Les macrophages alvéolaires et les cellules …...Les macrophages alvéolaires et les cellules dendritiques, deux joueurs clés dans l’homéostasie pulmonaire et la réponse asthmatique
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Les macrophages alvéolaires et les cellules dendritiques, deux joueurs clés dans l’homéostasie
1.3.2. Physiopathologie ............................................................................... 20 1.3.3. Cascade inflammatoire ...................................................................... 21 1.3.4. Dichotomie du rôle des AM ............................................................... 27
CHAPITRE 2 : Problématiques, hypothèse et objectifs de recherche ................... 33
2.1.Mise en contexte ............................................................................................. 34
2.2.Hypothèse et objectifs ..................................................................................... 35
CHAPITRE 3 : Lung mDC1 and mDC2 are differentially activated during a tolerogenic and asthmatic response ...................................................................... 39
3.1.Page titre ......................................................................................................... 40
Figure 1.1 : Orientation de la réponse immunitaire par les DC. .............................. 6
Figure 1.2 : La plasticité des AM dans l’immunité pulmonaire. ............................. 13
Figure 1.3 : Option de traitement de l’asthme par étape. ...................................... 19
Figure 1.4 : Biomarqueurs de l’asthme. ................................................................ 21
Figure 1.5 : Étapes importantes de la sensibilisation de l’asthme allergique. ....... 23
Figure 1.6 : Cascade inflammatoire de l’asthme allergique. .................................. 25
CHAPITRE 3
Figure 3.1 : The proportion of lung parenchyma mDC1 and mDC2 is different between naïve PVG and naïve BN. ....................................................................... 57
Figure 3.2 : Parenchymal mDC proportion is increased in both the tolerogenic and asthmatic response. .............................................................................................. 58
Figure 3.3 : The proportion of OVA+ mDC2 is increased in tolerogenic rats. ........ 59
Figure 3.4 : OVA+ DC migration to the dLN is enhanced in tolerogenic rats......... 60
Figure 3.5 : mDC1 maturation was increased in the dLN of asthmatic animals. ... 61
CHAPITRE 4
Figure 4.1 : Sensitization status of AM does not modulate early eosinophil recruitment in the airways ..................................................................................... 88
Figure 4.2 : DC recruitment in asthma is enhanced, but not modulated by AM .... 89
Figure 4.3 : DC allergen capture is decreased by AM from naïve rats .................. 90
Figure 4.4 : DC accumulation in draining lymph nodes is not modulated .............. 91
Figure 4.5 : OVA+ mDC accumulation in draining lymph nodes is inhibited by AM from naïve rats ...................................................................................................... 92
Figure 4.6 : Th2 polarized cell accumulation is enhanced locally after allergen challenge and modulated by AM transfer .............................................................. 93
Figure 4.7 : AM allergen capture is enhanced in asthma, but is not modulated by adoptive transfer ................................................................................................... 94
Figure 4.8 : MHC II and CD23 expression are not modulated on AM early on asthma development ............................................................................................. 95
Figure 4.9 : AM withdrawal from the asthmatic environment restores their protective functions ............................................................................................... 96
XII
CHAPITRE 5
Figure 5.1 : AM express the surface molecule CD200 and its expression is dysregulated in asthma ....................................................................................... 119
Figure 5.2 : rCD200 reduces AHR, but does not modulate cell recruitment in bronchoalveolar lavages ...................................................................................... 120
Figure 5.3 : mDC recruitment to the lung of asthmatic rats is inhibited by rCD200 ............................................................................................................................ 121
Figure 5.4 : rCD200 reduces the accumulation of Th2 cells in the lung of asthmatic animals ................................................................................................................ 122
Figure 5.5 : rCD200 does not alter dLN DC and T cell numbers ......................... 123
XIII
Liste des abréviations
AHR : Hyperactivité bronchique / Airway hyperresponsiveness AM : Alveolar macrophage / Macrophage alvéolaire ASM : Aiway smooth muscle B220 : Classe de CD45 BDCA : Blood dendritic cell antigen BN : Brown Norway cAM : Macrophage alvéolaire « cultivé » CCL : Chemokine C-C motif Ligand CCR : C-C chemokine receptor CD : Cluster of differenciation / Cluster de différenciation CMH / MHC : Complexe majeur d’histocompatibilité / Major histocompatibility
complex CXCL : Chemokine C-X-C motif Ligand CXCR : C-X-C chemokine receptor DALY : Disability-adjusted life year DC : Dendritic cells / Cellule dendritique DCImm : Cellule dendritique immature DCmat : Cellule dendritique mature dLN : Draining lymph node DOK : Downstream of tyrosine kinase ERK : Extracellular signal-Regulated kinases FcR : FC receptor / Récepteur à immunoglobuline – portion FC GM-CSF : Granulocyte macrophage colony stimulating factor ICOSL : Inducible T cell CO-Stimulator Ligand IFN : Interféron IgE : Immunoglobuline de type E IL : interleukine / interleukin ITIM : Immunoreceptor tyrosine-based inhibitory motif JNK : Jun N-terminal Kinase LBA / BAL : Lavage broncho-alvéolaire / Bronchoalveolar lavage LT : Leucotriène LyT : Lymphocyte T LPS : Lipopolysaccharides M1/M2 : Activation des macrophages de type 1/2 mDC : Cellule dendritique myéloide nAM : Macrophage alvéolaire de rats naïfs NO : Oxide nitrique / Nitric oxide OVA : Ovalbumine p38 MAPK : p38 Mitogen-Activated Protein Kinase PD-L : Programmed cell Death Ligand pDC : Cellule dendritique plasmacytoïde PG : Prostaglandine
XIV
PRR : Pattern recognition receptor / Récepteurs de reconnaissance de motifs moléculaires
PVG : Piebald Virol Glaxo rCD200 : CD200 recombinant sAM : Macrophage alvéolaire de rats sensibilisés
SIRP : Signal-regulatory protein alpha TCR : T-cell receptor / Récepteur des lymphocytes T TGF : Transforming growth factor Th : T helper / Lymphocyte T auxiliaire TLR : Toll-like receptor TNF : Tumor necrosis factor Treg : Lymphocyte T régulateur
XV
Remerciements
Le doctorat est une longue épreuve d’endurance qui n’aurait pu s’accomplir
sans le soutien de mes directeurs de recherche, de l’équipe du laboratoire, ainsi
que de ma famille et mes amis.
Tout d’abord, je voudrais remercier ma directrice de recherche Elyse
Bissonnette pour toutes ces belles années qui seront la fondation de mon post-
doctorat et de mes projets futurs. Merci d’avoir réussi à m’infuser un peu de ta
sagesse et de ton organisation. Je tiens également à remercier mon co-directeur
David Marsolais. Bien que ton arrivé au centre de recherche a presque coïncidé
avec le début de mon doctorat, ton savoir et ton expertise ont grandement
influencé la réalisation de mes études. Tes commentaires et tes conseils ont
toujours permis d’améliorer mes projets.
J’aimerais également dire un gros merci à toutes mes assistantes de
recherche, sans qui tout ce parcours n’aurait pu se réaliser. Je pense à Annie, à
Véronique et, la dernière mais non la moindre, à Anick. Merci de m’avoir enduré,
moi et mon désordre. Votre support et vos nombreux conseils m’ont permis de
faire avancer mes projets. Je n’aurais pu passer au travers de toutes ces années
sans les « sacrifices chantant », les diners sushi, les 5@7, sans oublier les
nombreux cafés/diners, tous davantage ressourçant que scientifiques.
Avec les années, l’équipe Bissonnette n’a pas grandi, mais deux équipes
sont venues s’y greffer, soit les équipes de Marie-Renée Blanchet et David
Marsolais. Merci à vous tous d’avoir été mes collègues d’adoption et
particulièrement, à EM pour toutes les pouliches / licornes / etc. qui ont rempli le
lab. Merci également à la grande famille de pneumologie, notamment à Annick
(ex), Marie-Josée, MEP, MET (ex) et Sophie. Merci à Laetitia pour ta bonne
XVI
humeur, ton support, tes « doux » et tes conversations toujours appréciées. Merci
également à Marc pour toutes ces heures passées avec moi devant le cytomètre
et à ces excellentes dégustations de bières. Merci également à mes
prédécesseurs et anciens collègues de bureau : François, Marc-André, Mathieu.
Vous avez été des modèles et sans vous, le bureau a perdu un peu de son âme.
Merci également à ma famille : mon père, ma mère et mon frère. Même si
vous ne compreniez pas toujours (et ne comprenez peut-être pas encore) mes
recherches, vous avez toujours été là pour moi. On se rend compte de
l’importance de la famille lorsqu’on en a besoin et vous avez toujours répondu
présent. Merci pour tout.
Finalement, je tiens à remercier mon amour, ma blonde et nouvellement, ma
fiancée. J’ai passé à tes côtés les plus beaux moments de ma vie et nous avons
traversé les pires épreuves. Sans toi, je n’aurais jamais réussi à être où j’en suis.
Merci d’être à mes côtés et de m’endurer. Merci pour tout.
Junior, David, Ti-pou, tu as été le plus beau cadeau que l’on puisse avoir,
mais tu nous as été enlevé beaucoup trop rapidement. Tu as été et tu seras
toujours notre petite étoile filante...
XVII
Avant-propos
Cette thèse est constituée de 3 articles scientifiques qui abordent les
mécanismes impliqués dans la régulation de l’immunité pulmonaire et l’asthme
allergique. Dans un premier temps, l’introduction abordera le thème général de
l’homéostasie pulmonaire, ainsi que celui de l’asthme allergique. Suivant cette
dernière, trois chapitres aborderont les thèmes plus spécifiques du rôle des
populations de cellules dendritiques dans l’immunité pulmonaire, celui des
macrophages alvéolaires dans le maintien de l’homéostasie et finalement
l’implication de la voie du CD200 dans la tolérance immunitaire.
Article 1 (chapitre 3) : Lung mDC1 and mDC2 are differentially activated during a
tolerogenic and asthmatic response
Cet article traite de l’activation différentielle des différentes populations de
cellules dendritiques dans le développement d’une réponse tolérogène et
asthmatique. Cette étude a été réalisée lors de mon stage doctoral dans le
laboratoire du Dr Patrick Holt au Telethon Institute for Child Health Research à
Perth, en Australie. Ce stage avait pour but d’apprendre de nouvelles techniques
que Dre Bissonnette voulait intégrer à ses projets de recherche. Cette étude a été
désignée et réalisée sous la supervision du Dr Patrick Holt. J’ai réalisé toutes les
expériences présentées dans cet article avec la collaboration du Dre Deborah
Strickland. Également, j’ai effectué l’analyse et l’interprétation des données avec la
collaboration Dre Elyse Bissonnette et du Dr David Marsolais. J’ai également
rédigé l’article avec leur collaboration. La Dre Anick Langlois a collaboré à la
révision de l’article. Ce manuscrit est en préparation pour être soumis
1: Division of Cell Biology, Telethon Institute for Child Health Research (TICHR), and Centre for Child Health Research, The University of Western Australia , Perth , Western Australia, Australia. 2: Centre de recherche de l’Institut universitaire de cardiologie et de pneumologie de Québec (CRIUCPQ), Université Laval, Québec, Québec, Canada.
41
3.2. Résumé
Les cellules dendritiques (DC) jouent un rôle important dans l’immunité
pulmonaire. Elles peuvent aussi bien induire une réponse tolérogène
qu’asthmatique. Plusieurs études suggèrent que les différentes populations de DC
(DC myéloïdes (mDC)1-2 et les DC plasmacytoïdes (pDC)), ainsi que les DC des
différents compartiments pulmonaires (la trachée et le parenchyme pulmonaire),
ont des rôles distincts. Par contre, l’implication des différentes populations de DC
dans la tolérance et l’asthme allergique est encore matière à débat. Donc, nous
avons investigué l’activation des populations de DC dans une réponse
tolérogénique et asthmatique. Des rats Piebald Virol Glaxo (PVG) and Brown
Norway (BN) ont été sensibilisés et exposés plusieurs fois à l’ovalbumine (OVA).
Chez les rats PVG, ce traitement induit une réponse tolérogène, tandis que les rats
BN développent une réponse asthmatique. Ainsi, nous avons étudié la contribution
des différentes populations de DC lors de ces réponses. Après de multiples
expositions à l’allergène, davantage de mDC2 pulmonaires ont capturé des
allergènes et migré vers les ganglions lymphatiques chez les rats PVG tolérogènes
que chez les rats BN. Chez les rats asthmatiques, nous n’avons pas observé de
modulation de la capture de l’allergène, ainsi que la migration vers les ganglions
lymphatiques, par les différentes populations de DC. Par contre, la maturation des
mDC1 des ganglions lymphatiques de rats asthmatiques était augmentée par
rapport à celle des rats tolérogènes. De façon surprenante, aucune modulation de
l’activation des DC de la trachée n’a été observée dans les deux réponses. Bref,
nos données suggèrent que les mDC2 pulmonaires sont activées lors de la
tolérance, tandis que la réponse asthmatique est associée avec une augmentation
de la maturation des mDC1.
42
3.3. Abstract
Dendritic cells (DC) play a crucial role in lung immunity. They can induce
either a tolerogenic response or initiate an asthmatic cascade. It is suggested that
DC in the different lung compartment (trachea and lung parenchyma), as well as
the DC subsets (myeloid DC (mDC) 1-2 and plasmacytoid DC (pDC)), have distinct
role. However, little information is available on the role of these subsets in
tolerance and asthma. We investigated the activation of the DC subsets in a
tolerogenic and asthmatic response. Piebald Virol Glaxo (PVG) and Brown Norway
(BN) rats were sensitized and exposed to multiple OVA challenges. In PVG rats,
this treatment induced a tolerogenic response, whereas BN rats developed an
asthmatic response. Then, we investigated the respective contribution of each DC
subsets in these responses. In tolerogenic rats, we observed an increased allergen
sampling by mDC2 from the lung parenchyma compared to asthmatic BN rats. This
was translated by an increased migration of OVA+ mDC2 to the draining lymph
node (dLN) of PVG rats after multiple challenges. In asthmatic rats, the allergen
capture, as well as the migration to the dLN, of the DC subsets was not modified
after asthma development. However, MHC II expression (a maturation marker) on
mDC1 in dLN was increased in BN asthmatic group compared with PVG rats.
Surprisingly, no alteration in the response of tracheal DC was observed. Thus, our
data suggest that lung mDC2 activation is associated with the tolerogenic response
in PVG rats, whereas an increased maturation of dLN mDC1 was observed in the
asthmatic response of BN rats.
43
3.4. Introduction
Lung immunity is a complex balance between tolerance and inflammation
and little information is available on the determinants that skew these immune
responses. The immune outcome is modulated by the allergen dose, but a
controversy still exists whether a low or a high allergen dose is linked with asthma
development (1). Moreover, it is suggested that various immune responses are
mediated by distinct dendritic cell (DC) populations, but no study was able to
clearly delineate the role of each DC subset (2, 3). Finally, the maturation status of
DC can also alter the immune response. Indeed, immature DC express low level of
MHC II and favour tolerance, whereas mature DC can induce either an
inflammatory or anti-inflammatory response (4). Thus, DC biology is critical to the
outcome of allergen exposure.
In the lungs, myeloid DC (mDC) represents the majority of DC, whereas
plasmacytoid DC (pDC) are scarcer (5). mDC population can be further divided in
two subsets, mDC1 and mDC2. mDC1 are specialized in soluble particle uptake
and mDC2 are more efficient than mDC1 to activate CD8 T cells (3, 6). As for pDC,
they are specialized in viral defence and are also involved in allergen tolerance (7),
but this finding is still controversial as human pDC cannot induce Treg (8). Yet, the
role of DC subsets in the development of an asthmatic response and tolerance
remains unclear (3, 7, 9, 10).
Functions of lung DC subsets differ depending on their location, tracheal
mucosa vs lung parenchyma. In naïve animal, tracheal DC have a shorter half-life
and phagocyte more antigens than their lung counterpart (11). Whether or not
these compartments are differentially regulated in the context of tolerance and
asthmatic inflammation is unknown.
44
Given that DC are central in the allergen response and that they can induce
both asthma inflammation and tolerance, we examined how tracheal and
pulmonary DC subset are modulated during a tolerogenic response and an
asthmatic reaction following allergen exposure. The present study shows, for the
first time, that in a tolerogenic response, lung mDC2 increases their capacity to
capture allergen. On the other hand, the asthmatic response was associated with
an increased maturation of mDC1, while not affecting their capacity to capture
allergens.
3.5. Material and methods
Animals, treatments, and allergen exposures.
The 8- to 12-week-old specified-pathogen-free Piebald Virol Glaxo (PVG)
and Brown Norway (BN) rats were used. All experimental protocols were approved
by the Institutional Animal Ethics Committee of the TICHR (WA, Australia).
Ovalbumin (OVA) sensitization was performed by intraperitoneal inoculation of
100 μg OVA/200 μl aluminum hydroxide and rats were challenged 14–21 days
later. The challenge was done by daily aerosol exposition carried out over a 60-min
period using 1% OVA in phosphate-buffered saline for 6 consecutive days (12). For
in situ uptake studies, the last aerosol was replaced with intranasal instillation of
50 μg of OVA-Alexa647 in 75 μl. The naïve group was not sensitized nor
challenged daily, but received an intranasal instillation of fluorescent OVA. Tissues
were harvested 2 h after the last exposure.
45
Media and reagents.
Culture medium and isolation reagents including monoclonal antibodies and
immunostaining reagents were used as previously reported (12). Briefly,
monoclonal antibodies directed against cell surface antigens to identify dendritic
cells (CD4, CD11b, and MHC Class II) were purchased from BD Pharmingen
(Western Australia, Australia). OVA (grade V essentially lipopolysaccharide-free),
collagenase type IV, and DNase were purchased from Sigma (St Louis, MO).
Cell preparations.
Lymph nodes, tracheal mucosa, and lung parenchyma were digested with
collagenase to obtain single-cell suspensions (12). Briefly, tissues were digested
with Collagenase IV and DNase I to obtain single cell suspension. These
preparations were stained with monoclonal antibodies to identify the DC subsets.
Data were acquired on an LSRII flow cytometer (BD Biosciences, San Jose, CA)
and analyzed using the Flowjo software (version 8.8.6; Tree Star Inc., Stanford,
CA).
Statistics
Prism (GraphPad Software, La Jolla, CA) was used for all statistical
analyses, which includes one-way and two-way ANOVAs with Bonferroni post hoc
test. Data are presented as mean ± SEM and p values < 0.05 were considered
significant.
