin

About

retur Het interim that

Whething

NH2 phenylalanine

Apr . 17 , 2018

wwwwwww

probetrotter

Within

??? VENH2 www

Sheet 62 of 90

wwww NH2

o - fluoro - DL - phenylalanine

p - fluoro - DL - phenylalanine

Fig . 35

US 9 , 943 , 555 B2

araC / BAD

insB / 1

male / K ( ~ 5327k !

( - 4688 kbp )

~ 71 . 4kbp )

atent

lacz ( ~ 448 kbp )

metJ / BL ( ~ 4551 kbp )

argE / C ( ~ 4590kb :

5 . 4 Mb

V5 Mb

dapa 748 kb

5 Mb

rhtC / rhtB 104409 kbp )

hemc / cya ( ~ 4387 kbp )

Apr . 17 , 2018

??? .

1 M6L

( 1141 kbp )

E . coli 1917 Nissle chromosome

- ( - 132kbp )

4 Mb

BPKL A raspekêp ) porno romanesti

Micrones ) proglalkbp )

par monde 3 Mb Fig . 36 ( ~ 330 % Abp )

.

Sheet 63 of 90

mety / argG ( ~ 3671 kbp )

2 Mb

Fig . 36 sediment

US 9 , 943 , 555 B2

atent Apr . 17 , 2018

Brightness of constitutive RFP integrated in

three locations : 1 . AraB / C 2 . MalE / K 3 . MetY / ArgG

4 . Nissle ( non - fluorescent )

Sheet 64 of 90

Fig . 37

US 9 , 943 , 555 B2

US 9 , 943 , 555 B2

Fig . 38 Days

- 6 8

9 ster

:

…

… .

.

. . . … . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . .

iiiiiii

10 - 11

: :

| : :

?

Sheet 65 of 90

: : : : : : :

nonersion

inseconnet

: : : :

www

.

Pierrrrrrrr

:

Nissle Recovered ( CFU / mg fecal sample )

Apr . 17 , 2018

Nissle Administered ( CFU / mL )

: : : : :

. . .

: : : : :

Nissle

: : : : :

wiwiwii

: :

atent

?

or : :

US 9 , 943 , 555 B2

Fig . 39A

Sheet 66 of 90

SC 2 Hd 92€ Hd 925 - Hd ST Sud S29 Hd SZZ = Hd

SainUWOZI

ETU sainuu 062 Sanuju 099

Apr . 17 , 2018

( WW ) aud

SajnuW0€ 2 sajnuw01

atent

SYN - PKU302

atent

SYN - PKU304

Apr . 17 , 2018

10 minutes

T ILIT

SumUW OE U

T

( WW ) aud

??????????

MMMMMMMMMMM

17111XXXXXXX

IITTITTIIIIIIIII

1111IIIIIIIIIIIII11111

60 minutes 90 minutes 0 120 minutes

Sheet 67 of 90

p

= 7 , 2

tk - 6 . 3

t? -

25

ph? : 4 . 25

ph? : 3 . 2

t? - 3 . 23

Fig . 39B

US 9 , 943 , 555 B2

Synthetic Biotics : Single Product ; Multiple MoAs

atent

MOA 1

Apr . 17 , 2018

MOA |

MOA 2 MOA 2

E . coli 1917 Nissle chromosome

Sheet 68 of 90

MOA 5

MOA 3

MOA 4 Fig . 40

US 9 , 943 , 555 B2

atent

Pfnrs

1000

2000

3000

-

PAL3 PAL3

-

I

_

phep phep


Apr . 17 , 2018

RBS Linear 3206 bp

FNR binding site

Sheet 69 of 90

Fig . 41

US 9 , 943 , 555 B2

RBS and leader region Pfnrs

2000 2000


atent

1000 1000

3000

Apr . 17 , 2018

Int5

Photorhabdus luminescens PAL3

Strong promoter attBS

attBS

- 10

Sheet 70 of 90

FNR binding site MALPT - kn - KIKO with fnrS - Int5 unflipped PAL3 rrnBUP ( 5351 . . 9091 ) 3741 bp Fig . 42A

US 9 , 943 , 555 B2

RBS . and leader region Pfnrs


atent

1000

2000

3000

Apr . 17 , 2018

Int5 Ints

Photorhabdus luminescens PAL3 X attBS

Strong promoter attbs

- 10

FNR binding site MALPT - kn - KIKO with fors - Int5 flipped PAL3 rrnBUP ( 5351 . . 9091 ) 3741 bp

Sheet 71 of 90

Fig . 42B

US 9 , 943 , 555 B2


e RBS and leader region madera

atent

1000 1000

2000 2000

3000 3000

4000

Int5

T7 RNA polymerase 7 RNA polymerase

Apr . 17 , 2018

attBS

promoter attBS Stronger attBS

Sheet 72 of 90

FNR - 10

binding site

MALPT - kn - KIKO with fors - Int5 unflipped T7 polymerase rrnBUP ( 5351 9091 ) 4794 bp Fig . 43A

US 9 , 943 , 555 B2


RBS and leader region 3000 3000

atent

1000 1000

2000 2000

4000

Int5

T7 RNA polymerase

Apr . 17 , 2018

attes

attBS

Strong promoter

- 10

FNR

Sheet 73 of 90

- 10

binding site

MALPT - kn - KIKO with fors - Int5 flipped T7 polymerase rrnBUP ( 5351 . . 9091 ) 4794 bp Fig . 43B

US 9 , 943 , 555 B2

atent

500 500

1000 1000

1500 1500

Photorhabdus luminescens PAL3

Apr . 17 , 2018

T7 promoter RBS and leader region

Sheet 74 of 90

1672 bp Fig . 430

US 9 , 943 , 555 B2

atent

500

1000

1500

2000

2500

ara arac

o

Int5 Ints

Apr . 17 , 2018

TSS

Para - INT5 ( recombinase ) 2861 bp )


Sheet 75 of 90

Fig . 44A

US 9 , 943 , 555 B2

atent

500

1000

1500

2000

2500

Apr . 17 , 2018

T7 RNA polymerase

attB5 attB5 plac

attB5


Sheet 76 of 90

malPT - Pconstitutive - T7 polymerase ( unflipped ) 285 Fig . 44B

US 9 , 943 , 555 B2

atent

In vivo inducer

Strong Promoter

TTTTTTTTT

range . .

-

-

1001

4

OFF

PAL3

OFF

Apr . 17 , 2018

Input

Percent ON

Reco

nbinase Iba PAL3 / 4

ON

TTTTTTTTTTTTTTT

·

- -

·

Sheet 77 of 90

· · · ·

* * * PAL3

O

+

102

Phenylalanine degradation

10 - 2 10 - 1 100 101 Inducer concentration

Fig . 45A

Fig . 45B

US 9 , 943 , 555 B2

+ Ara

Toxin - based arabinose

Ara ( after delivery )

Toxin ( T )

atent

N

N

002

w

*

* 774 time *

Protein levels

tetR

antitoxin

toxin

* * 1

arac

arac 11 tetrantitoxin | Parac ParaBAD

Antitoxin ( AT )

* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *

Apr . 17 , 2018

ter

Preto

* * * *

TetR

wwwwwwwwwwwwwwwwwwwwwwwwwwwww

Essential gene - based arabinose

ATT ATT Cells viable cell death Time

Ara ( after delivery )

+ Ara

Y

.

Sheet 78 of 90

. . .

