Little Exercise, Big Effects: Reversing Aging and Infection-Induced Memory Deficits, and Underlying Processes

Little exercise, big effects: Reversing aging and infection-induced memory deficits, and underlying processes

Ruth M. Barrientos, Matthew G. Frank, Nicole Y. Crysdale, Timothy R. Chapman, Jared T.Ahrendsen, Heidi E.W. Day, Serge Campeau, Linda R. Watkins, Susan L. Patterson, andSteven F. MaierDepartment of Psychology & Neuroscience, University of Colorado at Boulder, Boulder, CO80309, USA

AbstractWe have previously found that healthy aged rats are more likely to suffer profound memoryimpairments following a severe bacterial infection than are younger adult rats. Such a peripheralchallenge is capable of producing a neuroinflammatory response, and in the aged brain thisresponse is exaggerated and prolonged. Normal aging primes, or sensitizes microglia and thisappears to be the source of this amplified inflammatory response. Among the outcomes of thisexaggerated neuroinflammatory response are impairments in synaptic plasticity, and reductions ofbrain derived neurotrophic factor (BDNF), both of which have been associated with cognitiveimpairments. Since it has been shown that physical exercise increases BDNF mRNA in thehippocampus, the present study examined voluntary exercise in 24 mos old F344xBN rats as aneuroprotective therapeutic in our bacterial infection model. Although aged rats ran only anaverage of 0.7 km per week, this small amount of exercise was sufficient to completely reverseinfection-induced impairments in hippocampus-dependent long-term memory compared tosedentary animals. Strikingly, exercise prevented the infection-induced exaggeratedneuroinflammatory response and the blunted BDNF mRNA induction seen in the hippocampus ofsedentary rats. Moreover, voluntary exercise abrogated age-related microglial sensitization,suggesting a possible mechanism for exercise-induced neuroprotection in aging.

IntroductionOne of the more important advances in recent neuroscience research is the understandingthat there is extensive communication between the immune system and the central nervoussystem. Multiple pathways supporting this communication have been described, and as aresult of this communication, neural activity is altered quite extensively during a peripheralinfection (Maier and Watkins, 1998). Pro-inflammatory cytokines (e.g. interleukin-1beta;IL-1β) play a key role in this communication, as they are regulators of host responses toinfection, inflammation, and reactions to stress or trauma. Importantly, this immune-to-brainsignaling results in de novo production of pro-inflammatory cytokines within the brain,primarily by microglia (Van Dam et al., 1995).

Aged rats show a particular vulnerability to hippocampal-dependent long-term memoryimpairments following a peripheral Escherichia coli (E. coli) infection, which is paralleledby an exaggerated and long-lasting pro-inflammatory cytokine response in the hippocampus,effects not observed in young adult rats (Barrientos et al., 2006; Barrientos et al., 2009).Blockade of IL-1β signaling in the brain, with administration of IL-1 receptor antagonist

Correspondence should be addressed to Dr. Ruth M. Barrientos, Dept. of Psychology & Neuroscience, Campus Box 345, Universityof Colorado at Boulder, Boulder, CO 80309-0345. Telephone: 303-492-0777; Fax: 303-492-2967; [email protected].

NIH Public AccessAuthor ManuscriptJ Neurosci. Author manuscript; available in PMC 2012 February 10.

Published in final edited form as:J Neurosci. 2011 August 10; 31(32): 11578–11586. doi:10.1523/JNEUROSCI.2266-11.2011.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

(IL-1RA), eliminates the memory impairment (Frank et al., 2010b), underscoring theprominent role of IL-1β in the underlying neural processes. The potentiated pro-inflammatory cytokine response in hippocampus of aged rats has been shown to be due, atleast in part, to a priming of microglial cells that occurs with normal aging (Godbout et al.,2005; Frank et al., 2006; Frank et al., 2010a). Morphological and antigenic markers ofactivation (e.g. MHCII) are upregulated in hippocampal microglia of aged rats compared tothat of young adults (Frank et al., 2006), and the neuroinflammatory response to a pro-inflammatory stimulus is potentiated (Godbout et al., 2005; Frank et al., 2010a).

The exaggerated neuroinflammatory response following a peripheral infection in aged ratsproduces a dramatic and specific deficit in a form of long-lasting synaptic plasticity that isdependent on brain-derived neurotrophic factor (BDNF) (Chapman et al., 2010). BDNF is aneuronal growth factor that is rapidly and specifically expressed in the hippocampus duringcontextual learning (Hall et al., 2000), and is crucial for the formation of long-termmemories that depend on the hippocampus (Tyler et al., 2002; Soule et al., 2006). Andagain, blocking IL-1β signaling with IL-1RA protected against failure of long-lastingsynaptic plasticity (Chapman et al., 2010), and BDNF reductions (Cortese et al., 2011) inaged rats following infection.

Here, we examined voluntary exercise in aged rats as a possible therapeutic intervention toameliorate the cascade of maladaptive responses that follow peripheral infection, includinga) memory impairments, b) reduced BDNF induction, c) potentiated neuroinflammation, andd) microglial sensitization. In young subjects, physical exercise has been shown to increasehippocampal BDNF (Cotman et al., 2007), enhance memory performance on tasks thatdepend on the hippocampus via upregulation of BDNF (Vaynman et al., 2004), andameliorate the neuroinflammatory response following an immune challenge (Nickerson etal., 2005). However, whether exercise would reduce aging-induced susceptibility to thecognitive impairments that follow peripheral infection, and the processes thought to underliethese impairments, has not been explored.

Materials and MethodsSubjects

Subjects were male F344xBN F1 rats obtained from the National Institute on Aging(Bethesda, MD). Upon arrival at our facility, aged rats were 22 mos old, weighedapproximately 575 g, and were housed singly in Plexiglas cages (52 L X 30 W X 21 H, cm).All rats were allowed free access to food and water and were given 1–2 wk to acclimate tocolony conditions before experimentation began. Runners were housed in a cage with arunning wheel (circumference 1.08 m). A bicycle computer was attached to each cage/wheelto monitor running. Another group was housed in a cage with a running wheel that waslocked in place (Locked) to control for having a novel item in their cage, but these rats wereunable to run. A third group did not have a running wheel in their cage (Sedentary). Ratswere maintained in these conditions for 6 wk. The animal colony was maintained at 22±1°Con a 12 hr light/dark cycle (lights on at 07:00 h). All experiments were conducted inaccordance with protocols approved by the University of Colorado Animal Care and UseCommittee. All efforts were made to minimize the number of animals used and theirsuffering.

Immune challengeIn all but the glial sensitization experiments, animals received an intraperitoneal (i.p.)injection of either Escherichia coli (E. coli) (a ubiquitous bacterial strain), or vehicle. Oneday prior to administration, stock cultures were thawed and cultured overnight (15–20 h) in

Barrientos et al. Page 2

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

40 mL of brain-heart infusion (BHI; DIFCO Laboratories, Detroit, MI) in an incubator(37°C, 95% air + 5% CO2). The number of bacteria in cultures was quantified byextrapolating from previously determined growth curves. Cultures were then centrifuged for15 min at 4°C, 3000 RPM, supernatants discarded, and bacteria resuspended in sterilephosphate buffered saline (PBS). Bacteria were resuspended with a volume of PBS toachieve a dose of 1.0 × 1010 CFU. A volume of 250 μL was injected i.p. Vehicle-treated ratsreceived an injection of sterile PBS of an equal volume (250 μL).