46
3.6. Results
Allergen induces an accumulation of mDC in the lung parenchyma, but not
in tracheal mucosa
In order to understand the implication of each DC subsets in tolerance
versus allergic airway inflammation, sensitized PVG (allergy tolerant) and BN
(allergy susceptible) rats were exposed to 6 antigen challenges (once a day for six
days). Sensitized PVG rats who received multiple allergen challenges develop a
features, including eosinophilia, airway hyperresponsiveness (AHR), and T cell
polarization (12, 14). DC subsets were identified in trachea and lung parenchyma
using fluorochome-labeled antibodies raised against MHC II, CD11b and CD4
fluorochrome labelled antibodies coupled with FACS analysis. Myeloid DC (mDC)
are MHC IIhigh/CD11b+ and can be divided in two populations according to CD4
expression (mDC1 are CD4+ and mDC2 are CD4–) and plasmacytoid DC (pDC)
are MHC IIint/CD11b–/CD4+ (Figure 3.1A). In both compartments of the lung, the
vast majority of DC were mDC, whereas the pDC subset accounted for less than
10% of the DC population. In PVG lung parenchyma, the majority of DC were
mDC1 (30 ± 5%), whereas in BN, there was an almost equal proportion of mDC1
and mDC2 (Figure 3.1B). In tracheal mucosa, the majority of DC were mDC1 for
both PVG and BN rats (respectively, 66 ± 3% and 58 ± 5%) (Figure 3.1C). Thus,
mDC1 are more represented in naïve PVG lung DC subsets, whereas mDC2 are
more frequent in naïve BN lungs.
After multiple allergen challenges, mDC1 and mDC2 accumulate in the lung
parenchyma of both BN and PVG rats, whereas the pDC subset was not
modulated (Figure 3.2A). The accumulation of mDC subsets was not different in
tolerogenic and asthmatic responses. Surprisingly, in tracheal mucosa, there was
no accumulation of mDC or pDC in either strain of rats after multiple challenges
47
(Figure 3.2B). Therefore, both the asthmatic and tolerogenic responses are
associated with an increased accumulation of mDC in the lung parenchyma,
without any alteration of the proportion of DC in the tracheal mucosa.
The tolerogenic response is associated with an increased allergen capture by lung
mDC2
We investigated the capacity of DC subsets to sample allergens. Thus, the
last challenge was done with intranasal administration of fluorescent OVA. In the
lung parenchyma of naïve rats, a significant proportion of mDC1 and mDC2 were
OVA+ in both PVG and BN rats (respectively, 10 ± 3% and 4 ± 2% for mDC1;
5 ± 2% and 3 ± 1% for mDC2) (Figure 3.3A). Interestingly, multiple allergen
challenges of PVG rats did not alter the percent of lung OVA+ mDC1, whereas the
proportion of lung OVA+ mDC2 significantly increased by 4 fold (20 ± 2% vs
5 ± 2%). In contrast, the proportion of OVA+ mDC1 and mDC2 was unchanged in
the lung parenchyma of BN rats after multiple challenges. Less than 1% of pDC
were positive for allergens in lungs of BN and PVG rats (Figure 3.3).
In tracheal mucosa of both naïve and challenged PVG, mDC1 allergen
capture represented 1 ± 1% of the mDC1 population, whereas 8 ± 2% and 6 ± 1%
mDC2 were OVA+, respectively (Figure 3.3B). In BN trachea, around 1% of mDC1
and mDC2 captured allergens, independently of the group studied. Overall, the
tolerogenic response was marked by a strong increase in allergen capture by lung
parenchyma mDC2, while no modulation of OVA+ DC was observed in the allergic
response.
The tolerogenic response is characterized by a strong accumulation of OVA+
mDC2 to the draining lymph nodes
48
After sampling allergens in the lungs, DC migrate to the draining lymph
nodes (dLN) to stimulate reactive T cells. This step is crucial to mount an immune
response, either inflammatory or tolerogenic. Thus, we evaluated the type of OVA+
DC that migrated from the lung to dLN 2 h after a fluorescent OVA challenge. In
naïve PVG rats, 76 ± 11% of the dLN OVA+ DC were mDC1, whereas OVA+ mDC2
and pDC represented respectively, 24 ± 11% and 1 ± 1%. Multiple challenged PVG
rats had a drastic increase in the number of dLN OVA+ DC by more than 40-fold.
The greatest increase was observed for mDC2, which reached 478 ± 53 x103
OVA+ cells per dLN, whereas OVA+ mDC1 and pDC reached, respectively,
62 ± 11 x103 and 13 ± 4 x103 OVA+ cells per dLN (Figure 3. 4). In dLN of naïve BN
animals, the proportion of OVA+ DC favored slightly mDC1 over mDC2 (64 ± 15%
vs 35 ± 15%), whereas 1 ± 1% of dLN pDC were OVA+. Moreover, the amount of
OVA+ DC in the dLN did not increase in BN rats after multiple challenges
compared with the naïve group. Therefore, the hallmark of the tolerogenic
response is a strong migration of OVA+ mDC2 to the dLN, while in asthmatic
animals mDC OVA+ migration to the dLN was not altered.
mDC1 maturation is increased in the dLN of asthmatic rats
To further investigate the implication of the DC subsets in immune response,
we evaluated the activation status of DC subsets in the dLN using the expression
of MHC II. In PVG rats, MHC II expression by dLN DC subsets was similar
between naïve and multiple challenged rats (Figure 3.5). In BN animals, multiple
allergen challenges induce a significant 2-fold increase of MHC II expression on
mDC1, whereas no difference was observed in mDC2 and pDC. Thus, no increase
of DC maturation was observed in tolerogenic rats, whereas BN inflammatory
response was associated with an enhanced maturation of dLN mDC1.
49
3.7. Discussion
Lung homeostasis involves a complex interplay between immune cells.
Depending on the insult perceived, the immune system normally mounts a
response to contain the threat. In allergic asthma, the homeostasis is breached
and an exaggerated immune response is triggered by usually innocuous particles
(allergens). Interestingly, DC play a key role in both homeostasis and allergic
response, but the role of specific DC subsets in tolerance and inflammation
remains poorly understood. Thus, we investigated the contribution of each DC
subset in the development of a tolerogenic and asthmatic responses. Our results
show that these two immune responses are associated with divergent activation of
specific DC subsets. Indeed, the tolerogenic response involves an increased
capture of allergens by lung parenchymal mDC2 and their rapid migration to the
dLN. In contrast, allergen capture by parenchymal mDC subsets was not increased
in asthmatic BN rats. In these rats, the weak allergen sampling and migration to the
dLN was counterbalanced by an increased maturation of their dLN mDC1. Overall,
these data support that mDC2 have a role in inducing a tolerogenic response to
inhaled allergens, whereas the asthmatic response may be mediated by mDC1.
Previous reports have shown that multiple challenges of sensitized animals,
including PVG rats (13) as well as various mouse strains (15, 16), attenuate
asthma prototypic features through enhanced Treg numbers and functions. Our
current results suggest that this phenotype is associated with an increased
sampling of the allergens by lung parenchymal mDC2 and their migration to the
dLN. These findings support a previous study that linked mouse mDC2 (identified
as CD103+ mDC) activity with Treg activation in pulmonary and intestinal
experimental settings (17, 18). The present study is in contradiction with that of
Fear et al (5) who showed that tolerogenic mice have a reduced number of OVA+
mDC in the lungs. This discrepancy suggests that tolerance can be achieved either
with a low allergen dose (i.e. amount of OVA capture by lung DC) (5) or with a high
50
DC allergen sampling (as observed in the present study and elsewhere (12)).
Furthermore, these differences could be variations between mice (5) and rat
immune tolerogenic response (12). Thus, in PVG rats, the tolerance is associated
with an increase in allergen sampling by mDC2.
To further investigate the role of DC subsets in lung immunity, we
investigated the DC response to allergens in BN asthmatic rats. The allergen
burden is linked to the polarization of the immune response, but no consensus
emerged whether high or low DC migration favors a Th2 response (1, 12, 19-21)..
In the present study, DC allergen capture was much smaller after multiple
challenges in the tracheal mucosa and in the lung parenchyma of BN rats
compared with PVG rats, supporting that a low OVA+ DC migration induced Th2
immunity. This is in agreement with Strickland et al (12) who demonstrated that the
allergic response of BN rats was associated with a low allergen capture by DC,
whereas high allergen exposure can reinstate homeostasis. Furthermore, in the
present study, we show that the asthmatic response of BN rats is associated with
enhanced maturation of dLN mDC1, supporting previous finding that mDC1 are
essential for Th2 polarization (22). More mature mDC1, even with low allergen
capture, are likely more effective to present antigen and activate Th2 cells. Overall,
the allergic response of BN rats is likely linked to a low allergen sampling (or low
allergen dose) and with increased maturation of mDC1.
Our study suggests that parenchymal, and not tracheal, DC are involved in
lung immunity or at least in tolerance induction. This observation is in contradiction
with the data of von Garnier et al (11), who showed an increased phagocytic
capacity of tracheal mDC compared to parenchymal mDC. This discrepancy could
be due to difference in species immune response or because they only
investigated the baseline response, whereas we induced an immune response via
sensitization and multiple allergen exposures. Thus, multiple challenges of
sensitized rats seem to activate parenchymal instead of tracheal mDC.
51
Overall, these findings shed some light on the activation of the different DC
subsets in the induction of tolerance and asthma. Indeed, we showed that
increased allergen sampling by parenchymal mDC2 and their migration to the dLN
is associated with tolerance induction, whereas asthma response is linked with a
low allergen sampling in conjunction with an increase of mDC1 maturation. Current
studies in our laboratory are performed to investigate whether mDC1 and mDC2
functions can be specifically altered in order to blunt the asthmatic reaction or to
favour a tolerogenic response.
3.8. Acknowledgements
This work was supported by the Canadian Institutes of Health Research
(MOP-84346), the National Health and Medical Research Council of Australia and
the Fondation JD Bégin. JFLJ was supported by Fonds de Recherche du Québec
– Santé (FRQS) and the Réseau en santé respiratoire du FRQS. DM is a FRQS
Junior 1 salary awardee. We thank Jenny Thomas (TICHR, Perth AU) for technical
help.
52
3.9. References
1. Platts-Mills TA, Woodfolk JA. Allergens and their role in the allergic immune response. Immunological reviews 2011;242(1):51-68. 2. Guilliams M, Lambrecht BN, Hammad H. Division of labor between lung dendritic cells and macrophages in the defense against pulmonary infections. Mucosal immunology 2013;6(3):464-473. 3. Desch AN, Henson PM, Jakubzick CV. Pulmonary dendritic cell development and antigen acquisition. Immunol Res 2013;55(1-3):178-186. 4. Reis e Sousa C. Dendritic cells in a mature age. Nat Rev Immunol 2006;6(6):476-483. 5. Fear VS, Burchell JT, Lai SP, Wikstrom ME, Blank F, von Garnier C, Turner DJ, Sly PD, Holt PG, Strickland DS, et al. Restricted aeroallergen access to airway mucosal dendritic cells in vivo limits allergen-specific CD4+ T cell proliferation during the induction of inhalation tolerance. J Immunol 2011;187(9):4561-4570. 6. Jakubzick C, Helft J, Kaplan TJ, Randolph GJ. Optimization of methods to study pulmonary dendritic cell migration reveals distinct capacities of DC subsets to acquire soluble versus particulate antigen. Journal of immunological methods 2008;337(2):121-131. 7. de Heer HJ, Hammad H, Soullie T, Hijdra D, Vos N, Willart MA, Hoogsteden HC, Lambrecht BN. Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. The Journal of experimental medicine 2004;200(1):89-98. 8. Hubo M, Jonuleit H. Plasmacytoid dendritic cells are inefficient in activation of human regulatory T cells. PloS one 2012;7(8):e44056. 9. Li X, Yang A, Huang H, Zhang X, Town J, Davis B, Cockcroft DW, Gordon JR. Induction of type 2 T helper cell allergen tolerance by IL-10-differentiated regulatory dendritic cells. American journal of respiratory cell and molecular biology 2010;42(2):190-199. 10. Charbonnier AS, Hammad H, Gosset P, Stewart GA, Alkan S, Tonnel AB, Pestel J. Der p 1-pulsed myeloid and plasmacytoid dendritic cells from house dust mite-sensitized allergic patients dysregulate the T cell response. Journal of leukocyte biology 2003;73(1):91-99. 11. von Garnier C, Filgueira L, Wikstrom M, Smith M, Thomas JA, Strickland DH, Holt PG, Stumbles PA. Anatomical location determines the distribution and function of dendritic cells and other APCs in the respiratory tract. J Immunol 2005;175(3):1609-1618. 12. Strickland DH, Thomas JA, Mok D, Blank F, McKenna KL, Larcombe AN, Sly PD, Holt PG. Defective aeroallergen surveillance by airway mucosal dendritic cells as a determinant of risk for persistent airways hyper-responsiveness in experimental asthma. Mucosal immunology 2012;5(3):332-341. 13. Strickland DH, Stumbles PA, Zosky GR, Subrata LS, Thomas JA, Turner DJ, Sly PD, Holt PG. Reversal of airway hyperresponsiveness by induction of
53
airway mucosal CD4+CD25+ regulatory T cells. The Journal of experimental medicine 2006;203(12):2649-2660. 14. Careau E, Sirois J, Bissonnette EY. Characterization of lung hyperresponsiveness, inflammation, and alveolar macrophage mediator production in allergy resistant and susceptible rats. American journal of respiratory cell and molecular biology 2002;26(5):579-586. 15. Burchell JT, Wikstrom ME, Stumbles PA, Sly PD, Turner DJ. Attenuation of allergen-induced airway hyperresponsiveness is mediated by airway regulatory T cells. American journal of physiology Lung cellular and molecular physiology 2009;296(3):L307-319. 16. Swirski FK, D'Sa A, Kianpour S, Inman MD, Stampfli MR. Prolonged ovalbumin exposure attenuates airway hyperresponsiveness and T cell function in mice. Int Arch Allergy Immunol 2006;141(2):130-140. 17. del Rio ML, Bernhardt G, Rodriguez-Barbosa JI, Forster R. Development and functional specialization of CD103+ dendritic cells. Immunological reviews 2010;234(1):268-281. 18. Khare A, Krishnamoorthy N, Oriss TB, Fei M, Ray P, Ray A. Cutting Edge: Inhaled Antigen Upregulates Retinaldehyde Dehydrogenase in Lung CD103+ but Not Plasmacytoid Dendritic Cells To Induce Foxp3 De Novo in CD4+ T Cells and Promote Airway Tolerance. J Immunol 2013;191(1):25-29. 19. Boonstra A, Asselin-Paturel C, Gilliet M, Crain C, Trinchieri G, Liu YJ, O'Garra A. Flexibility of mouse classical and plasmacytoid-derived dendritic cells in directing T helper type 1 and 2 cell development: dependency on antigen dose and differential toll-like receptor ligation. The Journal of experimental medicine 2003;197(1):101-109. 20. Hosken NA, Shibuya K, Heath AW, Murphy KM, O'Garra A. The effect of antigen dose on CD4+ T helper cell phenotype development in a T cell receptor-alpha beta-transgenic model. The Journal of experimental medicine 1995;182(5):1579-1584. 21. von Garnier C, Wikstrom ME, Zosky G, Turner DJ, Sly PD, Smith M, Thomas JA, Judd SR, Strickland DH, Holt PG, et al. Allergic airways disease develops after an increase in allergen capture and processing in the airway mucosa. J Immunol 2007;179(9):5748-5759. 22. Plantinga M, Guilliams M, Vanheerswynghels M, Deswarte K, Branco-Madeira F, Toussaint W, Vanhoutte L, Neyt K, Killeen N, Malissen B, et al. Conventional and Monocyte-Derived CD11b(+) Dendritic Cells Initiate and Maintain T Helper 2 Cell-Mediated Immunity to House Dust Mite Allergen. Immunity 2013;38(2):322-335.
54
3.10. Figure legends
Figure 3.1: The proportion of lung parenchyma mDC1 and mDC2 is different
between naïve PVG and BN.
Single cell suspensions of lung parenchyma and tracheal mucosa were prepared
from naïve PVG and BN rats. DC were identified by flow cytometry using MHC II,
CD11b and CD4 expression in whole cell suspensions. A) Gating strategy used to
identify mDC1, mDC2, and pDC. The proportion of DC subsets in the lung
parenchyma and in the tracheal mucosa of PVG and BN rats is depicted in,
respectively, B) and C). Lung parenchymal mDC1 were overrepresented in PVG
compared with BN, whereas mDC2 were overrepresented in BN compared with
PVG. Frequencies of DC subsets in the trachea were similar between the two
strains of rats. pDC represented a minor fraction in the tissues tested. *: indicates
significant differences (p < 0.05). Mean SEM; n = 3-4 per group.
Figure 3.2: Parenchymal mDC proportion is increased in both tolerogenic and
asthmatic response.
Single cell suspensions of lung parenchyma and tracheal mucosa were prepared
from PVG and BN rats 2 h after OVA challenge. DC were identified by flow
cytometry using MHC II, CD11b and CD4 expression in whole cell suspensions.
mDC1, mDC2, and pDC proportion of the lung parenchyma are shown in (A;B;C),
whereas tracheal mDC1, mDC2, and pDC are shown in (D;E;F). mDC1 and mDC2
were increased in lung parenchyma of tolerogenic and asthmatic rats compared
with their respective naïve group. No modulation of DC proportion was observed in
the trachea mucosa. *: indicates significant differences (p < 0.05). Mean SEM; n
= 3-4 per group.
55
Figure 3.3: The proportion of OVA+ mDC2 is increased in tolerogenic rats.
Single cell suspensions of lung parenchyma and tracheal mucosa were prepared
from PVG and BN rats 2 h after challenge with OVA-AlexaFluor647. Allergen
capture was assessed by measuring the frequency of AlexaFluor647+ cells on DC
subsets, using flow cytometry. mDC1, mDC2, and pDC allergen capture in the lung
parenchymal is shown in (A;B;C) and in the tracheal mucosa in (D;E;F). Compared
with naïve PVG, the allergen uptake by lung mDC2 is significantly increased in
tolerogenic rats, whereas the others subsets OVA+ frequencies were not altered.
In BN, the allergen sampling of DC was not altered in any subset after multiple
challenges. *: indicates significant differences (p < 0.05). Mean SEM; n = 3-4 per
group.
