LPS regulates proinflammatory gene expression in macrophages by altering histone deacetylase expression

The FASEB Journal • Research Communication

LPS regulates proinflammatory gene expression inmacrophages by altering histone deacetylaseexpression

Hnin Thanda Aung,*,†,1 Kate Schroder,*,†,1 Stewart R. Himes,*,† Kristian Brion,*,†

Wendy van Zuylen,*,† Angela Trieu,*,† Harukazu Suzuki,‡ Yoshihide Hayashizaki,‡

David A. Hume,*,† Matthew J. Sweet,*,† and Timothy Ravasi*,†,‡,§,2

*Cooperative Research Centre for Chronic inflammatory Diseases and †Australian Research CouncilSpecial Research Centre for Functional and Applied Genomics, Institute for Molecular Bioscience,University of Queensland, Australia; ‡Laboratory for Genome Exploration Research Group, RIKENGenomic Sciences Center, RIKEN Yokohama Institute, Tsurumi-ku, Yokohama, Japan; and†Department of Bioengineering, University of California, San Diego, California, USA

ABSTRACT Bacterial LPS triggers dramatic changesin gene expression in macrophages. We show here thatLPS regulated several members of the histone deacety-lase (HDAC) family at the mRNA level in murine bonemarrow-derived macrophages (BMM). LPS transientlyrepressed, then induced a number of HDACs (Hdac-4,5, 7) in BMM, whereas Hdac-1 mRNA was induced morerapidly. Treatment of BMM with trichostatin A (TSA),an inhibitor of HDACs, enhanced LPS-induced expres-sion of the Cox-2, Cxcl2, and Ifit2 genes. In the case ofCox-2, this effect was also apparent at the promoterlevel. Overexpression of Hdac-8 in RAW264 murinemacrophages blocked the ability of LPS to induce Cox-2mRNA. Another class of LPS-inducible genes, whichincluded Ccl2, Ccl7, and Edn1, was suppressed by TSA,an effect most likely mediated by PU.1 degradation.Hence, HDACs act as potent and selective negativeregulators of proinflammatory gene expression and actto prevent excessive inflammatory responses in macro-phages.—Aung, H. T., Schroder, K., Himes, S. R.,Brion, K., van Zuylen, W., Trieu, A., Suzuki, H., Ha-yashizaki, Y., Hume, D. A., Sweet, M. J., Ravasi, T. LPSregulates proinflammatory gene expression in macro-phages by altering histone deacetylase expression.FASEB J. 20, 1315–1327 (2006)

Key Words: transcriptional regulatory networks � epigenetic �histone code � innate immunity � inflammation

Transcriptional activation of mammalian genesrequires chromatin remodeling (1–4). Transcriptionalactivators typically recruit enzymes that modify the tailsof histones through acetylation, methylation, and phos-phorylation (5, 6). Perhaps the most striking demon-stration of this process was the recent study of theactions of the estrogen receptor on the model pS2promoter, which involves cyclical association and disso-ciation of at least 46 nuclear proteins involved inchromatin remodeling (7).

As part of the innate immune response, macro-phages recognize and are activated by conserved com-ponents of microorganisms (pathogen-associated mo-lecular patterns), and respond with a massive alterationin transcriptional output. Expression profiling has re-vealed thousands of genes that are induced or re-pressed in macrophages in response to the classicalactivating agent LPS (8–10). The regulated genes clus-ter at various locations in the mouse genome, and theirexpression varies greatly between macrophages fromdifferent mouse strains (9).

The response to LPS is initiated via a signalingcomplex that includes CD14, toll-like receptor 4(TLR4), and MD2. Upon activation, adaptor proteinsare recruited to the cytoplasmic tail of TLR4, andsubsequent signaling generates multiple transcriptionalregulators, including NF-�B, AP1, C/EBP, IRF-3, andnumerous other transcription factors (11–14). The LPStarget genes are induced or repressed in a temporalcascade. Early response genes, including those encod-ing many proinflammatory cytokines and chemokines,are induced transiently, peaking at �2–4 h, and arerepressed progressively from that time. Other genes areinduced at later time points, up to 24 h post-stimula-tion, and many are targets of inducible transcriptionfactors or of secreted proteins that act in an autocrinemanner to elicit secondary signaling cascades (15).Repression of the earlier response genes is partlyirreversible and has been associated with the phenom-enon of LPS tolerance (16).

Given the scale of the transcriptional response to LPSin macrophages, we reasoned there might be globalalterations in the expression and/or function of chro-matin remodeling genes across the temporal cascade.

1 These authors contributed equally to this work.2 Correspondence: Department of Bioengineering, Uni-

versity of California, San Diego, CA, USA. E-mail:[email protected]

doi: 10.1096/fj.05-5360com

13150892-6638/06/0020-1315 © FASEB

There have been few published studies of chromatinremodeling in activated macrophages, mostly relatingto selected modifications of histones associated withspecific promoters (17–21). In this study, we usedexpression profiling and quantitative polymerase chainreaction (PCR) to demonstrate that many chromatinand DNA-modifying enzymes are themselves transcrip-tionally regulated by LPS and that there is a temporalcascade of expression of positive, followed by negativetranscriptional regulators. Here we identify LPS-induc-ible genes that are specifically targeted for inactivationby histone deacetylases, and show that overexpressionof Hdac-8 selectively blocked LPS-inducible gene ex-pression. This study represents the first comprehensiveanalysis of the impact of chromatin remodeling ontranscriptional regulation in macrophages, and sug-gests that regulated histone deacetylation has a globaleffect on the extent and nature of the inducible tran-scriptional regulatory cascade in macrophages.

MATERIALS AND METHODS

Cell culture and reagents

All cells were cultured in RPMI 1640 media supplementedwith 10% FCS, 20 U/ml penicillin, 20 �g/ml streptomycin,and 2 mM L-glutamine (complete media) in an incubator at37°C with 5% CO2. The murine macrophage cell lineRAW264 was from the American Type Culture Collection(ATCC) (Manassas, VA, USA). Bone marrow-derived macro-phages (BMM) were obtained from femurs of 6- to 8-wk-oldC57BL/6J mice as described previously (22). Briefly, bonemarrow cavities were flushed with complete media. Bonemarrow cells, recovered by centrifugation at 400 g for 5 min,were cultured for 6 days in complete medium containing 104

U/ml recombinant human colony-stimulating factor 1(CSF-1) (a gift from Chiron, Emeryville, CA, USA). On day 6,BMM were harvested and seeded at 3 � 106 cells/10 cm tissueculture dish in complete medium � CSF-1. On the followingday, BMM were treated with 10 ng/ml LPS (Salmonellaminnesota, Sigma-Aldrich, St. Louis, MO, USA) for the indi-cated times. Trichostatin A (TSA) (Sigma) was dissolved in100% ethanol, stored at –20°C, and used at a final concen-tration in cell culture of 0.5 �M unless stated otherwise.

Generation of constructs and stable and transienttransfections in RAW264

The pEF6HDAC-8 plasmid was constructed by amplifying themouse Hdac-8 coding region from mouse macrophage cDNA,using specific primers (Table 1) and Pfx polymerase (Invitro-gen, Carlsbad, CA, USA). The PCR product was cloned intothe mammalian expression plasmid, pEF6/V5-His-TOPO (In-vitrogen). The integrity of the coding region was confirmedby DNA sequencing. Protein expression was verified by im-munoblotting cell lysates from RAW264 cells transiently trans-fected with pEF6HDAC-8, with an anti-V5 monoclonal anti-body (mAb) (Serotec, Raleigh, NC, USA). The plasmid,pGL2b1.4KbCox2, was made by PCR amplification of a 1.4 kbregion upstream of the ATG of Cox-2 from C57Bl6/J genomicDNA using specific primers (Table 1) for insertion intopGL2B (Promega, Madison, WI, USA). RAW264 cells stablyexpressing Hdac-8 were generated by electroporating 5 � 106