Contextual fear conditioningWe chose to use the immediate-shock fear conditioning paradigm (Fanselow, 1990; Rudy etal., 2002) as the learning task. Here, foot shock is delivered very quickly upon exposure tothe experimental context on the fear conditioning day. However, the rats are pre-exposed tothe context at an earlier time. The pre-exposures are required so that the subjects are able toform a “conjunctive representation” of the context, so that it can be associated with theshock on the conditioning day (Rudy et al., 2002). We chose this fear conditioning paradigmbecause it is highly and specifically dependent on the hippocampus (Rudy et al., 2002), andwe have already shown that E. coli interferes with memory of this task in aging rats(Barrientos et al., 2006). The conditioning context was one of two identical Igloo ice chests(54 L × 30 W × 27 H, cm) with white interiors. A speaker and an activated 24-V DClightbulb were mounted on the ceiling of each chest. The conditioning chambers (26 L × 21W × 24 H, cm), placed inside each chest, were made of clear plastic and had window screentops. A foot shock was delivered through a removable floor of stainless steel rods 1.5 mm indiameter, spaced 1.2 cm center to center. Each rod was wired to a shock generator andscrambler (Colbourn Instruments, Allentown, PA). Chambers were cleaned with waterbefore each animal was conditioned or tested.

Rats were taken two at a time from their home cage and transported to the conditioningcontext in a black bucket with the lid on so that the rats could not see where they were beingtaken. This procedure was used in order to establish an association between the contextualrepresentation of the conditioning context and the transport cues that precede placement ofthe rat in the context. Rats were placed in the context and allowed to freely explore and thenwere transported back to their home cage where they remained approximately 40 sec beforethe next exposure. This procedure was repeated 3 times. Animals remained in the novelcontext for 5 min on the first exposure and for 40 sec on two subsequent exposures. The ratswere transported in the black bucket each time that they were returned to their home cage,but with the lid off. The purpose of these multiple exposures was to establish the features ofthe black bucket as retrieval cues that could activate the representation of the context (forfurther detail see (Rudy et al., 2002)). Seventy-two hr later, each animal was taken from itshome cage and transported to the conditioning context in the black bucket. There, theyreceived one 2 sec, 1.5 mA shock immediately after being placed in the context. They werethen quickly taken out of the context and transported back to their home cage. The rats’ timein the conditioning context on this day never exceeded 10 sec. Fear of the conditioningcontext was assessed 24 hr after immediate shock (4 days after pre-exposure) by placing therat in the conditioning context for 6 min. Several hr later, generalized fear was assessed byplacing the rat in an alternate context for 6 min also. Every 10 sec each rat was judged aseither freezing or active at the instant the sample was taken. Freezing, the rat’s dominantdefensive fear response, is a complete suppression of behavior that is accompanied byimmobility, shallow breathing, and a variety of other autonomic changes including anincrease in heart rate and pilo-erection (Fanselow and Lester, 1988). Freezing in theseexperiments was defined as the absence of all visible movement, except for respiration.Scoring began approximately 10 sec after the animal was placed into the chamber. Scoring

Barrientos et al. Page 3

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

was carried out by observers blind to experimental treatment, and inter-rater reliabilityexceeded 97% for all experiments.

Tissue dissectionFor in situ hybridization experiments, animals were rapidly decapitated one at a time 2 hrpost-conditioning. Age-matched home cage control rats were also sacrificed in this manner.Brains were removed, rapidly frozen in isopentane, and stored at −70°C. For all otherexperiments, animals were given a lethal dose of sodium pentobarbital and transcardiallyperfused with ice-cold saline (0.9%) for 3 min to remove peripheral immune leukocytesfrom the CNS vasculature. Brains were then rapidly extracted and placed on an ice-coldfrosted glass plate and hippocampi dissected for both IL-1β protein assay and microglia cellisolations. Liver was also dissected for measurement of IL-1β protein. Tissues slated forprotein measurements were quickly frozen in liquid nitrogen and stored at −70°C until thetime of processing. For methods on how tissues were processed for microglial isolationexperiments, see below.

In situ hybridization and histologyBrains were cut (10 μm slices) on a Leica cryostat through the dorsal hippocampus, thaw-mounted onto poly-l-lysine-coated slides, and stored at −70°C until processing. Sectionswere fixed in buffered paraformaldehyde (4%) for 1 hr, rinsed three times with 2x SSC(standard sodium citrate), placed in 0.1 M triethanolamine containing 0.25% aceticanhydride for 10 min, rinsed for 5 min in H2O, and dehydrated in alcohols. The cDNAprobe specific for BDNF generated by standard RT-PCR and subcloned into pSC-A plasmid(Stratagene), was directed at exon IX, which codes for the mature protein (GenbankEF125675.1, nt 661–1410). It was linearized using the NHE restriction enzyme. To generate35S-labeled complementary RNA to BDNF mRNA, 1 μg of linearized plasmid DNA, 5 μl5x transcription buffer (Promega), 7.5 μl 35S-UTP, 4μl of H2O, 2.5 μl 0.1 M dithiothreitol(DTT), 1 μl each of 100 mM GTP, CTP, and ATP, 1μl of RNase inhibitor, and 1μl T3polymerase in a total volume of 25 μl were incubated for 2 hr at 37°C. To isolate thecomplete complementary RNA from single nucleotides, a Sephadex G50-50 column wasused. The 35S-labeled probe was diluted in hybridization buffer to yield an approximateconcentration of 1 × 106 cpm/65 μl. The hybridization buffer consisted of 50% formamide,10% dextran sulfate, 2X SSC, 50 mM sodium phosphate buffer (pH = 7.4), 1X Denhardt’ssolution, and 0.1 mg/ml yeast tRNA. The radiolabeled probe/hybridization mixture (65 μl)was applied to each slide, and sections were coverslipped. Slides were placed in coveredplastic boxes lined with filter paper moistened with 50% formamide/50% H2O andincubated for 12–16 hr at 55°C. Coverslips were floated off in 2X SSC, and slides wererinsed three times in 2X SSC. Slides were incubated in RNase A (200 μg/ml) for 60min at37°C, followed by successive washes in 2X, 1X, 0.5X, and 0.1X SSC for 2–3 min each,with an additional incubation in 0.1X SSC for 60 min at 70°C. Slides were rinsed in distilledH2O, dehydrated in alcohols, and exposed to Kodak BIOMAX MR x-ray film for 7 days.

Semi-quantitative analyses were performed on digitized images from x-ray films in thelinear range of the acquisition system. This system consisted of a Northern Light box, modelB-95 (Imaging Research Inc., St-Catharines, Ont., Canada), a Sony XC-ST70 digital camerafitted with a Navitar 7000 zoom lens, a Scion Corp. LG3 frame grabber board, and ScionImage (ver. Beta 4.0.2–Scion Corporation, Frederick, MD) on a Dell 8100 computer. Signalpixels of a region of interest were defined as having a gray value of 3.5 standard deviationsabove the mean gray value of a cell-poor area close to the region of interest. The number ofpixels and the average gray values above the set background were then computed for theregion of interest and multiplied, giving an integrated densitometric measurement. Based onour recent electrophysiology findings showing a substantial deficit in long-lasting synaptic

Barrientos et al. Page 4

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

plasticity in CA1 neurons of infected aged rats (Chapman et al., 2010), we chose to focus onthe CA1 region of the hippocampus here. An average of eight to twelve measurements weremade for this region, and these values were further averaged to obtain a single integrateddensity value for each rat. The specificity of the probe was confirmed in a controlexperiment by using a sense probe. No specific hybridization was observed in the sensetreated sections (data not shown).