Figure 3.4: OVA+ DC migration to the dLN is enhanced is tolerogenic rats.
Single cell suspensions of dLN were prepared from PVG and BN rats 2 h after
challenge with OVA-AlexaFluor647. Allergen capture was assessed by measuring
the frequency of AlexaFluor647+ cells on DC subsets, using flow cytometry. The
migration of OVA+ mDC1, mDC2, and pDC to the dLN is shown in (A;B;C).
Compared with naïve PVG, the migration of all the OVA+ DC subsets were
significantly increased after multiple allergen challenge. In asthmatic BN, the
migration of OVA+ DC was not altered in any subset compared with naïve rats. *:
indicates significant differences (p < 0.05). Mean SEM; n = 3-4 per group.
Figure 3.5: mDC1 maturation was increased in the dLN of asthmatic animals.
Single cell suspensions of dLN were prepared from PVG and BN rats 2 h after
OVA challenge. The maturation of the DC subsets was assessed by MHC II
expression, using flow cytometry. The MHC II expression on mDC1, mDC2, and
pDC in the dLN is shown in (A;B;C). In PVG rats, the expression of MCH II by the
56
DC subsets was unchanged between the naïve and the multiple challenged
groups. MHC II expression on dLN mDC1 was significantly increased in asthmatic
Dysregulation of alveolar macrophages unleashes dendritic cell-mediated
mechanisms of allergic airway inflammation
Jean-Francois Lauzon-Joset, MSc; David Marsolais, PhD; Anick Langlois, PhD;
Elyse Y Bissonnette, PhD.
Centre de recherche de l’Institut universitaire de cardiologie et de pneumologie de Québec (CRIUCPQ), Université Laval, Québec, QC, Canada. Running head: Alveolar macrophages control dendritic cells
Chemical) and rats were challenged 21 days later by intranasal instillation of 75 μg
of OVA-Alexa647 (Invitrogen, Grand Island, NY) in 100 μl of saline. All groups were
challenged with OVA and tissues were harvested 2 h after exposure.
AM elimination and grafting.
AM depletion was achieved by Clodronate liposome (Clodrosome;
Encapsula, Nashville, TN) administration as previously described6. Briefly, 17 days
after sensitization, 100 ml of 5 mg/ml Clodrosome was instilled in each lobe (right
and left). At the maximal depletion time, 3 days later (day 20), these animals
received AM intratracheally, which were obtained from sensitized (Asthma+sAM) or
naïve (Asthma+nAM) rats. Also, in some experiments, AM depleted rats received
sAM kept ex vivo in serum free complete RPMI medium (Gibco BRL, Burlington,
Canada) in non adherent tubes for 24 h (Asthma+cAM)15.
Cell isolation and preparation.
78
To identify cell types and to measure AM allergen capture, BAL were
performed as previously described6, with 50 mL of PBS-EDTA. Cell types were
identified using cytospins stained with Diff-Quik (Gibco BRL). Lung tissue and
draining lymph nodes (dLN) were prepared as previously reported26. Briefly,
tissues were digested with Collagenase IV and DNase I (Worthington Biochemical
Corp, Lakewood, NJ) to obtain single cell suspension. Identification of cell
populations was performed using monoclonal antibodies (Biolegend, San Diego,
CA; BD Pharmingen, San Diego, CA; R&D, Minneapolis, MN) directed against cell
surface antigens and intracellular markers. mDC are CD11b+/MHC IIhigh, pDC are
CD11b–/MHC II+/CD4+ and AM are CD172α+(ED9)/autofluorescencehigh. T cell
populations were identified using CD4, CD3, IL-4, FoxP3, STAT6, and CD25
expression. Allergen capture was measured by AlexaFluor647 fluorescence and
AM activation was assessed with MHC II and CD23 expression. Data were
acquired on a BD FACS Aria II (Becton Dickinson, Franklin Lakes, NJ) and
analyzed using Flowjo software (Tree star inc, Ashland, OR).
Lung digestion and ELISA.
To measure cytokine level in lung tissue, approximately 10 mg of lung tissue
was placed in ice-cold PBS supplemented with protease and phosphastase
inhibitor cocktail (Roche, Mannheim, Germany) and homogenized with a Polytron
homogenizer. ELISA were performed with DuoSet kit (R&D Systems) to measure
GM-CSF level and results are expressed per gram of tissue.
Statistics.
GraphPad Prism (La Jolla, CA) was used for all statistical analysis, which
includes one-way and two-way ANOVA with Bonneferonni post hoc test. Data are
presented as mean ± SEM and p values < 0.05 were considered significant.
79
4.8. Disclosure
The authors declare no conflict of interest.
4.9. Acknowledgements
This work was supported by Canadian Institutes of Health Research (MOP-
84346) and Fondation JD Bégin. JFLJ was supported by Fonds de Recherche du
Québec - Santé. We thank Emilie Bernatchez and Marc Veillette for technical help.
We also thank Dr Ynuk Bossé and Dr Yvon Cormier for critical review of the
manuscript.
80
4.10. References
1. Elias JA, Lee CG, Zheng T, Ma B, Homer RJ, Zhu Z. New insights into the pathogenesis of asthma. The Journal of clinical investigation 2003; 111(3): 291-297. 2. Holgate ST. Pathogenesis of asthma. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2008; 38(6): 872-897. 3. Peters-Golden M. The alveolar macrophage: the forgotten cell in asthma. American journal of respiratory cell and molecular biology 2004; 31(1): 3-7. 4. Lambrecht BN. Alveolar macrophage in the driver's seat. Immunity 2006; 24(4): 366-368. 5. Careau E, Proulx LI, Pouliot P, Spahr A, Turmel V, Bissonnette EY. Antigen sensitization modulates alveolar macrophage functions in an asthma model. American journal of physiology Lung cellular and molecular physiology 2006; 290(5): L871-879. 6. Careau E, Turmel V, Lauzon-Joset JF, Bissonnette EY. Alveolar macrophages reduce airway hyperresponsiveness and modulate cytokine levels. Experimental lung research 2010; 36(5): 255-261. 7. Careau E, Bissonnette EY. Adoptive transfer of alveolar macrophages abrogates bronchial hyperresponsiveness. American journal of respiratory cell and molecular biology 2004; 31(1): 22-27. 8. Thepen T, McMenamin C, Oliver J, Kraal G, Holt PG. Regulation of immune response to inhaled antigen by alveolar macrophages: differential effects of in vivo alveolar macrophage elimination on the induction of tolerance vs. immunity. European journal of immunology 1991; 21(11): 2845-2850. 9. Bang BR, Chun E, Shim EJ, Lee HS, Lee SY, Cho SH et al. Alveolar macrophages modulate allergic inflammation in a murine model of asthma. Experimental & molecular medicine 2011; 43(5): 275-280. 10. Tang C, Inman MD, van Rooijen N, Yang P, Shen H, Matsumoto K et al. Th type 1-stimulating activity of lung macrophages inhibits Th2-mediated allergic airway inflammation by an IFN-gamma-dependent mechanism. J Immunol 2001; 166(3): 1471-1481. 11. Naessens T, Vander Beken S, Bogaert P, Van Rooijen N, Lienenklaus S, Weiss S et al. Innate imprinting of murine resident alveolar macrophages by allergic bronchial inflammation causes a switch from hypoinflammatory to hyperinflammatory reactivity. The American journal of pathology 2012; 181(1): 174-184. 12. Thepen T, Van Rooijen N, Kraal G. Alveolar macrophage elimination in vivo is associated with an increase in pulmonary immune response in mice. The Journal of experimental medicine 1989; 170(2): 499-509. 13. Thepen T, Kraal G, Holt PG. The role of alveolar macrophages in regulation of lung inflammation. Annals of the New York Academy of Sciences 1994; 725: 200-206.
81
14. Byers DE, Holtzman MJ. Alternatively activated macrophages and airway disease. Chest 2011; 140(3): 768-774. 15. Pouliot P, Spahr A, Careau E, Turmel V, Bissonnette EY. Alveolar macrophages from allergic lungs are not committed to a pro-allergic response and can reduce airway hyperresponsiveness following ex vivo culture. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2008; 38(3): 529-538. 16. Fear VS, Burchell JT, Lai SP, Wikstrom ME, Blank F, von Garnier C et al. Restricted aeroallergen access to airway mucosal dendritic cells in vivo limits allergen-specific CD4+ T cell proliferation during the induction of inhalation tolerance. J Immunol 2011; 187(9): 4561-4570. 17. Bratke K, Lommatzsch M, Julius P, Kuepper M, Kleine HD, Luttmann W et al. Dendritic cell subsets in human bronchoalveolar lavage fluid after segmental allergen challenge. Thorax 2007; 62(2): 168-175. 18. Jahnsen FL, Moloney ED, Hogan T, Upham JW, Burke CM, Holt PG. Rapid dendritic cell recruitment to the bronchial mucosa of patients with atopic asthma in response to local allergen challenge. Thorax 2001; 56(11): 823-826. 19. Holt PG. Dendritic cells as sentinel cells in asthma. Clinical & Experimental Allergy Reviews 2001; 1(2): 77-79. 20. van Rijt LS, Jung S, Kleinjan A, Vos N, Willart M, Duez C et al. In vivo depletion of lung CD11c+ dendritic cells during allergen challenge abrogates the characteristic features of asthma. The Journal of experimental medicine 2005; 201(6): 981-991. 21. Soumelis V, Reche PA, Kanzler H, Yuan W, Edward G, Homey B et al. Human epithelial cells trigger dendritic cell mediated allergic inflammation by producing TSLP. Nature immunology 2002; 3(7): 673-680. 22. Holt PG, Oliver J, Bilyk N, McMenamin C, McMenamin PG, Kraal G et al. Downregulation of the antigen presenting cell function(s) of pulmonary dendritic cells in vivo by resident alveolar macrophages. The Journal of experimental medicine 1993; 177(2): 397-407. 23. Kim JY, Sohn JH, Choi JM, Lee JH, Hong CS, Lee JS et al. Alveolar Macrophages Play a Key Role in Cockroach-Induced Allergic Inflammation via TNF-alpha Pathway. PloS one 2012; 7(10): e47971. 24. Moreira AP, Hogaboam CM. Macrophages in allergic asthma: fine-tuning their pro- and anti-inflammatory actions for disease resolution. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research 2011; 31(6): 485-491. 25. Jakubzick C, Tacke F, Llodra J, van Rooijen N, Randolph GJ. Modulation of dendritic cell trafficking to and from the airways. J Immunol 2006; 176(6): 3578-3584. 26. Strickland DH, Thomas JA, Mok D, Blank F, McKenna KL, Larcombe AN et al. Defective aeroallergen surveillance by airway mucosal dendritic cells as a determinant of risk for persistent airways hyper-responsiveness in experimental asthma. Mucosal immunology 2012; 5(3): 332-341. 27. Careau E, Sirois J, Bissonnette EY. Characterization of lung hyperresponsiveness, inflammation, and alveolar macrophage mediator production
82
in allergy resistant and susceptible rats. American journal of respiratory cell and molecular biology 2002; 26(5): 579-586. 28. Tschernig T, Neumann D, Pich A, Dorsch M, Pabst R. Experimental bronchial asthma - the strength of the species rat. Current drug targets 2008; 9(6): 466-469. 29. Martin JG, Tamaoka M. Rat models of asthma and chronic obstructive lung disease. Pulmonary pharmacology & therapeutics 2006; 19(6): 377-385. 30. Sung SS, Bolton WK. Editorial: Are men rats? Dendritic cells in autoimmune glomerulonephritis. Journal of leukocyte biology 2010; 88(5): 831-835. 31. Out TA, Wang SZ, Rudolph K, Bice DE. Local T-cell activation after segmental allergen challenge in the lungs of allergic dogs. Immunology 2002; 105(4): 499-508. 32. Berg JT, Lee ST, Thepen T, Lee CY, Tsan MF. Depletion of alveolar macrophages by liposome-encapsulated dichloromethylene diphosphonate. J Appl Physiol 1993; 74(6): 2812-2819. 33. Strickland DH, Thepen T, Kees UR, Kraal G, Holt PG. Regulation of T-cell function in lung tissue by pulmonary alveolar macrophages. Immunology 1993; 80(2): 266-272. 34. Bilyk N, Holt PG. Inhibition of the immunosuppressive activity of resident pulmonary alveolar macrophages by granulocyte/macrophage colony-stimulating factor. The Journal of experimental medicine 1993; 177(6): 1773-1777. 35. Stampfli MR, Wiley RE, Neigh GS, Gajewska BU, Lei XF, Snider DP et al. GM-CSF transgene expression in the airway allows aerosolized ovalbumin to induce allergic sensitization in mice. The Journal of clinical investigation 1998; 102(9): 1704-1714. 36. Snelgrove RJ, Goulding J, Didierlaurent AM, Lyonga D, Vekaria S, Edwards L et al. A critical function for CD200 in lung immune homeostasis and the severity of influenza infection. Nature immunology 2008; 9(9): 1074-1083. 37. Bedoret D, Wallemacq H, Marichal T, Desmet C, Quesada Calvo F, Henry E et al. Lung interstitial macrophages alter dendritic cell functions to prevent airway allergy in mice. The Journal of clinical investigation 2009; 119(12): 3723-3738. 38. Woolley KL, Adelroth E, Woolley MJ, Ellis R, Jordana M, O'Byrne PM. Granulocyte-macrophage colony-stimulating factor, eosinophils and eosinophil cationic protein in subjects with and without mild, stable, atopic asthma. The European respiratory journal : official journal of the European Society for Clinical Respiratory Physiology 1994; 7(9): 1576-1584. 39. Lewkowich IP, Lajoie S, Clark JR, Herman NS, Sproles AA, Wills-Karp M. Allergen uptake, activation, and IL-23 production by pulmonary myeloid DCs drives airway hyperresponsiveness in asthma-susceptible mice. PloS one 2008; 3(12): e3879. 40. de Heer HJ, Hammad H, Soullie T, Hijdra D, Vos N, Willart MA et al. Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. The Journal of experimental medicine 2004; 200(1): 89-98. 41. Plantinga M, Guilliams M, Vanheerswynghels M, Deswarte K, Branco-Madeira F, Toussaint W et al. Conventional and Monocyte-Derived CD11b(+)
83
Dendritic Cells Initiate and Maintain T Helper 2 Cell-Mediated Immunity to House Dust Mite Allergen. Immunity 2013; 38(2): 322-335. 42. Huh JC, Strickland DH, Jahnsen FL, Turner DJ, Thomas JA, Napoli S et al. Bidirectional interactions between antigen-bearing respiratory tract dendritic cells (DCs) and T cells precede the late phase reaction in experimental asthma: DC activation occurs in the airway mucosa but not in the lung parenchyma. The Journal of experimental medicine 2003; 198(1): 19-30. 43. Knight SC, Iqball S, Roberts MS, Macatonia S, Bedford PA. Transfer of antigen between dendritic cells in the stimulation of primary T cell proliferation. European journal of immunology 1998; 28(5): 1636-1644. 44. Bradley BL, Azzawi M, Jacobson M, Assoufi B, Collins JV, Irani AM et al. Eosinophils, T-lymphocytes, mast cells, neutrophils, and macrophages in bronchial biopsy specimens from atopic subjects with asthma: comparison with biopsy specimens from atopic subjects without asthma and normal control subjects and relationship to bronchial hyperresponsiveness. The Journal of allergy and clinical immunology 1991; 88(4): 661-674. 45. Wardlaw AJ, Dunnette S, Gleich GJ, Collins JV, Kay AB. Eosinophils and mast cells in bronchoalveolar lavage in subjects with mild asthma. Relationship to bronchial hyperreactivity. The American review of respiratory disease 1988; 137(1): 62-69. 46. Birrell MA, Battram CH, Woodman P, McCluskie K, Belvisi MG. Dissociation by steroids of eosinophilic inflammation from airway hyperresponsiveness in murine airways. Respiratory research 2003; 4: 3. 47. Venkayya R, Lam M, Willkom M, Grunig G, Corry DB, Erle DJ. The Th2 lymphocyte products IL-4 and IL-13 rapidly induce airway hyperresponsiveness through direct effects on resident airway cells. American journal of respiratory cell and molecular biology 2002; 26(2): 202-208. 48. Korf JE, Pynaert G, Tournoy K, Boonefaes T, Van Oosterhout A, Ginneberge D et al. Macrophage reprogramming by mycolic acid promotes a tolerogenic response in experimental asthma. American journal of respiratory and critical care medicine 2006; 174(2): 152-160. 49. Johnston LK, Rims CR, Gill SE, McGuire JK, Manicone AM. Pulmonary macrophage subpopulations in the induction and resolution of acute lung injury. American journal of respiratory cell and molecular biology 2012; 47(4): 417-426.
84
4.11. Figure legends
Figure 4.1) Sensitization status of AM does not modulate early eosinophil
recruitment in the airways
Asthmatic rats were sensitized i.p. with OVA/Alum. AM were depleted and replaced
with AM from sensitized rats (Asthma+sAM) or naïve rats (Asthma+nAM). BAL
were performed 2 h after OVA challenge. Total cell counts (a) and cellularity (b)
were measured after Trypan blue and DiffQuick stainings, respectively. Total cell
numbers were similar in all groups and eosinophilia was present in asthmatic,
Asthma+sAM and Asthma+nAM groups. *: indicate significant differences (p <
0.05) compared with the naïve group. Mean SEM; n = 4-7 per group.
Figure 4.2) DC recruitment in asthma is enhanced, but not modulated by AM
Single cell suspensions were prepared from lungs 2 h after OVA challenge. DC
were identified by flow cytometry using MHC II and CD11b expression in either
whole cell suspensions for the mDC; or after gating on CD4+ cells for the pDC.
mDC and pDC fractions are shown in (a; c) and number per g of lung in (b; d).
mDC numbers were increased in asthmatic, Asthma+sAM, and Asthma+nAM
groups compared with the naïve, whereas pDC population was not affected in any
condition. *: indicate significant differences (p < 0.05) compared with the naïve
group. Mean SEM; n = 4-7 per group.
Figure 4.3) DC allergen capture is decreased by AM from naïve rats
Single cell suspensions were prepared from lungs 2 h after instillation of OVA-
AlexaFluor647 challenge. Allergen capture was assessed by measuring the
frequency of AlexaFluor647+ cells on DC subsets, using flow cytometry. mDC and
85
pDC OVA+ frequency are shown in (a; c) and number per g of lung in (b; d).