cells in 250 �l complete media, containing 20 mM HEPES

and 10 �g of pEF6HDAC-8, at 280 V and 1000 �F capacitanceon a Bio-Rad Gene Pulser (Bio-Rad, Hercules, CA, USA). Oneday post-transfection, cells were selected with 2 �g/ml Blas-tocidin (Invitrogen). After 10–14 days, stably selected colo-nies were pooled and screened for Hdac-8 expression byintracellular staining using an antibody (Ab) against the V5tag, followed by detection with a FACSCalibur flow cytometer(Becton Dickinson, Rockville, MD, USA). RAW264 cells stablytransfected with pGL2b1.4KbCox2 were generated identi-cally, except that 1 �g of pNT-neo, which confers resistance toG418, was included in electroporations, and colonies wereselected on the basis of resistance to 200 �g/ml G418.RAW264 pools stably transfected with pGL2b1.4KbCox2 werestimulated with LPS for 36 h, lysed, and assayed for luciferaseactivity according to the manufacturer’s instructions (Roche,Indianapolis, IN, USA). Protein concentration in lysates wasdetermined by bicinchoninic acid (BCA) protein assay(Pierce, Rockford, IL, USA); the level of luciferase activity,calculated as light units/�g of protein assayed, was displayedas relative light units. For transient transfection analysis,electroporations were performed as described above witheither 10 �g pGL-2B or 10 �g pGL2b1.4KbCox2. After 24 hcells were stimulated with medium, LPS, TSA, or LPS � TSAfor 7 h. Lysates were prepared and assayed for total proteinand luciferase activity as described above.

Quantitative real-time PCR

Total RNA was extracted from BMM using RNAeasy Midicolumns (Qiagen, Chatsworth, CA, USA) following the man-ufacturer’s protocol. Total RNA (1 �g) from each sample wastreated with DNase I (Ambion, Austin, TX, USA) and reversetranscribed using a 17-mer oligo(dT) and the Superscript IIIRNase H reverse transcriptase kit or Superscript III First-Strand Synthesis System for RT-PCR (Invitrogen), accordingto the manufacturer’s instructions. Negative control samples(no first-strand synthesis) were prepared by performing re-verse transcription reactions in the absence of reverse tran-scriptase. Quantitative real-time PCR was carried out withcDNA using the SYBR Green kit (Applied Biosystems, FosterCity, CA, USA), gene-specific primers and an ABI Prism 7000Sequence Detection System (Applied Biosystems). Thethreshold cycle (Ct) value was calculated from amplificationplots, and gene expression was normalized using the Ct of thehousekeeping gene hypoxanthine guanine phosphoribosyltransferase (hprt). Gene-specific primer pairs were designedusing Primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi), with an optimal primer size of 20bases, amplicon size of 100 bp, and annealing temperature of65°C. All primer sequences are displayed in Table 1.

Immunoblotting

BMM were treated with 10 ng/ml of LPS and/or TSA, asrequired, before either isolation of nuclei and extraction ofprotein or collection of whole cell extract according toestablished protocols (23). The concentration of protein inthe extracts was determined by BCA protein assay accordingto the manufacturer’s protocol (Pierce). Samples (5 �gprotein) were resolved on precast 12% polyacrylamide gels(Invitrogen) before blotting onto methanol-activated immo-bilon-P PDVF membranes (Millipore, Billerica, MA, USA).Blots were blocked and probed with specific antibodies toPU.1 (Santa Cruz, Biotechnology, Santa Cruz, CA, USA),ERK-1/2 (Cell Signaling Technology, Beverly, MA, USA),Cox-2 (Cell Signaling Technology), or STAT-1 (Cell SignalingTechnology). Bands were visualized using a horseradish per-oxidase-conjugated anti-rabbit IgG Ab (Cell Signaling Tech-

1316 Vol. 20 July 2006 AUNG ET AL.The FASEB Journal

nology) and chemiluminescence (Amersham Biosciences,Piscataway, NJ, USA). Signals on X-ray film were scannedusing a Bio-Rad GS 800 densitometer.

Endothelin-1 ELISA

BMM were treated with medium, TSA (500 nM), LPS (10ng/ml), or TSA�LPS over a 24 h time course. Levels ofendothelin-1 in BMM culture supernatants were determinedusing an endothelin-1 ELISA kit (R&D Systems, Minneapolis,MN, USA), as per the instructions of the manufacturer.

Chromatin immunoprecipitation (ChIP) assay

Cross-linking was performed by adding 1% formaldehydedirectly into tissue culture dishes containing 3 � 106 BMM atdifferent time points after LPS treatment, followed by incu-bation at room temperature for 10 min. Cells were washedtwice with PBS, collected, and pelleted by centrifugation at400 g for 5 min. Nuclei, isolated as described previously (24),were resuspended in sonication buffer (containing 50 mMTris-HCl, pH 8.1, 10 mM EDTA, 1% SDS, and proteaseinhibitors) and incubated on ice for 10 min to lyse the nuclei.Nuclear extracts were then sonicated to obtain �200-1000 bp

fragments of chromatin. Immunoprecipitation was carriedout according to the protocol provided by Upstate Biotech-nology (Lake Placid, NY, USA). Briefly, chromatin was diluted10-fold in ChIP dilution buffer. A small amount of chromatinwas kept aside at this step to be used as input control insubsequent PCR reactions. Antibodies antiacetyl-histone H4(K12) (Abcam), anti-RNA-polymerase II, and antihistone-H4(Upstate) were incubated with diluted chromatin at 4°Covernight. Immunoprecipitations were also carried out with-out Ab (no Ab controls). Protein A Sepharose (AmershamBiosciences), blocked with sheared salmon sperm DNA, wasused to collect Ab-chromatin complexes. Immune complexeswere then washed once with low salt immune complex washbuffer (containing 0.1% SDS, 1% Triton X-100, 2 mM EDTA,20 mM Tris-HCl, pH 8.1, 150 mM NaCl), once with high saltimmune complex wash buffer (containing 0.1% SDS, 1%Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1500 mMNaCl), once with LiCl immune complex wash buffer (0.25MLiCl, 1% IGEPAL-CA630, 1% deoxycholic acid, 1 mM EDTA,10 mM Tris-HCl, pH 8.1), and twice with sterile TE buffer.The chromatin (histone-DNA complexes) were eluted withfreshly prepared elution buffer (containing 1% SDS and 0.1MNaHCO3), followed by reverse cross-linking with 0.3M NaClat 65°C for 4–5 h. DNA was then recovered by phenol-chloroform extraction and ethanol precipitation, followed by

TABLE 1. List of primer sequences used for conventional PCR, real-time PCR, PCR cloning, and gel shift assay

Primer sequences

Forward ReverseCox-2 RT GAACCTGCAGTTTGCTGTGGG TCGCACACTCTGTTGTGCTCC

ChIP1 AAATTAACCGGTAGCTGTGTGC ATCTAAGGTCCTAACTAAGGGAATCChIP2 CTAATTCCACCAGTACAGATGa GTTCGCTGAGTCTGCGCCTAGTa

PCRc GGTACCATGGTCGATTGGATTCCCCC CTCGAGCAGAGCAGCACAGCTCGGAAMip-2 RT GCGCTGTCAATGCCTGAAGA GACTTCTGTCTGGGCGCAGTG

ChIP GGGCTTTTCCAGACATCGTG GTGTAGCCTGGTGGTTGGTGGarg-39 RT ACACTCCTCAGGGCAGCCAG GGCGTTGTTTGGCAGCTTTT

ChIP ATCAGCAAGATGCACCAAGATG GGTGGGTTCTGGATAAAAGAGTGCcl-2 RT CCCACTCACCTGCTGCTACTCA GCTTCTTTGGGACACCTGCTG

ChIP ATTTGCTCCCAGGAGTGGC GGAGTCAGGCAGGGTGCTTCcl-7 RT CCAATGCATCCACATGCTGC GCTTCCCAGGGACACCGAC

ChIP1 AGGCAGAGCTGCCAGAAGAG AACAGGAGGCAGGGTGAGTCChIP2 CCTGTTTCTAGACTCCAAGCTCCb CCTCCAACCAGCTCAGCTACTATb

PCRc GAGCTCTCCAAAGACTGGCAATGTGGAA CTCGAGGGCTATGAGCAGCAGGCACAHdac-1 RT TGCTCGCTGCTGGACTTAC GTAGGGCAGCTCATTAGGGATCTHdac-4 RT GCTCTCCCAGCTCTCCAGCA GTTGTGAGCTGCTGCACCGTHdac-5 RT TGAGAGGCAGGCCCTTCAGT CCTCCAGTGCCACTCCCAACHdac-6 RT ACCGGTATGACCGTGGCACT TCCAGGGCACATTGACAGTGAHdac-7 RT GTTCACCATGGCAACGGCAC ACTGCCTGGGAAGAAGTTGCCHdac-8 RT TGGAGATGCCAGAGGAACCC TTGGGGACCTTCACAAGGGA