Detection of IL-1β proteinTo prepare the tissue for the assay, each tissue was added to 0.25–0.5 mL of Iscove’s culturemedium containing 5% fetal calf serum and a cocktail enzyme inhibitor (100 mM Amino-n-caproic acid, 10 mM EDTA, 5 mM Benzamidine HCL, and 0.2 mM Phenylmethyl sulfonylfluoride). Total protein was mechanically dissociated from tissue using a sonicdismembrator (Branson Ultrasonic Corp, Model 150E). Sonication consisted of 20 sec ofcell disruption at 52% amplitude. Sonicated samples were centrifuged at 10,000 g at 4°C for10 min. Supernatants were removed and stored at 4°C until ELISA was performed. Bradfordprotein assays were also performed to determine total protein concentrations in sonicationsamples.

Levels of IL-1β protein were determined using a commercially available rat IL-1β ELISAkit (R&D Systems, Minneapolis, MN). The assay was performed according to themanufacturer’s instructions. The sensitivity of the assay is less than 5 pg/ml. Inter- and intra-assay coefficient of variation is 5.5% and 4.7%, respectively. 50 μl of tissue sonicates wereused for the assay, and samples were run in duplicate. The concentration of IL-1β protein ispresented as picograms (pg) of IL-1β/100 μg of total protein.

Ex vivo immune stimulation of hippocampal microglia with LPS24 mos old subjects that had 6 wk prior access to either a running wheel, or a locked wheelwere given a lethal dose of sodium pentobarbital and transcardially perfused with ice-coldsaline (0.9%) as described above. Brains were then rapidly extracted and placed on an ice-cold frosted glass plate and hippocampi dissected. Hippocampal microglia were isolatedusing a Percoll density gradient as previously described (Frank et al., 2006).Immunophenotype and purity of microglia was assessed using real time RT-PCR. Microgliawere suspended in DMEM+10% FBS and microglia concentration determined by trypanblue exclusion. Microglia concentration was adjusted to a density of 5 × 103 cells/100 μl and100 μl added to individual wells of a 96-well v- bottom plate. LPS was then utilized tochallenge microglia in vitro. We have previously determined the optimal in vitro conditionsunder which LPS stimulates a pro-inflammatory cytokine response in these cells (Frank etal., 2006). Cells were incubated with 4 different doses of LPS (0.1, 1, 10, and 100 ng/ml) ormedia alone for 2 hr at 37°C, 5% CO2. At the end of the incubation, the plate wascentrifuged at 1000 x g for 10 min at 4°C to pellet cells and cells washed 1x in ice cold PBSand centrifuged at 1000 x g for 10 min at 4°C. Cell lysis/homogenization, DNase treatment,and cDNA synthesis were performed using the SuperScript III CellsDirect cDNA SynthesisSystem (Invitrogen, Carlsbad, CA).

Real time RT-PCR measurement of gene expressionA detailed description of the PCR amplification protocol has been published previously(Frank et al., 2006). cDNA sequences were obtained from Genbank at the National Centerfor Biotechnology Information (NCBI; www.ncbi.nlm.nih.gov). Primer sequences weredesigned using the Eurofins MWG Operon Oligo Analysis & Plotting Tool(http://www.operon.com/technical/toolkit.aspx) and tested for sequence specificity using theBasic Local Alignment Search Tool at NCBI (Altschul et al., 1997). Primers were obtainedfrom Invitrogen. Primer specificity was verified by melt curve analysis. All primers were

Barrientos et al. Page 5

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

designed to exclude amplification of genomic DNA. Primer sequences are as follows: β-Actin, F- TTCCTTCCTGGGTATGGAAT, R- GAGGAGCAATGATCTTGATC; IL-1β, F-CCTTGTGCAAGTGTCTGAAG, R-GGGCTTGGAAGCAATCCTTA; IL-6, F-AGAAAAGAGTTGTGCAATGGCA, R-GGCAAATTTCCTGGTTATATCC; TNFα, F-CAAGGAGGAGAAGTTCCCA, R- TTGGTGGTTTGCTACGACG.

PCR amplification of cDNA was performed using the Quantitect SYBR Green PCR Kit(Qiagen, Valencia, CA). Formation of PCR product was monitored in real time using theMyiQ Single-Color Real-Time PCR Detection System (BioRad, Hercules, CA). Relativegene expression was determined by taking the expression ratio of the gene of interest to β-Actin.

ResultsDistance Run & Body weight changes

Aged (22.5 mos old) rats were housed with a running wheel, a locked running wheel, or nowheel. The last two groups served as sedentary controls, while rats provided with afunctional wheel were given free, around-the-clock access to the wheels for a period of 6wk. Animals given access to a functional running wheel ran an average of 1.0 km during thefirst wk, and steadily decreased distances until stabilizing around 0.5 km the last two wk ofthe study (Fig. 1a). This is only a small amount of running. In fact, data from our laboratoryshows that young (3 mo) rats of the same strain as used here (F344xBN) run an average of30 km per wk over a 6 wk period (data not shown). Strikingly, aged rats ran nearly 50 timesless than young animals. There were no differences in body weight between the three groupsat the start of the study (Fig. 1b inset). However, despite the small amounts of exercisedisplayed by the aged runners, it is notable that they showed marked weight loss by the firstwk, compared to both sedentary rats and rats housed with a locked wheel, and maintainedthat weight loss for the duration of the experiment (Fig. 1b). Interestingly, rats housed with alocked wheel trended towards weight loss also, and indeed had lost significantly moreweight compared to sedentary rats on wks 4, 5 and 6, but remained significantly heaviercompared to running rats.

Effects of voluntary wheel-running on E. coli-induced contextual fear memoryHere, we examined the influence of voluntary wheel running on peripheral infection-induced hippocampal-dependent memory consolidation deficits. This was only done in agedrats because E. coli does not produce a memory deficit in young rats (Barrientos et al.,2006). After 6 wk of free access to a running wheel, a locked wheel, or no wheel, 24 mosold rats received a peripheral administration of E. coli or vehicle. Contextual fearconditioning occurred 4 days later. Testing for contextual fear memory, by scoring freezingbehavior in a 6 min test, occurred 4 days after conditioning.

The results are presented in Fig. 2. As is typical, E. coli produced a long-term memoryimpairment for conditioning occurring 4 days later in sedentary rats. It is known that it ismemory that is impaired rather than learning, because prior work has shown that short-termmemory tested shortly after conditioning is unaffected (Barrientos et al., 2006), indicatingthat learning occurs normally. Provision of a locked running wheel did not reduce thememory impairment produced by infection, but free access to a running wheel completelyeliminated the impairment (Fig. 2a).

To determine specificity of the freezing response, we scored freezing behavior of allsubjects in an alternate context. There were no differences among the groups (Fig. 2b).These data confirmed that the freezing behavior exhibited in the conditioning context wasdue to remembering where they had been shocked previously, rather than to generalized fear

Barrientos et al. Page 6

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

or anxiety. The fact that freezing in the shock context in the E. coli-treated sedentary ratswas no greater than in the non-shock context indicates the magnitude of the memoryimpairment produced by the E. coli infection.