Compared with naïve rats, allergen uptake was increased in asthmatic and
Asthma+sAM groups, but not in Asthma+nAM group. Allergen uptake was also
significantly lower in Asthma+nAM group compared with the Asthma+sAM group.
pDC allergen uptake was low in all groups tested. *: p < 0.05. Mean SEM; n = 4-7
per group.
Figure 4.4) DC accumulation in draining lymph nodes is not modulated
Single cell suspensions were prepared from dLN 2 h after OVA challenge. mDC
and pDC were identified by flow cytometry using MHC II and CD11b expression.
Proportion of mDC and pDC in dLN was similar and their numbers were not
modulated in any group. *: p < 0.05. Mean SEM; n = 4-7 per group.
Figure 4.5) OVA+ mDC accumulation in draining lymph nodes is inhibited by AM
from naïve rats
Single cell suspensions were prepared from dLN 2 h after instillation of OVA-
AlexaFluor647. Allergen capture was assessed by measuring the frequency of
AlexaFluor647+ cells on mDC subsets, using flow cytometry. The OVA+ mDC/dLN
frequency is shown in (a) and number in (b). Allergen uptake was increased in the
asthmatic group compared with naïve rats. Allergen uptake was similar between
asthmatic and Asthma+sAM groups, but was strongly reduced in the Asthma+nAM
group. *: p < 0.05. Mean SEM; n = 4-7 per group.
Figure 4.6) Th2 polarized cell accumulation is enhanced locally after allergen
challenge and modulated by AM transfer
Single cell suspensions were prepared from lungs 2 h after OVA challenge. Th2
cells were identified by flow cytometry using CD4, CD3, STAT6, and IL-4
86
expression. Th2 cell frequency (a) and number per g of lung (b) were higher in
asthmatic and Asthma+sAM groups compared with naïve and Asthma+nAM
groups, respectively. *: p < 0.05. Mean SEM; n = 4-7 per group.
Figure 4.7) AM allergen capture is enhanced in asthma, but is not modulated by
adoptive transfer
BAL were performed 2 h after instillation of OVA-AlexaFluor647. Allergen capture
was assessed by measuring the frequency of AlexaFluor647+ cells in
autofluoresent+/CD172+ AM, using flow cytometry. AM OVA+ frequency is shown
in (a) and number in (b). Allergen capture was higher in asthmatic and
Asthma+sAM groups compared with naïve and Asthma+nAM groups. *: p < 0.05.
Mean SEM; n = 4-7 per group.
Figure 4.8) MHC II and CD23 expression are not modulated on AM early on
asthma development
BAL were performed 2 h after instillation of OVA. MHC II and CD23 expression
was measured on autofluoresent+/CD172+ AM, using flow cytometry. AM
expression of MHC II (a) and CD23 (b) is depicted as the ratio of mean
fluorescence intensity (MFI) over naïve rats. No modulation was observed. *: p <
0.05. Mean SEM; n = 3-5 per group.
Figure 4.9) AM withdrawal from the asthmatic environment restores their
protective functions
Asthmatic rats were sensitized i.p. with OVA/Alum and AM were replaced with ex
vivo cultured sAM (Asthma+cAM). The effect of sAM on allergen capture by mDC
(a) and AM (b), as well as on Th2 response (c) were measured 2 h after instillation
of OVA-AlexaFluor647. (a) Frequency (left panel) and number (right panel) of
87
OVA+ mDC/g of lung was lower in Asthma+cAM group compared with asthmatic
rats. (b) OVA+ AM in BAL were less frequent in Asthma+cAM than in asthmatic
rats. (c) cAM transfer reduced considerably the number of Th2 cells in the lung
compared with asthmatic animals. *: p < 0.05. Mean SEM; n = 3-5 per group.
88
4.12. Figures
Figure 4.1 : Sensitization status of AM does not modulate early eosinophil
recruitment in the airways
89
Figure 4.2 : DC recruitment in asthma is enhanced, but not modulated by AM
90
Figure 4.3 : DC allergen capture is decreased by AM from naïve rats
91
Figure 4.4 : DC accumulation in draining lymph nodes is not modulated
92
Figure 4.5 : OVA+ mDC accumulation in draining lymph nodes is inhibited by AM
from naïve rats
93
Figure 4.6 : Th2 polarized cell accumulation is enhanced locally after allergen
challenge and modulated by AM transfer
94
Figure 4.7 : AM allergen capture is enhanced in asthma, but is not modulated by
adoptive transfer
95
Figure 4.8 : MHC II and CD23 expression are not modulated on AM early on
asthma development
96
Figure 4.9 : AM withdrawal from the asthmatic environment restores their
protective functions
97
4.
CHAPITRE 5 : Restoration of lung CD200
activity abrogates airway
hyperresponsiveness in experimental asthma
Article soumis au
American Journal of Respiratory Cell and Molecular Biology
98
5.1. Page titre
Restoration of lung CD200 activity abrogates airway hyperresponsiveness in
experimental asthma
Jean-Francois Lauzon-Joset; Anick Langlois; David Marsolais; Elyse Y
Bissonnette.
Centre de recherche de l’Institut universitaire de cardiologie et de pneumologie de
Allergic asthma is an inflammatory disease characterized by excessive
immune activation toward normally innocuous antigens. Although many cell types
are involved in asthma pathogenesis, the activation of dendritic cell (DC), mainly
myeloid DC (mDC), is sufficient to induce the asthmatic cascade (1, 2). Indeed,
mDC sample allergens from the airways and induce T cells to develop an antigen-
specific Th2 response. Th2 cells then produce chemokines and cytokines that
attract and activate eosinophils, B cells, and mast cells. Furthermore, Th2 cells are
central for the development of airway remodeling and hyperresponsiveness (AHR)
(3). This inflammatory cascade is enabled by the dysregulation of homeostatic
pathways that limit airway inflammation (4, 5). Indeed, lungs must withstand a
perpetual stimulation by exogenous particles by expressing high level of anti-
inflammatory molecules (6). Thus, identification of mechanisms determining
immunological homeostasis of the lung might contribute to a better understanding
of asthma pathogenesis.
Recent studies support that the interaction between CD200 and its receptor
(CD200R) plays an important role in the regulation of immune responses (7).
CD200 is a highly conserved membrane molecule present on many cells, including
epithelial cells, lymphocytes, and some myeloid cells. CD200 is deprived of
intracellular signaling domain, but it induces anti-inflammatory cascades by
activating CD200R. Previous reports showed that high CD200 expression induces
immune ignorance that enables cancer progression and viral persistence (8).
Conversely, low level of CD200 is associated with autoimmune disease
progression, such as arthritis and neurodegenerative disorders (8). Interestingly,
peripheral blood cells of asthmatic patients have reduced expression of CD200 (9),
suggesting a dysregulation of this molecule in asthma. However, no information is
available on pulmonary expression of CD200 in asthma.
102
Alveolar macrophages (AM) are important players in lung immunity (10).
These immune cells, residing in airways and alveoli, express higher basal level of
anti-inflammatory molecules than do their counterparts in other organs (11). They
are among the first immune cell types to encounter particles entering the lumen of
airways and produce a plethora of mediators to initiate or resolve immune
responses (12). By default, the role of AM is to maintain homeostasis and induce
tolerance (13), as supported by numerous studies showing that AM depletion
induces or enhances pulmonary inflammatory responses (14-16). In asthmatic
subjects, AM functions are altered and skewed toward an inflammatory response
(17). Thus, AM have pro-inflammatory functions in asthma (14, 18, 19), and these
dysregulations could be sufficient to induce an asthma-like phenotype. However
the exact nature of AM alterations in asthma remains misunderstood.
Given the potent anti-inflammatory effects of CD200, its documented roles in
several inflammatory diseases, and the inflammatory nature of asthma, our general
hypothesis is that pulmonary CD200 dysregulation contributes to the pathogenesis
of asthma. Using a model of allergic asthma in Brown Norway rats, we show for the
first time that in response to allergens, AM from asthmatic animals (aAM) fail to
upregulate CD200. Furthermore, local delivery of recombinant CD200 (rCD200)
completely abrogates AHR, which is associated with alleviation of mDC and Th2
cell recruitment into the lungs, but not with reduction of eosinophil numbers in
bronchoalveolar lavage (BAL) fluids. Thus, our study reveals a local role for CD200
in Th2 cell accumulation and AHR in experimental asthma.
103
5.5. Materials and Methods
Animals and allergen exposure
Brown Norway SSN rats were bred and maintained in the animal facility of
the IUCPQ. The protocol was approved by Laval University Animal Care
Committee in accordance with the guidelines of the Canadian Council on Animal
Care. Eight- to 12-weeks-old males were used. Ovalbumin (OVA) grade V (Sigma
Chemical, St. Louis, MO) sensitization was performed by i.p. injection of 1 mg
OVA/10 mg aluminum hydroxide (Sigma Chemical). On day 20 after sensitization,
groups of animals received intratracheal (i.t.) administration of either 100 mol of
recombinant mouse CD200 Fc Chimera (rCD200; R&D, Minneapolis, MN) or
recombinant human IgG1 Fc (Sham; R&D). On day 21, all groups were challenged
by intranasal instillation of 75 μg of OVA-AlexaFluor647 (Invitrogen, Grand Island,
NY) in 100 μl of saline and tissues were harvested 24 h later.
CD200 expression
AM were obtained by BAL of normal Brown Norway rats and purified by
adherence on plastic for 2 h. RNA was extracted by Trizol according to
manufacturer’s protocol. Then, RT-PCR was performed using One-Step RT-PCR
from Invitrogen according to standard protocol with 50 ng of RNA and amplified
with CGCTGAGCACAGCTCAAGTGGA forward primer and
AGGAGATGGCAGGGGCT-GGG reverse primer.
Analysis of responsiveness to methacholine
Lung functions were measured as previously described (20). Briefly, rats
were anaesthetized with ketamine-xylazine, tracheotomized and connected to a
104
small animal ventilator (FX4; FlexiVent, SCIREQ, Inc., Montreal, QC, Canada).
Animals were then paralyzed with pancuronium bromide (0.05 mg/kg) and
ventilated with 10 ml/kg at a frequency of 90 breaths/min with a positive end
expiratory pressure (PEEP) of 3 cm H2O. Increasing doses of methacholine were
nebulized for 30 s and lung resistance (RL) was assessed using Sinusoidal single-
frequency oscillation waveform. After each dose, the maximal response was
compiled and compared between groups.
Cell isolation and preparation
BAL were performed as previously described (14). Cell types were identified
using cytospins stained with Diff-Quick (Gibco BRL, Burlington, ON, Canada). Lung
tissue and draining lymph nodes (dLN) were prepared as previously reported (21).
Briefly, tissues were digested with Collagenase IV and DNase I (Worthington
Biochemical Corp, Lakewood, NJ) to obtain single cell suspension. Identification of
cell populations was performed using monoclonal antibodies (Biolegend, San
Diego, CA; BD Pharmingen, San Diego, CA; R&D) directed against cell-surface
antigens and intracellular markers. mDC are CD11b+/MHC IIhigh, pDC are CD11b–
/MHC II+/CD4+ and AM are CD172α+(ED9)/autofluorescencehigh. T cell populations
were identified using CD4, CD3, IL-4, and STAT6 expression. Data were acquired
on a BD FACS Aria II (Becton Dickinson, Franklin Lakes, NJ) and analyzed using
Flowjo software (Tree star inc, Ashland, OR).
Statistics
Prism (GraphPad Software, La Jolla, CA) was used for all statistical
analyses, which includes one-way and two-way ANOVAs with Bonferroni post hoc
test. Data are presented as mean ± SEM and p values < 0.05 were considered
significant.
105
5.6. Results
CD200 is expressed by AM and is dysregulated in experimental asthma
The expression of CD200 is classically associated with structural cells and
lymphocytes, but few studies support that myeloid lineage cells express CD200
(22-24). We first investigated AM expression of CD200 using RT-PCR analysis.
AM isolated from naïve rats expressed CD200 mRNA (Figure 5.1A). Then, we
used a well-described model of experimental asthma (25, 26) to investigate
allergen-induced modulation of CD200 expression on AM in vivo. Before allergen
challenge, AM from naïve (nAM) and asthmatic (aAM) animals had comparable
protein expression of CD200 (Figure 5.1B-C). Surprisingly, CD200 expression on
nAM drastically increased by 258 ± 52% following allergen challenge, whereas
expression of CD200 remained stable on aAM (Figure 5.1B-C). These data
suggest that CD200 upregulation on nAM might be involved in the protection
against asthma development. Therefore, we evaluated whether local delivery of
CD200 could inhibit key features of asthma.
Local administration of CD200 reverses AHR, but not lung eosinophilia
AHR is an important criterion for asthma identification and a good indicator
of poor asthma control. Thus, we evaluated lung resistance in response to
methacholine (MCh) in naïve and asthmatic animals treated with either a soluble
CD200 recombinant Fc chimera (rCD200) or an isotype-matched recombinant Fc
(Sham), 24 h before allergen exposure. Asthmatic rats showed an increased
response to incremental doses of MCh, compared with naïve animals (Figure 5.2A;
50 mg/ml of MCh increased lung resistance by 15 ± 4 and 4 ± 1 fold, respectively),
whereas the level of MCh responsiveness after lung delivery of rCD200, but not of
the sham molecule, was identical to naïve rats (Figure 5.2A).
106
We next investigated whether rCD200 effect on lung resistance was
associated with a modulation of leukocyte recruitment. Total cell count in the BAL
was increased in the asthmatic group compared with naïve animals (Figure 5.2B),
mainly because of eosinophil recruitment (Figure 5.2C). However, no modulation
was observed between asthmatic animals treated or not with either sham or
rCD200, for both total cell count and eosinophil number (Figure 5.2B-C). Therefore,
rCD200 treatment inhibited AHR in asthmatic animals independently of eosinophil
accumulation.
DC and Th2 cell recruitment in the lung is inhibited by rCD200
Airway inflammation in asthma is characterized by an important
accumulation of DC and Th2 cells in the lung. Thus, we measured the modulation
of lung DC subsets and lymphocyte populations by rCD200 treatment. DC (MHC
IIhigh/autofluorescencelow) were divided into myeloid DC (mDC; CD11b+) and
plasmacytoid DC (pDC; CD11b-/CD4+). As previously reported (4, 18), mDC is the
major lung DC subset in both naïve and asthmatic rats (Figure 5.3). The number of
lung mDC significantly increased following allergen challenge in asthmatic animals,
whereas no variation of pDC number was observed (Figure 5.3B). After rCD200
treatment, mDC number returned to the level of the naïve group while sham
treatment did not alter mDC accumulation compared with asthmatic animals
(Figure 5.3B).
The analysis of lung T cell populations (Figure 5.4) showed that asthmatic
lungs had more than twice the number of CD3+/CD4+ lymphocytes (CD4+ T cells)
(Figure 5.4B), as well as IL4+/Stat6+ Th2 cells (Figure 5.4D), compared with naïve
animals. In rCD200–treated animals, CD4+ T cell and Th2 cell numbers were
reduced by 42 and 49%, respectively, compared to the sham group (Figure 5.4B-
D). Thus, rCD200 treatment inhibits allergen-induced mDC recruitment, as well as
Th2 cell accumulation to the lungs of asthmatic animals.
107
rCD200 does not alter allergen-induced Th2 accumulation in draining lymph
nodes of asthmatic animals
mDC migrate from the lungs to the draining lymph nodes (dLN) to induce the
expansion of antigen-specific T cells. Given that rCD200 treatment reduced lung
accumulation of inflammatory Th2 cells, we investigated whether rCD200 interfered
with the migration of allergen-loaded DC to the dLN. In asthmatic animals, there
was an increased number of OVA+ mDC compared with naïve rats, whereas OVA+
pDC number remained the same (Figure 5.5A-B). However, no modulation of
allergen-loaded DC in the dLN was observed after rCD200 treatment compared
with asthmatic and sham groups. Accordingly, there was no modulation of dLN
CD4+ T cells (Figure 5.5C-D) nor Th2 cells (Figure 5.5E-F) in sham or rCD200
treated animals compared with the asthmatic group. Therefore, rCD200 treatment
did not alter DC and T cells in the dLN. Thus, lung rCD200 delivery abrogated AHR
and this protective effect was associated with local control of the Th2 response.
5.7. Discussion
CD200-CD200R interaction is a central immune mechanism that controls
the activation of subsets of myeloid cells (27). Treatment with CD200 was shown to
reduce the development of experimental multiple sclerosis (28) and collagen-
induced arthritis (29). This pathway is also the object of a new clinical trial for
chronic leukemia (30). Although asthma is characterized by myeloid cell activation
and that CD200 acts on myeloid cells, no report addressed the local role of CD200
in the context of asthma. Strikingly, we show here that allergen challenge induced
a strong upregulation of CD200 in AM of naïve animals, but not in AM of asthmatic
rats. The impact of CD200 dysregulation in asthma was further confirmed by
replenishing CD200 into the lung of asthmatic rats. Indeed, the local administration
of rCD200 completely inhibited AHR and drastically reduced lung accumulation of
108
mDC and Th2 cells. Hence, CD200 plays a critical role in lung immunity and local
administration of CD200 is sufficient to inhibit AHR and lung T cell accumulation.
CD200 is an immunomodulatory molecule expressed by a variety of cells,
but few reports addressed its expression on myeloid cells (23, 24). In the airways,
AM are the predominant immune cells and uniformly express CD200R (11). Here,
we show that AM also express the CD200R ligand, CD200. Furthermore, CD200
mRNA expression was confirmed in AM of non-asthmatic subjects (data not
shown), suggesting that CD200 expression by AM is also involved in human lung
homeostasis. These data contradict the study of Jiang-Shieh et al (31) showing
that CD200 expression is present on epithelial cells, but absent on AM. However,
they based their identification of AM as “cells found in the airway lumen” of tissue
slices, a technique that hinders the identification of AM. On the other hand, we
specifically looked at AM retrieved by BAL (high yield) and identified them with
macrophage markers using flow cytometry (high specificity). Also, the intensity of
CD200 expression seems to vary among AM subsets (from low to high expression;
Figure 5.1B), which would limit the identification of CD200+ within the small number
of AM found on each tissue slice. Nevertheless, it is possible that AM and epithelial
cells express different magnitude of CD200, which could have “hidden” CD200+
AM in tissue slices. However, in our hands, we observed similar labeling between
ex vivo purified epithelial cells and AM from naïve rats (data not shown). Thus,
using strictly identified AM, we demonstrated that AM express CD200 mRNA and
that CD200 protein is present at their surface.