.

. .

.

. . . .

.

. . . .

.

. . . required level of essential protein

.

| arac 1 essential Parac ParalAD

Protein levels

wwwwwwwwwwwwwwwwwwwww

Fig . 46A

Cells viable

Cell death Time

US 9 , 943 , 555 B2

atent Apr . 17 , 2018 Sheet 79 of 90 Sheet 79 of 90 US 9 , 943 , 555 B2

antitoxin filmen )

constitutive

toxin Heterologous Gene Fig . 46B

tetR ranija

se sono le

arabinose tetR

Parac ParaBAD arac


arabinose

| arac 17 | tetr ] [ antitoxin ] I toxin tetR Para? ParaBAD

or

constitutive

Fig . 46C

Kpni Bamit

were in the morning

FWD

Xmal

thin der

atent

Sall Sail

ECORI Avril

antt

Avril et

Sphi '

mentioned Not

www

????? Wewe ORI

Xbal Sac Xmal bar

Psti Hindi ( Spel

paci ASCI

Swal

Fisel PsHAI

Notti

dow

kand

TO

i

Paci

Apr . 17 , 2018

minder

TO ) Asct

Fsel pel RK2 ) Psha , Swah

Sphi !

!

* * * * *

toxin

representera

? ??? ???? ????

FWD no es

anipa

con we w

- - - > Plasmid of interest

Sheet 81 of 90

Desired host

were content

Fig . 47 Fig . 47

RBS

rep

antit

RBS repanti

kanR kank

US 9 , 943 , 555 B2

U . S . Patent Apr . 17 , 2018 Sheet 82 of 90 US 9 , 943 , 555 B2

800

600T 6001 clbA clbA 967 bp

Fig . 48A 2001 4001

2001 2001 ECOLIN _ 11195

atent

200

3001

400

100 100 ECOLIN 11195

95

200

FRT FRT

clbA clba

Apr . 17 , 2018

clba clbA KO 424 bp

Sheet 83 of 90

Fig . 48B

US 9 , 943 , 555 B2

Wild - type clbA ( SEQ ID NO : 64 )

atent

tac

7

aata

( ?

0 t

(

a

t

t

a

a

c

actt

0 caaatatcacataatcttaacatatcaataaacacagtaaagtttcatgtgaaaaacatcaaaca taaa

ataca ??

taaa

aaacc tgaggattgatatattaattggacatactagtttttttcatcaaaccagtagagataacttcott cactatctcaatgaggaagaaataaaacgctatgatcagtttcattttgtgagtgataaagaact ctatattttaagccgtatcctgctcaaaacagcactaaaaagatatcaacctgatgtctcattac aatcatggcaatttagtacgtgcaaatatggcaaaccatttatagtttttcctcagttggcaaaa aagattttttttaacctttcccatactatagatacagtagccgttgctattagttctcactgega gottggtgtcgatattgaacaaataagagatttagacaactcttatctgaatatcagtcagcatt tttttactocacaggaagctactaacatagtttcacttcctcottatgaaggtcaattacttttt tggaaaatgtggacgctcaaagaagcttacatcaaatatcgaggtaaaggcctatctttaggact ggattotattgaatttcatttaacaaataaaaaactaacttcaaaatatagagattcacctottt atttctctcaatggaaaatatgtaactcatttctcgcattagcctctccactcatcacccctaaa ataactattaagctatttcctatgcagtcccaactttatcaccacgactatcagctaattcatto gtcaaatgggcagaattgaatcgccacggataatctagacacttctgagccgtcgataatattga ttttcatattccgtcggtggtgtaagtatcccgcataatcgtgccattcacatttag Apr . 17 , 2018

clbA knockout ( SEQ ID NO : 65 )

Sheet 84 of 90

aaaaaac a

O

at

rt

* Cat t

c

a

a t

a

tt a

a t

ot C

t

c

t

cta

G

T

G

??? ggatggggggaaacatggataagttcaaagaaaaaaacccgttatctctgcgtgaaagacaagta ???? ttgcgcatgctggcacaaggtgatgagtactctcaaatatcacataatcttaacatatcaataaa cacagtaaagtttcatgtgaaaaacatcaaacataaaatacaagctcggaatacgaatcacgcta tacacattgctaacaggaatgagattatctaaatgaggattgaTGTGTAGGCTGGAGCTGCTTCG AAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCGGAATAGGAACTAAGGAG GATATTCATATGtcgtcaaatgggcagaattgaatcgccacggataatctagacacttctgagco gtcgataatattgattttcatattccgtcggtgg G

T

A

Fig . 49

US 9 , 943 , 555 B2


i Outer Membrane Outer Membrane Peptidoglycan Periplasm Inner Membrane Cytoplasm

1

Fig . 50

- - - - - - -

atent

??? BamA complex ????

Outer Membrane

Apr . 17 , 2018

|

Peptidoglycan

??III

Periplasm

H

I

I

SecYEG complex

Mit

SecYEG complex

Inner Membrane Inner Membrane

Sheet 86 of 90

Cytoplasm

Sec Signal

LINKER B - Domain

Fig . 51

US 9 , 943 , 555 B2

atent

TOIC

Tolco W

Outer Membrane 1111 Outer Membrane

Apr . 17 , 2018

ny

Peptidoglycan

Hlyc

Hlyc

Periplasm

null11111111111111111 1

Inner Membrane Inner Membrane

Sheet 87 of 90

Hl??

' HlyB

Cytoplasm

HIYA : 5 Fig . 52

US 9 , 943 , 555 B2

atent

Omocor Omot

Ompc or Ompt

PAL

TOIA

TOIB

.

Lpp ( Braun ' s Lipoprotein )

Outer Membrane

Apr . 17 , 2018

NUORIL I

Outer Membrane

P

o

1

S

VVVVV

peptidoglycan Peptidoglycan Periplasm Periplasm

0 0

mutatni mutiti W

Sheet 88 of 90

IU Inner Membrane

Degs , DegP , Nlpl , or other Periplasmic Protease

Cytoplasm

Fig . 53

US 9 , 943 , 555 B2


DEFINE

RE?? DESIGN INTEGRATE ???? sic BUILD

E

Fig . 54

U . S . Patent

FIG . 55A

FIG . 55B

FIG . 55C

FIG . 55D

FIG . 55E

1 - 1 -

-

- F

1

Apr . 17 , 2018

SC ,

SC ,

Aerobic Peraduction

Harvest

Vial Fill / Storage

Sheet 90 of 90

Upstream

Downstream

US 9 , 943 , 555 B2

US 9 , 943 , 555 B2 BACTERIA ENGINEERED TO REDUCE gastritis and severe allergic reactions ( e . g . , wheezing , light

HYPERPHENYLALANINEMIA headedness , nausea , flushing of the skin ) . The enzyme phenylalanine ammonia lyase ( PAL ) is

The present application is a continuation of U . S . appli capable of metabolizing phenylalanine to non - toxic levels of cation Ser . No . 15 / 154 , 934 , filed May 13 , 2016 , which 5 ammonia and transcinnamic acid . Unlike PAH , PAL does claims the benefit of priority to U . S . Provisional Patent not require THB cofactor activity in order to metabolize Application No . 62 / 161 , 137 , filed May 13 , 2015 , and U . S . phenylalanine . Studies of oral enzyme therapy using PAL Provisional Patent Application No . 62 / 256 , 052 , filed Nov . have been conducted , but “ human and even the animal 16 , 2015 , the contents of which are hereby incorporated by studies were not continued because PAL was not available in reference herein in their entirety . 10 sufficient amounts at reasonable cost ” ( Sarkissian et al . ,

This disclosure relates to compositions and therapeutic 1999 ) . A pegylated form of recombinant PAL ( PEG - PAL ) is methods for reducing hyperphenylalaninemia . In certain also in development as an injectable form of treatment . aspects , the disclosure relates to genetically engineered However , most subjects dosed with PEG - PAL have suffered bacteria that are capable of reducing hyperphenylalaninemia from injection site reactions and / or developed antibodies to in a mammal . In certain aspects , the compositions and 15 this therapeutic enzyme ( Longo et al . , 2014 ) . Thus , there is methods disclosed herein may be used for treating diseases significant unmet need for effective , reliable , and / or long associated with hyperphenylalaninemia , e . g . , phenylketonu term treatment for diseases associated with hyperphenylala ria . ninemia , including PKU .

Phenylalanine is an essential amino acid primarily found L - amino acid deaminase ( LAAD ) catalyzes oxidative in dietary protein . Typically , a small amount is utilized for 20 deamination of phenylalanine to generate phenylpyruvate , protein synthesis , and the remainder is hydroxylated to and trace amounts of ammonia and hydrogen peroxide . tyrosine in an enzymatic pathway that requires phenylala - Phenylpyruvic acid ( PPA ) is widely used in the pharmaceu nine hydroxylase ( PAH ) and the cofactor tetrahydrobiop tical , food , and chemical industries , and PPA is the starting terin . Hyperphenylalaninemia is a group of diseases associ - material for the synthesis of D - phenylalanine , a raw inter ated with excess levels of phenylalanine , which can be toxic 25 mediate in the production of many chiral drugs and food and cause brain damage . Primary hyperphenylalaninemia is additives . LAAD has therefore been studied in the context of caused by deficiencies in PAH activity that result from industrial PPA production ( Hou et al . 2015 , Appl Microbiol mutations in the PAH gene and / or a block in cofactor Biotechnol . 2015 October ; 99 ( 20 ) : 8391 - 402 ; “ Production of metabolism . phenylpyruvic acid from L - phenylalanine using an L - amino

Phenylketonuria ( PKU ) is a severe form of hyperphenyl - 30 acid deaminase from Proteus mirabilis : comparison of enzy alaninemia caused by mutations in the PAH gene . PKU is an matic and whole - cell biotransformation approaches ” ) . Phe autosomal recessive genetic disease that ranks as the most nylpyruvate is unable to cross the blood brain barrier ( Steele , common inborn error of metabolism worldwide ( 1 in 3 , 000 Fed Proc . 1986 June ; 45 ( 7 ) : 2060 - 4 ; “ Blood - brain barrier births ) , and affects approximately 13 , 000 patients in the transport of the alpha - keto acid analogs of amino acids , ” United States . More than 400 different PAH gene mutations 35 indicating that this conversion is useful in controlling the have been identified ( Hoeks et al . , 2009 ) . Current PKU neurological phenotypes of PKU . therapies require substantially modified diets consisting of In some embodiments , the disclosure provides genetically protein restriction . Treatment from birth generally reduces engineered bacteria that encode and express a phenylalanine brain damage and mental retardation ( Hoeks et al . , 2009 ; metabolizing enzyme ( PME ) . In some embodiments , the Sarkissian et al . , 1999 ) . However , the protein - restricted diet 40 disclosure provides genetically engineered bacteria that must be carefully monitored , and essential amino acids as encode and express phenylalanine ammonia lyase and / or well as vitamins must be supplemented in the diet . Further phenylalanine hydroxylase and / or L - aminoacid deaminase more , access to low protein foods is a challenge as they are and are capable of reducing hyperphenylalaninemia . more costly than their higher protein , nonmodified counter - In certain embodiments , the genetically engineered bac parts ( Vockley et al . , 2014 ) . 45 teria are non - pathogenic and may be introduced into the gut

In children with PKU , growth retardation is common on in order to reduce toxic levels of phenylalanine . In certain a low - phenylalanine diet ( Dobbelaere et al . , 2003 ) . In adult - embodiments , the phenylalanine ammonia lyase and / or phe hood , new problems such as osteoporosis , maternal PKU , nylalanine hydroxylase and / or L - aminoacid deaminase is and vitamin deficiencies may occur ( Hoeks et al . , 2009 ) . stably produced by the genetically engineered bacteria , Excess levels of phenylalanine in the blood , which can 50 and / or the genetically engineered bacteria are stably main freely penetrate the blood - brain barrier , can also lead to tained in vivo and / or in vitro . In certain embodiments , the neurological impairment , behavioral problems ( e . g . , irrita genetically engineered bacteria further comprise a phenyl bility , fatigue ) , and / or physical symptoms ( e . g . , convulsions , alanine transporter gene to increase their uptake of phenyl skin rashes , musty body odor ) . International guidelines alanine . The invention also provides pharmaceutical com recommend lifelong dietary phenylalanine restriction , which 55 positions comprising the genetically engineered bacteria , is widely regarded as difficult and unrealistic ( Sarkissian et and methods of modulating and treating disorders associated al . , 1999 ) , and “ continued efforts are needed to overcome the with hyperphenylalaninemia . biggest challenge to living with PKU — lifelong adherence to the low - phe diet ” ( Macleod et al . , 2010 ) . BRIEF DESCRIPTION OF THE FIGURES

In a subset of patients with residual PAH activity , oral 60 administration of the cofactor tetrahydrobiopterin ( also FIG . 1 depicts a synthetic biotic for treating phenylke referred to as THB , BH4 , Kuvan , or sapropterin ) may be tonuria ( PKU ) and disorders characterized by hyperphenyl used together with dietary restriction to lower blood phe alaninemia . nylalanine levels . However , cofactor therapy is costly and FIG . 2 A depicts a schematic of phenylalanine hydroxy only suitable for mild forms of phenylketonuria . The annual 65 lase action in phenylketonuria ( PKU ) . FIG . 2B depicts a cost of Kuvan , for example , may be as much as $ 57 , 000 per schematic of phenylalanine hydroxylase ( PAH ) action . FIG . patient . Additionally , the side effects of Kuvan can include 2C depicts a schematic of phenylalanine ammonia lyase

US 9 , 943 , 555 B2

( PAL ) action . FIG . 2D depicts a schematic of L - amino acid the strain is SYN - PKU511 . FIG . 13C depicts a schematic deaminase ( LAAD ; e . g . , from Proteus mirabilis ) action . diagram of one preferred embodiment of the disclosure ,

FIG . 3 depicts a synthetic biotic for treating phenylke - wherein the E . coli Nissle chromosome is engineered to tonuria ( PKU ) and disorders characterized by hyperphenyl contain five copies of PAL under the control of an oxygen alaninemia . 5 level - dependent promoter ( e . g . , PfnrS - PAL3 ) inserted at

FIG . 4 depicts a synthetic biotic for treating phenylke different integration sites on the chromosome ( malE / K , tonuria ( PKU ) and disorders characterized by hyperphenyl - vicS / nepl . malP / T . agal / rsml . and cea ) , and one copy of a alaninemia . phenylalanine transporter gene under the control of an FIG . 5 depicts a synthetic biotic for treating phenylke oxygen level - dependent promoter ( e . g . , PfnrS - pheP ) tonuria ( PKU ) and disorders characterized by hyperphenyl - 10 inserted at a different integration site on the chromosome alaninemia . ( lacZ ) . The genome is further engineered to include a thyA FIG . 6 depicts the gene organization of an exemplary auxotrophy , in which the thyA gene is deleted and / or construct comprising a gene encoding PAL3 and a Tet promoter sequence on a high - copy plasmid e . g . , as com replaced with an unrelated gene , as well as a kanamycin prised in SYN - PKU202 , SYN - PKU303 . resistance gene .

FIG . 7 depicts the gene organization of an exemplary FIG . 14 depicts the gene organization of a non - limiting construct comprising a gene encoding PAL3 and an FNR exemplary construct comprising a gene encoding araC and promoter sequence on a low - copy plasmid , e . g . , as com a gene encoding LAAD from Proteus mirabilis and an prised in SYN - PKU304 , SYN - PKU307 , SYN - PKU305 , arabinose inducible promoter ( ParaBAD ) sequence for chro SYN - PKU306 . 20 mosomal insertion into the endogenous arabinose operon for

FIG . 8 depicts the gene organization of an exemplary chromosomal integration , e . g . , as comprised in SYN construct comprising a gene encoding PAL3 and a Tet PKU705 . promoter sequence on a low - copy plasmid , e . g . , SYN . FIG . 15A depicts phenylalanine concentrations in samples PKU302 , SYN - PKU201 . comprising bacteria expressing PAL1 or on low - copy ( LC ;

FIG . 9 depicts the gene organization of an exemplary 25 SYN - PKU101 ) or high - copy ( HC ; SYN - PKU102 ) plasmids construct , e . g . , comprised in SYN - PKU401 , comprising a or PAL3 on low - copy ( LC ; SYN - PKU201 ) or high - copy cloned LAAD gene under the control of a Tet promoter ( HC ; SYN - PKU202 ) plasmids , induced with anhydrous sequence and a Tet repressor gene . tetracycline ( ATC ) , and then grown in culture medium

FIG . 10 depicts a schematic representation of the con - supplemented with 4 mM ( 660 , 000 ng / mL ) of phenylala struction of a phep knock - in strain , wherein recombineering 30 nine . Samples were removed at 0 hrs , 4 hrs , and 23 hrs . is used to insert a second copy of phep into the Nissle lacZ Phenylalanine concentrations were determined by mass gene . spectrometry . FIG . 15B depicts cinnamate levels in samples

FIG . 11 depicts the gene organization of an exemplary at 4 hrs and 23 hrs post - induction . In PAL3 - expressing construct comprising a gene encoding PheP , a gene encoding strains , the PAL3 gene is derived from Photorhabdus lumi TetR , and a tet promoter sequence for chromosomal inser - 35 nescens , an enterobacterium in the same taxonomic subdi tion e . g . , as for example comprised in SYN - PKU203 , SYN - vision as Escherichia coli . PKU401 , SYN - PKU402 , SYN - PKU302 , and SYN . FIG . 16A depicts phenylalanine concentrations in samples PKU303 . comprising bacteria expressing PAL1 or PAL3 on low - copy

FIG . 12A depicts the gene organization of an exemplary ( LC ) or high - copy ( HC ) plasmids , or further comprising a construct , comprising a cloned PAL3 gene under the control 40 copy of phep driven by the Tet promoter integrated into the of an FNR promoter sequence , on a low - copy , kanamycin - chromosome . Bacteria were induced with ATC , and then resistant plasmid ( PSC101 origin of replication . Under grown in culture medium supplemented with 4 mM ( 660 , anaerobic conditions , PAL3 degrades phenylalanine to non 000 ng / mL ) of phenylalanine to an OD600 of 2 . 0 . Samples toxic trans - cinnamate . FIG . 12B depicts an additional copy were removed at 0 hrs , 2 hrs , and 4 hrs post - induction and of the endogenous E . coli high affinity phenylalanine trans - 45 phenylalanine concentrations were determined by mass porter , phep , driven by the PfnrS promoter and inserted into spectrometry . Notably , the additional copy of pheP permitted the lacZ locus on the Nissle chromosome . the degradation of phenylalanine ( 4 mM ) in 4 hrs . FIG . 16B FIGS . 13A , 13B , and 13C depict schematic diagrams of depicts cinnamate levels in samples at 2 hrs and 4 hrs

non - limiting embodiments of the disclosure . FIG . 13A post - induction . In some embodiments , cinnamate may be depicts phenylalanine degradation components integrated 50 used as an alternative biomarker for strain activity . PheP into the E . coli Nissle chromosome . In some embodiments , overexpression improves phenylalanine metabolism in engi engineered plasmid - free bacterial strains are used to prevent neered bacteria . Strains analyzed in this data set are SYN plasmid conjugation in vivo . In some embodiments , mul - PKU101 , SYN - PKU102 , SYN - PKU202 , SYN - PKU201 , tiple insertions of the PAL gene result in increased copy SYN - PKU401 , SYN - PKU402 , SYN - PKU203 , SYN number and / or increased phenylalanine degradation activity . 55 PKU302 , SYN - PKU303 . In some embodiments , a copy of the endogenous E . coli high FIGS . 17A and 17B depict the state of one non - limiting affinity phenylalanine transporter , phep , is driven by the embodiment of the PAL construct under non - inducing ( FIG . PfnrS promoter and is inserted into the lacZ locus . FIG . 13B 17A ) and inducing ( FIG . 17B ) conditions . FIG . 17A depicts depicts a schematic diagram of one non - limiting embodi - relatively low PAL and PheP production under aerobic ment of the disclosure , wherein the E . coli Nissle chromo - 60 conditions due to oxygen ( 0 ) preventing FNR from some is engineered to contain four copies of PfnrS - PAL dimerizing and activating PAL and / or phep gene expression . inserted at four different insertion sites across the genome FIG . 17B depicts up - regulated PAL and PheP production ( malE / K , yicS / nepl , agal / rsml , and cea ) , and one copy of a under anaerobic conditions due to FNR dimerizing and phenylalanine transporter gene inserted at a different inser - inducing FNR promoter - mediated expression of PAL and tion site ( lacZ ) . In this embodiment , the PAL gene is PAL3 65 pheP ( squiggle above “ PAL ” and “ pheP ” ) . Arrows adjacent derived from P . luminescens , and the phenylalanine trans - to a single rectangle , or a cluster of rectangles , depict the porter gene is phep derived from E . coli . In one embodiment , promoter responsible for driving transcription ( in the direc

US 9 , 943 , 555 B2

tion of the arrow ) of such gene ( s ) . Arrows above each phenylalanine was quantified by mass spectrometry . SYN rectangle depict the expression product of each gene . PKU511 comprises 5 integrated copies of an anaerobically