Memory deficits were reversed, not just preventedIn prior work rats were tested at 24 mos, as here. Since it is unknown whether E. coli-induced memory deficits are present at 22.5 mos, the age at which exercise was begun, itcannot be concluded whether exercise reversed a deficit that was already present, orprevented the development of the deficit. To answer this question, we determined whetherE. coli would impair memory formation at 22.5 mos in sedentary rats, thereby indicating thatthe physiological changes that produce the memory deficit had already taken place. Thememory impairment was indeed present. E. coli-treated rats froze significantly less in theconditioning context than did vehicle-treated rats F(1, 8) = 5.46, p < 0.05. When tested in analternate context however, there was no difference between the groups F(1, 8) = 2.17, p >0.05 (graphs not shown), showing that the impairment was specific to the fear memory.These results suggest that voluntary exercise indeed reverses physiological changes thatmake sedentary aged animals more vulnerable to the memory impairments induced by E.coli infection.

Effects of voluntary wheel-running on E. coli-induced reductions in BDNF mRNAContextual fear conditioning has been shown to induce BDNF mRNA expression, and thisinduction is critical to long-term memory formation (Hall et al., 2000; Tyler et al., 2002;Barrientos et al., 2003; Barrientos et al., 2004; Vaynman et al., 2004; Soule et al., 2006;Cotman et al., 2007; Greenwood et al., 2009). Importantly, elevated levels of pro-inflammatory cytokines blunt this BDNF increase (Barrientos et al., 2003; Barrientos et al.,2004). To determine whether voluntary running reduces or prevents the effects of E. coli onBDNF expression, we used in situ hybridization to measure BDNF mRNA levels in the CA1region of the hippocampus 2 hr following contextual fear conditioning. This was done insedentary, locked wheel, and running animals that had been administered either vehicle or E.coli 4 days prior to being conditioned. Age-matched vehicle- and E. coli-treated home cagecontrol (HCC) rats were also used to assess baseline values. BDNF mRNA levels arepresented in Fig. 3 as a percent of the vehicle-treated HCC rats.

All conditioned groups had a robust and significant induction of BDNF mRNA compared tonon-conditioned vehicle-treated HCC rats (Fig.3). BDNF levels of vehicle-treated HCC ratsdid not differ from that of E. coli-treated HCC rats, likely due to a floor effect. Vehicle-treated runners had significantly greater BDNF induction than did vehicle-treated ratshoused with a locked wheel, but these values were not significantly greater than those ofvehicle-treated sedentary rats. However, E. coli-treated sedentary and locked wheel rats hadsignificantly blunted BDNF mRNA induction compared to their vehicle-treated controls.Strikingly, E. coli-treated runners did not exhibit any blunting, as their BDNF mRNAexpression was indistinguishable from vehicle-treated runners, and was significantly greaterthan all other E. coli-treated groups.

These data strongly suggest that voluntary exercise prevents the effects of E. coli on BDNFmRNA induction in the hippocampus of aged rats following a learning experience.

Effects of voluntary wheel-running on E. coli-induced elevations in IL-1βAging exaggerates and prolongs the IL-1β increase in the hippocampus that follows theperipheral administration of E. coli (Barrientos et al., 2006; Barrientos et al., 2009), and thisresponse has been shown to be responsible for hippocampal-dependent memory deficits, asblocking IL-1 receptors in hippocampus blocks those deficits (Frank et al., 2010b). Given

Barrientos et al. Page 7

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

that we have shown that voluntary exercise reverses the E. coli-induced memoryimpairments, we should expect that this intervention should also reduce hippocampal IL-1βincreases after E. coli administration in aging subjects. Thus, we measured IL-1β protein 4days post-E. coli in rats that had access to a running wheel, a locked wheel, or no wheel. Wemeasured IL-1β in both the hippocampus and liver. The inflammatory response following animmune challenge in liver has received little attention in aged rats, a significant gap in theliterature since inflammatory responses in the liver are especially important in immune-to-brain communication (Campbell et al., 2007).

Hippocampus—Running had no effect on basal IL-1β protein levels in hippocampus (Fig.4a). As is typical, E. coli increased hippocampal IL-1β in sedentary aged rats. The presenceof a locked running wheel did not prevent this IL-1β increase. However, rats that had freeaccess to running wheels showed no increase in hippocampal IL-1β at the time pointexamined. That is, exercise completely blocked the potentiated IL-1β response produced byinfection.

Liver—The pattern in the liver was somewhat different (Fig. 4b). E. coli produced a verylarge increase in IL-1β that was reduced, but not eliminated by both the locked and theunlocked wheels. The fact that IL-1β levels in liver from E. coli-treated runners wereelevated compared to vehicle-treated controls and were not lower than E. coli-treated lockedwheel rats, suggests, not surprisingly, that pro-inflammatory cytokine levels in the liver arenot as critical as hippocampal IL-1β, in producing or preventing hippocampal- dependentmemory deficits.

Effects of voluntary wheel-running on microglial sensitizationSensitization of microglial cytokine responses with age has been suggested as a plausiblemechanism facilitating aging-related cognitive vulnerability to infection (Perry, 2004; Franket al., 2006; Henry et al., 2009; Frank et al., 2010a). Thus, we isolated hippocampalmicroglia from 24 mos old subjects that had 6 wk prior access to either a running wheel, or alocked wheel. We did not employ a sedentary control in order to reduce animal usage, andthe locked wheel control is the more stringent of the 2 controls. Hippocampi were dissectedand microglia isolated, as previously described (Frank et al., 2010a), and stimulated in vitrowith increasing doses of lipopolysaccharide (LPS) for 2 hr. LPS is the major component ofthe cell walls of gram negative bacteria, and is commonly used to stimulate pro-inflammatory cytokine responses. Gene expression of three pro-inflammatory cytokines(TNFα, IL-1β, & IL-6) was measured using real-time PCR.

TNFα—LPS dose-dependently increased TNFα mRNA, and this increase was potentlyreduced by prior exercise at all doses of LPS (Fig. 5a).

IL-1β—LPS also dose-dependently increased IL-1β mRNA, and this increase was alsoblunted by exercise, in all doses except for the highest dose of LPS (Fig. 5b).

IL-6—Again, LPS dose-dependently increased expression of IL-6. However, exercise onlyreduced the IL-6 mRNA increase at the highest LPS dose (Fig. 5c). Given that IL-6induction lags behind TNFα and IL-1β (Givalois et al., 1994), the 2 hr timepoint may nothave been ideal for the observation of IL-6 increases.

Taken together, these data show that exercise robustly reduces the potentiated inflammatoryresponse of aged hippocampal microglia to pro-inflammatory stimulation.