In the present paper, we showed a dysregulation of CD200 on AM in
experimental asthma, confirming the altered expression of CD200 by asthmatic
peripheral blood cells observed by Aoki et al (9). However, this is in contradiction
with a genetic study that did not find a modulation of AM CD200 expression in an
asthma cohort (32). This discrepancy could be explained by their comparison of
AM from asthmatic and non-asthmatic subjects without any allergen challenge; two
groups for which our study predicts comparable level of CD200. Indeed, we
109
showed that CD200 levels are similar on AM of naïve and asthmatic animals
before allergen challenge. Hence, our study is the first to specifically address the
effect of allergen challenge on AM from naïve and sensitized animals. Strikingly,
CD200 expression on AM was greatly upregulated following allergen challenge in
naïve animals, but not in asthmatic rats. Our results suggest that the homeostatic
response to allergens can be obliterated in asthmatic animals due to the lack of
CD200 regulation in AM, and this could be involved in the development of AHR.
Our data also demonstrated that treatment with rCD200 inhibits a key
feature of asthma; AHR. Indeed, AHR is a defining characteristic of asthma and
causes serious limitations to asthmatic patient’s quality of life (33). Interestingly,
rCD200 treatment abrogates AHR in asthmatic animals. AHR reduction by rCD200
is probably mediated through multiple mechanisms, given that many cells express
CD200R. However, there is no report showing CD200R expression on airway
smooth muscle (ASM) cells, suggesting that AHR inhibition by rCD200 does not
involve direct alteration of ASM contractility. Furthermore, rCD200 does not
modulate the MCh-contraction of isolated trachea (data not shown), supporting an
indirect mechanism. Yet, many mechanisms are known to influence AHR
development.
Th2 cells are deemed to be sufficient to induce asthma pathogenesis,
including AHR (34, 35), and their cell products can increase respiratory system
responsiveness to acetylcholine (36). Interestingly, rCD200 treatment reduces lung
Th2 cell number which could contribute to the inhibition of AHR observed in our
model. Although CD200 was never studied in asthma, Snelgroove et al observed a
similar effect in an influenza model (11). Indeed, CD200–/– mice infected with
influenza virus have an increased accumulation of DC and CD4+ T cells, compared
with wild type animals. Also, in agreement with our observation, Li et al (24)
showed that rCD200 stimulation reduces DC migration and T cell activation in vitro.
Thus, it suggests that CD200 is critical to maintain homeostasis by limiting the
recruitment of mDC and CD4+ T cells to the lungs. Alternatively, AHR reduction by
110
rCD200 may also be a consequence of mast cell inhibition. Indeed, mast cell
degranulation contributes to the hypercontractility of ASM cells (37, 38) and is
inhibited by CD200R activation (39). Also, our group showed that AM functions are
altered in asthmatic animals and can be reprogrammed to protect against AHR
development (14, 18, 40). Given that CD200 inhibits inflammatory macrophages
(41) and that AM express high level of CD200R (11), CD200 treatment may target
aAM to reinstate homeostasis. Thus, CD200 inhibition of AHR is probably
downstream of one or multiple targets, including Th2 cell, mast cell, and AM
inhibition.
While reducing AHR and Th2 cell accumulation, rCD200 administration did
not alter eosinophil accumulation. Even though asthma was first described as an
eosinophilic disease and there is a correlation between eosinophilia and severity of
the disease (42), it seems that asthma is much more heterogeneous than originally
thought. Some phenotypes are not dependent on eosinophil activation and
eosinophils might be more important for severe asthma/exacerbation (43). Indeed,
treatment with anti–IL-5 (a chemotactic cytokine for eosinophils) reduces
exacerbation and improves lung function in a subset of eosinophilic-asthma (44),
whereas it only reduces eosinophilia in another subset of asthma (43, 45).
Furthermore, one can inhibit eosinophil recruitment without altering Th2
recruitment and AHR development (46). On the other hand, T cell activation is
sufficient to induce asthma pathognomonic features (34, 47), suggesting that under
specific circumstances, T cells are sufficient targets to disrupt the asthmatic
cascade. Thus, eosinophilia is not altered by local administration of rCD200, but
central mechanisms of asthmatic pathogenesis, i.e. AHR and T cell recruitment,
are inhibited by rCD200 treatment.
Overall, this study is the first to demonstrate that AM express CD200 and
that treatment with rCD200 abrogates AHR in experimental asthma, in association
with a reduction of mDC and Th2 cell recruitment to the lungs. Also, it seems that
the inability of AM to upregulate the expression of CD200 in response to allergen
111
challenge may be critical for asthma development. Therefore, rCD200 treatment
might be a novel avenue for asthma therapy. Current studies in our lab are
performed to better understand the cellular mechanisms involved in CD200
protective effects on asthma pathogenesis.
5.8. Acknowledgements
We thank Emilie Bernatchez and Marc Veillette for technical help, and Dr
Ynuk Bossé for investigating the effect of rCD200 on tracheal contraction. We also
thank Dr Ynuk Bossé and Dr Yvon Cormier for critical review of the manuscript.
112
5.9. References
1. Lewkowich IP, Lajoie S, Clark JR, Herman NS, Sproles AA, Wills-Karp M. Allergen uptake, activation, and IL-23 production by pulmonary myeloid DCs drives airway hyperresponsiveness in asthma-susceptible mice. PloS one 2008;3(12):e3879. 2. Plantinga M, Guilliams M, Vanheerswynghels M, Deswarte K, Branco-Madeira F, Toussaint W, Vanhoutte L, Neyt K, Killeen N, Malissen B, Hammad H, Lambrecht BN. Conventional and Monocyte-Derived CD11b(+) Dendritic Cells Initiate and Maintain T Helper 2 Cell-Mediated Immunity to House Dust Mite Allergen. Immunity 2013;38(2):322-335. 3. Murdoch JR, Lloyd CM. Chronic inflammation and asthma. Mutat Res 2010;690(1-2):24-39. 4. Umetsu DT, Dekruyff RH. Immune dysregulation in asthma. Curr Opin Immunol 2006;18(6):727-732. 5. Lipscomb MF, Wilder JA. Immune dysregulation as a cause for allergic asthma. Curr Opin Pulm Med 1999;5(1):10-20. 6. Wissinger E, Goulding J, Hussell T. Immune homeostasis in the respiratory tract and its impact on heterologous infection. Semin Immunol 2009;21(3):147-155. 7. Holt PG, Strickland DH. The CD200-CD200R axis in local control of lung inflammation. Nature immunology 2008;9(9):1011-1013. 8. Holmannova D, Kolackova M, Kondelkova K, Kunes P, Krejsek J, Ctirad A. CD200/CD200R paired potent inhibitory molecules regulating immune and inflammatory responses; Part II: CD200/CD200R potential clinical applications. Acta medica 2012;55(2):59-65. 9. Aoki T, Matsumoto Y, Hirata K, Ochiai K, Okada M, Ichikawa K, Shibasaki M, Arinami T, Sumazaki R, Noguchi E. Expression profiling of genes related to asthma exacerbations. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2009;39(2):213-221. 10. Lambrecht BN. Alveolar macrophage in the driver's seat. Immunity 2006;24(4):366-368. 11. Snelgrove RJ, Goulding J, Didierlaurent AM, Lyonga D, Vekaria S, Edwards L, Gwyer E, Sedgwick JD, Barclay AN, Hussell T. A critical function for CD200 in lung immune homeostasis and the severity of influenza infection. Nature immunology 2008;9(9):1074-1083. 12. Lohmann-Matthes M, Steinmuller C, Franke-Ullmann G. Pulmonary macrophages. European Respiratory Journal 1994;7(9):1678-1689. 13. Coleman MM, Ruane D, Moran B, Dunne PJ, Keane J, Mills KH. Alveolar Macrophages Contribute to Respiratory Tolerance by Inducing FoxP3 Expression in Naive T Cells. American journal of respiratory cell and molecular biology 2013;48(6):773-780. 14. Careau E, Turmel V, Lauzon-Joset JF, Bissonnette EY. Alveolar macrophages reduce airway hyperresponsiveness and modulate cytokine levels. Experimental lung research 2010;36(5):255-261.
113
15. Valstar D, Schijf M, Arts JE, Kuper CF, Nijkamp F, Storm G, Bloksma N, Henricks PJ. Alveolar macrophages suppress non-specific inflammation caused by inhalation challenge with trimellitic anhydride conjugated to albumin. Arch Toxicol 2006;80(9):561-571. 16. Bang BR, Chun E, Shim EJ, Lee HS, Lee SY, Cho SH, Min KU, Kim YY, Park HW. Alveolar macrophages modulate allergic inflammation in a murine model of asthma. Experimental & molecular medicine 2011;43(5):275-280. 17. Yang M, Kumar RK, Foster PS. Interferon-γ and pulmonary macrophages contribute to the mechanisms underlying prolonged airway hyperresponsiveness. Clinical & Experimental Allergy 2010;40(1):163-173. 18. Lauzon-Joset JF, Marsolais D, Langlois A, Bissonnette EY. Dysregulation of alveolar macrophages unleashes dendritic cell-mediated mechanisms of allergic airway inflammation. Mucosal immunology 2013. 19. Careau E, Proulx LI, Pouliot P, Spahr A, Turmel V, Bissonnette EY. Antigen sensitization modulates alveolar macrophage functions in an asthma model. American journal of physiology Lung cellular and molecular physiology 2006;290(5):L871-879. 20. Labonte I, Hassan M, Risse PA, Tsuchiya K, Laviolette M, Lauzon AM, Martin JG. The effects of repeated allergen challenge on airway smooth muscle structural and molecular remodeling in a rat model of allergic asthma. American journal of physiology Lung cellular and molecular physiology 2009;297(4):L698-705. 21. Strickland DH, Thomas JA, Mok D, Blank F, McKenna KL, Larcombe AN, Sly PD, Holt PG. Defective aeroallergen surveillance by airway mucosal dendritic cells as a determinant of risk for persistent airways hyper-responsiveness in experimental asthma. Mucosal immunology 2012;5(3):332-341. 22. Holmannova D, Kolackova M, Kondelkova K, Kunes P, Krejsek J, Andrys C. CD200/CD200R paired potent inhibitory molecules regulating immune and inflammatory responses; Part I: CD200/CD200R structure, activation, and function. Acta medica 2012;55(1):12-17. 23. Darmochwal-Kolarz D, Serafin A, Tabarkiewicz J, Kolarz B, Rolinski J, Oleszczuk J. The expressions of co-stimulatory molecules are altered on putative antigen-presenting cells in cord blood. American journal of reproductive immunology 2013;69(2):180-187. 24. Li Y, Zhao LD, Tong LS, Qian SN, Ren Y, Zhang L, Ding X, Chen Y, Wang YX, Zhang W, Zeng XF, Zhang FC, Tang FL, Zhang X, Ba DN, He W, Cao XT, Lipsky PE. Aberrant CD200/CD200R1 expression and function in systemic lupus erythematosus contributes to abnormal T-cell responsiveness and dendritic cell activity. Arthritis research & therapy 2012;14(3):R123. 25. Tschernig T, Neumann D, Pich A, Dorsch M, Pabst R. Experimental bronchial asthma - the strength of the species rat. Current drug targets 2008;9(6):466-469. 26. Martin JG, Tamaoka M. Rat models of asthma and chronic obstructive lung disease. Pulmonary pharmacology & therapeutics 2006;19(6):377-385. 27. Minas K, Liversidge J. Is the CD200/CD200 receptor interaction more than just a myeloid cell inhibitory signal? Crit Rev Immunol 2006;26(3):213-230.
114
28. Liu Y, Bando Y, Vargas-Lowy D, Elyaman W, Khoury SJ, Huang T, Reif K, Chitnis T. CD200R1 agonist attenuates mechanisms of chronic disease in a murine model of multiple sclerosis. The Journal of neuroscience : the official journal of the Society for Neuroscience 2010;30(6):2025-2038. 29. Gorczynski RM, Chen Z, Yu K, Hu J. CD200 immunoadhesin suppresses collagen-induced arthritis in mice. Clinical immunology 2001;101(3):328-334. 30. Mahadevan D, Lanasa MC, Whelden M, Faas SJ, Ulery TL, Kukreja A, Li L, Bedrosian CL, Heffner T. First-In-Human Phase I Dose Escalation Study of a Humanized Anti-CD200 Antibody (Samalizumab) in Patients with Advanced Stage B Cell Chronic Lymphocytic Leukemia (B-CLL) or Multiple Myeloma (MM). ASH Annual Meeting abstract 2010;116:2465. 31. Jiang-Shieh YF, Chien HF, Chang CY, Wei TS, Chiu MM, Chen HM, Wu CH. Distribution and expression of CD200 in the rat respiratory system under normal and endotoxin-induced pathological conditions. Journal of anatomy 2010;216(3):407-416. 32. Madore AM, Perron S, Turmel V, Laviolette M, Bissonnette EY, Laprise C. Alveolar macrophages in allergic asthma: an expression signature characterized by heat shock protein pathways. Human immunology 2010;71(2):144-150. 33. Porsbjerg C, Rasmussen L, Nolte H, Backer V. Association of airway hyperresponsiveness with reduced quality of life in patients with moderate to severe asthma. Annals of allergy, asthma & immunology : official publication of the American College of Allergy, Asthma, & Immunology 2007;98(1):44-50. 34. Mishima H, Hojo M, Watanabe A, Hamid QA, Martin JG. CD4+ T cells can induce airway hyperresponsiveness to allergen challenge in the brown norway rat. American journal of respiratory and critical care medicine 1998;158(6):1863-1870. 35. Gavett SH, Chen X, Finkelman F, Wills-Karp M. Depletion of murine CD4+ T lymphocytes prevents antigen-induced airway hyperreactivity and pulmonary eosinophilia. American journal of respiratory cell and molecular biology 1994;10(6):587-593. 36. Venkayya R, Lam M, Willkom M, Grunig G, Corry DB, Erle DJ. The Th2 lymphocyte products IL-4 and IL-13 rapidly induce airway hyperresponsiveness through direct effects on resident airway cells. American journal of respiratory cell and molecular biology 2002;26(2):202-208. 37. Berger P, Compton SJ, Molimard M, Walls AF, N'Guyen C, Marthan R, Tunon-De-Lara JM. Mast cell tryptase as a mediator of hyperresponsiveness in human isolated bronchi. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 1999;29(6):804-812. 38. Page S, Ammit AJ, Black JL, Armour CL. Human mast cell and airway smooth muscle cell interactions: implications for asthma. American journal of physiology Lung cellular and molecular physiology 2001;281(6):L1313-1323. 39. Zhang S, Cherwinski H, Sedgwick JD, Phillips JH. Molecular mechanisms of CD200 inhibition of mast cell activation. J Immunol 2004;173(11):6786-6793. 40. Pouliot P, Spahr A, Careau E, Turmel V, Bissonnette EY. Alveolar macrophages from allergic lungs are not committed to a pro-allergic response and can reduce airway hyperresponsiveness following ex vivo culture. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2008;38(3):529-538.
115
41. Gorczynski RM. CD200 and its receptors as targets for immunoregulation. Curr Opin Investig Drugs 2005;6(5):483-488. 42. Bousquet J, Chanez P, Lacoste JY, Barneon G, Ghavanian N, Enander I, Venge P, Ahlstedt S, Simony-Lafontaine J, Godard P, Michel FB. Eosinophilic inflammation in asthma. The New England journal of medicine 1990;323(15):1033-1039. 43. Wenzel SE. Eosinophils in asthma--closing the loop or opening the door? The New England journal of medicine 2009;360(10):1026-1028. 44. Castro M, Mathur S, Hargreave F, Boulet LP, Xie F, Young J, Wilkins HJ, Henkel T, Nair P, Res-5- Study G. Reslizumab for poorly controlled, eosinophilic asthma: a randomized, placebo-controlled study. American journal of respiratory and critical care medicine 2011;184(10):1125-1132. 45. Flood-Page P, Swenson C, Faiferman I, Matthews J, Williams M, Brannick L, Robinson D, Wenzel S, Busse W, Hansel TT, Barnes NC, International Mepolizumab Study G. A study to evaluate safety and efficacy of mepolizumab in patients with moderate persistent asthma. American journal of respiratory and critical care medicine 2007;176(11):1062-1071. 46. Fattouh R, Al-Garawi A, Fattouh M, Arias K, Walker TD, Goncharova S, Coyle AJ, Humbles AA, Jordana M. Eosinophils are dispensable for allergic remodeling and immunity in a model of house dust mite-induced airway disease. American journal of respiratory and critical care medicine 2011;183(2):179-188. 47. Siegle JS, Hansbro N, Herbert C, Yang M, Foster PS, Kumar RK. Airway hyperreactivity in exacerbation of chronic asthma is independent of eosinophilic inflammation. American journal of respiratory cell and molecular biology 2006;35(5):565-570.
116
5.10. Figure legends
Figure 5.1: AM express the surface molecule CD200 and its expression is
dysregulated in asthma
AM were harvested by BAL and purified by adherence. mRNA was extracted with
Trizol reagent and CD200 expression was assessed with one-step RT-PCR. A)
CD200 (arrow) and -actin (arrowhead) mRNA expression in AM. B-C) Asthmatic
rats were sensitized i.p. with ovalbumin (OVA)/Alum and BAL were performed 24 h
after OVA challenge. AM from naïve (nAM) and asthmatic (aAM) rats were
harvested before (pre) or after (post) allergen challenge, and identified as
CD172+/autofluorescent+ cells by FACS. B) Representative histogram of FACS
analysis and C) mean fluorescence intensity (MFI) percentage over control (nAM
pre-allergen challenge) are depicted. n = 4-7. Asterisk indicates significant
differences (P<0.05) compared with the naïve group.
Figure 5.2: rCD200 reduces AHR, but does not modulate cell recruitment in
bronchoalveolar lavages
Asthmatic rats were sensitized i.p. with ovalbumin (OVA)/Alum and received
recombinant IgG (Sham) or CD200 chimera (rCD200) i.t. 24 h before allergen
challenge. Lung resistance (RL) and BAL were analyzed 24 h after OVA challenge.
A) RL was assessed after nebulisation with incremental doses of MCh. B) Total cell
counts and C) cellularity were measured after Trypan blue and DiffQuick stainings,
respectively. AM: alveolar macrophages; Eos: eosinophils; Neutro: neutrophils. n =
4-7. Asterisk indicates significant differences (P<0.05) compared with the naïve
group.