PCRd ACTTTGGCTCGCGGACGGTTG GACCACATGCTTCAGATTCCCTTTGAHdac-9 RT TGGAGCAGCAGAGGCAAGAA TTGCCACTGCCCTTTCTCGTHdac-10 RT CGACTGCTCTGGGATGACCC CAGGCACCTTTCTTCCAGGCHdac-11 RT GGAATTGGAGTGGGGCACAG GCCAGCGTTGTACACCACCAP/CAF RT CAATGGCTGGAAGAACCCTA CCAAGTGAGAAACGTGAGCACited-2 RT CAGCTGCAGAAGCTCAACAA GGTTGCAATCTCGGAAGTGCBP RT AAGTCACCCAGCTCTCCTCA GGCTGATTGGCCACATACTTp300 RT CAGAACCAGCAGATGCTCAA GAGGTGCTTGGCTGTTCTTC

Gel shift probes (Boldface indicates the Pu.1 consensus)

Ccl-2 proximal attcaacttccactttccaCcl-2 distal ctctctcttcctccaccacCcl-7 atctctgcttccttcctcattctaCox-2 cccgggaggggaagctgtgac

a These primer sequences were obtained from Joo et al. (19). b These primers were used only for PU.1 ChIP PCR. c These primers wereused for promoter amplification of the corresponding genes. d These primers were used for amplification of the full-length cDNA.

1317EPIGENETIC REGULATION OF LPS-INDUCIBLE GENE EXPRESSION

PCR amplification, by using primers listed in Table 1. ThePCR conditions used were initial denaturation at 95°C for 5min, followed by 30 cycles of 95°C (30 s), 58°C (30 s), and72°C (30 s). Alternatively, recovered DNA was subjected toreal-time PCR as described above.

Nuclear extract preparation and gel shift assays

The preparation of nuclear extracts as well as the methodused for gel shift assays has been described (25). The probesused for gel shift assays (shown in Table 1) were end-labeledusing T4 polynucleotide kinase and [�-32P]-ATP, and sepa-rated on NAP-5 columns (Amersham Biosciences). Nuclearproteins bound to radiolabeled probe were resolved using 8%discontinuous polyacrylamide gel electrophoresis. Gels weredried onto 3M paper and visualized by exposure to X-ray film.

RESULTS

Chromatin remodeling on macrophage activationwith LPS

An earlier study from our group documented the timecourse of LPS stimulation of murine BMM, usingRIKEN full-length mouse cDNA microarrays (9). InBMM from C57Bl6/J mice, �30% of genes were regu-lated by LPS at some time over a 21 h time course,indicating that LPS has a global effect on gene expres-sion in macrophages (9). Many transcripts that encodeproteins associated with chromatin remodeling werealso acutely modulated by LPS (data not shown).Broadly speaking, between 2 and 7 h, when the majorityof LPS-inducible genes reach peak expression, therewas an up-regulation of transcripts encoding nuclearproteins associated with transcriptional activation and“opening up” of chromatin. In particular, transcriptsencoding members of the histone acetyltransferasecomplex, CBP, p300, Cited-2, and P/CAF (17,19,26),were transiently up-regulated on LPS stimulation asassessed by real-time PCR (Fig. 1), consistent with aprevious report (26). Whereas CBP, p300, and P/CAFexpression peaked 7 h after stimulation, Cited-2 (CBP/p300-interacting transactivator with ED-rich tail 2)peaked at 2 h. Combined with the scale of the tran-scriptional response to LPS, these data led us to thehypothesis that the transcriptional activation that oc-curs early in the LPS response is supported by increasedproduction of positive regulators. This pattern may beamplified by a coordinate decrease in mRNA encodingnegative regulators such Sirt 1, 2, and 3 and Ncor,which was also evident in our analysis (data not shown).

Expression and regulation of histone deacetylasesin macrophages

Upon long-term treatment of BMM with LPS (21 h),the transcriptional profile returned to a state that wassimilar but not identical to unstimulated cells (9).Members of the HDAC family repress transcriptionthrough histone modification (27–31). We hypothe-sized that regulation of HDAC mRNA expression by

LPS might contribute to the early induction and sub-sequent repression of proinflammatory gene expres-sion. We therefore assessed mRNA levels for HDACmembers in BMM over an LPS time course (Fig. 2).Most of the HDACs analyzed were expressed at very lowlevels in BMM relative to hprt. Hdac-1, at least, is knownto be expressed and functional in macrophages (32), sothe mRNA level does not necessarily correlate withprotein level or function. As predicted, LPS transientlyrepressed expression of several of the HDACs (Hdac-4,5, 6, and 7) at time points (4, 6 h) that correlated withmaximal activation of proinflammatory gene expres-sion. By 24 h after LPS treatment, Hdac-4, 5, and 7mRNA levels had returned to greater than thosepresent in unstimulated cells. In contrast, induction ofHdac-1 mRNA by LPS was more rapid and peaked at 8 hpost-LPS stimulation, suggesting it may play a divergentrole from other HDACs in regulating LPS-induciblegene expression in macrophages.

The histone deacetylase inhibitor, trichostatin A,differentially regulates induction of subclasses ofLPS-responsive genes in macrophages

The expression analysis described above indicated thatthe transient repression followed by the late inductionof HDACs might serve to allow for activation andsubsequent down-regulation of proinflammatory geneexpression. To determine whether HDACs do indeedact to switch off LPS-inducible gene expression and toidentify the specific genes that HDACs target, we per-formed expression array profiling using microarraychips enriched for LPS-inducible transcripts on BMMresponding to LPS, with or without TSA treatment.Three distinct classes of LPS-responsive genes wereidentified: 1) LPS-inducible transcripts that were unaf-fected by TSA pretreatment; 2) LPS-inducible tran-

Figure 1. Regulation of components of the histone acetyl-transferase complex by LPS in BMM. BMM were stimulatedwith LPS (10 ng/ml) for 0, 2, 7, or 21 h. Levels of p300,P/CAF, Cited-2, and CBP mRNAs were quantified by real-timePCR. Data points represent the average of triplicate determi-nations � sd.


scripts that were superinduced by TSA pretreatment; 3)LPS-induced transcripts that were repressed or blockedcompletely by TSA treatment (data not shown). Eachclass effectively acts as an internal control for theothers, suggesting that TSA-sensitive HDACs have dis-tinct roles on different classes of target genes. Thearrays used were not comprehensive and contain manyreplicate targets. Hence, gene lists for the three classesdo not provide global coverage and are therefore notreported in this study. Instead, we focused on a smallnumber of genes and confirmed the selective effects ofTSA on LPS-inducible gene expression in BMM byreal-time PCR. Cyclooxygenase 2 (Cox-2), chemokine(C-X-C motif) ligand 2 (Cxcl2), and IFN-induced pro-tein with tetratricopeptide repeats 2 (Ifit2) mRNAswere all strongly up-regulated at 10 h post-LPS treat-ment and were superinduced by TSA � LPS (Fig. 3a).Chemokine (C-C motif) ligand 2 (Ccl2), Ccl7, andendothelin 1 (Edn1) mRNAs were also inducible byLPS (10 h), but the response was substantially impairedin the presence of TSA (Fig. 3a). TSA also impairedbasal mRNA expression of Ccl2 and Ccl7, but not Edn1.In isolation, these data suggest that HDACs act asnegative regulators of Cox-2 and coregulated genes, butfunction as positive regulators of Ccl7 and coregulatedgenes. We confirmed that these divergent effects ofTSA on gene expression in BMM were also apparent atthe protein level. TSA treatment enhanced the level ofLPS-induced Cox-2 protein in BMM (Fig. 3b), butcompletely blocked production of LPS-induced endo-thelin-1 in BMM culture supernatants over a 24 h timecourse (Fig. 3c). Subsequent analysis focused on Cox-2and Ccl7 as representatives of either class of gene.

Since LPS transiently repressed, then induced manyof the HDACs (Fig. 2), we also assessed the kinetics ofCox-2 (LPS/TSA superinduced) and Ccl7 (TSA re-pressed) mRNA regulation by LPS in BMM (Fig. 4a).Cox-2 and Ccl7 mRNAs peaked at 4–6 h in response to

LPS (Fig. 4a) and correlated with the transient repres-sion of Hdac-4, 5, 6, and 7 expression (Fig. 2). Thesubsequent decline in Cox-2 and Ccl7 mRNA levels at8–24 h (Fig. 4a) also correlated with the delayedinduction of Hdac-1, 4, 5, and 7 mRNAs (Fig. 2). Hence,the kinetics of Cox-2 and Ccl7 regulation by LPS wasconsistent with HDACs as negative regulators of Cox-2gene expression, but was not consistent with HDACs aspositive regulators of Ccl7 gene expression. Since wehypothesized that HDACs were responsible for thedecline in expression of Cox-2 (and similarly regulatedgenes) that occurs 6–8 h after LPS stimulation (Fig.4a), we also assessed the effect of TSA when given atlater time points after the initial stimulation with LPS.TSA was given to BMM after 7 h of LPS treatment, andthe effect on subsequent declines in mRNA levels wasassessed 11 and 20 h after the initial stimulation withLPS (Fig. 4b). Consistent with the hypothesis, the decayin mRNA expression of the superinduced gene Cox-2was prevented by TSA. Conversely, mRNA for theTSA-repressed gene Ccl7 decayed more rapidly in thepresence of TSA.

Hdac-8 and transcriptional repression ofLPS-responsive genes

One caveat about the studies here is that TSA might beacting through mechanisms other than HDACs. Theselective actions on a subset of LPS-responsive genesargue against a distal effect of TSA on some aspect ofLPS signaling. However, to complement the evidencethat HDACs negatively regulate LPS-inducible expres-sion of Cox-2 and similarly regulated genes, we exam-ined the effect of HDAC overexpression in macro-phages. In a recent study, overexpression of the class IHDAC, Hdac-1, suppressed activity of the Cox-2 pro-moter (26). We examined the effect of Hdac-8, the onlyother class 1 HDAC expressed in BMM, on Cox-2

Figure 2. Regulation of HDAC mRNA expressionby LPS in BMM. BMM were stimulated with LPS(10 ng/ml) for 0, 2, 4, 6, 8, or 24 h. RNA andcDNA was prepared, and Hdac-1, 3, 4, 5, 6, 7, 8, 9,10, and 11 mRNA levels were quantitated by real-time PCR. Data points represent the average oftriplicate determinations � sd. Similar results wereobtained in 3 independent experiments.


expression. Ectopic overexpression of Hdac-8 in stablytransfected RAW264 cells blocked the ability of LPS toinduce Cox-2, but not Ccl7 mRNA (Fig. 5). This findingsupports the view that blockade of HDAC action by TSAmediated the superinduction of Cox-2 mRNA on LPSstimulation of BMM. However, Hdac-8 overexpressionin RAW264 cells did not superinduce Ccl7 mRNAexpression, thus suggesting that TSA may act indepen-

dent of HDACs to mediate repression of this class ofLPS-inducible gene in macrophages.

LPS and TSA act at the level of the Cox-2 promoterto regulate expression

To determine whether the effects of TSA are mediatedat the level of promoter activation, 1.4 kb of the Cox-2proximal promoter region was chosen to include re-gions conserved across mammalian species (www.dcode.org) and linked to a luciferase reporter gene. Intransient transfections in RAW264 cells, regulation ofthe Cox-2 promoter mirrored that of the endogenousgene; the promoter was induced by LPS (5.5-fold) andwas superinduced by the combination of LPS � TSA(18-fold) (Fig. 6a). In RAW264 cells stably transfectedwith pGL2b1.4KbCox2, a similar phenomenon was alsoapparent (Fig. 6b). Hence, TSA enhanced LPS-inducedCox-2 expression via its actions on the promoter.

Figure 3. The effect of the histone deacetylase inhibitor TSAon LPS-inducible gene expression in BMM. a) BMM weretreated with medium, LPS (10 ng/ml), TSA (0.5 �M), orLPS � TSA for 10 h. RNA and cDNA was prepared, and levelsof Cox-2, Cxcl2, Ifit2, Ccl2, Ccl7, and Edn1 mRNAs wereestimated by real-time PCR. Data points represent the averageof triplicate determinations � sd. Similar results were ob-tained in at least 3 independent experiments. b) BMM weretreated with medium or LPS (10 ng/ml). After another 8 h,BMM were stimulated with medium or TSA (0.5 �M). 24 hafter the initial LPS stimulation, whole cell lysates wereprepared from all samples (con, LPS, TSA, LPS�TSA). Levelsof Cox-2 protein, relative to the STAT-1 loading control, werequantified by immunoblotting and densitometry. c) BMMwere treated with medium, LPS (10 ng/ml), TSA (0.5 �M) orLPS � TSA over a 24 h time course. Levels of endothelin-1secreted into culture supernatants were determined byELISA. Data points represent the average of duplicates andthe errors represent the range.

Figure 4. Kinetics of regulation of TSA-sensitive genes by LPS.a) BMM were stimulated with LPS (10 ng/ml) for 0, 2, 4, 6, 8,or 24 h. RNA and cDNA was prepared, and Cox-2 (filledsquares) and Ccl7 (open circles) mRNA levels were quanti-tated by real-time PCR. Data points represent the average ofduplicate determinations � sd. Similar results were ob-tained in 2 independent experiments. b) BMM were stimu-lated with LPS (10 ng/ml) for 0, 4, 7, 11, and 20 h. At 7 hpost-LPS treatment, the 11 and 20 h treatment groups weretreated with either medium or TSA (0.5 �M). RNA and cDNAwas prepared and Cox-2 and Ccl7 mRNA levels were quanti-tated by real-time PCR. Data points represent the average oftriplicate determinations � sd; similar results were obtainedin 2 independent experiments.


Changes in the extent of H4K12 acetylation arecorrelated with LPS-inducible gene expression

We predicted that during the time course of LPS actionthere would be detectable alterations in the level ofhistone acetylation associated with the promoters ofLPS target genes. We therefore carried out chromatinimmunoprecipitation (ChIP) analysis to examine theextent of histone acetylation on the promoters ofTSA-sensitive genes across an extended LPS timecourse of 0 (unstimulated), 0.5, 2, 4, 7, 24, and 48 h(Fig. 7). Figure 7a demonstrates the promoter architec-ture of the genes examined and the PCR primers usedin this analysis. Within the same experiment, we con-firmed the alterations in mRNA levels for the genes ofinterest (Fig. 7b). When Ab for histone H4 acetylated atlysine 12 was used for the ChIP analysis, there was anincrease and subsequent decrease in the extent ofhistone acetylation at H4K12, which paralleled that ofthe mRNA level detected by real-time PCR for each thefive genes tested here; the three genes enhanced byTSA (Cox-2, Cxcl2, and Ifit2) as well as the two genesrepressed by TSA (Ccl2 and Ccl7) (Fig. 7b). To confirmthat the regions tested were indeed representative ofinducible promoters, ChIP analysis was also performedwith an RNA polymerase II Ab. For the three genessuperinduced by TSA, the level of RNApol II associa-tion with their promoters increased substantially beforethe peak of mRNA production, suggesting that theinduction is indeed primarily transcriptional. By con-trast, the TSA-repressed genes showed a relatively smallincrease in RNApol II association upon LPS stimulation(Fig. 7b). We suggest that, like the TNF-� and Mac-

Marcks genes studied in our laboratory (33, 34), thesegenes may have constitutively active promoters, and asignificant proportion of the regulation is post-tran-scriptional. These data indicate that LPS acutely regu-lated histone acetylation. However, there was no corre-lation between H4K12 acetylation and differentialeffects of TSA on subsets of LPS-inducible genes.

Effect of HDAC inhibition on LPS tolerance

Pretreatment of macrophages with LPS leads to a stateof LPS insensitivity that may be partly related to thephenomenon of LPS tolerance in vivo (35, 36). Todetermine whether chromatin modification by HDACscontributes to LPS insensitivity, macrophages were ini-tially activated with LPS for 7 h. LPS was then removed

Figure 5. Effect of ectopic Hdac-8 expression on Cox-2 mRNAregulation in RAW264 cells. Pooled RAW264 cells stablyexpressing Hdac-8 (filled bars) or the empty vector, pEF6(unfilled bars) were generated. Each population was stimu-lated with LPS (10 ng/ml) for 0, 2, or 7 h. RNA and cDNA wasprepared and levels of Cox-2 and Ccl7 mRNA were quantitatedby real-time PCR. Data points indicate average of triplicates �sd; similar results were obtained in 2 independent experi-ments.

Figure 6. Regulation of the Cox-2 promoter by LPS and TSA.a) RAW264 cells were transiently transfected withpGL2b1.4KbCox2, or pGL-2B. Transfections were split and,24 h later, treated with medium (control), LPS (10 ng/ml),TSA (0.5 �M), or LPS�TSA for 7 h. Luciferase activityrelative to total protein was calculated, and results are pre-sented as fold induction relative to control values. Data pointsrepresent the average of triplicates � sd, and similar resultswere obtained in 3 independent experiments. b) Pools ofRAW264 cells stably transfected with pGL2b1.4KbCox2 weregenerated. Cells were treated for 6 h with medium, LPS (10ng/ml), TSA (0.5 �M) or LPS�TSA. Luciferase activityrelative to the untreated control is displayed. Data are repre-sentative of 2 experiments.


and cells were washed, fresh media added, and cellsgrown overnight. On the following day cells wererestimulated with either medium or LPS for 7 h in thepresence or absence of TSA. Levels of Cox-2 and Ccl7mRNA were then assessed (Fig. 8). As expected, induc-

tion of Cox-2 mRNA by a secondary LPS challenge wasreduced compared to the primary LPS response, whileCcl7 mRNA was not induced at all by a secondary LPSchallenge (Fig. 8). Addition of TSA alone for 7 h on theday after the initial LPS stimulation reactivated Cox-2expression, suggesting that HDACs, induced by theprimary LPS stimulation actively repressed Cox-2 ex-pression. Hence, for Cox-2 and similarly regulatedgenes, LPS-induced HDACs are likely to contribute tothe phenomenon of endotoxin tolerance. However,because of the dramatic impact of TSA alone on geneexpression in this system, the effects of TSA on asecondary LPS challenge are difficult to interpret; Cox-2mRNA was actually 5-fold repressed by a secondary LPSchallenge whereas induction of Ccl7 mRNA (in terms offold induction) was restored (Fig. 8). While this findingis difficult to interpret, it nonetheless highlights thedifferential regulation of these two classes of gene.

Figure 7. ChIP analysis of H4 lysine 12 (H4K12) acetylation atTSA-regulated promoters during LPS activation of BMM. a)The maps for the promoter regions of LPS-inducible genes inwhich gene expression was enhanced (Cox-2, Cxcl2, and Ifit2)or repressed (Ccl2 and Ccl7) by TSA are shown. The PCRfragments amplified in ChIP analysis are also shown. b)Duplicate sets of BMM were stimulated with LPS for 0, 0.5, 2,4, 7, 24, or 48 h; one time course set was used to prepare RNAto quantitate endogenous gene expression while the secondtime course set was used for immunoprecipitation experi-ments (either acetylated histone H4 lysine 12 or RNA polII).Levels of acetylated histone H4 lysine 12 and RNA polII ateach of the 5 promoters, as well as endogenous gene expres-sion, were determined by real-time PCR. All data are ex-pressed as fold induction with control values set to 1 exceptfor mRNA levels of Cox-2 and Ifit2; here control levels were setat 0.1. Similar results were obtained in 2 independent exper-iments.

Figure 8. Effect of TSA on in vitro endotoxin tolerance. BMMwere stimulated with LPS (10 ng/ml) for 0, 7, or 10 h, andRNA and cDNA were prepared. In addition, BMM werestimulated for 7 h with LPS, then washed and grown over-night in medium free of LPS. On the following day, these cellswere restimulated for 7 h with medium or LPS (Booster LPS)in the presence (unfilled boxes) or absence (filled boxes) ofTSA (0.5 �M); RNA and cDNA were prepared. For allsamples, levels of Cox-2 and Ccl7 mRNA were determined byreal-time PCR. Data points represent the average of tripli-cates � sd; the experiment is representative of 2 independentexperiments.


The role of PU.1 in regulating LPS-inducible geneexpression regulation

The data described herein suggest that TSA enhancedLPS-induced Cox-2 expression by blocking the inhibi-tory actions of HDACs. However, despite the effects ofTSA on gene expression, much of our data wereinconsistent with HDACs as positive regulators of Ccl7and coregulated genes. For example, there was nopositive correlation between LPS-regulated HDAC ex-pression and LPS-regulated Ccl7 expression (Fig. 2, Fig.4a), and Hdac-8 overexpression in RAW264 did notinduce or enhance LPS-induced Ccl7 expression (Fig.5). Suzuki and colleagues claimed that PU.1, an Etsfamily transcription factor that regulates macrophage-specific gene expression (37), was degraded in murinemacrophages in response to TSA (38). Thus, we deter-mined whether the negative effect of TSA on Ccl2 andCcl7 expression occurs via targeting of PU.1. We firstconfirmed that TSA does lead to loss of PU.1 protein inthe BMM being studied here, which are distinct fromperitoneal macrophages and cell lines used by others(38). Western blot analysis confirmed that the level ofPU.1 protein in BMM was indeed repressed by treat-

ment with TSA in a dose-response manner (Fig. 9a).Consensus PU.1 binding sites were present in theproximal 1 kb region of the Ccl2 and Ccl7 promoters,while an imperfect PU.1 binding site is also present inthe TSA superinduced Cox-2 promoter (Fig. 7a, Fig.9b). Gel mobility shift assays showed that PU.1 (asconfirmed by supershifting with an anti-PU.1 Ab)bound the predicted binding sites within the Ccl2, Ccl7,and Cox-2 promoters (Fig. 9c). To confirm that PU.1was recruited to these promoters, we performed ChIPassays on the promoters of interest across the LPS timecourse using an anti-PU.1 Ab. Both real-time andconventional PCR analyses were performed on chroma-tin immunoprecipitated with an anti-PU.1 Ab (Fig. 9d).Chromatin before immunoprecipitation was used asinput control for both types of PCR. The ChIP profileconfirmed an earlier report that PU.1 is recruited tothe Cox-2 promoter in response to LPS (19). By con-trast, PU.1 was constitutively associated with the Ccl2and Ccl7 promoters, suggesting it contributes to basaltranscription (Fig. 9d). Hence, the inhibitory effect ofTSA on Ccl2 and Ccl7 gene expression is most likelymediated by PU.1 degradation.

Figure 9. Involvement of PU.1 in regulating expression of TSA-repressed genes. a) BMM were treated either with LPS (10ng/ml) for 0, 2, 7, or 24 h, TSA (0.75 �M or 1.5 �M) for 7 h, or with LPS � TSA for 7 h. Whole cell extracts or nuclear extractswere prepared and the total amount of PU.1 and ERK-1/2 was determined by immunoblotting. A 150 kDa nonspecific band (*)appeared when immunoblotting nuclear extracts with the anti-PU.1 Ab and is displayed as an internal loading control. b)Putative PU.1 binding sites within the Cox-2, Ccl2, and Ccl7 promoters are indicated (boldface underlined) relative to thetranscription start sites. c) Gel mobility shift assays were performed using BMM nuclear extracts and ds radiolabeled probes(shown in Table 1). Nuclear extract and probe cocktail was treated with or without an anti-PU.1 Ab prior to separation by PAGE.Arrows mark PU.1 bound to probe and PU.1-containing complexes supershifted (ss) with the Ab. d) BMM, treated over a 0–48h LPS time course, were fixed, nuclei isolated, and chromatin prepared. Immunoprecipitations were performed with an antiPU.1 Ab. Fragments (Fig. 7a) were amplified by conventional and real-time PCR. Chromatin before immunoprecipitation wasused as an input control.


Regulation of HDAC expression in macrophagesby TSA

The low basal expression of the HDACs in BMM (Fig.2) prompted us to determine whether HDACs act ontheir own promoters to maintain low basal expressionin macrophages. Hence, BMM were treated for 10 or24 h with TSA, and expression of Hdac-1 to 11 wasassessed. Fig. 10 shows that, with the exception ofHdac-7 and 9, TSA strongly up-regulated expression ofall of the HDACs examined at both time points. Hence,in macrophages HDACs are likely to negatively regulatetheir own expression. In contrast, Hdac-9 expressionwas repressed by TSA at both time points, suggestingthat this Hdac may be a PU.1 target gene.

DISCUSSION

In this study, we have shown that LPS-inducible genesin mouse BMM can be divided into distinct classesdepending on their sensitivity to TSA. We have identi-fied several genes in which the LPS response wasenhanced by TSA (Cox-2, Cxcl2, and Ifit2). This extendsa previous finding which showed that TSA enhancedLPS-induced expression of the dual specificity phospha-tase, MKP-M, in macrophages (21). Apart from thepositive effects of TSA on LPS-induced gene expres-sion, we provide several other lines of evidence thatHDACs negatively regulate this class of gene. First,induction of Cox-2 mRNA by LPS coincided with down-regulation of Hdac-4, 5, 6, and 7 mRNAs, while thesubsequent decline in LPS-induced Cox-2 mRNA levelscoincided with the induction of Hdac-1 mRNA (Fig. 2,Fig. 4a). The LPS-induced Cox-2 expression profile alsocorrelated with acetylation and deacetylation at histoneH4K12 at the Cox-2 promoter (Fig. 7b). Further, over-expression of Hdac-8 in RAW264 cells selectivelyblocked LPS-induced Cox-2 expression (Fig. 5).

Despite the effect of Hdac-8 on Cox-2 expression, thecomplex patterns of expression of different HDACsacross the time course of the LPS response preclude adefinitive identification of a particular corepressor thatis responsible for the actions of TSA in each of thecircumstances studied. Hdac-1 induction by LPS peakedat 8 h (Fig. 2) and correlated most closely with theonset of repression of gene expression (Fig. 4a) andhistone deacetylation of target promoters (Fig. 7b).Others have also reported that Hdac-1 cotransfectionblocked activity of the Cox-2 promoter in macrophages(26). However, the addition of TSA to BMM 24 h afteran initial stimulation with LPS still reactivated Cox-2expression (Fig. 8) even though Hdac-1 mRNA was onlytransiently induced by LPS (Fig. 2). Hence, it is prob-able that sequential regulation of HDACs controlsLPS-inducible Cox-2 expression. A proposed mecha-nism for the role of histone acetylation and deacetyla-tion in regulation of Cox-2 and similarly regulated genesis outlined in Fig. 11. LPS transiently represses expres-sion of Hdac-4, 5, 6, and 7 (Fig. 2) and up-regulatescomponents of the histone acetyltransferase complex(Fig. 1). The combined effect is histone H4 acetylationat target promoters (Fig. 7b) and transcriptional activa-tion. LPS also triggers histone H3 phosphorylation andphosphoacetylation at target promoters via a MAPKp38-dependent pathway (39). Hdac-1 is then induced(Fig. 2) and acts to shut down gene expression. AsHdac-1 expression declines, Hdac-4, 5, and 7 are in-duced and act to maintain gene expression in a basalstate. We have not assessed cellular localization ofHDACs in this study, but many of the class II HDACscan shuttle between cytoplasm and nucleus (40). It istherefore likely that regulation of HDAC localizationalso contributes to LPS-inducible gene expression. Theobservation that TSA regulated the activity of the Cox-2promoter in transient transfection analysis (Fig. 6a)might be considered surprising, since it implies thattransiently transfected DNA is subjected to epigenetic

Figure 10. Regulation of Hdac expression in BMMby TSA. BMM were treated with TSA (0.5 �M) for10 or 24 h. RNA and cDNA were prepared andHdac expression was estimated by real-time PCR.Data represent the average of triplicates � sd.Similar results were obtained in 2 independentexperiments.


gene regulation. Nonetheless, a range of studies hasdemonstrated that HATs and HDACs do regulate pro-moter activity in transient transfection experiments,thus indicating that histone modification can indeedregulate promoter activity in such analyses.

Although TSA negatively regulated Ccl2, Ccl7, andEdn1 gene expression, we did not find supportingevidence that HDACs positively regulate expression ofthis gene class. For example, acetylated histone H4K12levels at the Ccl2 and Ccl7 promoters were maximalwhen Ccl2 and Ccl7 mRNA levels were maximal (Fig.7b). Further, overexpression of Hdac-8 in RAW264 cellsdid not induce Ccl7 expression (Fig. 5). Instead, themost likely explanation for the effect of TSA on thesegenes is that they are PU.1 target genes and that TSAinhibits basal and inducible expression by down-regu-lating PU.1 expression (Fig. 9a). This is supported bythe observation that PU.1 was associated with the Ccl2and Ccl7 promoters in unstimulated BMM (Fig. 9d). Acomprehensive analysis of the effects of TSA on geneexpression in macrophages is likely to identify otherPU.1 target genes. It should be noted that there weredifferences between the effects of TSA on Edn1 andCcl2/Ccl7 gene expression. Whereas TSA inhibitedboth basal and LPS-induced Ccl2/Ccl7 expression, TSAonly affected LPS-inducible expression of Edn1. Theinference is that PU.1 regulates LPS-inducible, but notbasal activity, of the Edn1 promoter. Another possibilityis that HDACs do indeed act as positive regulators ofEdn1 expression. Regardless of the mechanism, giventhe involvement of Edn1 in vasoconstriction and cardio-vascular disease (41), TSA might have therapeutic

applications in cardiovascular disease associated withinflammation.

Whereas the three superinducible genes studiedhere (Cox-2, Cxcl2, Ifit2) have classical CpG islands, theCcl7 and Ccl2 promoters are not CpG-rich and haveclassical TATA boxes. In the case of the CpG islands, itis possible that partial or complete methylation isinvolved in maintaining the basal transcription state ofthe genes, through the recruitment of histone deacety-lases by methyl CpG-binding proteins (42–44). Thispossibility is currently under investigation. The PU.1sites in this class of promoter are distal to the transcrip-tion start site, and the recruitment of PU.1 to thepromoter region occurs late in the activation response(Fig. 9d). The decay in PU.1 nuclear protein inducedby TSA might serve to prevent PU.1 association, but thiscould either be inconsequential or function in repres-sion. By contrast, in the Ccl7 gene a strong conservedPU.1 site is located close to the transcription start site,a functional location shared with many constitutivelyexpressed macrophage genes (45). In this distinctcontext, the loss of nuclear PU.1 could prevent tran-scriptional initiation and repress constitutive promoteractivity. The Ccl7 promoter has not been analyzed indetail, but in humans, at least, the purine-rich elementsmay be functional (46). The Ccl2 promoter has beenmore widely studied, and there is evidence that a distalNF-�B site controls regulated histone acetylation of aSp1 site at the proximal promoter (47). Ccl7 and Ccl2share one other distinct feature in that they form partof a limited set of macrophage genes that are targets of

Figure 11. Proposed model for regulation of Cox-2(and coregulated genes) by histone modification.In unstimulated macrophages there are low levelsof histone H3/H4 acetylation at the promoters ofLPS-inducible genes that contain CpG islands (dueto the action of histone deacetylases). Activation byLPS transiently down-regulates expression ofHdac-4, 5, 6, and 7 (HDACs) and up-regulatesexpression of p300, P/CAF, Cited-2, and CBP(HATs). Consequently, histone H3/H4 acetylationincreases, transcription factors and RNApol II arerecruited, and transcriptional activation occurs.Expression of Hdac-1 is also increased, and Hdac-1acts to deacetylate histone H3/H4 and shut downgene expression. Subsequently, as Hdac-1 mRNAlevels decline and expression of Hdac-4, 5, and 7increases, this acts to maintain low levels of histoneacetylation, RNApol II recruitment, and transcrip-tional activation.


the repressor BCL-6 in mice (48), although the rele-vance of this to our findings has not been investigated.

The ChIP studies of the pattern of histone acetyla-tion across the promoter regions of both TSA-superin-ducible and TSA-repressible genes revealed a commonpattern of rapidly inducible acetylation of histone H4,followed by deacetylation as the level of mRNA de-clined (Fig. 7b). By contrast, acetylation of histone H3was not well correlated with transcription and increasedacross the time course (data not shown). This observa-tion is consistent with the study by Laribee and Klemsz(49), who reported that TSA treatment increased his-tone H4, but not H3, acetylation in macrophages.However, post-translational modification of histone H3is still an important regulator of proinflammatory geneexpression (39). The decline in mRNA levels of induc-ible genes in macrophages responding to LPS is due, atleast in part, to inducible degradation of the mRNA.Our studies show there is also a dynamic sequence ofacetylation and deacetylation of histone H4 with timethat correlates with the recruitment of RNApol II to theLPS-inducible promoters, so that transient inductiondoes in fact represent transient transcriptional activa-tion for each of the genes we have studied. Theimportance of histone deacetylation in switching offtranscription is evident from the ability of TSA toprevent the decline in Cox-2 mRNA levels at later timepoints in the temporal cascade.

There is considerable interest in the use of TSAinhibitors in cancer chemotherapy, where they caninduce differentiation and growth arrest. The complexeffects on inducible gene expression in macrophages,as well as lineage-specific differentiation reported pre-viously (49), suggest that such agents could have un-predictable effects on innate immune responses andinflammation. Indeed, peroxynitrite-induced damageof Hdac-2 has been implicated in the steroid insensitiv-ity of patients with chronic obstructive pulmonarydisease (50), implying that clinical use of HDAC inhib-itors might have unwanted effects in exacerbatinginflammatory disease. Such an effect of TSA was re-ported in a neural inflammatory model (51). Nonethe-less, there may also be occasions when inhibition ofHDACs is desirable for treatment of macrophage-me-diated inflammatory disease, since TSA potently down-regulated inducible expression of the proinflammatorygenes, Ccl2, Ccl7, and Edn1. Separation of LPS-induc-ible genes into classes based on responsiveness to TSAopens up the possibility that HDAC inhibition, perhapsdirected against specific macrophage-expressed iso-forms, could have a subtle therapeutic benefit. Inoverview, we have shown a direct link between epige-netic gene regulation and environmental factors (LPSin this case). In particular, we have shown that regu-lated expression of multiple histone deacetylases con-tributes to feedback control of macrophage activationand that TSA can be used to distinguish differentclasses of LPS-responsive genes with distinct promoterarchitectures. HDAC inhibitors that selectively targetCcl2, Ccl7, Edn1, and coregulated genes may have

anti-inflammatory properties that could be utilized fortherapeutic applications.

We thank the SRC microarray facility at the University ofQueensland for providing us with the microarray Chips usedfor these analyses. This work was funded by grants from theNational Health and Medical Research Council of Australia(NHMRC) to D.A.H. Research Grant for Advanced andInnovational Research Program in Life Science to Y.H. Re-search Grant for Advanced and Innovational Research Pro-gram in Life Science to J.K. CREST (Core Research forEvolutional Science and Technology) of Japan Science andTechnology Corporation (JST) to Y.H. Research Grant forthe Genome Network Project from the Ministry of Education,Culture, Sports, Science and Technology (MEXT) of theJapanese Government.

REFERENCES

1. Zaidi, S. K., Young, D. W., Choi, J. Y., Pratap, J., Javed, A.,Montecino, M., Stein, J. L., van Wijnen, A. J., Lian, J. B., andStein, G. S. (2005) The dynamic organization of gene-regulatorymachinery in nuclear microenvironments. EMBO Rep. 6, 128–133

2. Giacca, M. (2004) The HIV-1 Tat protein: a multifaceted targetfor novel therapeutic opportunities. Curr. Drug Targets ImmuneEndocr. Metabol. Disord. 4, 277–285

3. Duroux, M., Houben, A., Ruzicka, K., Friml, J., and Grasser,K. D. (2004) The chromatin remodelling complex FACT asso-ciates with actively transcribed regions of the Arabidopsis ge-nome. Plant J. 40, 660–671

4. Dean, A. (2004) Chromatin remodelling and the interactionbetween enhancers and promoters in the beta-globin locus. BriefFunct. Genomic Proteomic. 2, 344–354

5. Cosgrove, M. S., and Wolberger, C. (2005) How does thehistone code work? Biochem. Cell Biol. 83, 468–476

6. Mellor, J. (2005) The dynamics of chromatin remodeling atpromoters. Mol. Cell 19, 147–157

7. Metivier, R., Penot, G., Hubner, M. R., Reid, G., Brand, H., Kos,M., and Gannon, F. (2003) Estrogen receptor-alpha directsordered, cyclical, and combinatorial recruitment of cofactors ona natural target promoter. Cell 115, 751–763

8. Wells, C. A., Ravasi, T., Sultana, R., Yagi, K., Carninci, P., Bono,H., Faulkner, G., Okazaki, Y., Quackenbush, J., Hume, D. A.,and Lyons, P. A. (2003) Continued discovery of transcriptionalunits expressed in cells of the mouse mononuclear phagocytelineage. Genome Res. 13, 1360–1365

9. Wells, C. A., Ravasi, T., Faulkner, G. J., Carninci, P., Okazaki, Y.,Hayashizaki, Y., Sweet, M., Wainwright, B. J., and Hume, D. A.(2003) Genetic control of the innate immune response. BMCImmunol. 4, 5

10. Ravasi, T., Wells, C., Forest, A., Underhill, D. M., Wainwright,B. J., Aderem, A., Grimmond, S., and Hume, D. A. (2002)Generation of diversity in the innate immune system: macro-phage heterogeneity arises from gene-autonomous transcrip-tional probability of individual inducible genes. J. Immunol. 168,44–50

11. Akira, S., and Sato, S. (2003) Toll-like receptors and theirsignaling mechanisms. Scand. J. Infect. Dis. 35, 555–562

12. Akira, S., Yamamoto, M., and Takeda, K. (2003) Role ofadapters in Toll-like receptor signalling. Biochem. Soc Trans. 31,637–642

13. Yamamoto, M., Yamazaki, S., Uematsu, S., Sato, S., Hemmi, H.,Hoshino, K., Kaisho, T., Kuwata, H., Takeuchi, O., Takeshige,K., Saitoh, T., Yamaoka, S., Yamamoto, N., Yamamoto, S., Muta,T., Takeda, K., and Akira, S. (2004) Regulation of Toll/IL-1-receptor-mediated gene expression by the inducible nuclearprotein IkappaBzeta. Nature 430, 218–222

14. Ozinsky, A., Underhill, D. M., Fontenot, J. D., Hajjar, A. M.,Smith, K. D., Wilson, C. B., Schroeder, L., and Aderem, A.(2000) The repertoire for pattern recognition of pathogens by


the innate immune system is defined by cooperation betweentoll-like receptors. Proc. Natl. Acad. Sci. U. S. A. 97, 13766–13771

15. Schroder, K., Hertzog, P. J., Ravasi, T., and Hume, D. A. (2004)Interferon-gamma: an overview of signals, mechanisms andfunctions. J. Leukoc. Biol. 75, 163–189

16. Hume, D. A., Underhill, D. M., Sweet, M. J., Ozinsky, A. O.,Liew, F. Y., and Aderem, A. (2001) Macrophages exposedcontinuously to lipopolysaccharide and other agonists that actvia toll-like receptors exhibit a sustained and additive activationstate. BMC Immunol. 2, 11

17. Park, G. Y., Joo, M., Pedchenko, T., Blackwell, T. S., andChristman, J. W. (2004) Regulation of macrophage cyclooxy-genase-2 gene expression by modifications of histone H3. Am. J.Physiol. 286, L956–L962

18. Lee, J. Y., Kim, N. A., Sanford, A., and Sullivan, K. E. (2003)Histone acetylation and chromatin conformation are regulatedseparately at the TNF-alpha promoter in monocytes and mac-rophages. J. Leukoc. Biol. 73, 862–871

19. Joo, M., Park, G. Y., Wright, J. G., Blackwell, T. S., Atchison,M. L., and Christman, J. W. (2004) Transcriptional regulation ofthe cyclooxygenase-2 gene in macrophages by PU. 1. J. Biol.Chem. 279, 6658–6665

20. Zhou, W., Chang, S., and Aune, T. M. (2004) Long-rangehistone acetylation of the Ifng gene is an essential feature of Tcell differentiation. Proc. Natl. Acad. Sci. U. S. A. 101, 2440–2445

21. Musikacharoen, T., Oguma, A., Yoshikai, Y., Chiba, N., Masuda,A., and Matsuguchi, T. (2004) Interleukin-15 induces IL-12receptor {beta}1 gene expression through PU. 1 and IRF 3 bytargeting chromatin remodeling. Blood

22. Sweet, M. J., Campbell, C. C., Sester, D. P., Xu, D., McDonald,R. C., Stacey, K. J., Hume, D. A., and Liew, F. Y. (2002)Colony-stimulating factor-1 suppresses responses to CpG DNAand expression of toll-like receptor 9 but enhances responses tolipopolysaccharide in murine macrophages. J. Immunol. 168,392–399

23. Himes, S. R., Tagoh, H., Goonetilleke, N., Sasmono, T., Oce-andy, D., Clark, R., Bonifer, C., and Hume, D. A. (2001) Ahighly conserved c-fms gene intronic element controls macro-phage-specific and regulated expression. J. Leukoc. Biol. 70,812–820

24. Boyd, K. E., Wells, J., Gutman, J., Bartley, S. M., and Farnham,P. J. (1998) c-Myc target gene specificity is determined by apost-DNA binding mechanism. Proc. Natl. Acad. Sci. U. S. A. 95,13887–13892

25. Stacey, K. J., Sweet, M. J., and Hume, D. A. (1996) Macrophagesingest and are activated by bacterial DNA. J. Immunol. 157,116–2122

26. Deng, W. G., Zhu, Y., and Wu, K. K. (2004) Role of p300 andPCAF in regulating cyclooxygenase-2 promoter activation byinflammatory mediators. Blood 103, 2135–2142

27. Thiel, G., Lietz, M., and Hohl, M. (2004) How mammaliantranscriptional repressors work. Eur. J. Biochem. 271, 2855–2862

28. Greene, W. C., and Chen, L. F. (2004) Regulation of NF-kappaBaction by reversible acetylation. Novartis Found Symp. 259, 208–217; discussion 218–225

29. Marks, P. A., Miller, T., and Richon, V. M. (2003) Histonedeacetylases. Curr. Opin. Pharmacol. 3, 344–351

30. Peterson, C. L., and Laniel, M. A. (2004) Histones and histonemodifications. Curr. Biol. 14, R546–551

31. Schreiber, S. L., and Bernstein, B. E. (2002) Signaling networkmodel of chromatin. Cell 111, 771–778

32. Wessells, J., Baer, M., Young, H. A., Claudio, E., Brown, K.,Siebenlist, U., and Johnson, P. F. (2004) BCL-3 and NF-kappa Bp50 attenuate LPS-induced inflammatory responses in macro-phages. J. Biol. Chem. 279, 49995–50003. Epub 2004 Oct 1

33. Costelloe, E. O., Stacey, K. J., Antalis, T. M., and Hume, D. A.(1999) Regulation of the plasminogen activator inhibitor-2(PAI-2) gene in murine macrophages. Demonstration of a novelpattern of responsiveness to bacterial endotoxin. J. Leukoc. Biol.66, 172–182

34. Chang, S., Stacey, K. J., Chen, J., Costelloe, E. O., Aderem, A.,and Hume, D. A. (1999) Mechanisms of regulation of the

MacMARCKS gene in macrophages by bacterial lipopolysaccha-ride. J. Leukoc. Biol. 66, 528–534

35. Medvedev, A. E., Kopydlowski, K. M., and Vogel, S. N. (2000)Inhibition of lipopolysaccharide-induced signal transduction inendotoxin-tolerized mouse macrophages: dysregulation of cyto-kine, chemokine, and toll-like receptor 2 and 4 gene expression.J. Immunol. 164, 5564–5574

36. Madonna, G. S., and Vogel, S. N. (1985) Early endotoxintolerance is associated with alterations in bone marrow-derivedmacrophage precursor pools. J. Immunol. 135, 3763–3771

37. Klemsz, M. J., McKercher, S. R., Celada, A., Van Beveren, C., andMaki, R. A. (1990) The macrophage and B cell-specific tran-scription factor PU. 1 is related to the ets oncogene. Cell 61,113–124

38. Suzuki, M., Yamada, T., Kihara-Negishi, F., Sakurai, T., andOikawa, T. (2003) Direct association between PU. 1 and MeCP2that recruits mSin3A-HDAC complex for PU. 1-mediated tran-scriptional repression. Oncogene 22, 8688–8698

39. Saccani, S., Pantano, S., and Natoli, G. (2002) p38-Dependentmarking of inflammatory genes for increased NF-kappa Brecruitment. Nat. Immunol. 3, 69–75

40. Sengupta, N., and Seto, E. (2004) Regulation of histone deacety-lase activities. J. Cell. Biochem. 93, 57–67

41. Ram, C. V. (2003) Possible therapeutic role of endothelinantagonists in cardiovascular disease. Am. J. Ther. 10, 396–400

42. Suzuki, M., Yamada, T., Kihara-Negishi, F., Sakurai, T., andOikawa, T. (2003) Direct association between PU. 1 and MeCP2that recruits mSin3A-HDAC complex for PU. 1-mediated tran-scriptional repression. Oncogene 22, 8688–8698

43. Yoon, H. G., Chan, D. W., Reynolds, A. B., Qin, J., and Wong, J.(2003) N-CoR mediates DNA methylation-dependent repres-sion through a methyl CpG binding protein Kaiso. Mol. Cell. 12,723–734

44. Wade, P. A., Gegonne, A., Jones, P. L., Ballestar, E., Aubry, F.,and Wolffe, A. P. (1999) Mi-2 complex couples DNA methyl-ation to chromatin remodelling and histone deacetylation. Nat.Genet. 23, 62–66

45. Rehli, M., Lichanska, A., Cassady, A. I., Ostrowski, M. C., andHume, D. A. (1999) TFEC is a macrophage-restricted memberof the microphthalmia-TFE subfamily of basic helix-loop-helixleucine zipper transcription factors. J. Immunol. 162, 1559–1565

46. Murakami, K., Nomiyama, H., Miura, R., Follens, A., Fiten, P.,Van Coillie, E., Van Damme, J., and Opdenakker, G. (1997)Structural and functional analysis of the promoter region of thehuman MCP-3 gene: transactivation of expression by novelrecognition sequences adjacent to the transcription initiationsite. DNA Cell Biol. 16, 173–183

47. Boekhoudt, G. H., Guo, Z., Beresford, G. W., and Boss, J. M.(2003) Communication between NF-kappa B and Sp1 controlshistone acetylation within the proximal promoter of the mono-cyte chemoattractant protein 1 gene. J. Immunol. 170, 4139–4147

48. Toney, L. M., Cattoretti, G., Graf, J. A., Merghoub, T., Pandolfi,P. P., Dalla-Favera, R., Ye, B. H., and Dent, A. L. (2000) BCL-6regulates chemokine gene transcription in macrophages. Nat.Immunol. 1, 214–220

49. Laribee, R. N., and Klemsz, M. J. (2001) Loss of PU. 1 expres-sion following inhibition of histone deacetylases. J. Immunol.167, 5160–5166

50. Marwick, J. A., Kirkham, P. A., Stevenson, C. S., Danahay, H.,Giddings, J., Butler, K., Donaldson, K., MacNee, W., and Rah-man, I. (2004) Cigarette smoke alters chromatin remodellingand induces pro-inflammatory genes in rat lungs. Am. J. Respir.Cell Mol. Biol. 31, 633–642. Epub 2004 Aug 27

51. Suuronen, T., Huuskonen, J., Pihlaja, R., Kyrylenko, S., andSalminen, A. (2003) Regulation of microglial inflammatoryresponse by histone deacetylase inhibitors. J. Neurochem. 87,407–416

Received for publication October 24, 2005.Accepted for publication March 3, 2006.


LPS regulates proinflammatory gene expression in macrophages by altering histone deacetylase expression

Documents