Barrientos et al. Page 8

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

DiscussionIt has been noted that cognitive declines during normal, healthy aging are often precipitousrather than gradual, and that these declines are frequently preceded by peripheralinflammatory challenges such as infection or injury (Holmes et al., 2003; Sparkman andJohnson, 2008; Barrientos et al., 2010). However, the mechanism(s) responsible for thesedeclines are not understood. This led us to study aging rats (not senescent) that showunimpaired cognitive function on standard memory tasks prior to an infection, but exhibitprolonged impairments of long-term memory following infection (Barrientos et al., 2006).The duration of these impairments perfectly parallel the duration of IL-1β elevations in thehippocampus (Barrientos et al., 2009), and intracerebral administration of IL-1RA blocksthese effects (Frank et al., 2010b). Given these prior findings, pro-inflammatory cytokinessuch as IL-1β clearly play a prominent role in the processes underlying these impairments.One likely possibility is that IL-1β alters downstream mediators important to memoryformation. BDNF appears to be a strong candidate in this regard, as it has been repeatedlyimplicated as key for plasticity and the formation of memories (Tyler et al., 2002; Soule etal., 2006), and it is known to be downregulated by IL-1β (Barrientos et al., 2004). To furtherexplore this issue, we have examined LTP in hippocampal slices of young and aged subjectsthat had received E. coli or vehicle 4 days earlier. E. coli abrogated only forms of LTP thatare heavily dependent on BDNF, and only in aged rats (Chapman et al., 2010).

It is known that exercise can increase hippocampal BDNF expression (Cotman et al., 2007)as well as improve cognitive function in a number of situations (Woods et al., 2002;Greenwood et al., 2009; Erickson et al., 2011). Thus, we sought to determine whether itmight prevent/reverse aging-induced susceptibility to memory impairments produced byperipheral immune challenge, and whether it would alter the age-related changes thought tomediate this impairment. Six weeks of access to a running wheel completely eliminated thememory impairment produced by E. coli in aged subjects. This effect was not produced bythe provision of a locked running wheel, so activity in the wheel seems to be required.Remarkably, this effect occurred even though the aging subjects ran very little, only ~700meters a wk on average, nearly 50 times less than does a young rat. Nonetheless, the activitywas enough to produce a ~6% body weight reduction within 2 wk of the intervention, and tomaintain that reduction over the duration of the study (6–7 wk). Moreover, the finding thatthe susceptibility to memory impairment is present at 22.5 mos suggests that exercisereversed age-related processes that had already developed.

As noted, BDNF induced after learning and maintained during the consolidation period iscritical for long-term memory formation. In the present study, infection markedly bluntedBDNF mRNA induction in the CA1 region of the hippocampus of sedentary and lockedwheel rats. However, exercise potently prevented the blunting effects of infection on BDNFlevels, as these levels were as high in infected runners as in vehicle-treated runners. Therewere no significant differences in BDNF expression between vehicle-treated sedentary andrunning rats, an effect which conflicts with what has been shown in young animals (Cotmanet al., 2007). This may be due to the large discrepancy in the amounts of exercise achievedbetween aged and young rats, but this explanation is only speculative.

Increased hippocampal IL-1β is a likely cause of the BDNF reductions found here becausea) intra-hippocampal administration of IL-1β reduces BDNF (Barrientos et al., 2004); b)peripheral E. coli increases hippocampal IL-1β (Barrientos et al., 2009), and c) intra-cerebraladministration of IL-1RA blocks hippocampal BDNF reductions produced by E. coli(Cortese et al., 2011). Here, IL-1β in the hippocampus was indeed significantly elevated inboth sedentary and locked wheel subjects following infection. Strikingly however, rats thatexercised showed no such elevation. This could be the critical protection produced by

Barrientos et al. Page 9

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

running given the likely role of hippocampal IL-1β in producing hippocampal-dependentmemory impairments (Gemma and Bickford, 2007; Barrientos et al., 2010), BDNFreductions (Lapchak et al., 1993; Cortese et al., 2011) and impairments in associatedprocesses such as LTP (Chapman et al., 2010; Lynch, 2010).

There are two different, but not mutually exclusive, global possibilities concerning whyaging leads to exaggerated brain IL-1β increases following peripheral infection. It is possiblethat aging sensitizes the brain machinery that produces IL-1β upon receiving signals fromthe periphery, or aging could sensitize the peripheral machinery that signals the brain duringinfection. The latter possibility was examined previously with the finding being that agingdoes not increase the pro-inflammatory cytokine response to E. coli in the periphery (serumor spleen) (Barrientos et al., 2009). However, liver changes were not examined in that study,and the liver now appears to be a key structure in leading to immune-to-brain signals(Campbell et al., 2007). Thus, liver IL-1β levels were examined here. While the ability toexercise blunted liver IL-1β increases compared to that of sedentary rats, those levels did notdiffer from infected rats that had locked wheels. Since these two groups did differsignificantly on memory performance, these findings suggest that pro-inflammatorycytokine levels in the liver are not as critical as those in the hippocampus for producing, orpreventing, hippocampal-dependent memory deficits.

Prior work has indicated that aging does sensitize the brain machinery that produces IL-1β(Perry, 2004; Frank et al., 2006; Henry et al., 2009; Frank et al., 2010a). This work hasfocused on microglia since microglia are generally viewed as the major source of brainIL-1β (Van Dam et al., 1995). We thus examined isolated hippocampal microglia in thepresent studies. Microglia isolated from rats that were able to run for 6 wk showed amarkedly reduced pro-inflammatory response to LPS compared to microglia isolated fromrats that had locked wheels. That is, running reduced the sensitivity of microglia tostimulation, and this may be at the core of the mechanism by which running protects theaging subjects. Several mechanisms have been suggested as to how aging might sensitizemicroglia. Microglia are maintained in a quiescent state by ligation of either the fractalkine(CX(3)CR1) or CD200 receptor (Hoek et al., 2000; Cardona et al., 2006), both expressed onthe microglial cell surface. The ligands for these receptors (CX(3)CL1, CD200,respectively) are expressed on neurons, and so contact with neurons reduces microglialactivity (Hoek et al., 2000). Aging has been shown to reduce both CX(3)CR1 (Wynne et al.,2010) and CD200 (Frank et al., 2006; Lyons et al., 2007). Thus, it is possible that runningrestores signaling in either or both of these pathways. Since LPS is a Toll-like receptor 4(TLR4) ligand, it can also be noted that aging upregulates TLR expression in brain(Letiembre et al., 2007). Since there are also endogenous ligands that activate TLRs(Bianchi, 2007), it is also possible that exercise reduces microglial sensitivity by decreasingTLR expression. In any case, the present report is the first to show that running can reducemicroglial sensitivity to stimulation.

In sum, the data strongly support the view that aging produces cognitive vulnerability toperipheral immune challenge because it sensitizes microglia, leading to exaggerated brainpro-inflammatory responses to the challenge, thereby interfering with BDNF expression inthe period after learning. This hypothesis requires that any manipulation which bluntsmemory declines after infection also reduce microglial sensitivity, IL-1β increases, andBDNF decreases, and conversely. This is precisely the pattern of results presented here.