117
Figure 5.3: mDC recruitment to the lung of asthmatic rats is inhibited by
rCD200
Asthmatic rats were sensitized i.p. with ovalbumin (OVA)/Alum and received
recombinant IgG (Sham) or CD200 chimera (rCD200) i.t. 24 h before allergen
challenge. Single cell suspensions were prepared from lungs 24 h after OVA
challenge and analyzed by FACS. Myeloid DC (mDC) were gated on non-
autofluorescent cells and identified as CD11b+ and major histocompatibility
complex (MHC) II+ cells, whereas plasmacytoid DC (pDC) were gated on non-
autofluorescent CD4+ cells and identified as CD11b–, CD4+ and MHC II+ cells.
mDC and pDC A) frequencies of total lung cells and B) number per g of lung were
measured. n = 4-7. Asterisk indicates significant differences (P<0.05).
Figure 5.4: rCD200 reduces the accumulation of Th2 cells in the lung of
asthmatic animals
Asthmatic rats were sensitized i.p. with ovalbumin (OVA)/Alum and received
recombinant IgG (Sham) or CD200 chimera (rCD200) i.t. 24 h before allergen
challenge. Single cell suspensions were prepared from lungs 24 h after OVA
challenge and analyzed by flow cytometry. CD4+ T cell (CD3+) and IL-4+/Stat6+ Th2
cell frequencies of total lung cells (A;C, respectively) and number per g of lung
(B;D, respectively) were measured. n = 4-7. Asterisk indicates significant
differences (P<0.05).
Figure 5.5: rCD200 does not alter dLN DC and T cell numbers
Asthmatic rats were sensitized i.p. with ovalbumin (OVA)/Alum and received
recombinant IgG (Sham) or CD200 chimera (rCD200) i.t. 24 h before OVA-
AlexaFluor647 challenge. Single cell suspensions were prepared from draining
lymph node (dLN) 24 h after OVA exposure and OVA+ DC was assessed by
118
measuring the frequency of AlexaFluor647+ DC, using flow cytometry. A) OVA+
mDC and pDC frequencies of total dLN cells and B) OVA+ mDC and pDC number
in dLN were measured. CD4+ T cell and IL-4+/Stat6+ Th2 frequencies of total dLN
cells (C;E, respectively) and number per dLN (D;F, respectively). n = 4-7. Asterisk
indicates significant differences (P<0.05) compared with the naïve group.
119
5.11. Figures
Figure 5.1 : AM express the surface molecule CD200 and its expression is
dysregulated in asthma
120
Figure 5.2 : rCD200 reduces AHR, but does not modulate cell recruitment in
bronchoalveolar lavages
121
Figure 5.3 : mDC recruitment to the lung of asthmatic rats is inhibited by rCD200
122
Figure 5.4 : rCD200 reduces the accumulation of Th2 cells in the lung of asthmatic
animals
123
Figure 5.5 : rCD200 does not alter dLN DC and T cell numbers
125
CHAPITRE 6 : Discussion, conclusion et
perspectives
126
6.1. Activation des populations de DC dans l’immunité
pulmonaire
L’immunité pulmonaire est composée de plusieurs types de cellules ayant
des fonctions spécifiques, dont les DC. Les DC sont des cellules clés pour orienter
la réaction immune à un allergène vers une réponse asthmatique ou tolérogène.
En effet, les DC peuvent aussi bien polariser les lymphocytes T en Th2 qu’en Treg.
Bien que plusieurs populations de DC soient présentes dans le poumon, peu
d’informations sont disponibles quant à savoir l’implication de ces différentes
populations dans les multiples réponses immunes.
Pour éclaircir ce point, nous nous sommes intéressés à l’activation des DC
dans une réponse tolérogène et asthmatique. Dans cette étude, nous avons
démontré que l’activation des mDC2 pulmonaires est associée avec le
développement d’une réponse tolérogène, tandis que la réponse inflammatoire
asthmatique est liée avec l’activation des mDC1. Des résultats similaires ont été
observés dans d’autres modèles tolérogènes et inflammatoires chez la souris (35,
37, 160). Donc, les mDC2 de rats et les DC CD103+ de souris ont des fonctions
tolérogènes homologues (26, 29). En résumé, nos résultats supportent pour la
première fois que la mise en place d’une réponse tolérogène et asthmatique sont,
respectivement, associées à l’activation des mDC2 et mDC1 pulmonaires.
Également, cette étude a mis en lumière la relation entre la dose
d’allergènes et l’initiation de la réponse immunitaire. En effet, bien que les rats
PVG et BN aient été exposés à la même quantité d’allergène, la quantité d’OVA
transportée par les mDC dans les ganglions lymphatiques est très différente entre
les deux espèces. Cela confirme donc les observations de Strickland et al (161)
qu’une faible capture de l’OVA par les DC est associée à une réponse asthmatique
Th2, tandis qu’une forte capture des allergènes favorise la tolérance.
127
L’implication des différents compartiments pulmonaires lors d’une réponse
tolérogène et asthmatique a également été le sujet de cette étude. Contrairement à
ce que von Garnier et al (13) ont observé, notre étude n’a identifié aucune
modulation des fonctions des DC de la trachée lors d’une réponse tolérogène et
asthmatique chez les rats PVG et BN. Cette divergence pourrait s’expliquer par
l’utilisation de modèles différents. Tout d’abord, von Garnier et al (13) ont étudié la
capture de l’allergène chez des souris naïves, tandis que nous avons utilisé des
modèles de rats impliquant une sensibilisation et plusieurs expositions à un
allergène. Bien qu’il soit possible que le système immun des différentes espèces
présente des différences intrinsèques, les modèles utilisés dans notre étude ont
l’avantage de mieux représenter la « réalité ». En effet, les rats ont été exposés à
l’allergène sur une longue période, contrairement à l’injection d’un bolus
d’allergène intranasale ou intratrachéale. De plus, l’exposition répétée (1 fois par
jour durant 6 jours) est davantage représentative de ce qui peut arriver chez un
patient asthmatique. Bref, nos données supportent que les DC pulmonaires, et non
celles de la trachée, sont impliquées dans la mise en place d’une réponse
tolérogène et asthmatique. Ainsi, pour la suite des études, nous nous sommes
concentrés sur l’activation des DC pulmonaires dans la réponse asthmatique et
particulièrement, comment leur activation est régulée.
6.2. Mécanismes de l’homéostasie pulmonaire
Grâce à la meilleure compréhension des fonctions des DC dans l’immunité
pulmonaire, il a été possible d’approfondir des mécanismes qui contrôlent
l’homéostasie pulmonaire. Pour ce faire, deux principaux thèmes ont été abordés
dans cette thèse, soit le rôle des AM et celui de la voie CD200/CD200R dans
l’homéostasie pulmonaire. Ces études avaient pour but de mieux comprendre les
128
mécanismes qui contrôlent l’activation des DC et plus particulièrement, lesquels
sont dérégulés lors de la réponse asthmatique.
Les macrophages alvéolaires
Les AM sont les cellules immunitaires pulmonaires les plus abondantes.
Leurs fonctions permettent aussi bien la mise en place d’une réponse
inflammatoire qu’anti-inflammatoire. Bien que chez des sujets asthmatiques, les
AM ont un phénotype pro-inflammatoire (50, 144, 145), plusieurs études ont
démontré que, de façon constitutive, les AM ont des fonctions anti-inflammatoires
(48, 54). En effet, plusieurs études in vitro ont démontré que les AM interfèrent
avec l’activation des DC (62, 63) et peuvent même induire l’activation des Treg
(61). De plus, le transfert de AM naïfs dans des rats asthmatiques est suffisant
pour empêcher le développement d’AHR et pour altérer la cascade inflammatoire
observée chez les rats asthmatiques (55, 57, 58, 138, 145, 149, 159). Cela
suggère donc que les AM pourraient interférer avec la réponse asthmatique en
modulant l’activation des DC, mais les mécanismes impliqués dans cette
régulation sont encore mécompris.
Notre étude avait donc comme objectif de déterminer l’interaction des AM et
des DC dans l’homéostasie pulmonaire. Nous avons démontré pour la première
fois que les AM naïfs modulent l’activation des mDC in vivo en inhibant leur
capacité à capturer des allergènes. De plus, nos résultats montrent que les AM
naïfs inhibent aussi bien l’activation des mDC1 que les mDC2 (données non
publiés) et n’induisent pas de réponse Treg. Ces résultats suggèrent que,
contrairement à la réponse tolérogène observée dans les rats PVG, les AM naïfs
de rats BN maintiennent l’homéostasie pulmonaire via l’ignorance immunitaire. Il
est possible que la discordance entre ces deux réponses soit liée au nombre
d’exposition à l’allergène. En effet, le modèle de transfert de AM dans les rats BN
est exposé seulement une fois à l’allergène, tandis que la réponse tolérogène des
rats PVG est induite après des expositions allergéniques multiples. Il est donc
129
possible qu’un faible nombre d’exposition favorise l’ignorance, tandis que
l’exposition répétée entraine une réponse tolérogène. En effet, la tolérance
implique le développement de Treg qui circule afin de contrôler l’activation du
système immunitaire. Par contre, il serait trop « coûteux » pour le système
immunitaire de mettre un place une réponse tolérogène contre tous les allergènes
et antigènes auxquels nous sommes exposés. Pour ce faire, les mécanismes
d’ignorance permettent d’éliminer rapidement et silencieusement la majorité des
éléments exogènes inoffensifs, afin de permettre le développement de réponses
tolérogènes lorsque requis. En résumé, cette étude a démontré pour la première
fois que les AM participent à l’ignorance immunitaire en limitant la capture de
l’allergène par les DC.
Malgré l’altération de l’activation des DC, les AM n’affectent pas
l’accumulation des éosinophiles au poumon, mais interfèrent avec le
développement de l’AHR (58, 138). Quoique plusieurs études ont déjà remarqué
une dissociation entre l’AHR et l’éosinophilie (135-137, 162), notre étude suggère
que les mécanismes qui contrôlent l’éosinophilie sont distincts de ceux qui
contrôlent l’activation des DC. Quoique peu d’évidences directes sont disponibles
sur les étapes du recrutement des éosinophiles, plusieurs études ont démontré
que les cellules épithéliales pulmonaires sont les principales productrices
d’éotaxine (chimiokine des éosinophiles) (163-165). Il est donc probable que le
transfert de AM n’affecte pas la production de chimiokines par les cellules
épithéliales et donc le recrutement d’éosinophiles.
Afin de mieux comprendre l’homéostasie pulmonaire et le rôle des AM dans
cette réponse, il est important d’identifier les mécanismes impliqués dans
l’interaction entre les AM et les DC. Dans cette étude, nous avons démontré que le
transfert de AM naïfs réduit la capture d’OVA par les DC et que ce n’est pas induit
par une plus grande élimination (ou phagocytose) de l’OVA par les AM, ni par une
altération du profil de cytokines des LBA. En effet, les AM naïfs phagocytent moins
d’OVA que ceux asthmatiques et la concentration d’IL-10 (une cytokine anti-
130
inflammatoire) et de GM-CSF (Granulocyte macrophage colony-stimulating factor;
un facteur impliqué dans l’activation des DC) n’est pas modulée (64, 166, 167).
Pour ces raisons, nous nous sommes intéressés à une voie homéostatique
nouvellement décrite, celle du CD200/CD200R.
La voie du CD200/CD200R
Le CD200 et le CD200R sont des protéines de surfaces exprimées par une
panoplie de cellules immunitaires et structurales. L’interaction du CD200 avec son
récepteur modulent plusieurs processus inflammatoires, dont la réponse antivirale
et l’inflammation arthritique (65, 69, 78). L’activation de CD200R par le CD200
inhibe la dégranulation des mastocytes, tandis qu’elle diminue la production de
cytokines pro-inflammatoires par les macrophages (60, 71, 73, 74). Le CD200R est
davantage exprimé par les AM que par ses homologues résidents des autres
tissus (60), suggérant un rôle important dans l’immunité pulmonaire. Bien
qu’aucune étude n’ait investigué le rôle de cette voie dans la réaction asthmatique
pulmonaire, une étude génétique a mis en évidence une réduction de l’expression
du CD200 sur les monocytes circulants chez les patients asthmatiques en
exacerbation (80). Toutes ces informations suggèrent que, dans l’asthme, la voie
du CD200/CD200R est dérégulée.
Nous avons donc évalué la dérégulation de cette voie de signalisation dans
la pathogénèse de l’asthme allergique. Nous sommes la première équipe qui a
démontré que les AM expriment le CD200 (en plus du CD200R), ce qui suggère
que les AM modulent les fonctions des cellules exprimant le CD200R, incluant
elles-mêmes. Aussi, nous avons démontré que l’expression du CD200 par les AM
augmente en réponse à une exposition allergénique chez des rats naïfs, tandis
que chez les rats asthmatiques, aucune modulation n’est observée. Puisque la
voie du CD200/CD200R est dérégulée dans l’asthme, nous avons testé si
l’administration d’une protéine recombinante de CD200 (rCD200) pouvait altérer la
réponse asthmatique et l’activation des DC.
131
Notre étude est la première étude qui démontre que l’administration du
CD200 interfère avec la cascade asthmatique. En effet, l’administration de rCD200
chez des rats asthmatiques a complètement inhibé l’AHR, sans toutefois affecter
l’éosinophilie. Il est intéressant de noter que le transfert de AM sains et le rCD200
inhibent les mêmes composantes de la réaction asthmatique, ce qui supporte que
l’inhibition de l’AHR par les AM pourrait être médiée via le CD200. De plus, si les
cellules épithéliales sont bel et bien responsables du recrutement des éosinophiles
(voir plus haut; (135-137, 162)), il est normal que le rCD200 n’affecte pas les
fonctions de l’épithélium, puisque celui est dépourvu de CD200R. Par contre, il est
possible que le rCD200 compense pour la dérégulation du CD200 sur d’autres
cellules pulmonaires, dont les DC et les cellules épithéliales. En effet, des résultats
préliminaires de notre laboratoire suggèrent que l’expression du CD200 sur les
cellules épithéliales bronchiques est également diminuée dans l’asthme.
L’axe DC/lymphocytes Th2 est également modulé par le traitement avec
rCD200. En effet, l’accumulation des mDC, ainsi que des lymphocytes Th2, au
poumon de rats asthmatiques est inhibée par le rCD200. Par contre, le rCD200 ne
module pas la migration des mDC OVA+ vers les ganglions lymphatiques. Ces
résultats suggèrent donc que le contrôle de l’immunité par les AM ne s’effectue
pas seulement via la voie du CD200, puisque le transfert de AM, contrairement au
rCD200, réduit la capture d’allergènes par les mDC pulmonaires, ainsi que leur
accumulation aux ganglions lymphatiques.
En résumé, nous sommes les premiers à avoir démontré que les AM
expriment le CD200 et que, dans l’asthme, son expression est dérégulée dans le
poumon. De plus, nos résultats démontrent pour la première fois que
l’administration de rCD200 est efficace pour moduler plusieurs éléments de la
cascade asthmatique, dont l’AHR et la réponse Th2. Finalement, les AM et le
CD200 contrôlent l’homéostasie pulmonaire, entre autre, via la modulation des
fonctions des DC, mais les fonctions anti-inflammatoires des AM incluent
probablement d’autres mécanismes en plus du CD200.
132
6.3. Conclusions et perspectives
Nous avons mis en évidence la modulation différentielle de l’activation des
mDC1 et mDC2 dans les réponses asthmatique et tolérogène. Si les DC
trachéales semblent jouer un rôle mineur, les mDC2 pulmonaires sont
préférentiellement activées en condition tolérogène. Au point de vue mécanistique,
il serait intéressant de confirmer ces observations à l’aide du transfert de mDC1 et
mDC2. De plus, l’identification du ou des facteurs qui permettent aux mDC1 et
mDC2 d’induire des réponses immunes différentielles seraient un atout majeur afin
de pouvoir moduler la réponse immune. Bien que les AM semblent contrôler
l’activation des mDC, ils ne semblent pas agir différemment sur l’une ou l’autre des
sous-populations.
Nous avons également démontré que les AM régulent l’activation des mDC.
L’identification du ou des mécanismes de communication intercellulaire employé
par les AM pour maintenir l’homéostasie pulmonaire est encore mal défini.
Toutefois, nous avons démontré que le rCD200 duplique certaines des fonctions
des AM naïfs, ce qui suggère que l’expression du CD200 par les AM pourrait
contrôler l’homéostasie pulmonaire. En effet, l’administration de rCD200 est
suffisante pour moduler dans le poumon l’accumulation des DC et des
lymphocytes Th2. Par contre, ce traitement ne semble pas affecter la réponse
immunitaire périphérique (i.e. dans les ganglions lymphatiques), ce qui pourrait
permettre d’entretenir l’activation de la cascade inflammatoire. Afin de mieux
comprendre l’immunobiologie du CD200, il serait important de déterminer les
cibles du rCD200 et si le rCD200 altère directement les fonctions des DC et/ou des
lymphocytes Th2. En autre, il serait possible de déterminer si la présence des AM
est nécessaire pour l’effet du rCD200 en déplétant les AM avant d’administrer le
rCD200. De plus, afin de mieux comprendre le rôle des AM dans l’homéostasie
133
pulmonaire, l’investigation de la contribution du CD200 présent à la surface des
AM serait importante. Pour ce faire, il serait possible d’éliminer l’expression du
CD200 sur les AM avant de les transférer par interférence à l’ARN (e.g. en utilisant
des small interference RNA; siRNA), mais cela impliquerait probablement d’utiliser
des lignées cellulaires (e.g. les NR8383) au lieu de AM ex vivo. En effet, les AM
sont des cellules particulièrement résistantes à ce genre de traitement et
l’utilisation de lignée stable facilite le processus (168, 169).
En conclusion, les différentes populations de DC sont activées pour mettre
en place une réponse tolérogène et inflammatoire. De plus, les AM jouent un rôle
important dans l’homéostasie pulmonaire via l’interaction avec les DC. La perte
des capacités homéostatiques des AM dans le contexte de l’asthme pourrait
s’expliquer, du moins en partie, par la dérégulation de la voie du CD200. Toutefois
les multiples cibles potentielles du rCD200 restent à déterminer. Ainsi, nos études
ont éclairci certains mécanismes impliqués dans l’immunité pulmonaire et sera la
base d’études futures dans le laboratoire du Dre Bissonnette.