FIG . 18 depicts B - galactosidase levels in samples com ( FNR ) controlled gene encoding phenylalanine ammonia prising bacteria harboring a low - copy plasmid expressing lyase ( PAL ) at 5 chromosomal locations and an anaerobi lacZ from an FNR - responsive promoter selected from the 5 cally controlled gene encoding a high affinity Phe trans exemplary FNR promoters shown Table 3 ( Pfnr1 - 5 ) . Dif - porter ( pheP ) integrated in the lacZ locus . ferent FNR - responsive promoters were used to create a FIGS . 25A and 25B depict phenylalanine concentrations library of anaerobic - inducible reporters with a variety of in cultures of a synthetic probiotic strain , SYN - PKU401 , in cultures o expression levels and dynamic ranges . These promoters which comprises a high copy pUC57 - plasmid with LAAD included strong ribosome binding sites . Bacterial cultures 10 driven by a Tet inducible promoter , cells were grown in were grown in either aerobic ( + 0 , ) or anaerobic conditions flasks shaking at 37 C , and induced with TCA at early log ( 02 ) . Samples were removed at 4 hrs and the promoter phase for a duration of 2 hours . Cells were spun down and activity based on B - galactosidase levels was analyzed by performing standard B - galactosidase colorimetric assays . re - suspended in assay buffer containing phenylalanine . Cells

FIG . 19 A depicts a schematic representation of the lacZ 15 were measured at various cell concentrations and at varying gene under the control of an exemplary FNR promoter oxygen levels . Cells were either incubated aerobically ( 1 ml ) ( P ) . LacZ encodes the B - galactosidase enzyme and is a in a 14 ml culture tube , shaking at 250 rpm . For microaero common reporter gene in bacteria . FIG . 19B depicts FNR bic conditions , cells ( 1 ml ) were incubated in a 1 . 7 ml promoter activity as a function of ß - galactosidase activity in conical tube without shaking . Cells were incubated anaero SYN - PKU904 . SYN - PKU904 , an engineered bacterial 20 bically in a Coy anaerobic chamber supplying 90 % N2 , 5 % strain harboring a low - copy fnrS - lacZ fusion gene , was CO2 , and 5 % H2 . Aliquots were removed from cell assays grown in the presence or absence of oxygen . Values for every 30 min for 2 hrs for phenylalanine quantification by standard B - galactosidase colorimetric assays are expressed mass spectrometry . FIG . 25A depicts phenylalanine concen in Miller units ( Miller , 1972 ) . These data suggest that the trations under aerobic conditions using two cell densities . A fnrS promoter begins to drive high - level gene expression 25 and B are duplicates under the same experimental condi within 1 hr . under anaerobic conditions . FIG . 19C depicts tions . The activity in aerobic conditions is ~ 50 umol / hr . / 1e9 the growth of bacterial cell cultures expressing lacZ over cells . FIG . 25B depicts phenylalanine concentrations of time , both in the presence and absence of oxygen . aerobically , microaerobically , or anaerobically grown cells .

FIGS . 20A and 20B depict phenylalanine levels produced FIG . 26A shows phenylalanine concentrations before and under aerobic ( FIG . 20A ) or anaerobic conditions ( FIG . 30 after feeding in an in vivo mouse model of PKU . At the 20B ) in samples of wild - type Nissle , samples of bacteria beginning of the study , homozygous BTBR - Pahenu2 mice comprising a low - copy plasmid expressing PAL3 from the were given water supplemented with 100 micrograms / mL Tet promoter or exemplary FNR promoters , or further com - ATC and 5 % sucrose . Mice were fasted by removing chow prising a copy of phep driven by the Tet promoter and overnight ( 10 hrs ) , and blood samples were collected by integrated into the chromosome . Samples were incubated in 35 mandibular bleeding the next morning in order to determine culture medium supplemented with ATC and 4 mM ( 660 , baseline phenylalanine levels . Mice were given chow again , 000 ng / mL ) of phenylalanine . Samples were removed at 0 gavaged with 100 microliters ( 5x10° CFU ) of bacteria hrs , 2 hrs , 4 hrs , and 24 hrs . Phenylalanine concentration was ( SYN - PKU302 or control Nissle ) after 1 hr . , and allowed to determined by mass spectrometry . These data suggest that feed for another 2 hrs . Serum phenylalanine concentrations the FNR - responsive fnrS promoter is as effective at activat - 40 were determined 2 hrs post - gavage . FIG . 26B shows the ing PAL3 expression as a tetracycline - inducible promoter percent ( % ) change in blood phenylalanine concentrations under anaerobic conditions . before and after feeding as a male or female group average

FIG . 21 depicts phenylalanine concentrations in cultures ( p < 0 . 01 ) . of synthetic probiotic strains , with and without an additional FIGS . 27A and 27B depict blood phenylalanine concen copy of pheP inserted on the chromosome . After 1 . 5 hrs of 45 trations relative to baseline following subcutaneous phenyl growth , cultures were placed in Coy anaerobic chamber alanine challenge in an in vivo mouse model of PKU . Mice supplying 90 % N , 5 % CO . , and 5 % H , . After 4 hrs of were orally gavaged with 200 uL of H , O ( n = 30 ) , SYN induction , bacteria were resuspended in assay buffer con - PKU901 ( n = 33 ) , or SYN - PKU303 ( n = 34 ) at 30 and 90 taining 4 mM phenylalanine . Aliquots were removed from minutes post - phenylalanine injection ( 0 . 1 mg / gram of aver cell assays every 30 min for 3 hrs for phenylalanine quan - 50 age group body weight ) . FIGS . 27A and 27B show blood tification by mass spectrometry . Phenylalanine degradation phenylalanine concentrations at 2 hrs and 4 hrs post - phe rates in strains comprising an additional copy of phep nylalanine injection , respectively . These data indicate that ( SYN - PKU304 and SYN - PKU305 ; left ) were higher than oral administration of the engineered probiotic strain SYN strains lacking an additional copy of pheP ( SYN - PKU308 PKU303 significantly reduces blood phenylalanine levels in and SYN - PKU307 ; right ) . 55 mice , compared to mice administered mock treatment ( H2O )

FIG . 22 depicts trans - cinnamate concentrations ( PAL or the parental strain ( SYN - PKU901 ) ( * , p < 0 . 05 ; * * * , activity ) for strains comprising single PAL3 insertions at p < 0 . 001 ; * * * * , p < 0 . 00001 ) . SYN - PKU303 is capable of various locations on the chromosome . intercepting enterorecirculating phenylalanine .

FIG . 23 depicts trans - cinnamate concentrations ( PAL FIG . 28 depicts blood phenylalanine concentrations rela activity ) for strains comprising multiple PAL3 insertions at 60 tive to baseline following subcutaneous phenylalanine chal various locations on the chromosome . lenge in an in vivo mouse model of PKU . Mice were orally

FIG . 24 depicts phenylalanine concentrations in cultures gavaged with 200 uL of H2O ( n = 30 ) , SYN - PKU901 ( n = 33 ) , of synthetic probiotic strain SYN - PKU511 over time . After SYN - PKU303 ( n = 34 ) , or SYN - PKU304 ( n = 34 ) at 30 and 90 2 . 5 hrs of growth , cultures were placed in Coy anaerobic minutes post - phenylalanine injection ( 0 . 1 mg / gram of aver chamber supplying 90 % N2 , 5 % CO2 , and 5 % H2 . After 3 . 5 65 age group body weight ) . Blood phenylalanine concentra hrs of induction in phenylalanine containing medium , whole tions post phenylalanine injection indicate that SYN cell extracts were prepared every 30 min for 3 hrs and PKU304 ( low copy plasmid containing forS - PAL ) is at least

US 9 , 943 , 555 B2

as effective as SYN - PKU303 ( high copy plasmid containing centrations of phenylalanine ( FIG . 33A ) , and absolute val Tet - PAL ) in reducing circulating Phe levels in the entero ues of phenylalanine and PKU specific and PAL specific recirculation model . metabolites ( FIGS . 33B , 33C , 33D , 33E , and 33F ) following

FIGS . 29A and 29B depict blood phenylalanine concen subcutaneous phenylalanine challenge in an in vivo mouse trations relative to baseline following subcutaneous phenyl - 5 model of PKU . Mice were orally gavaged with a total of alanine challenge in an in vivo mouse model of PKU . Mice 8004 of H2O ( n = 9 ] ) , SYN - PKU801 ( n = 12 ) , or 800 uL of were orally gavaged with H2O , SYN - PKU901 , SYN SYN - PKU517 ( n = 12 ) ( 3 . 6e10 cfu / mouse ) at 30 and 90 PKU303 , or SYN - PKU304 at 30 and 90 minutes post minutes post - phenylalanine injection . FIG . 33A depicts phenylalanine injection ( 0 . 1 mg / gram of average group body blood phenylalanine concentrations relative to baseline ; weight ) . FIGS . 29A and 29B show blood phenylalanine 10 total metabolic activity for SYN - PKU517 was calculated as concentrations at 2 hrs and 4 hrs post - phenylalanine injec 39 . 6 umol / hr . and the total reduction in Aphe was 17 % tion , respectively . These data indicate that oral administra tion of engineered probiotic strains SYN - PKU303 and SYN relative to SYN - PKU801 ( P < 0 . 05 ) . FIG . 33B depicts the PKU304 significantly reduces blood phenylalanine levels in blood phenylalanine concentration at 0 and 4 hours post mice compared to mice administered mock treatment ( H . O ) 15 phenylalanine injection . FIG . 33C depicts the blood phe or the parental strain ( SYN - PKU901 ) ( * p < 0 . 05 ; * * nylpyruvate concentration at 0 and 4 hours post phenylala p < 0 . 01 ; * * * , p < 0 . 001 ; * * * * , p < 0 . 0001 ) . FIGS . 29C and 29D nine injection . FIG . 33D depicts the blood phenyllactate depict scatter plots of the data shown in FIGS . 29A and 29B . concentration at 0 and 4 hours post phenylalanine injection .

FIGS . 30A and 30B depict blood phenylalanine concen FIG . 33E depicts the blood t - cinnamic acid concentration at trations relative to baseline following subcutaneous phenyl - 20 0 and 4 hours post phenylalanine injection . FIG . 33F depicts alanine challenge in an in vivo mouse model of PKU . Mice the blood hippuric acid concentration at 0 and 4 hours post were orally gavaged with 200 uL of H2O ( n = 12 ) , 200 uL of phenylalanine injection . SYN - PKU901 ( n = 12 ) , or 100 , 200 , or 400 uL of SYN - FIGS . 34A , 34B , 34C , 34D , 34E , and 34F depict blood PKU304 ( n = 12 in each dose group ) at 30 and 90 minutes phenylalanine concentrations relative to baseline and con post - phenylalanine injection ( 0 . 1 mg / gram of average group 25 centrations of phenylalanine ( FIG . 34A ) , and absolute val body weight ) . FIGS . 30A and 30B show a dose - dependent ues of phenylalanine and PKU specific and PAL specific decrease in blood phenylalanine levels in SYN - PKU304 - metabolites ( FIGS . 34B , 340 , 34D , 34E , and 34F ) following treated mice compared to mice administered mock treatment subcutaneous phenylalanine challenge in an in vivo mouse ( HO ) or the parental strain ( SYN - PKU901 ) ( * 30 % model of PKU . Mice were orally gavaged with a total of 800 decrease ; p < 0 . 05 ) . This experiment represents one of eight 30 uL of H2O ( n = 12 ) , SYN - PKU901 ( n = 12 ) , or 800 uL of studies of this same design , and each one shows that SYN - PKU705 ( n = 12 ) ( 3 . 6e10 cfu / mouse ) at 30 and 90 SYN - PKU304 is capable of intercepting enterorecirculating minutes post - phenylalanine injection . FIG . 34A depicts phenylalanine . blood phenylalanine concentrations relative to baseline ;

FIGS . 31A and 31B depicts a schematic of PKU specific total metabolic activity for SYN - PKU705 was calculated as and PAL specific phenylalanine metabolites . FIG . 31A 35 133 . 2 umol / hr . and the total reduction in Aphe was 30 % depicts a schematic of the conversion of phenylalanine to relative to SYN - PKU901 ( P < 0 . 05 ) . FIG . 34B depicts the phenylpyruvic acid and phenyllactic acid in the absence of blood phenylalanine concentration at 0 and 4 hours post functional PAH . FIG . 31B depicts a schematic of the con - phenylalanine injection . FIG . 34C depicts the blood phe version of phenylalanine to trans - cinnamic acid by PAL3 , nylpyruvate concentration at 0 and 4 hours post phenylala which is further metabolized to hippuric acid by liver 40 nine injection . FIG . 34D depicts the blood phenyllactate enzymes . These metabolites can be detected by mass spec - concentration at 0 and 4 hours post phenylalanine injection . trometry as described in Examples 24 - 26 or by other means . FIG . 34E depicts the blood t - cinnamic acid concentration at

FIGS . 32A , 32B , 32C , 32D , 32E , and 32F depict blood and 4 hours post phenylalanine injection . FIG . 34F depicts phenylalanine concentrations relative to baseline and con - the blood hippuric acid concentration at 0 and 4 hours post centrations of phenylalanine ( FIG . 32A ) , and absolute val - 45 phenylalanine injection . ues of phenylalanine and PKU specific and PAL specific FIG . 35 depicts phenylalanine and 2 toxic analogs , metabolites ( FIGS . 32B , 32C , 32D , 32E , and 32F ) following p - fluoro - DL - phenylalanine , and o - fluoro - DL - phenylalanine , subcutaneous phenylalanine challenge in an in vivo mouse which are useful for an untargeted approach to select PAL model of PKU . Mice were orally gavaged with a total of enzymes with increased activity . P - fluoro - DL - phenylala 8004 of H2O ( n = 12 ) , SYN - PKU901 ( n = 12 ) , or 8004 of 50 nine , and o - fluoro - DL - phenylalanine are incorporated into SYN - PKU304 ( n = 12 ) ( 2 . 9e10 cfu / mouse ) at 30 and 90 cellular protein in the place of phenylalanine , resulting in minutes post - phenylalanine injection . FIG . 32A depicts cell death . Since these compounds are readily taken up by blood phenylalanine concentrations relative to baseline ; Phep , and can act as a substrate for PAL as shown below , total metabolic activity for SYN - PKU304 was calculated as they can be employed in genetic selection and screening for 81 . 2 umol / hr . and the total reduction in Aphe was 45 % 55 the identification of strains with improved Phe consumption relative to SYN - PKU901 ( P < 0 . 05 ) . FIG . 32B depicts the activity . Mutations allowing more efficient PAL metabolism blood phenylalanine concentration at 0 and 4 hours post may prevent the incorporation of the phenylalanine analog phenylalanine injection . FIG . 32C depicts the blood phe into cellular protein , therefore allowing growth under higher nylpyruvate concentration at 0 and 4 hours post phenylala concentrations of the analog . nine injection . FIG . 32D depicts the blood phenyllactate 60 FIG . 36 depicts a map of exemplary integration sites concentration at 0 and 4 hours post phenylalanine injection within the E . coli 1917 Nissle chromosome . These sites FIG . 32E depicts the blood t - cinnamic acid concentration at indicate regions where circuit components may be inserted O and 4 hours post phenylalanine injection . FIG . 32F depicts into the chromosome without interfering with essential gene the blood hippuric acid concentration at 0 and 4 hours post expression . Backslashes ( l ) are used to show that the inser phenylalanine injection . 65 tion will occur between divergently or convergently

FIGS . 33A , 33B , 33C , 33D , 33E , and 33F depict blood expressed genes . Insertions within biosynthetic genes , such phenylalanine concentrations relative to baseline and con - as thyA , can be useful for creating nutrient auxotrophies . In

US 9 , 943 , 555 B2 10

some embodiments , an individual circuit component is FIG . 45A depicts a schematic of a recombinase - based inserted into more than one of the indicated sites . switch to activate PAL3 expression using different inducible

FIG . 37 depicts three bacterial strains which constitu - promoters and ribosome binding sites . Recombinase expres tively express red fluorescent protein ( RFP ) . In strains 1 - 3 , sion causes recombinatorial flipping of the PAL3 gene to the the rfp gene has been inserted into different sites within the 5 ON orientation , leading to the production of PAL3 and to the bacterial chromosome , and results in varying degrees of degradation of phenylalanine . In some embodiments , brightness under fluorescent light . Unmodified E . coli Nissle recombinase - based switches are tuned to respond to specific ( strain 4 ) is non - fluorescent . levels of an inducer . FIG . 45B depicts the relationship

FIG . 38 depicts a graph of Nissle residence in vivo . between the concentration of an inducer and the percentage Streptomycin - resistant Nissle was administered to mice via 10 of PAL3 - containing constructs in the ON orientation . The oral gavage without antibiotic pre - treatment . Fecal pellets shaded area shows the predicted efficacy range of the from 6 total mice were monitored post - administration to inducer in vivo . determine the amount of administered Nissle still residing FIG . 46A depicts another non - limiting embodiment of the within the mouse gastrointestinal tract . The bars represent disclosure , wherein the expression of a heterologous gene is the number of bacteria administered to the mice . The line 15 activated by an exogenous environmental signal . In the represents the number of Nissle recovered from the fecal absence of arabinose , the AraC transcription factor adopts a samples each day for 10 consecutive days . conformation that represses transcription . In the presence of

FIGS . 39A and 39B depict phenylalanine concentrations arabinose , the AraC transcription factor undergoes a con in SYN - PKU302 cultures over time . After 1 . 5 hrs of growth , formational change that allows it to bind to and activate the ATC was added to cultures of SYN - PKU302 , and SYN - 20 ParaBAD promoter ( ParaBAD ) , which induces expression of PKU304 cultures were placed in Coy anaerobic chamber the Tet repressor ( TetR ) and an anti - toxin . The anti - toxin supplying 90 % N2 , 5 % CO2 , and 5 % H2 . After 4 hrs of builds up in the recombinant bacterial cell , while TetR induction , bacteria were resuspended in assay buffer con - prevents expression of a toxin ( which is under the control of taining 4 mM phenylalanine and at different pH ( pH range a promoter having a TetR binding site ) . However , when 7 . 25 - 2 . 25 ) . Aliquots were removed from cell assays every 25 arabinose is not present , both the anti - toxin and TetR are not 30 min for 2 hrs for phenylalanine quantification by mass expressed . Since TetR is not present to repress expression of spectrometry . Phenylalanine degradation rates decreased as the toxin , the toxin is expressed and kills the cell . FIG . 46A pH of the assay buffer decreased in both strains , SYN - also depicts another non - limiting embodiment of the disclo PKU302 ( FIG . 39A ) and SYN - PKU304 ( FIG . 39B ) . sure , wherein the expression of an essential gene not found

FIG . 40 depicts an exemplary schematic of the E . coli 30 in the recombinant bacteria is activated by an exogenous 1917 Nissle chromosome comprising multiple mechanisms environmental signal . In the absence of arabinose , the AraC of action ( MoAs ) . transcription factor adopts a conformation that represses

FIG . 41 depicts the gene organization of an exemplary transcription of the essential gene under the control of the construct in which the PAL3 and phep genes are co - tran - araBAD promoter and the bacterial cell cannot survive . In scribed under the control of an exemplary FNR promoter 35 the presence of arabinose , the AraC transcription factor ( Pfurs ) . undergoes a conformational change that allows it to bind to FIGS . 42A and 42B depict the gene organization of an and activate the araBAD promoter , which induces expres

exemplary construct in which the Int5 recombinase gene is s ion of the essential gene and maintains viability of the operably linked to an exemplary FNR promoter ( Ptnrs ) , and bacterial cell . the PAL3 gene is operably linked to a strong constitutive 40 FIG . 46B depicts a non - limiting embodiment of the promoter . FIG . 42A depicts a schematic diagram of the disclosure , where an anti - toxin is expressed from a consti PAL3 gene , flanked by Int5 sites , in the OFF orientation ( 3 ' tutive promoter , and expression of a heterologous gene is to 5 ' ) . When Int5 gene expression is activated under anaero - activated by an exogenous environmental signal . In the bic conditions , recombinatorial flipping of PAL3 to the ON absence of arabinose , the AraC transcription factor adopts a orientation ( 5 ' to 3 ' ; FIG . 42B ) leads to the production of 45 conformation that represses transcription . In the presence of PAL3 and to phenylalanine metabolism . Any strong consti - arabinose , the AraC transcription factor undergoes a con tutive promoter sequence may be used . formational change that allows it to bind to and activate the

FIGS . 43A , 43B , and 43C depict the gene organization of araBAD promoter , which induces expression of TetR , thus an exemplary construct in which the Int5 recombinase gene preventing expression of a toxin . However , when arabinose is operably linked to an FNR promoter ( Plus ) , and the gene 50 is not present , TetR is not expressed , and the toxin is encoding T7 RNA polymerase is flanked by recombinase expressed , eventually overcoming the anti - toxin and killing sites and operably linked to a strong constitutive promoter . the cell . The constitutive promoter regulating expression of FIG . 43A depicts a schematic diagram of the T7 RNA the anti - toxin should be a weaker promoter than the pro polymerase gene , flanked by Int5 sites , in the OFF orienta moter driving expression of the toxin . The araC gene is tion . When Int5 gene expression is activated under anaerobic 55 under the control of a constitutive promoter in this circuit . conditions , the T7 RNA polymerase gene is flipped to the FIG . 46C depicts another non - limiting embodiment of the ON orientation ( FIG . 43B ) . In engineered bacterial strains disclosure , wherein the expression of a heterologous gene is comprising a copy of PAL3 under the control of a 17 - driven activated by an exogenous environmental signal . In the promoter ( P . 77 ; FIG . 43C ) , T7 RNA polymerase expression absence of arabinose , the AraC transcription factor adopts a leads to the production of PAL3 and to phenylalanine 60 conformation that represses transcription . In the presence of metabolism . arabinose , the AraC transcription factor undergoes a con

FIGS . 44A and 44B depict the gene organization of an formational change that allows it to bind to and activate the exemplary construct in which the Int5 recombinase gene is araBAD promoter , which induces expression of the Tet operably linked to an ParaBAD promoter ( P AD ) , and the repressor ( TetR ) and an anti - toxin . The anti - toxin builds up gene encoding T7 RNA polymerase is flanked by recombi - 65 in the recombinant bacterial cell , while TetR prevents nase sites and operably linked to a strong constitutive expression of a toxin ( which is under the control of a promoter . promoter having a TetR binding site ) . However , when

US 9 , 943 , 555 B2 12

arabinose is not present , both the anti - toxin and TetR are not starter culture 1 ( SC1 ) : loop full - glycerol stock , duration expressed . Since TetR is not present to repress expression of overnight , temperature 37° C . , shaking at 250 rpm . FIG . 55B the toxin , the toxin is expressed and kills the cell . The araC depicts the parameters for starter culture 2 ( SC2 ) : 1 / 100 gene is either under the control of a constitutive promoter or dilution from SC1 , duration 1 . 5 hours , temperature 37° C . , an inducible promoter ( e . g . , AraC promoter ) in this circuit . 5 shaking at 250 rpm . FIG . 55C depicts the parameters for the

FIG . 47 depicts the use of GeneGuards as an engineered production bioreactor : inoculum — SC2 , temperature 37° C . , safety component . All engineered DNA is present on a pH set point 7 . 00 , pH dead band 0 . 05 , dissolved oxygen set plasmid which can be conditionally destroyed . See , e . g . , point 50 % , dissolved oxygen cascade agitation / gas FLO , Wright et al . , 2015 . agitation limits 300 - 1200 rpm , gas FLO limits 0 . 5 - 20 stan

FIG . 48A depicts a schematic diagram of a wild - type clbA 10 dard liters per minute , duration 24 hours . FIG . 55D depicts construct . FIG . 48B depicts a schematic diagram of a clbA the parameters for harvest : centrifugation at speed 4000 rpm knockout construct . and duration 30 minutes , wash 1x10 % glycerol / PBS , cen

FIG . 49 depicts exemplary sequences of a wild - type clb trifugation , re - suspension 10 % glycerol / PBS . FIG . 55E construct and a clbA knockout construct . depicts the parameters for vial fill / storage : 1 - 2 mL aliquots ,

FIG . 50 depicts a schematic of a secretion system based 15 - 80° C . on the flagellar type III secretion in which a modified flagellum is used to secrete a therapeutic peptide of interest DESCRIPTION OF EMBODIMENTS by recombinantly fusing the peptide to an N - terminal fla gellar secretion signal of a native flagellar component so that The present disclosure includes genetically engineered the intracellularly expressed chimeric peptide can be mobi - 20 bacteria , pharmaceutical compositions thereof , and methods lized across the inner and outer membranes into the sur - of modulating and treating disorders associated with hyper rounding host environment . phenylalaninemia . In some embodiments , the genetically

FIG . 51 depicts a schematic of a type V secretion system engineered bacteria comprise a gene encoding non - native for the extracellular production of recombinant proteins in phenylalanine ammonia lyase ( PAL ) and are capable of which a therapeutic peptide ( star ) can be fused to an N - ter - 25 processing and reducing phenylalanine in a mammal . Thus , minal secretion signal , a linker and the beta - domain of an the genetically engineered bacteria and pharmaceutical com auto - secreter . In this system , the N - terminal signal sequence positions comprising those bacteria may be used to metabo directs the protein to the SecA - YEG machinery , which lize phenylalanine in the body into non - toxic molecules in moves the protein across the inner membrane into the order to treat and / or prevent conditions associated with periplasm , followed by subsequent cleavage of the signal 30 hyperphenylalaninemia , including PKU . In certain aspects , sequence . The beta - domain is recruited to the Bam complex the compositions comprising the genetically engineered where the beta - domain is folded and inserted into the outer bacteria may be used in the methods of the disclosure to treat membrane as a beta - barrel structure . The therapeutic peptide and / or prevent disorders associated with hyperphenylala is then threaded through the hollow pore of the beta - barrel ninemia . structure ahead of the linker sequence . The therapeutic 35 In order that the disclosure may be more readily under peptide is freed from the linker system by an autocatalytic stood , certain terms are first defined . These definitions cleavage or by targeting of a membrane - associated peptidase should be read in light of the remainder of the disclosure and ( scissors ) to a complementary protease cut site in the linker . as understood by a person of ordinary skill in the art . Unless

FIG . 52 depicts a schematic of a type I secretion system , defined otherwise , all technical and scientific terms used which translocates a passenger peptide directly from the 40 herein have the same meaning as commonly understood by cytoplasm to the extracellular space using HlyB ( an ATP - a person of ordinary skill in the art . Additional definitions binding cassette secreter ; HlyD ( a membrane fusion pro - are set forth throughout the detailed description . tein ) ; and Tolc ( an outer membrane protein ) which form a “ Hyperphenylalaninemia , " “ hyperphenylalaninemic , " channel through both the inner and outer membranes . The and “ excess phenylalanine ” are used interchangeably herein secretion signal - containing C - terminal portion of HlyA is 45 to refer to increased or abnormally high concentrations of fused to the C - terminal portion of a therapeutic peptide ( star ) phenylalanine in the body . In some embodiments , a diag to mediate secretion of this peptide . nostic signal of hyperphenylalaninemia is a blood phenyl

FIG . 53 depicts a schematic of the outer and inner alanine level of at least 2 mg / dL , at least 4 mg / dL , at least membranes of a gram - negative bacterium , and several dele - 6 mg / dL , at least 8 mg / dL , at least 10 mg / dL , at least 12 tion targets for generating a leaky or destabilized outer 50 mg / dL , at least 14 mg / dL , at least 16 mg / dL , at least 18 membrane , thereby facilitating the translocation of a thera - mg / dL , at least 20 mg / dL , or at least 25 mg / dL . As used peutic polypeptides to the extracellular space , e . g . , thera - herein , diseases associated with hyperphenylalaninemia peutic polypeptides of eukaryotic origin containing disul - include , but are not limited to , phenylketonuria , classical or phide bonds . Deactivating mutations of one or more genes typical phenylketonuria , atypical phenylketonuria , perma encoding a protein that tethers the outer membrane to the 55 nent mild hyperphenylalaninemia , nonphenylketonuric peptidoglycan skeleton , e . g . , lpp , ompC , ompA , ompF , tol? , hyperphenylalaninemia , phenylalanine hydroxylase defi tolB , pal , and / or one or more genes encoding a periplasmic ciency , cofactor deficiency , dihydropteridine reductase defi protease , e . g . , degs , degP , nlpl , generates a leaky phenotype . ciency , tetrahydropterin synthase deficiency , and Segawa ' s Combinations of mutations may synergistically enhance the disease . Affected individuals can suffer progressive and leaky phenotype . 60 irreversible neurological deficits , mental retardation ,

FIG . 54 depicts a schematic of non - limiting processes for encephalopathy , epilepsy , eczema , reduced growth , micro designing and producing the genetically engineered bacteria cephaly , tremor , limb spasticity , and / or hypopigmentation of the present disclosure . ( Leonard 2006 ) . Hyperphenylalaninemia can also be sec

FIGS . 55A , B , C , D , and E depict a schematic of non - ondary to other conditions , e . g . , liver diseases . limiting manufacturing processes for upstream and down - 65 “ Phenylalanine ammonia lyase ” and “ PAL ” are used to stream production of the genetically engineered bacteria of refer to a phenylalanine metabolizing enzyme ( PME ) that the present disclosure . FIG . 55A depicts the parameters for converts or processes phenylalanine to trans - cinnamic acid

MAI MUUTTUNUT PILU MULUT MOONHITI

Documents