Exercise in humans has been shown to protect against declines in cognitive function withaging. For example, recent reports showed that aerobic exercise increased hippocampalvolume and improved spatial memory (Erickson et al., 2011) and delayed the onset ofcognitive impairments (Jedrziewski et al., 2010) in older individuals. It was concluded that

Barrientos et al. Page 10

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

exercise lowers the risk of dementia. It has been noted that dementia is often preceded byperipheral infection or other immune challenges (Holmes et al., 2003), and so the presentdata offer a possible mechanism for the protection afforded by physical activity. It should benoted that aging-associated cognitive declines may arise from various different insultstargeting different brain regions and/or functions. Therefore, depending upon the etiology ofthe cognitive decline, physical exercise may exert its beneficial effects through verydifferent mechanisms. For instance, in the TgCRND8 mouse model of Alzheimer’s diseaseexercise has been demonstrated to reduce amyloid load by improving energy metabolism inhippocampal neurons (Adlard et al., 2005). In a model of stroke however, exercise improvedcerebral outcomes by increasing endothelial nitric oxide synthase thereby increasing thedensity of perfused vasculature and cerebral blood flow (Gertz et al., 2006). In the presentstudy, we conclude that even small to moderate amounts of physical activity protect againstinfection-induced cognitive loss by normalizing microglial-driven neuroinflammatoryresponses to peripheral immune activation.

AcknowledgmentsThis work was supported by grants from the National Institute on Aging R01AG02827 (R.M.B., M.G.F., L.R.W.,S.F.M.) and R21AG031467 (S.L.P.). We thank Jennifer Hoover and Giuseppe P. Cortese for their skillful technicalassistance.

ReferencesAdlard PA, Perreau VM, Pop V, Cotman CW. Voluntary exercise decreases amyloid load in a

transgenic model of Alzheimer’s disease. J Neurosci. 2005; 25:4217–4221. [PubMed: 15858047]Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST

andPSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. [PubMed: 9254694]

Barrientos RM, Frank MG, Watkins LR, Maier SF. Memory impairments in healthy aging: Role ofaging-induced microglial sensitization. Aging Dis. 2010; 1:212–231. [PubMed: 21132050]

Barrientos RM, Sprunger DB, Campeau S, Watkins LR, Rudy JW, Maier SF. BDNF mRNAexpression in rat hippocampus following contextual learning is blocked by intrahippocampalIL-1beta administration. J Neuroimmunol. 2004; 155:119–126. [PubMed: 15342202]

Barrientos RM, Sprunger DB, Campeau S, Higgins EA, Watkins LR, Rudy JW, Maier SF. Brain-derived neurotrophic factor mRNA downregulation produced by social isolation is blocked byintrahippocampal interleukin-1 receptor antagonist. Neuroscience. 2003; 121:847–853. [PubMed:14580934]

Barrientos RM, Frank MG, Hein AM, Higgins EA, Watkins LR, Rudy JW, Maier SF. Time course ofhippocampal IL-1 beta and memory consolidation impairments in aging rats following peripheralinfection. Brain Behav Immun. 2009; 23:46–54. [PubMed: 18664380]

Barrientos RM, Higgins EA, Biedenkapp JC, Sprunger DB, Wright-Hardesty KJ, Watkins LR, RudyJW, Maier SF. Peripheral infection and aging interact to impair hippocampal memory consolidation.Neurobiol Aging. 2006; 27:723–732. [PubMed: 15893410]

Bianchi ME. DAMPs, PAMPs and alarmins: all we need to know about danger. J Leukoc Biol. 2007;81:1–5. [PubMed: 17032697]

Campbell SJ, Jiang Y, Davis AE, Farrands R, Holbrook J, Leppert D, Anthony DC.Immunomodulatory effects of etanercept in a model of brain injury act through attenuation of theacute-phase response. J Neurochem. 2007; 103:2245–2255. [PubMed: 17883399]

Cardona AE, Pioro EP, Sasse ME, Kostenko V, Cardona SM, Dijkstra IM, Huang D, Kidd G,Dombrowski S, Dutta R, Lee JC, Cook DN, Jung S, Lira SA, Littman DR, Ransohoff RM. Controlof microglial neurotoxicity by the fractalkine receptor. Nat Neurosci. 2006; 9:917–924. [PubMed:16732273]

Chapman TR, Barrientos RM, Ahrendsen JT, Maier SF, Patterson SL. Synaptic correlates of increasedcognitive vulnerability with aging: peripheral immune challenge and aging interact to disrupt

Barrientos et al. Page 11

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

theta-burst late-phase long-term potentiation in hippocampal area CA1. J Neurosci. 2010;30:7598–7603. [PubMed: 20519534]

Cortese GP, Barrientos RM, Maier SF, Patterson SL. Aging and a Peripheral Immune ChallengeInteract to Reduce Mature Brain-Derived Neurotrophic Factor and Activation of TrkB,PLC{gamma}1, and ERK in Hippocampal Synaptoneurosomes. J Neurosci. 2011; 31:4274–4279.[PubMed: 21411668]

Cotman CW, Berchtold NC, Christie LA. Exercise builds brain health: key roles of growth factorcascades and inflammation. Trends Neurosci. 2007; 30:464–472. [PubMed: 17765329]

Erickson KI, Voss MW, Prakash RS, Basak C, Szabo A, Chaddock L, Kim JS, Heo S, Alves H, WhiteSM, Wojcicki TR, Mailey E, Vieira VJ, Martin SA, Pence BD, Woods JA, McAuley E, KramerAF. Exercise training increases size of hippocampus and improves memory. Proc Natl Acad Sci US A. 2011

Fanselow MS. Factors governing one trial contextual conditioning. Anim Learn Behav. 1990; 18:264–270.

Fanselow, MS.; Lester, LS. A functional behavioristic approach to aversively motivated behavior:predatory imminence as a determinant of the topography of defensive behavior. In: Bolles, RC.;Beecher, MD., editors. Evolution and Learning. Hillside, NJ: Erlbaum; 1988. p. 185-211.

Frank MG, Barrientos RM, Watkins LR, Maier SF. Aging sensitizes rapidly isolated hippocampalmicroglia to LPS ex vivo. J Neuroimmunol. 2010a; 226:181–184. [PubMed: 20537730]

Frank MG, Barrientos RM, Biedenkapp JC, Rudy JW, Watkins LR, Maier SF. mRNA up-regulation ofMHC II and pivotal pro-inflammatory genes in normal brain aging. Neurobiol Aging. 2006;27:717–722. [PubMed: 15890435]

Frank MG, Barrientos RM, Hein AM, Biedenkapp JC, Watkins LR, Maier SF. IL-1RA blocks E. coli-induced suppression of Arc and long-term memory in aged F344xBN F1 rats. Brain BehavImmun. 2010b; 24:254–262. [PubMed: 19822205]

Funk JA, Gohlke J, Kraft AD, McPherson CA, Collins JB, Jean Harry G. Voluntary exercise protectshippocampal neurons from trimethyltin injury: Possible role of interleukin-6 to modulate tumornecrosis factor receptor-mediated neurotoxicity. Brain Behav Immun. 2011

Garcia-Mesa Y, Lopez-Ramos JC, Gimenez-Llort L, Revilla S, Guerra R, Gruart A, Laferla FM,Cristofol R, Delgado-Garcia JM, Sanfeliu C. Physical Exercise Protects Against Alzheimer’sDisease in 3xTg-AD Mice. J Alzheimers Dis. 2011; 24:421–454. [PubMed: 21297257]

Gemma C, Bickford PC. Interleukin-1beta and caspase-1: players in the regulation of age-relatedcognitive dysfunction. Rev Neurosci. 2007; 18:137–148. [PubMed: 17593876]

Gertz K, Priller J, Kronenberg G, Fink KB, Winter B, Schrock H, Ji S, Milosevic M, Harms C, BohmM, Dirnagl U, Laufs U, Endres M. Physical activity improves long-term stroke outcome viaendothelial nitric oxide synthase-dependent augmentation of neovascularization and cerebral bloodflow. Circ Res. 2006; 99:1132–1140. [PubMed: 17038638]