135
CHAPITRE 7 : Bibliographie
136
1. Green DR, Ferguson TA. The role of Fas ligand in immune privilege. Nat Rev Mol Cell Biol 2001;2(12):917-924. 2. Tournoy KG, Provoost S, Van Hove C, Joos G. The role of immune tolerance in asthma pathogenesis. Curr Allergy Asthma Rep 2006;6(5):437-443. 3. Miyata R, van Eeden SF. The innate and adaptive immune response induced by alveolar macrophages exposed to ambient particulate matter. Toxicology and applied pharmacology 2011;257(2):209-226. 4. Sanders CJ, Doherty PC, Thomas PG. Respiratory epithelial cells in innate immunity to influenza virus infection. Cell Tissue Res 2011;343(1):13-21. 5. Hussell T, Goulding J. Structured regulation of inflammation during respiratory viral infection. The Lancet infectious diseases 2010;10(5):360-366. 6. Guillot L, Nathan N, Tabary O, Thouvenin G, Le Rouzic P, Corvol H, Amselem S, Clement A. Alveolar epithelial cells: master regulators of lung homeostasis. Int J Biochem Cell Biol 2013;45(11):2568-2573. 7. Wissinger E, Goulding J, Hussell T. Immune homeostasis in the respiratory tract and its impact on heterologous infection. Semin Immunol 2009;21(3):147-155. 8. Holt PG, Strickland DH. The CD200-CD200R axis in local control of lung inflammation. Nature immunology 2008;9(9):1011-1013. 9. Reis e Sousa C. Dendritic cells in a mature age. Nat Rev Immunol 2006;6(6):476-483. 10. Hansel TT, Johnston SL, Openshaw PJ. Microbes and mucosal immune responses in asthma. Lancet 2013;381(9869):861-873. 11. Desch AN, Henson PM, Jakubzick CV. Pulmonary dendritic cell development and antigen acquisition. Immunol Res 2013;55(1-3):178-186. 12. Jakubzick C, Tacke F, Llodra J, van Rooijen N, Randolph GJ. Modulation of dendritic cell trafficking to and from the airways. J Immunol 2006;176(6):3578-3584. 13. von Garnier C, Filgueira L, Wikstrom M, Smith M, Thomas JA, Strickland DH, Holt PG, Stumbles PA. Anatomical location determines the distribution and function of dendritic cells and other APCs in the respiratory tract. J Immunol 2005;175(3):1609-1618. 14. Holt PG, Haining S, Nelson DJ, Sedgwick JD. Origin and steady-state turnover of class II MHC-bearing dendritic cells in the epithelium of the conducting airways. J Immunol 1994;153(1):256-261. 15. Hahn I, Klaus A, Maus R, Christman JW, Welte T, Maus UA. Dendritic cell depletion and repopulation in the lung after irradiation and bone marrow transplantation in mice. American journal of respiratory cell and molecular biology 2011;45(3):534-541. 16. Vermaelen K, Pauwels R. Pulmonary dendritic cells. American journal of respiratory and critical care medicine 2005;172(5):530-551. 17. Cook DN, Bottomly K. Innate immune control of pulmonary dendritic cell trafficking. Proc Am Thorac Soc 2007;4(3):234-239. 18. Mahnke K, Schmitt E, Bonifaz L, Enk AH, Jonuleit H. Immature, but not inactive: the tolerogenic function of immature dendritic cells. Immunology and cell biology 2002;80(5):477-483. 19. Cools N, Van Tendeloo VF, Smits EL, Lenjou M, Nijs G, Van Bockstaele DR, Berneman ZN, Ponsaerts P. Immunosuppression induced by immature
137
dendritic cells is mediated by TGF-beta/IL-10 double-positive CD4+ regulatory T cells. Journal of cellular and molecular medicine 2008;12(2):690-700. 20. Gad M, Kristensen NN, Kury E, Claesson MH. Characterization of T-regulatory cells, induced by immature dendritic cells, which inhibit enteroantigen-reactive colitis-inducing T-cell responses in vitro and in vivo. Immunology 2004;113(4):499-508. 21. Lambrecht BN, Carro-Muino I, Vermaelen K, Pauwels RA. Allergen-induced changes in bone-marrow progenitor and airway dendritic cells in sensitized rats. American journal of respiratory cell and molecular biology 1999;20(6):1165-1174. 22. Fear VS, Burchell JT, Lai SP, Wikstrom ME, Blank F, von Garnier C, Turner DJ, Sly PD, Holt PG, Strickland DS, et al. Restricted aeroallergen access to airway mucosal dendritic cells in vivo limits allergen-specific CD4+ T cell proliferation during the induction of inhalation tolerance. J Immunol 2011;187(9):4561-4570. 23. Hubo M, Trinschek B, Kryczanowsky F, Tuettenberg A, Steinbrink K, Jonuleit H. Costimulatory molecules on immunogenic versus tolerogenic human dendritic cells. Frontiers in immunology 2013;4:82. 24. de Jong EC, Smits HH, Kapsenberg ML. Dendritic cell-mediated T cell polarization. Springer seminars in immunopathology 2005;26(3):289-307. 25. Boonstra A, Asselin-Paturel C, Gilliet M, Crain C, Trinchieri G, Liu YJ, O'Garra A. Flexibility of mouse classical and plasmacytoid-derived dendritic cells in directing T helper type 1 and 2 cell development: dependency on antigen dose and differential toll-like receptor ligation. The Journal of experimental medicine 2003;197(1):101-109. 26. Hochrein H, O'Keeffe M. Dendritic cell subsets and toll-like receptors. Handbook of experimental pharmacology 2008(183):153-179. 27. Crozat K, Guiton R, Guilliams M, Henri S, Baranek T, Schwartz-Cornil I, Malissen B, Dalod M. Comparative genomics as a tool to reveal functional equivalences between human and mouse dendritic cell subsets. Immunological reviews 2010;234(1):177-198. 28. Demedts IK, Brusselle GG, Vermaelen KY, Pauwels RA. Identification and characterization of human pulmonary dendritic cells. American journal of respiratory cell and molecular biology 2005;32(3):177-184. 29. Robbins SH, Walzer T, Dembele D, Thibault C, Defays A, Bessou G, Xu H, Vivier E, Sellars M, Pierre P, et al. Novel insights into the relationships between dendritic cell subsets in human and mouse revealed by genome-wide expression profiling. Genome biology 2008;9(1):R17. 30. Jahnsen FL, Moloney ED, Hogan T, Upham JW, Burke CM, Holt PG. Rapid dendritic cell recruitment to the bronchial mucosa of patients with atopic asthma in response to local allergen challenge. Thorax 2001;56(11):823-826. 31. Demedts IK, Bracke KR, Maes T, Joos GF, Brusselle GG. Different roles for human lung dendritic cell subsets in pulmonary immune defense mechanisms. American journal of respiratory cell and molecular biology 2006;35(3):387-393. 32. Jakubzick C, Helft J, Kaplan TJ, Randolph GJ. Optimization of methods to study pulmonary dendritic cell migration reveals distinct capacities of DC subsets to acquire soluble versus particulate antigen. Journal of immunological methods 2008;337(2):121-131.
138
33. Coquerelle C, Moser M. DC subsets in positive and negative regulation of immunity. Immunological reviews 2010;234(1):317-334. 34. GeurtsvanKessel CH, Lambrecht BN. Division of labor between dendritic cell subsets of the lung. Mucosal immunology 2008;1(6):442-450. 35. Khare A, Krishnamoorthy N, Oriss TB, Fei M, Ray P, Ray A. Cutting Edge: Inhaled Antigen Upregulates Retinaldehyde Dehydrogenase in Lung CD103+ but Not Plasmacytoid Dendritic Cells To Induce Foxp3 De Novo in CD4+ T Cells and Promote Airway Tolerance. J Immunol 2013;191(1):25-29. 36. Matteoli G, Mazzini E, Iliev ID, Mileti E, Fallarino F, Puccetti P, Chieppa M, Rescigno M. Gut CD103+ dendritic cells express indoleamine 2,3-dioxygenase which influences T regulatory/T effector cell balance and oral tolerance induction. Gut 2010;59(5):595-604. 37. del Rio ML, Bernhardt G, Rodriguez-Barbosa JI, Forster R. Development and functional specialization of CD103+ dendritic cells. Immunological reviews 2010;234(1):268-281. 38. de Heer HJ, Hammad H, Soullie T, Hijdra D, Vos N, Willart MA, Hoogsteden HC, Lambrecht BN. Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. The Journal of experimental medicine 2004;200(1):89-98. 39. Oriss TB, Ostroukhova M, Seguin-Devaux C, Dixon-McCarthy B, Stolz DB, Watkins SC, Pillemer B, Ray P, Ray A. Dynamics of dendritic cell phenotype and interactions with CD4+ T cells in airway inflammation and tolerance. J Immunol 2005;174(2):854-863. 40. Holt PG, Stumbles PA. Characterization of dendritic cell populations in the respiratory tract. Journal of aerosol medicine : the official journal of the International Society for Aerosols in Medicine 2000;13(4):361-367. 41. Fitzgerald-Bocarsly P, Dai J, Singh S. Plasmacytoid dendritic cells and type I IFN: 50 years of convergent history. Cytokine & growth factor reviews 2008;19(1):3-19. 42. Guery L, Hugues S. Tolerogenic and activatory plasmacytoid dendritic cells in autoimmunity. Frontiers in immunology 2013;4:59. 43. Hubo M, Jonuleit H. Plasmacytoid dendritic cells are inefficient in activation of human regulatory T cells. PloS one 2012;7(8):e44056. 44. Gordon SB, Read RC. Macrophage defences against respiratory tract infections. British medical bulletin 2002;61:45-61. 45. Marriott HM, Dockrell DH. The role of the macrophage in lung disease mediated by bacteria. Experimental lung research 2007;33(10):493-505. 46. Broug-Holub E, Toews GB, van Iwaarden JF, Strieter RM, Kunkel SL, Paine R, 3rd, Standiford TJ. Alveolar macrophages are required for protective pulmonary defenses in murine Klebsiella pneumonia: elimination of alveolar macrophages increases neutrophil recruitment but decreases bacterial clearance and survival. Infection and immunity 1997;65(4):1139-1146. 47. Lohmann-Matthes M, Steinmuller C, Franke-Ullmann G. Pulmonary macrophages. European Respiratory Journal 1994;7(9):1678-1689. 48. Kooguchi K, Hashimoto S, Kobayashi A, Kitamura Y, Kudoh I, Wiener-Kronish J, Sawa T. Role of alveolar macrophages in initiation and regulation of
139
inflammation in Pseudomonas aeruginosa pneumonia. Infection and immunity 1998;66(7):3164-3169. 49. Westphalen K, Gusarova GA, Islam MN, Subramanian M, Cohen TS, Prince AS, Bhattacharya J. Sessile alveolar macrophages communicate with alveolar epithelium to modulate immunity. Nature 2014. 50. Moreira AP, Hogaboam CM. Macrophages in allergic asthma: fine-tuning their pro- and anti-inflammatory actions for disease resolution. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research 2011;31(6):485-491. 51. Hussell T, Bell TJ. Alveolar macrophages: plasticity in a tissue-specific context. Nat Rev Immunol 2014;14(2):81-93. 52. Benoit M, Desnues B, Mege JL. Macrophage polarization in bacterial infections. J Immunol 2008;181(6):3733-3739. 53. Mantovani A, Sica A, Sozzani S, Allavena P, Vecchi A, Locati M. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol 2004;25(12):677-686. 54. Balhara J, Gounni AS. The alveolar macrophages in asthma: a double-edged sword. Mucosal immunology 2012;5(6):605-609. 55. Careau E, Bissonnette EY. Adoptive transfer of alveolar macrophages abrogates bronchial hyperresponsiveness. American journal of respiratory cell and molecular biology 2004;31(1):22-27. 56. Valstar D, Schijf M, Arts JE, Kuper CF, Nijkamp F, Storm G, Bloksma N, Henricks PJ. Alveolar macrophages suppress non-specific inflammation caused by inhalation challenge with trimellitic anhydride conjugated to albumin. Arch Toxicol 2006;80(9):561-571. 57. Bang BR, Chun E, Shim EJ, Lee HS, Lee SY, Cho SH, Min KU, Kim YY, Park HW. Alveolar macrophages modulate allergic inflammation in a murine model of asthma. Experimental & molecular medicine 2011;43(5):275-280. 58. Careau E, Turmel V, Lauzon-Joset JF, Bissonnette EY. Alveolar macrophages reduce airway hyperresponsiveness and modulate cytokine levels. Experimental lung research 2010;36(5):255-261. 59. Goulding J, Godlee A, Vekaria S, Hilty M, Snelgrove R, Hussell T. Lowering the threshold of lung innate immune cell activation alters susceptibility to secondary bacterial superinfection. The Journal of infectious diseases 2011;204(7):1086-1094. 60. Snelgrove RJ, Goulding J, Didierlaurent AM, Lyonga D, Vekaria S, Edwards L, Gwyer E, Sedgwick JD, Barclay AN, Hussell T. A critical function for CD200 in lung immune homeostasis and the severity of influenza infection. Nature immunology 2008;9(9):1074-1083. 61. Coleman MM, Ruane D, Moran B, Dunne PJ, Keane J, Mills KH. Alveolar Macrophages Contribute to Respiratory Tolerance by Inducing FoxP3 Expression in Naive T Cells. American journal of respiratory cell and molecular biology 2013;48(6):773-780. 62. Strickland DH, Thepen T, Kees UR, Kraal G, Holt PG. Regulation of T-cell function in lung tissue by pulmonary alveolar macrophages. Immunology 1993;80(2):266-272.
140
63. Holt PG, Oliver J, Bilyk N, McMenamin C, McMenamin PG, Kraal G, Thepen T. Downregulation of the antigen presenting cell function(s) of pulmonary dendritic cells in vivo by resident alveolar macrophages. The Journal of experimental medicine 1993;177(2):397-407. 64. Bilyk N, Holt PG. Inhibition of the immunosuppressive activity of resident pulmonary alveolar macrophages by granulocyte/macrophage colony-stimulating factor. The Journal of experimental medicine 1993;177(6):1773-1777. 65. Holmannova D, Kolackova M, Kondelkova K, Kunes P, Krejsek J, Andrys C. CD200/CD200R paired potent inhibitory molecules regulating immune and inflammatory responses; Part I: CD200/CD200R structure, activation, and function. Acta medica 2012;55(1):12-17. 66. Vaine CA, Soberman RJ. The CD200-CD200R1 Inhibitory Signaling Pathway: Immune Regulation and Host-Pathogen Interactions. Advances in immunology 2014;121:191-211. 67. Schutz F, Hackstein H. Identification of novel dendritic cell subset markers in human blood. Biochemical and biophysical research communications 2013. 68. Mukhopadhyay S, Pluddemann A, Hoe JC, Williams KJ, Varin A, Makepeace K, Aknin ML, Bowdish DM, Smale ST, Barclay AN, et al. Immune inhibitory ligand CD200 induction by TLRs and NLRs limits macrophage activation to protect the host from meningococcal septicemia. Cell host & microbe 2010;8(3):236-247. 69. Gorczynski RM. CD200:CD200R-Mediated Regulation of Immunity. ISRN Immunology 2012;2012:18. 70. Petermann KB, Rozenberg GI, Zedek D, Groben P, McKinnon K, Buehler C, Kim WY, Shields JM, Penland S, Bear JE, et al. CD200 is induced by ERK and is a potential therapeutic target in melanoma. The Journal of clinical investigation 2007;117(12):3922-3929. 71. Mihrshahi R, Barclay AN, Brown MH. Essential roles for Dok2 and RasGAP in CD200 receptor-mediated regulation of human myeloid cells. J Immunol 2009;183(8):4879-4886. 72. Zhang S, Cherwinski H, Sedgwick JD, Phillips JH. Molecular mechanisms of CD200 inhibition of mast cell activation. J Immunol 2004;173(11):6786-6793. 73. Pietila M, Lehtonen S, Tuovinen E, Lahteenmaki K, Laitinen S, Leskela HV, Natynki A, Pesala J, Nordstrom K, Lehenkari P. CD200 positive human mesenchymal stem cells suppress TNF-alpha secretion from CD200 receptor positive macrophage-like cells. PloS one 2012;7(2):e31671. 74. Jenmalm MC, Cherwinski H, Bowman EP, Phillips JH, Sedgwick JD. Regulation of myeloid cell function through the CD200 receptor. J Immunol 2006;176(1):191-199. 75. Hatherley D, Cherwinski HM, Moshref M, Barclay AN. Recombinant CD200 protein does not bind activating proteins closely related to CD200 receptor. J Immunol 2005;175(4):2469-2474. 76. Gorczynski R, Chen Z, Kai Y, Lee L, Wong S, Marsden PA. CD200 is a ligand for all members of the CD200R family of immunoregulatory molecules. J Immunol 2004;172(12):7744-7749. 77. Holmannova D, Kolackova M, Kondelkova K, Kunes P, Krejsek J, Ctirad A. CD200/CD200R paired potent inhibitory molecules regulating immune and
141
inflammatory responses; Part II: CD200/CD200R potential clinical applications. Acta medica 2012;55(2):59-65. 78. Simelyte E, Alzabin S, Boudakov I, Williams R. CD200R1 regulates the severity of arthritis but has minimal impact on the adaptive immune response. Clinical and experimental immunology 2010;162(1):163-168. 79. Rygiel TP, Rijkers ES, de Ruiter T, Stolte EH, van der Valk M, Rimmelzwaan GF, Boon L, van Loon AM, Coenjaerts FE, Hoek RM, et al. Lack of CD200 enhances pathological T cell responses during influenza infection. J Immunol 2009;183(3):1990-1996. 80. Aoki T, Matsumoto Y, Hirata K, Ochiai K, Okada M, Ichikawa K, Shibasaki M, Arinami T, Sumazaki R, Noguchi E. Expression profiling of genes related to asthma exacerbations. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2009;39(2):213-221. 81. Umetsu DT, Dekruyff RH. Immune dysregulation in asthma. Curr Opin Immunol 2006;18(6):727-732. 82. Lipscomb MF, Wilder JA. Immune dysregulation as a cause for allergic asthma. Curr Opin Pulm Med 1999;5(1):10-20. 83. ISAAC, TheUnion. The Global asthma report 2011. The International Union Agaisnt Tuberculosis and Lung Disease 2011(Paris, France). 84. Boulet LP, Dorval E, Labrecque M, Turgeon M, Montague T, Thivierge RL. Towards Excellence in Asthma Management: final report of an eight-year program aimed at reducing care gaps in asthma management in Quebec. Canadian respiratory journal : journal of the Canadian Thoracic Society 2008;15(6):302-310. 85. Braman SS. The global burden of asthma. Chest 2006;130(1 Suppl):4S-12S. 86. Masoli M, Fabian D, Holt S, Beasley R. The global burden of asthma: executive summary of the GINA Dissemination Committee report. Allergy 2004;59(5):469-478. 87. Bahadori K, Doyle-Waters MM, Marra C, Lynd L, Alasaly K, Swiston J, FitzGerald JM. Economic burden of asthma: a systematic review. BMC pulmonary medicine 2009;9:24. 88. Ismaila AS, Sayani AP, Marin M, Su Z. Clinical, economic, and humanistic burden of asthma in Canada: a systematic review. BMC pulmonary medicine 2013;13(1):70. 89. March ME, Sleiman PM, Hakonarson H. Genetic polymorphisms and associated susceptibility to asthma. International journal of general medicine 2013;6:253-265. 90. von Mutius E, Hartert T. Update in asthma 2012. American journal of respiratory and critical care medicine 2013;188(2):150-156. 91. Bosse Y, Hudson TJ. Toward a comprehensive set of asthma susceptibility genes. Annu Rev Med 2007;58:171-184. 92. Custovic A, Simpson A. What are we learning from genetic cohort studies? Paediatric respiratory reviews 2006;7 Suppl 1:S90-92. 93. von Mutius E. Gene-environment interactions in asthma. The Journal of allergy and clinical immunology 2009;123(1):3-11; quiz 12-13.