Givalois L, Dornand J, Mekaouche M, Solier MD, Bristow AF, Ixart G, Siaud P, Assenmacher I,Barbanel G. Temporal cascade of plasma level surges in ACTH, corticosterone, and cytokines inendotoxin-challenged rats. Am J Physiol. 1994; 267:R164–170. [PubMed: 8048620]

Godbout JP, Chen J, Abraham J, Richwine AF, Berg BM, Kelley KW, Johnson RW. Exaggeratedneuroinflammation and sickness behavior in aged mice following activation of the peripheralinnate immune system. Faseb J. 2005; 19:1329–1331. [PubMed: 15919760]

Greenwood BN, Strong PV, Foley TE, Fleshner M. A behavioral analysis of the impact of voluntaryphysical activity on hippocampus-dependent contextual conditioning. Hippocampus. 2009;19:988–1001. [PubMed: 19115374]

Hall J, Thomas KL, Everitt BJ. Rapid and selective induction of BDNF expression in the hippocampusduring contextual learning. Nat Neurosci. 2000; 3:533–535. [PubMed: 10816306]

Henry CJ, Huang Y, Wynne AM, Godbout JP. Peripheral lipopolysaccharide (LPS) challengepromotes microglial hyperactivity in aged mice that is associated with exaggerated induction ofboth pro-inflammatory IL-1beta and anti-inflammatory IL-10 cytokines. Brain Behav Immun.2009; 23:309–317. [PubMed: 18814846]

Barrientos et al. Page 12

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Hoek RM, Ruuls SR, Murphy CA, Wright GJ, Goddard R, Zurawski SM, Blom B, Homola ME, StreitWJ, Brown MH, Barclay AN, Sedgwick JD. Down-regulation of the macrophage lineage throughinteraction with OX2 (CD200). Science. 2000; 290:1768–1771. [PubMed: 11099416]

Holmes C, El-Okl M, Williams AL, Cunningham C, Wilcockson D, Perry VH. Systemic infection,interleukin 1beta, and cognitive decline in Alzheimer’s disease. J Neurol Neurosurg Psychiatry.2003; 74:788–789. [PubMed: 12754353]

Jedrziewski MK, Ewbank DC, Wang H, Trojanowski JQ. Exercise and cognition: results from theNational Long Term Care Survey. Alzheimers Dement. 2010; 6:448–455. [PubMed: 21044775]

Lapchak PA, Araujo DM, Hefti F. Systemic interleukin-1 beta decreases brain-derived neurotrophicfactor messenger RNA expression in the rat hippocampal formation. Neuroscience. 1993; 53:297–301. [PubMed: 8492907]

Letiembre M, Hao W, Liu Y, Walter S, Mihaljevic I, Rivest S, Hartmann T, Fassbender K. Innateimmune receptor expression in normal brain aging. Neuroscience. 2007; 146:248–254. [PubMed:17293054]

Lynch MA. Age-related neuroinflammatory changes negatively impact on neuronal function. FrontAging Neurosci. 2010; 1:6. [PubMed: 20552057]

Lyons A, Downer EJ, Crotty S, Nolan YM, Mills KH, Lynch MA. CD200 ligand receptor interactionmodulates microglial activation in vivo and in vitro: a role for IL-4. J Neurosci. 2007; 27:8309–8313. [PubMed: 17670977]

Maier SF, Watkins LR. Cytokines for psychologists: implications of bidirectional immune-to-braincommunication for understanding behavior, mood, and cognition. Psychol Rev. 1998; 105:83–107.[PubMed: 9450372]

Nickerson M, Elphick GF, Campisi J, Greenwood BN, Fleshner M. Physical activity alters the brainHsp72 and IL-1beta responses to peripheral E. coli challenge. Am J Physiol Regul Integr CompPhysiol. 2005; 289:R1665–1674. [PubMed: 16081876]

Perry VH. The influence of systemic inflammation on inflammation in the brain: implications forchronic neurodegenerative disease. Brain Behav Immun. 2004; 18:407–413. [PubMed: 15265532]

Rudy JW, Barrientos RM, O’Reilly RC. Hippocampal formation supports conditioning to memory of acontext. Behav Neurosci. 2002; 116:530–538. [PubMed: 12148921]

Soule J, Messaoudi E, Bramham CR. Brain-derived neurotrophic factor and control of synapticconsolidation in theadult brain. Biochem Soc Trans. 2006; 34:600–604. [PubMed: 16856871]

Sparkman NL, Johnson RW. Neuroinflammation associated with aging sensitizes the brain to theeffects of infection or stress. Neuroimmunomodulation. 2008; 15:323–330. [PubMed: 19047808]

Stranahan AM, Mattson MP. Bidirectional metabolic regulation of neurocognitive function. NeurobiolLearn Mem. 2011

Tyler WJ, Alonso M, Bramham CR, Pozzo-Miller LD. From acquisition to consolidation: on the roleof brain-derived neurotrophic factor signaling in hippocampal-dependent learning. Learn Mem.2002; 9:224–237. [PubMed: 12359832]

Van Dam AM, Bauer J, Tilders FJ, Berkenbosch F. Endotoxin-induced appearance of immunoreactiveinterleukin-1 beta in ramified microglia in rat brain: a light and electron microscopic study.Neuroscience. 1995; 65:815–826. [PubMed: 7609880]

Vaynman S, Ying Z, Gomez-Pinilla F. Hippocampal BDNF mediates the efficacy of exercise onsynaptic plasticity and cognition. Eur J Neurosci. 2004; 20:2580–2590. [PubMed: 15548201]

Woods JA, Lowder TW, Keylock KT. Can exercise training improve immune function in the aged?Ann N Y Acad Sci. 2002; 959:117–127. [PubMed: 11976191]

Wynne AM, Henry CJ, Huang Y, Cleland A, Godbout JP. Protracted downregulation of CX(3)CR1 onmicroglia of aged mice after lipopolysaccharide challenge. Brain Behav Immun. 2010

Barrientos et al. Page 13

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Fig. 1.a) Distance run, and b) body weight changes over a 6 wk period. Means ± SEM are plotted.a) Rats (n=16) ran an average of 1028 ± 120 meters the first wk of the study, showed asteady decrease over the course of the study with distances stabilizing around 470± 67meters in wk 5 and 6. b) Inset (starting body weights): A one-way ANOVA showed thatthere were no differences in body weight at the start of the study between the 3 groups F(2,31) = 0.87, p > 0.05; n=8–16. Percent body weight changes over 6 wk: A repeated measuresANOVA showed there was a significant main effect of physical activity (sedentary, locked,runners), F(2, 29) = 42.12, p < 0.0001, a significant main effect of time F(5, 10) = 8.02, p <0.0001, and a significant physical activity x time interaction (F(10, 145) = 7.90, p < 0.0001.Fisher’s post-hoc tests revealed that runners (n=16) had lost significantly more weight thandid both sedentary rats (n=8) and those with a locked wheel (n=8) beginning with the firstwk of the study and continuing on through the last (p < .0001, each wk). Rats housed with alocked wheel also showed a weight reduction compared to sedentary rats, but these wereonly significant beginning on wk 4 and continuing through wk 6 (p < .01, each wk).