142
94. Holt PG, Sly PD. Non-atopic intrinsic asthma and the 'family tree' of chronic respiratory disease syndromes. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2009;39(6):807-811. 95. Gavala ML, Bashir H, Gern JE. Virus/allergen interactions in asthma. Curr Allergy Asthma Rep 2013;13(3):298-307. 96. Boulet LP, Becker A, Berube D, Beveridge R, Ernst P. Canadian Asthma Consensus Report, 1999. Canadian Asthma Consensus Group. CMAJ 1999;161(11 Suppl):S1-61. 97. O'Byrne PM. Global guidelines for asthma management: summary of the current status and future challenges. Polskie Archiwum Medycyny Wewnetrznej 2010;120(12):511-517. 98. Peters SP, Ferguson G, Deniz Y, Reisner C. Uncontrolled asthma: a review of the prevalence, disease burden and options for treatment. Respiratory medicine 2006;100(7):1139-1151. 99. van den Berge M, Arshad SH, Ind PW, Magnussen H, Hamelmann E, Kanniess F, Postma DS. Similar efficacy of ciclesonide versus prednisolone to treat asthma worsening after steroid tapering. Respiratory medicine 2009;103(8):1216-1223. 100. McIvor RA, Boulet LP, FitzGerald JM, Zimmerman S, Chapman KR. Asthma control in Canada: no improvement since we last looked in 1999. Can Fam Physician 2007;53(4):673-677, 672. 101. Moore WC, Meyers DA, Wenzel SE, Teague WG, Li H, Li X, D'Agostino R, Jr., Castro M, Curran-Everett D, Fitzpatrick AM, et al. Identification of asthma phenotypes using cluster analysis in the Severe Asthma Research Program. American journal of respiratory and critical care medicine 2010;181(4):315-323. 102. Wenzel SE. Asthma: defining of the persistent adult phenotypes. Lancet 2006;368(9537):804-813. 103. Holgate ST. Pathogenesis of asthma. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2008;38(6):872-897. 104. Wadsworth S, Sin D, Dorscheid D. Clinical update on the use of biomarkers of airway inflammation in the management of asthma. Journal of asthma and allergy 2011;4:77-86. 105. Vijverberg SJ, Hilvering B, Raaijmakers JA, Lammers JW, Maitland-van der Zee AH, Koenderman L. Clinical utility of asthma biomarkers: from bench to bedside. Biologics : targets & therapy 2013;7:199-210. 106. Szefler SJ, Wenzel S, Brown R, Erzurum SC, Fahy JV, Hamilton RG, Hunt JF, Kita H, Liu AH, Panettieri RA, Jr., et al. Asthma outcomes: biomarkers. The Journal of allergy and clinical immunology 2012;129(3 Suppl):S9-23. 107. Bousquet J, Jeffery PK, Busse WW, Johnson M, Vignola AM. Asthma. From bronchoconstriction to airways inflammation and remodeling. American journal of respiratory and critical care medicine 2000;161(5):1720-1745. 108. Global Initiative for Asthma (GINA). Global Strategy for Asthma Management and Prevention. 2008. 109. Wills-Karp M. Immunologic basis of antigen-induced airway hyperresponsiveness. Annu Rev Immunol 1999;17:255-281.
143
110. Naik SR, Wala SM. Inflammation, allergy and asthma, complex immune origin diseases: mechanisms and therapeutic agents. Recent patents on inflammation & allergy drug discovery 2013;7(1):62-95. 111. Smith H. Asthma, inflammation, eosinophils and bronchial hyperresponsiveness. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 1992;22(2):187-197. 112. van Rijt LS, Lambrecht BN. Dendritic cells in asthma: a function beyond sensitization. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2005;35(9):1125-1134. 113. Vermaelen KY, Carro-Muino I, Lambrecht BN, Pauwels RA. Specific migratory dendritic cells rapidly transport antigen from the airways to the thoracic lymph nodes. The Journal of experimental medicine 2001;193(1):51-60. 114. Charbonnier AS, Hammad H, Gosset P, Stewart GA, Alkan S, Tonnel AB, Pestel J. Der p 1-pulsed myeloid and plasmacytoid dendritic cells from house dust mite-sensitized allergic patients dysregulate the T cell response. Journal of leukocyte biology 2003;73(1):91-99. 115. Jahnsen FL, Strickland DH, Thomas JA, Tobagus IT, Napoli S, Zosky GR, Turner DJ, Sly PD, Stumbles PA, Holt PG. Accelerated antigen sampling and transport by airway mucosal dendritic cells following inhalation of a bacterial stimulus. J Immunol 2006;177(9):5861-5867. 116. Duez C, Gosset P, Tonnel AB. Dendritic cells and toll-like receptors in allergy and asthma. Eur J Dermatol 2006;16(1):12-16. 117. Murdoch JR, Lloyd CM. Chronic inflammation and asthma. Mutat Res 2010;690(1-2):24-39. 118. Pouliot P, Turmel V, Gelinas E, Laviolette M, Bissonnette EY. Interleukin-4 production by human alveolar macrophages. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2005;35(6):804-810. 119. Paul WE, Zhu J. How are T(H)2-type immune responses initiated and amplified? Nat Rev Immunol 2010;10(4):225-235. 120. Verstraelen S, Bloemen K, Nelissen I, Witters H, Schoeters G, Van Den Heuvel R. Cell types involved in allergic asthma and their use in in vitro models to assess respiratory sensitization. Toxicol In Vitro 2008;22(6):1419-1431. 121. Acharya M, Borland G, Edkins AL, Maclellan LM, Matheson J, Ozanne BW, Cushley W. CD23/FcepsilonRII: molecular multi-tasking. Clinical and experimental immunology 2010;162(1):12-23. 122. Kinet JP. The high-affinity IgE receptor (Fc epsilon RI): from physiology to pathology. Annu Rev Immunol 1999;17:931-972. 123. Cruse G, Cockerill S, Bradding P. IgE alone promotes human lung mast cell survival through the autocrine production of IL-6. BMC Immunol 2008;9:2. 124. Kalesnikoff J, Huber M, Lam V, Damen JE, Zhang J, Siraganian RP, Krystal G. Monomeric IgE stimulates signaling pathways in mast cells that lead to cytokine production and cell survival. Immunity 2001;14(6):801-811. 125. Lambrecht BN, Hammad H. Taking our breath away: dendritic cells in the pathogenesis of asthma. Nat Rev Immunol 2003;3(12):994-1003.
144
126. Bloemen K, Verstraelen S, Van Den Heuvel R, Witters H, Nelissen I, Schoeters G. The allergic cascade: review of the most important molecules in the asthmatic lung. Immunol Lett 2007;113(1):6-18. 127. Lewkowich IP, Lajoie S, Clark JR, Herman NS, Sproles AA, Wills-Karp M. Allergen uptake, activation, and IL-23 production by pulmonary myeloid DCs drives airway hyperresponsiveness in asthma-susceptible mice. PloS one 2008;3(12):e3879. 128. van Rijt LS, Jung S, Kleinjan A, Vos N, Willart M, Duez C, Hoogsteden HC, Lambrecht BN. In vivo depletion of lung CD11c+ dendritic cells during allergen challenge abrogates the characteristic features of asthma. The Journal of experimental medicine 2005;201(6):981-991. 129. Constant SL, Brogdon JL, Piggott DA, Herrick CA, Visintin I, Ruddle NH, Bottomly K. Resident lung antigen-presenting cells have the capacity to promote Th2 T cell differentiation in situ. The Journal of clinical investigation 2002;110(10):1441-1448. 130. Julia V, Hessel EM, Malherbe L, Glaichenhaus N, O'Garra A, Coffman RL. A restricted subset of dendritic cells captures airborne antigens and remains able to activate specific T cells long after antigen exposure. Immunity 2002;16(2):271-283. 131. Bratke K, Lommatzsch M, Julius P, Kuepper M, Kleine HD, Luttmann W, Christian Virchow J. Dendritic cell subsets in human bronchoalveolar lavage fluid after segmental allergen challenge. Thorax 2007;62(2):168-175. 132. Matsuda H, Suda T, Hashizume H, Yokomura K, Asada K, Suzuki K, Chida K, Nakamura H. Alteration of balance between myeloid dendritic cells and plasmacytoid dendritic cells in peripheral blood of patients with asthma. American journal of respiratory and critical care medicine 2002;166(8):1050-1054. 133. Venkayya R, Lam M, Willkom M, Grunig G, Corry DB, Erle DJ. The Th2 lymphocyte products IL-4 and IL-13 rapidly induce airway hyperresponsiveness through direct effects on resident airway cells. American journal of respiratory cell and molecular biology 2002;26(2):202-208. 134. Jin D, Zhang L, Zheng J, Zhao Y. The inflammatory Th 17 subset in immunity against self and non-self antigens. Autoimmunity 2008;41(2):154-162. 135. Bradley BL, Azzawi M, Jacobson M, Assoufi B, Collins JV, Irani AM, Schwartz LB, Durham SR, Jeffery PK, Kay AB. Eosinophils, T-lymphocytes, mast cells, neutrophils, and macrophages in bronchial biopsy specimens from atopic subjects with asthma: comparison with biopsy specimens from atopic subjects without asthma and normal control subjects and relationship to bronchial hyperresponsiveness. The Journal of allergy and clinical immunology 1991;88(4):661-674. 136. Wardlaw AJ, Dunnette S, Gleich GJ, Collins JV, Kay AB. Eosinophils and mast cells in bronchoalveolar lavage in subjects with mild asthma. Relationship to bronchial hyperreactivity. The American review of respiratory disease 1988;137(1):62-69. 137. Birrell MA, Battram CH, Woodman P, McCluskie K, Belvisi MG. Dissociation by steroids of eosinophilic inflammation from airway hyperresponsiveness in murine airways. Respiratory research 2003;4:3. 138. Careau E, Proulx LI, Pouliot P, Spahr A, Turmel V, Bissonnette EY. Antigen sensitization modulates alveolar macrophage functions in an asthma model.
145
American journal of physiology Lung cellular and molecular physiology 2006;290(5):L871-879. 139. Hamid Q, Tulic M. Immunobiology of asthma. Annu Rev Physiol 2009;71:489-507. 140. Kay AB. The role of eosinophils in the pathogenesis of asthma. Trends Mol Med 2005;11(4):148-152. 141. Lambrecht BN. Alveolar macrophage in the driver's seat. Immunity 2006;24(4):366-368. 142. Peters-Golden M. The alveolar macrophage: the forgotten cell in asthma. American journal of respiratory cell and molecular biology 2004;31(1):3-7. 143. Kim JY, Sohn JH, Choi JM, Lee JH, Hong CS, Lee JS, Park JW. Alveolar Macrophages Play a Key Role in Cockroach-Induced Allergic Inflammation via TNF-alpha Pathway. PloS one 2012;7(10):e47971. 144. Byers DE, Holtzman MJ. Alternatively activated macrophages and airway disease. Chest 2011;140(3):768-774. 145. Naessens T, Vander Beken S, Bogaert P, Van Rooijen N, Lienenklaus S, Weiss S, De Koker S, Grooten J. Innate imprinting of murine resident alveolar macrophages by allergic bronchial inflammation causes a switch from hypoinflammatory to hyperinflammatory reactivity. The American journal of pathology 2012;181(1):174-184. 146. Yang M, Kumar RK, Foster PS. Interferon-γ and pulmonary macrophages contribute to the mechanisms underlying prolonged airway hyperresponsiveness. Clinical & Experimental Allergy 2010;40(1):163-173. 147. Thepen T, Kraal G, Holt PG. The role of alveolar macrophages in regulation of lung inflammation. Annals of the New York Academy of Sciences 1994;725:200-206. 148. Thepen T, Van Rooijen N, Kraal G. Alveolar macrophage elimination in vivo is associated with an increase in pulmonary immune response in mice. The Journal of experimental medicine 1989;170(2):499-509. 149. Tang C, Inman MD, van Rooijen N, Yang P, Shen H, Matsumoto K, O'Byrne PM. Th type 1-stimulating activity of lung macrophages inhibits Th2-mediated allergic airway inflammation by an IFN-gamma-dependent mechanism. J Immunol 2001;166(3):1471-1481. 150. Kurowska-Stolarska M, Stolarski B, Kewin P, Murphy G, Corrigan CJ, Ying S, Pitman N, Mirchandani A, Rana B, van Rooijen N, et al. IL-33 amplifies the polarization of alternatively activated macrophages that contribute to airway inflammation. J Immunol 2009;183(10):6469-6477. 151. Pouliot P, Spahr A, Careau E, Turmel V, Bissonnette EY. Alveolar macrophages from allergic lungs are not committed to a pro-allergic response and can reduce airway hyperresponsiveness following ex vivo culture. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2008;38(3):529-538. 152. Zosky GR, Sly PD. Animal models of asthma. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2007;37(7):973-988. 153. Shin YS, Takeda K, Gelfand EW. Understanding asthma using animal models. Allergy, asthma & immunology research 2009;1(1):10-18.
146
154. Mullane K, Williams M. Animal models of asthma: Reprise or reboot? Biochemical pharmacology 2013. 155. Laberge S, Rossi P, Yang XX, Martin JG. Antigen-induced airway inflammation and hyper-responsiveness does not enhance airway responses to a subsequent antigen challenge in rats. Respiratory medicine 2000;94(1):44-50. 156. Martin JG, Tamaoka M. Rat models of asthma and chronic obstructive lung disease. Pulmonary pharmacology & therapeutics 2006;19(6):377-385. 157. Sapienza S, Du T, Eidelman DH, Wang NS, Martin JG. Structural changes in the airways of sensitized brown Norway rats after antigen challenge. The American review of respiratory disease 1991;144(2):423-427. 158. Strickland DH, Stumbles PA, Zosky GR, Subrata LS, Thomas JA, Turner DJ, Sly PD, Holt PG. Reversal of airway hyperresponsiveness by induction of airway mucosal CD4+CD25+ regulatory T cells. The Journal of experimental medicine 2006;203(12):2649-2660. 159. Thepen T, McMenamin C, Oliver J, Kraal G, Holt PG. Regulation of immune response to inhaled antigen by alveolar macrophages: differential effects of in vivo alveolar macrophage elimination on the induction of tolerance vs. immunity. European journal of immunology 1991;21(11):2845-2850. 160. Plantinga M, Guilliams M, Vanheerswynghels M, Deswarte K, Branco-Madeira F, Toussaint W, Vanhoutte L, Neyt K, Killeen N, Malissen B, et al. Conventional and Monocyte-Derived CD11b(+) Dendritic Cells Initiate and Maintain T Helper 2 Cell-Mediated Immunity to House Dust Mite Allergen. Immunity 2013;38(2):322-335. 161. Strickland DH, Thomas JA, Mok D, Blank F, McKenna KL, Larcombe AN, Sly PD, Holt PG. Defective aeroallergen surveillance by airway mucosal dendritic cells as a determinant of risk for persistent airways hyper-responsiveness in experimental asthma. Mucosal immunology 2012;5(3):332-341. 162. Fattouh R, Al-Garawi A, Fattouh M, Arias K, Walker TD, Goncharova S, Coyle AJ, Humbles AA, Jordana M. Eosinophils are dispensable for allergic remodeling and immunity in a model of house dust mite-induced airway disease. American journal of respiratory and critical care medicine 2011;183(2):179-188. 163. Mattoli S, Stacey MA, Sun G, Bellini A, Marini M. Eotaxin expression and eosinophilic inflammation in asthma. Biochemical and biophysical research communications 1997;236(2):299-301. 164. Ying S, Robinson DS, Meng Q, Rottman J, Kennedy R, Ringler DJ, Mackay CR, Daugherty BL, Springer MS, Durham SR, et al. Enhanced expression of eotaxin and CCR3 mRNA and protein in atopic asthma. Association with airway hyperresponsiveness and predominant co-localization of eotaxin mRNA to bronchial epithelial and endothelial cells. European journal of immunology 1997;27(12):3507-3516. 165. Lloyd C. Chemokines in allergic lung inflammation. Immunology 2002;105(2):144-154. 166. Bedoret D, Wallemacq H, Marichal T, Desmet C, Quesada Calvo F, Henry E, Closset R, Dewals B, Thielen C, Gustin P, et al. Lung interstitial macrophages alter dendritic cell functions to prevent airway allergy in mice. The Journal of clinical investigation 2009;119(12):3723-3738.
147
167. Stampfli MR, Wiley RE, Neigh GS, Gajewska BU, Lei XF, Snider DP, Xing Z, Jordana M. GM-CSF transgene expression in the airway allows aerosolized ovalbumin to induce allergic sensitization in mice. The Journal of clinical investigation 1998;102(9):1704-1714. 168. Carralot JP, Kim TK, Lenseigne B, Boese AS, Sommer P, Genovesio A, Brodin P. Automated high-throughput siRNA transfection in raw 264.7 macrophages: a case study for optimization procedure. Journal of biomolecular screening 2009;14(2):151-160. 169. Rozema DB, Lewis DL. siRNA delivery technologies for mammalian systems. TARGETS 2003;2(6):253-260.