Barrientos et al. Page 14

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Sedentary rats gained an average of 0.55%, while rats housed with locked wheels lost anaverage of 1.73%, and runners lost an average of 5.52% of their starting weight.

Barrientos et al. Page 15

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Fig. 2.Freezing to the a) conditioned fear context and b) an alternate context with conditioninghaving occurred 4 days post-immune challenge in 24 mos old rats, following 6 wk ofphysical activity. Means ± SEM are plotted. a) There was a significant main effect ofphysical activity (sedentary, locked, runners), F(2, 26) = 4.12, p < 0.03, and a significantmain effect of immune challenge (vehicle, E. coli), F(1, 26) = 11.91, p < 0.002. There wasalso a significant physical activity x immune challenge interaction (F(2, 26) = 4.05, p <0.03.Fisher’s post-hoc tests revealed that sedentary E. coli-treated rats (n=4) froze significantlyless than vehicle-treated controls (p < 0.05; n=4), and E. coli-treated runners (p < 0.01; n=8).Locked-wheel E. coli-treated rats (n=4) also froze significantly less than vehicle controls (p< 0.01; n=4), and E. coli-treated runners (p < 0.01). E. coli-treated runners showed nodifference from their vehicle controls (p > 0.05; n=8). b) In the alternate context there was

Barrientos et al. Page 16

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

neither a main effect of physical activity F(2, 26) = 1.58, p > 0.05, nor of immune challengeF(1, 26) = 0.011, p > 0.05.

Barrientos et al. Page 17

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Fig. 3.a) BDNF mRNA expression levels in CA1 region of the hippocampus 2 hr post-conditioning in rats that received either vehicle or E. coli 4 days prior to conditioning.Percent of vehicle HCC± SEM are plotted. There was a significant main effect of physicalactivity (HCC, sedentary, locked, runners), F(3, 43) = 50.144, P < 0.0001, and a significantmain effect of immune challenge (vehicle, E. coli) F(1, 43) = 8.698, P < 0.005. There wasalso a significant physical activity x immune challenge interaction (F(3, 43) = 3.14, P <0.04.Fisher’s post-hoc tests showed that all conditioned groups had significantly greater BDNFexpression than vehicle-treated HCC rats. Vehicle-treated HCC (n=5) BDNF levels did notdiffer significantly than those of E. coli-treated HCC rats (P >0.05; n=6). Vehicle-treatedrunners (n=9) exhibited greater BDNF expression compared to vehicle-treated locked wheelrats (P <0.05; n=6), but not compared to vehicle-treated sedentary rats (n=6). Sedentary E.coli-treated rats (n=6) exhibited significantly blunted BDNF expression compared to theirvehicle controls (p < 0.05), and E. coli-treated runners (p < 0.0005; n=8). BDNF mRNA

Barrientos et al. Page 18

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

levels from locked-wheeled E. coli-treated rats (n=5) were also significantly lowercompared to their vehicle-treated controls (p < 0.01), and E. coli-treated runners (p <0.0001). BDNF mRNA levels in E. coli-treated runners did not differ from their vehicle-treated controls (p = 0.80). Representative photomicrographs of vehicle-treated b) HCC(non-conditioned) and c) conditioned hippocampal slices.

Barrientos et al. Page 19

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Fig. 4.IL-1β protein levels in a) hippocampus and b) liver 4 days post-immune challenge inanimals that were housed with a running wheel, a locked wheel or no wheel for 6 wk. Means± SEM are plotted. a) Hippocampus. There was a significant main effect of physical activity(sedentary, locked, runners), F(2, 35) = 6.11, p > 0.005, a significant main effect of immunechallenge (vehicle, E. coli), F(1, 35) = 15.21, p < 0.0005, and a significant physical activityx immune challenge interaction (F(2, 35) = 3.57, p < 0.05. Fisher’s post hoc tests showedthat all vehicle-treated rats exhibited comparable IL-1β protein levels, and did not differacross conditions. Sedentary E. coli-treated IL-1β levels (n=5) were significantly highercompared to their vehicle controls (p < 0.01; n=6), E. coli-treated locked-wheel rats (p <0.05; n=5)), and E. coli-treated runners (p < 0.0005; n=8). Hippocampal IL-1β levels oflocked-wheeled E. coli-treated rats were also significantly higher compared to their vehicle-treated controls (p < 0.005; n=6), and E. coli-treated runners (p = 0.05). IL-1β levels in E.coli-treated runners were not different from their vehicle-treated controls (p = 0.73; n=11).b) Liver. There was a significant main effect of physical activity, F(2, 36) = 5.18, p < 0.05, asignificant main effect of immune challenge, F(1, 36) = 41.98, p < 0.0001, and a significantphysical activity x immune challenge interaction (F(2, 36) = 6.05, p < 0.005. Again, allvehicle-treated rats exhibited comparable IL-1β protein levels, and did not differ acrossactivity conditions. However, IL-1β levels in sedentary E. coli-treated rats (n=7) weresignificantly higher compared to their vehicle controls (p < 0.0005; n=7), E. coli-treatedlocked-wheel rats (p < 0.05; n=4), and E. coli-treated runners (p < 0.05; n=8). Liver IL-1βlevels of locked wheel E. coli-treated rats were also significantly higher compared to theirvehicle-treated controls (p < 0.0001; n=5), but not different from E. coli-treated runners (p >0.05). Liver IL-1β levels in E. coli-treated runners were also significantly higher comparedto their vehicle-treated controls (p < 0.001; n=11).

Barrientos et al. Page 20

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Fig. 5.a) TNFα, b) IL-1β, and c) IL-6 gene expression in isolated microglia 2 hr followingstimulation with increasing doses of LPS. Means ± SEM are plotted; n=4 in each group. a)TNFα. There was a significant main effect of physical activity (locked, runners) F(1, 24) =37.03, p < 0.001, a significant main effect of LPS dose (0, 0.1, 1, 10, 100 ng), F(4, 24) =206.29, p < 0.0001, and a significant physical activity x LPS dose interaction (F(4, 24) =22.45, p < 0.0001. At all doses of LPS, even the 0 ng dose, TNF gene expression wassignificantly higher in microglia of locked-wheel rats than that of runners (p < 0.05). b)IL-1β. There was a significant main effect of physical activity F(1, 24) = 17.23, p < 0.01, asignificant main effect of LPS dose, F(4, 24) = 224.78, p < 0.0001, and a significantphysical activity x LPS dose interaction (F(4, 24) = 4.07, p < 0.01. IL-1β gene expressionwas significantly higher in microglia of locked-wheel rats than that of runners at the 0 ng (p< 0.002), 0.1 ng (p = 0.05), 1 ng (p < 0.01), and 10 ng (p < 0.05) doses, but not the 100 ngdose (p > 0.05). c) IL-6. There was no significant main effect of physical activity F(1, 24) =

Barrientos et al. Page 21

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

4.35, p > 0.05, a significant main effect of LPS dose, F(4, 24) = 117.19, p < 0.0001, and asignificant physical activity x LPS dose interaction (F(4, 24) = 7.35, p < 0.0005. IL-6 geneexpression was significantly higher in microglia of locked-wheel rats than that of runners atonly the 100 ng dose (p < 0.005).

Barrientos et al. Page 22

J Neurosci. Author manuscript; available in PMC 2012 February 10.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript