-
1
1 Title : Legacy of draught cattle breeds of South India:
Insights into population
2 structure, genetic admixture and maternal origin
3
4 Authors : Vandana Manomohan1,2, Ramasamy Saravanan 2, Rudolf
Pichler1, Nagarajan
5 Murali2, Karuppusamy Sivakumar2, Krovvidi Sudhakar3, Raja
K
6 Nachiappan4 and Kathiravan Periasamy1,5*
78 Affiliations : 1Animal Production and Health Section, Joint
FAO/IAEA Division of
9 Nuclear Techniques in Food and Agriculture, International
Atomic Energy
10 Agency, Vienna, Austria
11 2Veterinary College and Research Institute, Namakkal, Tamil
Nadu
12 Veterinary and Animal Sciences University, Chennai,
India;
13 3NTR College of Veterinary Science, Gannavaram, Sri
Venkateswara
14 Veterinary University, Tirupati, Andhra Pradesh, India;
15 4National Bureau of Animal Genetic Resources, Karnal,
Haryana, India;
16 5Animal Genetics Resources Branch, Animal Production and
Health
17 Division, Food and Agriculture Organization of the United
Nations, Rome,
18 Italy.
19
20 Corresponding: Kathiravan Periasamy21 author22
23
24 Address : Animal Production and Health Laboratory, Joint
FAO/IAEA Division of
25 Nuclear Techniques in Food and Agriculture, International
Atomic Energy
26 Agency, Seibersdorf, Vienna, Austria
27
28
29 Email : [email protected];
[email protected]
30
31
32 Telephone : 00431260027328
33
34
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
2
35 Legacy of draught cattle breeds of South India: Insights into
population structure,
36 genetic admixture and maternal origin
37
38 Vandana Manomohan1,2, Ramasamy Saravanan2, Rudolf Pichler1,
Nagarajan Murali2,
39 Karuppusamy Sivakumar2, Krovvidi Sudhakar3, Raja K
Nachiappan4
40 and Kathiravan Periasamy1,5*
41 1Animal Production and Health Section, Joint FAO/IAEA
Division, International Atomic
42 Energy Agency, Vienna, Austria; 2Veterinary College and
Research Institute, Namakkal,
43 Tamil Nadu Veterinary and Animal Sciences University,
Chennai, India; 3NTR College of
44 Veterinary Science, Gannavaram, Sri Venkateswara Veterinary
University, Tirupati, Andhra
45 Pradesh, India; 4National Bureau of Animal Genetic Resources,
Karnal, Haryana, India;
46 5Animal Genetics Resources Branch, Animal Production and
Health Division, Food and
47 Agriculture Organization of the United Nations, Rome,
Italy.
48 *Corresponding author email: [email protected];
[email protected] 49
50
51 ABSTRACT
52 The present study is the first comprehensive report on
diversity, population structure, genetic
53 admixture and mitochondrial DNA variation in South Indian
draught type zebu cattle. The
54 diversity of South Indian cattle was moderately higher. A
significantly strong negative
55 correlation coefficient of -0.674 (P6.25%) was observed in
Punganur, Vechur, Umblachery and Pulikulam cattle breeds. Two
63 major maternal haplogroups, I1 and I2, typical of zebu cattle
were observed, with the former
64 being predominant than the later. The pairwise differences
among the I2 haplotypes of South
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
3
65 Indian cattle were relatively higher than West Indian (Indus
valley site) zebu cattle. The results
66 indicated the need for additional sampling and comprehensive
analysis of mtDNA control
67 region variations to unravel the probable location of origin
and domestication of I2 zebu
68 lineage. The present study also revealed major concerns on
South Indian zebu cattle (i) risk of
69 endangerment due to small effective population size and high
rate of inbreeding (ii) lack of
70 sufficient purebred zebu bulls for breeding and (iii)
increasing level of taurine admixture in
71 zebu cattle. Availability of purebred semen for artificial
insemination, incorporation of
72 genomic/molecular information to identify purebred animals
and increased awareness among
73 farmers will help to maintain breed purity, conserve and
improve these important draught cattle
74 germplasms of South India.
75
76 Key words: Zebu, diversity, inbreeding, genetic relationship,
taurine introgression,
77 haplogroup, mismatch distribution, domestication
78
79 1. INTRODUCTION
80 Ever since domestication, animals have been used as an
important source of draught power for
81 agricultural production. Among them, cattle have been used
for a variety of farm operations
82 like ploughing, carting, tilling, sowing, weeding, water
lifting, threshing, oil extraction,
83 sugarcane crushing and transport. Over time, with increasing
mechanization of agriculture, the
84 use of draught cattle in farm operations reduced
significantly and became negligible in
85 advanced economies. However, in developing countries,
particularly in small holder
86 production systems and in hilly and mountainous regions,
agricultural production still relies on
87 draught animal power (Zhou et al. 2018). For example, 55% of
the smallholder farmers in
88 Swaziland rely on draft animal power for land cultivation,
and more than 88% of draft animals
89 found on the Swazi National Land are cattle (Kienzle et al.
2013). In India, the significance of
90 draught animal power has reduced greatly in the last few
decades with its share in total farm
91 power availability declining from about 78% in 1960-61 to 7%
in 2013-2014 (Singh et al. 2014)
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
4
92 and expected to further reduce to around 5% by 2020
(Natarajan et al. 2016). Over the years,
93 the annual use of draught animals declined from about
1200-1800 hours to 300-500 hours per
94 pair per year. Consequently, the population of draught cattle
steadily decreased at a negative
95 annual compound growth rate of about -0.8%, resulting in
significant decline of purebred native
96 breeds.
97 India is home to the largest cattle population (13.1 % of
world’s cattle population) in the world
98 which constitutes 37.3 % of its total livestock. As per the
19th livestock census, India has 190.9
99 million cattle, out of which 151 million is indigenous
cattle. The diversity of Indian cattle is
100 represented by 60 local breeds, eight regional transboundary
breeds and seven international
101 transboundary breeds (FAO, 2015). Of these, 41 have been
registered by National Bureau of
102 Animal Genetic Resources, the nodal agency for the
registration of livestock breeds in India.
103 The Indian Zebu cattle (Bos indicus) breeds have been
classified into three major groups: dairy
104 type, draught type and dual-purpose cattle. The dairy type
and dual-purpose cattle breeds are
105 predominantly distributed in North and North-Western India,
while most indigenous draught
106 type cattle breeds are located in Southern and Eastern
India. Apart from rapid mechanization
107 of agriculture in South India, the increasing cost of
maintaining draught type cattle forced the
108 farmers to replace these animals with crossbred cattle that
fetched better returns from the sale
109 of milk to dairy cooperatives. During late 1980s and early
1990s, the draught cattle breeds
110 started losing their economic relevance and the farmers
increasingly resorted to crossbreeding
111 with commercial taurine cattle like Jersey,
Holstein-Friesian and Brown Swiss. Such crossbred
112 cows approximately yielded more than double the milk as that
of indigenous draught breeds.
113 Combined with farmers’ preference for crossbreds, the
relatively easy access to breeding
114 services (through state animal husbandry departments, state
cooperatives and private
115 inseminators, etc.) and availability of better
infrastructure for artificial insemination and
116 veterinary care, the proportion of crossbred cattle among
the breedable females became much
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
5
117 higher in South Indian states than rest of India. The
crossbred cattle constitute 35.9% of total
118 cattle in Andhra Pradesh, 41.9% in Karnataka, 76.1% in Tamil
Nadu and 94.6% in Kerala as
119 against the national average of 27.7%. This resulted in
significant genetic dilution of draught
120 cattle breeds of South India with varying levels of
zebu-taurine admixture.
121 Indiscriminate crossbreeding, lack of stabilization of
exotic inheritance and absence of
122 selection among F2 hybrids led to negative impacts like
increased disease susceptibility,
123 decreased fertility and drop in production levels among
crossbred cattle. During the last two
124 decades, there has been a renewed interest in the
conservation of purebred indigenous draught
125 cattle breeds and implementation of selective breeding
programs targeting a range of traits.
126 Selective breeding schemes among certain purebred native
breeds like Kangayam, Ongole,
127 Deoni and Hallikar were put in place by making available the
purebred frozen semen for
128 artificial insemination. Such programs have been constrained
by the availability of superior
129 genetic merit bulls and unavailability of sufficient of
number of true to the type, purebred bulls.
130 With the absence of pedigree records, the level of taurine
inheritance in most purebred draught
131 cattle populations is not clearly understood. Further,
information on genetic differentiation,
132 population structure and maternal inheritance among South
Indian cattle breeds is scanty.
133 Hence, the present study was undertaken with the following
objectives: (i) assess biodiversity
134 and population structure among purebred South Indian draught
cattle breeds (ii) estimate level
135 of genetic admixture among purebred zebu cattle and (iii)
identify mitochondrial DNA based
136 maternal lineages and evaluate phylogeography of South
Indian cattle.
137
138 2. MATERIALS AND METHODS
139 2.1. Animal ethics statement
140 Blood samples were collected by jugular venipuncture into
EDTA vacutainer tubes from
141 various purebred zebu, commercial taurine and crossbred
cattle. Blood sampling was
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
6
142 performed by local veterinarians in the respective native
breed tracts following the standard
143 good animal practice. The consent was obtained from animal
owners for the usage of the
144 samples in this study. Therefore, no further license from
the “Institutional Committee for Care
145 and Use of Experimental Animals” of the Tamil Nadu
Veterinary and Animal Sciences
146 University, Chennai, India and the Joint FAO/IAEA Division,
International Atomic Energy
147 Agency, Vienna, Austria was required.
148 2.2. Sample collection
149 A total of 529 blood samples were collected from cattle
representing 14 breeds/populations
150 that are located in South/Peninsular Indian states: Ongole
(n=51) and Punganur (n=18) from
151 Andhra Pradesh; Hallikar (n=36) and Deoni (n=53) from
Karnataka; Vechur (n=26) from
152 Kerala; Alambadi (n=29), Bargur (n=52), Kangayam (n=51),
Pulikulam (n=34), Umblachery
153 (n=33), Holstein-Friesian (n=15), Jersey (n=34),
Holstein-Friesian crossbred (n=39) and Jersey
154 crossbred (n=58) from Tamil Nadu. A stratified random
sampling procedure was followed to
155 collect blood from unrelated cattle with typical phenotypic
features and located in randomly
156 selected villages of the native breed tract. With the
absence of pedigree records in most
157 instances, unrelatedness was ensured by interviewing the
farmers about the breeding history.
158 Genomic DNA was extracted by standard phenol chloroform
method (Sambrook and Russell,
159 2001). The DNA samples were subjected to quality control
using Nanodrop spectrophotometer
160 and stored at −20ºC until further processing.
161 2.3. Microsatellite genotyping
162 All the DNA samples were subjected to PCR amplification
using 27 FAO recommended
163 microsatellite markers (FAO, 2011; Supplementary Table ST1).
The forward primers
164 conjugated to one of the three fluorescent dyes (FAM, HEX
and ATTO550) were used for
165 genotyping these marker loci. Polymerase chain reaction was
performed under following
166 conditions: initial denaturation for 5 min at 950C, followed
by 35 cycles of denaturation for 30s
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
7
167 at 950C, 1 minute at specific annealing temperatures of
marker locus, elongation at 720C for 1
168 min with the final extension at 720C for 10 min. The PCR
products were then electrophoresed
169 after multiplexing in an automated DNA analyzer ABI3100
(Applied Biosystems, USA) with
170 ROX500 (Applied Biosystems, USA) as internal lane control.
All the 27 STR loci were
171 multiplexed in six sets for genotyping as shown in
Supplementary Table ST1. Determination
172 of allele size and extraction of genotype data was performed
using GENEMAPPER software.
173 2.4. Sequencing mitochondrial DNA control region
174 Primers were custom designed and synthesized to amplify 1207
bp bovine mitochondrial DNA
175 control region using Primer 3 version 4.0
(http://bioinfo.ut.ee/primer3-0.4.0/). The amplified
176 mtDNA control region included nucleotide positions 15167 to
30 of the complete bovine
177 mitochondrial genome sequence available at NCBI GenBank
accession number AF492350
178 (Hiendleder et al. 2008). The location and sequence of
forward and reverse primers are as
179 follows: BTMTD1-F (Positions 15167-15186; 5’
AGGACAACCAGTCGAACACC 3’) and
180 BTMTD1-R 5’ (Positions 11-30; GTGCCTTGCTTTGGGTTAAG 3’). The
amplicon included
181 complete D-loop (control region) flanked by partial
cytochrome B, complete t-RNA-Thr and
182 complete t-RNA-Pro coding sequences at 5’ end while partial
t-RNA-Phe sequence flanked the
183 3’end. Polymerase chain reaction was performed in a total
reaction volume of 40µl with the
184 following cycling conditions: initial denaturation at 95°C
for 15 min followed by 30 cycles of
185 95°C for 1 min; 58°C for 1 min; 72°C for 1 min with final
extension at 72°C for 10 min.
186 Purified PCR products were sequenced using Big Dye
Terminator Cycle Sequencing Kit
187 (Applied Biosystems, U.S.A) on an automated Genetic Analyzer
ABI 3100 (Applied
188 Biosystems, U.S.A).
189 2.5. Statistical analysis
190 The presence of null alleles in the dataset was checked
using Microchecker version 2.2.3
191 (Oosterhout et al. 2004). The neutrality of microsatellite
markers used in the present study was
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
8
192 evaluated by FST outlier approach as implemented in LOSITAN
version 1 for windows (Antao
193 et al. 2008). Basic diversity indices (allelic diversity and
heterozygosity) and genetic distances
194 (pairwise Nei’s genetic distance and pairwise
inter-individual allele sharing distance) among
195 South Indian cattle were estimated using MICROSATELLITE
ANALYZER (MSA) version
196 4.05 (Dieringer and Schlotterer, 2003). A UPGMA tree was
constructed based on pairwise
197 Nei’s genetic distances using PHYLIP version 3.5
(Felsenstein, 1993). F statistics for each
198 locus (Weir and Cockerman, 1984) was calculated and tested
using the program FSTAT
199 version 2.9.3.2. The exact tests for Hardy-Weinberg
Equilibrium to evaluate both
200 heterozygosity deficit and excess at each marker locus in
each population (HWE) were
201 performed using GENEPOP software. Analysis of molecular
variance (AMOVA) was
202 performed using ARLEQUIN version 3.1 (Excoffier et al.
2005). Multidimensional scaling
203 display of pairwise FST was conducted using SPSS version
13.0. Bayesian clustering analysis
204 was performed to evaluate population structure and genetic
admixture among South Indian
205 cattle using STRUCTURE 2.3.4 (Pritchard et al. 2000). The
program was run with the
206 assumption of K=2 to K=15 with at least 20 runs for each K.
The number of burn in periods
207 and MCMC repeats used for these runs were 200000 and 200000
respectively. The procedure
208 of Evanno et al. (2005) was used to estimate the second
order rate of change in LnP(D) and
209 identify the optimal K.
210 Mitochondrial DNA sequence editing, assembly of contigs and
multiple sequence alignments
211 were performed using Codon Code Aligner version 3.7.1.
Mitochondrial DNA diversity
212 parameters including nucleotide diversity, haplotype
diversity, parsimony informative sites and
213 average number of nucleotide differences were calculated
using DnaSP, version 4.10 (Rozas,
214 2009). Frequency of different haplotypes, haplotype sharing
and pairwise FST were estimated
215 using ARLEQUIN 2.1. MEGA version 6.0 (Tamura et al. 2011)
was utilized to identify optimal
216 DNA substitution model and construct maximum-likelihood
phylogeny. HKY+I+G was
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
9
217 identified as the optimal model for the current sequence
dataset based on Akaike information
218 criterion (AIC). The following sequences were used as
references for different maternal
219 lineages reported in zebu and taurine cattle: I1 (AB085923,
AB268563, AB268579,
220 EF417970, EF417971 and L27733), I2 (AB085921, AB268559,
AB268570, AB268573,
221 AB268581 and AY378133), T1 (DQ124399, EU177841 and
EU177842), T2 (DQ124383,
222 DQ124393, EU177849 and EU177851), T3 (EU177815, EU177816,
EU177838 and
223 EU177839), T4 (DQ124372, DQ124375, DQ124377 and DQ124392),
and T5 (EU177862,
224 EU177863, EU177864 and EU177865). Additionally, 298 mtDNA
control region sequences
225 deposited to GenBank from Bhutan (n=121), Nepal (n=14),
China (n=47), North India (n=53),
226 West India (n=45) and Vietnam (n=18) were utilized for
comparative analysis. The accession
227 number and details of GenBank sequences used in the study
are provided in Supplementary
228 Table ST2. Pairwise FST derived from mtDNA haplotype
frequency were utilized to perform
229 principal components analysis using SPSS version 13.0.
Mismatch distribution and the tests
230 for demographic expansion were performed using ARLEQUIN 3.1.
Three parameters viz. tau,
231 theta 0 and theta 1 were estimated under the sudden
expansion model and the tests for goodness
232 of fit were performed based on sum of square deviations
(SSD) between the observed and
233 expected mismatch and Harpending’s raggedness index. The
South Indian cattle breeds were
234 subjected to tests for selective neutrality through
estimation of Tajima’s D and Fu’s FS. Median
235 Joining (MJ) network of South Indian cattle haplotypes was
reconstructed using NETWORK
236 4.5.1.2 (Bandelt et al. 1999).
237
238 3. RESULTS
239 3.1. Basic diversity measures and Hardy-Weinberg
equilibrium
240 In the present study, a total of 13932 genotypes were
generated across 27 microsatellite loci in
241 516 cattle belonging to 10 draught type zebu breeds, 2
commercial taurine breeds and 2
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
10
242 crossbred populations. The mean basic diversity indices of
different South Indian cattle breeds
243 are presented in Table 1. Allelic diversity in terms of mean
observed number of alleles varied
244 from 5.93 (Punganur) to 8.07 (Pulikulam) across different
zebu cattle breeds, while it was 4.7
245 and 5.81 in the commercial taurine breeds, Jersey and
Holstein-Friesian respectively. The
246 observed heterozygosity ranged from 0.598 (Kangayam) to
0.671 (Alambadi and Punganur)
247 while the expected heterozygosity varied between 0.637
(Kangayam) and 0.727 (Punganur)
248 among the South Indian zebu cattle. Similarly, allelic
richness was lowest in Kangayam and
249 highest in Pulikulam cattle. Assessment of within breed
diversity based on inter-individual
250 allele sharing distance revealed Kangayam with the lowest
mean distance among individuals
251 (0.568) while Pulikulam cattle showed the highest mean
distance (0.647). The allelic diversity
252 observed among South Indian zebu cattle was relatively low
as compared to that of West-
253 Central Indian (Shah et al. 2012), North Indian (Sharma et
al. 2015) and East Indian (Sharma
254 et al. 2013) cattle. The primary domestication centre of
zebu (Bos indicus) cattle in North-
255 Western part of India near Indus valley could explain the
higher diversity of North Indian cattle
256 compared to that of South Indian breeds. Despite the
relatively low allelic diversity, the
257 observed and expected heterozygosity of South Indian cattle
were moderately higher (>60%)
258 and comparable to that of West-Central, North and East
Indian cattle (Shah et al. 2012; Sharma
259 et al. 2013, 2015). As expected, the crossbred cattle
(Jersey crossbreds and Holstein-Friesian
260 crossbreds) exhibited a higher level of allelic diversity
and heterozygosity than indigenous zebu
261 cattle.
262 The mean estimated FIS values were positive in all the zebu
cattle breeds and ranged between
263 0.027 (Hallikar) and 0.108 (Pulikulam). Breeds like
Umblachery, Vechur, Ongole and Bargur
264 showed mean FIS greater than 7% indicating significant
heterozygosity deficit, possibly due to
265 close breeding and potential inbreeding. The mean FIS
estimates observed in most South Indian
266 cattle breeds were higher than those reported for East
Indian (Sharma et al. 2013) and most
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
11
267 North Indian cattle with the exception of Mewati and Gaolao
(Sharma et al. 2015). However,
268 the mean FIS estimates reported for West-Central Indian
cattle were much higher than that of
269 South Indian cattle (Shah et al. 2012). Similarly, the mean
FIS for Vechur and Ongole cattle
270 observed in the present study was significantly lower than
reported previously by Radhika et
271 al. (2018) and Sharma et al. (2015) respectively. The test
for Hardy-Weinberg equilibrium
272 (HWE) was conducted on a total of 378 breed X locus
combinations. Among the 270 breed X
273 locus combinations tested for zebu cattle, about 62 (22.96%)
deviated significantly (P
-
12
292 significant outliers with high FST values, indicating
positive selection in force (Supplementary
293 Figure SF1). Of these, HEL5 exhibited significant
heterozygosity deficit and consequent
294 deviation from HWE in 12 out of 14 studied populations. Both
the loci have been reported to
295 be associated with production and/or reproduction traits in
cattle (de Oliveira et al. 2005; Li et
296 al. 2010; Vanessa et al. 2018). Specifically, the homozygous
long alleles at HEL5 (allele size
297 159-169) were significantly associated (p=0.022) with long
calving interval in Brangus-Ibage
298 cattle, a composite breed with taurine and zebu ancestry (de
Oliveira et al. 2005). In the present
299 study, significant difference in the frequency of long
(allele size 160-180) and short alleles
300 (allele size 148-158) was observed among the zebu, taurine
and crossbred cattle, resulting in
301 higher estimation of FST. Selective processes affect neutral
loci when the latter is in linkage
302 disequilibrium with other loci subjected to selection.
Considering the possibility of selective
303 forces operating at the two FST outlier loci, HEL5 and HEL13
were removed from subsequent
304 analysis of genetic relationship, admixture and population
structure of South Indian cattle.
305 3.2. Genetic differentiation and phylogeny
306 The global F statistics among the South Indian cattle breeds
are presented in Supplementary
307 Table ST3. The overall global FIT, FST and FIS among zebu,
taurine and crossbred cattle was
308 0.143, 0.101 and 0.047 respectively, while those estimates
among zebu cattle alone were 0.109,
309 0.057 and 0.056 respectively. The results indicated 10.1% of
the total genetic variation among
310 all the studied cattle were due to between breed differences
and it reduced to 5.7% when only
311 zebu cattle breeds were considered. The global FST among all
cattle breeds/populations ranged
312 from 0.052 (INRA005) to 0.223 (ETH152), whereas among zebu
cattle breeds, it varied
313 between 0.024 (INRA005) and 0.114 (HAUT24). Among the
investigated loci, ETH152
314 provided relatively more information on zebu-taurine divide
while HAUT24 provided
315 significant information on differences among zebu cattle
breeds. The global FST among South
316 Indian zebu cattle observed in the present study was
comparable to that of East Indian zebu
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
13
317 (Sharma et al. 2013) cattle. However, much higher genetic
differentiation had been reported
318 among West-Central (Shah et al. 2012) and North Indian
(Sharma et al. 2015) cattle breeds.
319 The pairwise FST and Nei’s genetic distance among the
draught type zebu, taurine and crossbred
320 cattle are presented in Table 2. The pairwise FST ranged
from 0.0234 (Hallikar-Alambadi) to
321 0.107 (Kangayam-Punganur) among the South Indian zebu cattle
breeds. Alambadi cattle was
322 observed to be genetically less differentiated from Hallikar
(FST=0.0234), Pulikulam
323 (FST=0.0237) and Bargur (FST=0.0259) while Kangayam cattle
showed highest differentiation
324 from Punganur (FST=0.107), Vechur (FST=0.1034) and Hallikar
(FST=0.0933). Interestingly,
325 significantly high genetic differentiation (FST=0.0919) was
observed among the two
326 dwarf/miniature type Vechur and Punganur cattle. Similar
findings were observed with respect
327 to the estimates of pairwise Nei’s genetic distance among
the South Indian zebu cattle breeds.
328 The radial tree and dendrogram constructed following UPGMA
algorithm based on pairwise
329 Nei’s genetic distance is presented in Figure 1. Broadly,
the taurine, zebu and their crossbred
330 cattle clustered separately as expected. Among the zebu
cattle, a major cluster was formed by
331 Alambadi, Bargur, Umblachery, Pulikulam, Deoni, Ongole and
Hallikar, within which three
332 sub-clusters were observed. Alambadi and Bargur formed the
first sub-cluster, Umblachery
333 and Pulikulam formed the second sub-cluster while Deoni,
Ongole and Hallikar formed the
334 third sub-cluster. Kangayam, Vechur and Punganur cattle
breeds did not form part of any of
335 these three clusters and were distinct among themselves.
336 3.3. Genetic relationship and population structure
337 Understanding genetic relationship and detecting the cryptic
genetic structure is an important
338 first step to elucidate the demography and ancestral history
of cattle populations. The
339 multidimensional scaling (MDS) analysis were used to
investigate the relationship among the
340 studied cattle breeds. Multidimensional scaling (MDS) is an
ordination technique used to
341 display information contained in a distance matrix and to
visualize relationship among
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
14
342 variables within a dataset. This method helps to reduce the
dimension of data and to detect
343 structure among populations in a typical genetic diversity
study. The MDS plots derived from
344 pairwise FST values are presented in Figure 2. The observed
s-stress value was 0.01202 when
345 all the breeds/populations were considered while it was
0.08001 when the zebu cattle alone
346 were considered. The MDS plots showed a pattern of
clustering similar to that of phylogeny.
347 The taurine and crossbreds clustered separately, while
Kangayam, Vechur and Punganur cattle
348 were distinct from rest of the zebu cattle breeds.
349 Bayesian clustering of individuals without prior population
information was performed to
350 assess the cryptic genetic structure in the studied cattle
breeds. Among K=2 to 15, the dataset
351 was best described with K=2 genetic clusters at which the
second order rate of change in
352 LnP(D) was maximum (Supplementary Figure SF2). At K=2, the
clustering of individuals
353 followed the zebu-taurine divide (Figure 3). When K=3 was
assumed, Zebu cattle breeds got
354 clustered based on Hallikar or Kangayam ancestry. Both
Hallikar and Kangayam cattle were
355 assigned to their respective clusters with >90%
proportion of membership coefficient. Deoni
356 (80%) and Ongole (69.2%) were predominantly assigned to
Kangayam ancestral cluster while
357 Vechur (86.4%), Punganur (78.7%), Bargur (75.7%) and
Alambadi (72.8%) cattle were
358 predominantly assigned to Hallikar cluster. Pulikulam and
Umblachery cattle showed
359 admixture from both the ancestry. When K=4 was assumed,
Deoni and Ongole clustered
360 together independent of Kangayam ancestry while at K=5,
Ongole clustered distinctly from
361 that of Deoni. At K=6, Deoni and Bargur formed a separate
cluster each, while Punganur and
362 Vechur clustered together. At K=7, the miniature breeds,
Pungaur and Vechur cattle clustered
363 distinctly. Significant genetic admixture of zebu ancestry
was observed among Alambadi,
364 Pulikulam and Umblachery cattle consistently under the
assumption of K=5 to 8.
365 To further understand the degree of phylogeographic
structure in the studied cattle breeds,
366 analysis of molecular variance (AMOVA) was performed to
assess the distribution of
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
15
367 microsatellite variation as a function of both breed
membership and geographic origin (Table
368 3). When no grouping was assumed, 94.56% of the total
variance among zebu cattle was found
369 within breeds while 5.44% of total variance was explained by
between breed differences. When
370 the breeds were grouped according to their province of
origin (Grouping I – based on
371 state/province), about 0.32% of total variance was due to
differences among groups (P>0.05)
372 while 5.21% was due to differences among populations within
groups. When the grouping was
373 done based on the classification of zebu cattle by Joshi and
Phillips (1953) (Grouping II),
374 among group variance was negligible (0.28%; P>0.05),
while most of the between population
375 variance was within groups (5.26%; P0.05) while variance
among populations within groups was 4.41%. When the grouping
was
378 based on Bayesian genetic structure (Grouping IV;
Group1-DEO; Group2-ONG; Group3-
379 BAR, ALA, HAL, PUL, UMB; Group4-VEC; Group5-PNR;
Group6-KAN), among group
380 variance was 2.78% and significant (P
-
16
392 informative sites. The overall nucleotide diversity and
average number of nucleotide
393 differences among South Indian cattle was 0.0111and 10.36
respectively. A total of 207 unique
394 haplotypes were observed with overall haplotype diversity of
0.961 (Table 4). The haplotype
395 diversity observed in most South Indian cattle breeds was
relatively higher than that of North
396 Indian zebu cattle located along the Gangetic plains (Sharma
et al. 2015). Two major maternal
397 haplogroups, I1 and I2, typical of zebu cattle were
observed, with the former being predominant
398 occurring 313 times and the later occurring 166 times.
However, there were differences in
399 certain breeds like Vechur and Umblachery in which I2
haplogroup was more frequent than I1.
400 Interestingly, six zebu cattle showed taurine lineage, of
which one belonged to T1 (Deoni),
401 three belonged to T2 (one each from Hallikar, Bargur and
Kangayam) and two belonged to T3
402 (one each from Deoni and Pulikulam). The overall nucleotide
diversity within I1 and I2
403 haplogroups were 0.0024 and 0.0029 respectively while the
overall average number of
404 nucleotide differences were 2.32 and 2.77 respectively
(Table 5). Among the 207 unique
405 haplotypes, 105 belonged to I1 haplogroup, 74 belonged to I2
haplogroup, 3 belonged to T3
406 haplogroup and one each belonged to T1 and T2 halpogroups
(Table 4). The overall haplotype
407 diversity within I1 haplogroup and I2 haplogroup was 0.907
and 0.949 respectively. The
408 haplotype diversity within I2 haplogroup was higher than
that of I1 in all the South Indian zebu
409 cattle breeds except Alambadi. Among the observed
haplotypes, 27 were found to be shared
410 across 2 or more breeds, of which 18 belonged to I1
haplogroup, 8 belonged to I2 haplogroup
411 and one belonged to T3 haplogroup (Supplementary Table ST4).
The haplotype
412 HxJxABDLKOPUVHJ_H13 was the most frequent among I1
haplogroup and shared with all
413 the investigated populations except Punganur cattle. Among
the I2 haplogroup,
414 HxJxABDLKOPUV_H7 was the most frequent haplotype and shared
among 11 populations
415 with the exception of Punganur, Holstein-Friesian and Jersey
cattle. A total of 139 singleton
416 haplotypes were observed, of which 67, 50, 18, 3 and one
belonging to I1, I2, T3, T2 and T1
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
17
417 haplogroups respectively. The higher proportion of singleton
haplotypes within I2 haplogroup
418 of South Indian cattle was consistent with relatively higher
haplotype and nucleotide diversity
419 observed within this lineage.
420 3.5. mtDNA phylogeny and evolutionary relationship
421 Phylogenetic analysis was performed on all the 207 unique
haplotypes along with reference
422 sequences of each haplogroup, the results of which is
presented in Supplementary Figure SF3.
423 The phylogenetic tree conformed to haplogroup classification
with the formation of two major
424 indicine clusters I1 and I2. There were no major
sub-clusters except for one minor clade
425 containing four or more haplotypes in each of the I1 and I2
haplogroups. The minor clade
426 within in I1 haplogroup was formed by four singleton
haplotypes (K_H142, L_H120, L_H115
427 and V_H181) from Kangayam, Hallikar and Vechur cattle breed.
Similarly, the minor clade
428 within I2 haplogroup was formed by three singleton and two
shared haplotypes (P_H155,
429 AD_H61, B_H84, L_H129 and OP_H149) from Pulikulam, Alambadi,
Deoni, Bargur, Hallikar
430 and Ongole cattle.
431 The frequency of mtDNA control region haplotypes was further
utilized to estimate pairwise
432 genetic differentiation among zebu cattle from South India
as well as the zebu inhabiting areas
433 closer to Indus valley sites (West Indian zebu) and Gangetic
plains (North Indian zebu and
434 Nepalese zebu). Analysis of I1 haplotypes revealed pairwise
FST varying between zero and
435 o.293 while I2 haplotypes showed pairwise FST varying
between zero and 0.255. The pairwise
436 FST among I1 haplotypes was zero among NIC-NPC, WIC-NPC,
ALA-UMB and HAL-UMB
437 breed combinations and less than 1% among ALA-HAL, WIC-HAL,
WIC-UMB, NIC-UMB,
438 ALA-WIC breed combinations. The largest FST among I1
haplotypes was observed between
439 Punganur cattle and other zebu breeds (Vechur, Ongole,
Deoni, Bargur and Nepalese) followed
440 by Vechur and other breeds (Pulikulam, Ongole and
Umbalchery). In contrast, the pairwise FST
441 among I2 haplotypes was zero between Punganur and other zebu
breeds (ONG, BAR, NIC,
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
18
442 UMB, DEO, HAL, WIC, ALA, KAN) and among HAL-DEO, WIC-DEO and
PUL-DEO breed
443 combinations. The largest FST among I2 haplotypes was
observed between Nepalese zebu and
444 South Indian zebu (ONG, KAN, PUL, BAR, UMB, VEC, DEO and
ALA) followed by Vechur
445 and other breeds (ALA, BAR, UMB, ONG, PUL, HAL and DEO).
446 The pairwise FST for each of the haplogroups were further
utilized to perform principal
447 components analysis (PCA) and understand the evolutionary
relationships among the zebu
448 cattle breeds (Figure 4). Principal components analysis
(PCA) performs orthogonal
449 transformation of a set of correlated variables (genetic
distance estimations) into a set of new
450 linearly uncorrelated variables called as principal
components. The three largest principal
451 components that explained maximum variation in the dataset
were used to project sampled
452 breeds into a three-dimensional geometric space. PCA of I1
haplotypes revealed the three
453 largest principal components explaining 93.04% of the total
variance in the dataset. The three-
454 dimensional scattergram drawn using the three largest
principal components showed the
455 distinctness of Punganur, Pulikulam and Vechur cattle from
all the other South Indian zebu
456 cattle breeds. The zebu cattle from North India and Nepal
were also found to be distinct from
457 West and South Indian zebu cattle. Similarly, PCA of I2
haplotypes revealed the three largest
458 principal components together contributing to 91.31% of
total variance in the dataset. The
459 three-dimensional scattergram showed Vechur and Nepalese
cattle distinct from other zebu
460 cattle breeds.
461 To understand the underlying genetic structure of each of
the two maternal lineages (I1 and
462 I2), analysis of molecular variance among zebu mtDNA
haplotypes of cattle from South India,
463 Gangetic plains (North India and Nepalese) and Indus valley
(West India) sites were conducted
464 (Table 6). When no grouping was assumed among I1 haplotypes,
6.17% of variance (P
-
19
467 India, Gangetic Plains and Indus valley sites), among group
variance was negligible (0.43%)
468 and insignificant (P>0.05). However, when Punganur,
Vechur and Pulikulam breeds were
469 grouped separately from other South Indian zebu breeds,
among group variance was 2.91%
470 and statistically significant (P0.05). However, when Vechur
and Nepalese cattle were grouped
477 together, among group variance increased to 6.04% and was
statistically significant (P
-
20
492 most of the South Indian breeds with the modal value at two
pairwise mismatches. Bimodal
493 distribution was observed among I1 haplotypes in Kangayam,
Umbalchery and Punganur
494 breeds with modal values at 1 and 3, 1and 5, 2 and 6
mismatches respectively. In case of zebu
495 cattle from Indus valley site (WIC), the modal value was
observed at 3 mismatches while the
496 Gangetic plains Zebu cattle, NIC and NPC showed modal values
at 3 and 2 mismatches
497 respectively. The modal values of South Indian I1 lineage
observed in the present study is
498 contrary to the reports made earlier (Chen et al. 2010).
Similarly, with respect to I2 lineage,
499 modal values were observed around two to four mismatches in
most of South Indian and
500 Gangetic Plain Zebu cattle (NIC and NPC) while it was
observed at one mismatch in Indus
501 valley site zebu cattle (WIC). Unimodal distribution of I2
haplotypes was observed in most
502 South Indian zebu breeds except Deoni, Kangayam and
Pulikulam. The mismatch analysis of
503 pairwise differences revealed the parameter ‘tau’ (the
coalescent time of expansion) ranging
504 from 1.268 (Ongole) to 8.406 (Punganur) among I1 haplotypes
while it ranged from 1.344
505 (Pulikulam) to 4.182 (Kangayam) among I2 haplotypes of South
Indian zebu cattle. The
506 estimated sum of squared deviations (SSD) and the raggedness
index was significant (P
-
21
517 of smaller magnitude was observed within the I1 haplogroup
indicating a possible sub-lineage
518 of I1. The South Indian zebu cattle were further subjected
to tests for selective neutrality, the
519 Tajima’s D and Fu’s FS. The Tajima’s D statistics was based
on frequency spectrum of
520 mutations while Fu’s FS was based on haplotype distribution.
The results revealed negative
521 Tajima’s D in all the investigated South Indian breeds for
haplogroup I1, of which Deoni,
522 Hallikar and Pulikulam were statistically significant (P
-
22
542 Alambadi, Ongole, Pulikulam) and medium to large (Deoni,
Kangayam) size animals; draught
543 characteristics varying from heavy load pulling capability
(Hallikar, Umblachery) to speed and
544 endurance in trotting (Kangayam, Bargur); utilities ranging
from draught to penning for dung
545 (Pulikulam, Bargur). Joshi and Phillips (1953) classified
Zebu cattle of India and Pakistan into
546 six major groups based on their morphology, breed history
and phenotypic characteristics. The
547 South Indian zebu cattle investigated in the present study
were classified under three major
548 categories: Group II, Short horned, white or light grey
cattle with coffin shaped skulls
549 (Ongole); Group III, Ponderously, built Red and White cattle
(Deoni); and Group IV, Mysore
550 type, compact sized cattle (Hallikar, Kangayam, Umblachery,
Bargur, Pulilkulam and
551 Alambadi). The bantam weight dwarf type cattle breeds,
Vechur and Punganur did not fall into
552 any of these three categories.
553 4.1. Population status, effective population size and
inbreeding estimates
554 With rapid mechanization of agriculture in South India, the
need for rearing draught cattle came
555 down drastically in the last few decades. This led to
reduction in effective population size and
556 consequent increase in rate of inbreeding in many of these
breeds (Singh and Sharma, 2017).
557 A significantly strong negative Pearson’s correlation
coefficient of -0.674 (P
-
23
567 had higher mean FIS estimates of 0.089 and 0.076
respectively. Although the total population
568 of both these breeds were relatively higher (39050 and 14154
heads of Umblachery and Bargur
569 respectively), only few hundred breedable males (586 and 624
for Umblachery and Bargur
570 respectively) were present in their respective native breed
tracts. Lack of availability of
571 sufficient breeding bulls was one of the main reasons for
low effective population size, higher
572 estimates of FIS and high rate of inbreeding in these breeds
(Singh and Sharma, 2017). Among
573 the South Indian zebu cattle, the lowest FIS estimate was
observed in Hallikar cattle
574 (FIS=0.021), whose total population was greater than 1.2
million heads with breedable male
575 and female population of 5524 and 397357 respectively.
Interestingly, Punganur cattle with a
576 total population of less than 3000 and effective population
size of ~200 showed positive, but
577 relatively lower estimate of FIS (0.041). This could be
possibly due to a better breedable male
578 to breedable female ratio observed in this breed (0.0715) as
compared to Vechur (0.0020),
579 Pulikulam (0.0084) and Umbalchery (0.0387) cattle (DADF,
2015).
580 Singh and Sharma (2017) assessed the degree of endangerment
of Indian zebu cattle breeds
581 based on estimated breed-wise cattle population data (DADF,
2015), effective population size
582 and estimated rate of inbreeding. Using the criteria laid
down by Food and Agriculture
583 Organization of the United Nations (FAO, 2013) and the
Indian Council of Agricultural
584 Research-National Bureau of Animal Genetic Resources
(ICAR-NBAGR, 2016), they
585 classified the status of Vechur as “critical” (breeding
males less than five, breeding females
586 494 and high rate of inbreeding), Punganur and Pulikulam as
“endangered” (breeding females
587 more than 300 but less than 3000) and Bargur as “vulnerable”
(breeding females more than
588 3000 but less than 6000). Thus, the status of four out of
ten South Indian zebu cattle breeds
589 investigated in the present study are in the category of
“under risk” from conservation
590 standpoint. The level of inbreeding estimates is consistent
with their population status and is a
591 cause for concern from conservation standpoint. It is also
worth to mention that the population
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
24
592 status of “Alambadi” breed is currently not known but has
been observed to retain moderate
593 levels of heterozygosity.
594 4.2. Origin, breed history and population structure
595 Most South Indian cattle breeds belong to Mysore type cattle
(Group IV), of which Hallikar is
596 considered to be the ancient one and widely distributed with
significant and stable population
597 size. Ware (1942) and Joshi and Phillips (1953) mentioned
the origin of most Mysore type
598 cattle breeds centred around Hallikar cattle. The results of
AMOVA and genetic structure
599 analysis obtained in the present study was in conformity
with this theory of origin for most, if
600 not all the breeds. Among group variance was significant
(P
-
25
617 colour, typical of being red and white or red with white
spots. These cattle are known for their
618 speed and endurance in trotting, but are very fiery, restive
and difficult to train (Ware, 1942;
619 Ganapathi et al. 2009; Pundir et al 2009). It also needs to
be noted that among these four Mysore
620 type Tamil Nadu breeds (Alambadi, Bargur Umblachery and
Pulikulam), significant selection
621 process had gone into the development of Bargur cattle,
particularly for their unique
622 morphological characteristics, herd uniformity and
adaptation to zero input, hilly environment.
623 This was evidenced by their individual assignment to unique
inferred cluster when K=7 to K=8
624 (Figure 3) was assumed under Bayesian clustering
analysis.
625 Pulikulam, is a migratory cattle breed, maintained in a
zero-input system in southern parts of
626 Tamil Nadu state of South India. These cattle have
predominantly white or greyish coat colour
627 and are mostly used for agricultural operations and rural
transport. These cattle are well-known
628 for their utilities as a sport animal for Jallikattu (a
traditional bull embracing sport) and penning
629 (a practice of manuring by keeping the cattle overnight in
open agricultural fields). These cattle
630 resemble Kangayam in physical appearance but are
significantly smaller and compact in size.
631 Gunn (1909) opined that these cattle probably had a strain
of Mysore cattle blood in them. The
632 present study revealed Pulikulam as a genetically distinct
breed from Kangayam but sharing
633 significant ancestry with Hallikar and Deoni cattle (Figure
3; K=4 to K=7). The genetic
634 difference between Pulikulam and Kangayam was also
consistent with the reported differences
635 in morphometric parameters that included body length, height
at withers and chest girth
636 (Kanakraj and Kathiresan, 2006; Singh et al. 2012).
637 Umblachery is an excellent draught cattle breed reared in
the eastern coastal areas of Tamil
638 Nadu state (Rajendran et al. 2008). These are medium sized
cattle, selectively bred for short
639 stature and suitability to work in marshy paddy fields.
Anecdotal evidence attributed the
640 possible origin and development of Umblachery from Kangayam
cattle. Gunn (1909)
641 mentioned that with the exception of appearance of head of
these animals due to dehorning,
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
26
642 these cattle retained the chief characteristics of Kangayam.
However, the present study showed
643 significant genetic differentiation among these breeds
(FST=0.070) and little or no traces of
644 Kangayam ancestry in Umblachery cattle. Similar to Pulikulam
cattle, significant admixture
645 was observed in Umblachery cattle with traces of Hallikar
and Deoni ancestry in them. This
646 could be possibly due to trade influx of cattle into native
tract of Umbalchery more than a
647 century ago, from Southern Tamil Nadu (Cumbum district)
where the now extinct breed called
648 “Kappiliyan” or “Tambiran Madu” of Canarese (Mysore) origin
was in abundance (Gunn,
649 1909; Littlewood, 1936).
650 The genetic structure analysis clearly indicated the
influence of Hallikar breed in the
651 development of most Mysore type cattle breeds of Tamil Nadu
(Alambadi, Bargur,
652 Umblachery and Pulikulam) with the exception of Kangayam.
Kangayam is one of the popular
653 draught breeds of South India known for their power (0.8hp
per pair of bullocks) and sturdiness
654 (Surendrakumar, 1988). Although, there are reports
indicating the existence of Kangayam
655 cattle for nearly three centuries (Reddi, 1957), the origin
and development of this breed has
656 been attributed mainly to 33rd Pattagar (community chief) of
Palayakottai who selectively bred
657 the local cattle, only with sires available in his herd. The
appearance of some of his cows/heifers
658 gave the impression that they had a distinct strain of
Ongole blood in them, as the Pattagar was
659 known to possess purebred Ongole cows (Gunn, 1909). But no
records were maintained by
660 Pattagar during the early stages of the development of this
breed to confirm this. Kangayam
661 cattle conform largely to Mysore type breeds, but with a
relatively larger body size, probably
662 indicating the admixture with a heavier breed (Phillips,
1944). However, the results of
663 phylogeny, multidimensional scaling and analysis of
molecular variance in the present study
664 clearly showed the genetic uniqueness of Kangayam cattle.
The pairwise FST indicated marked
665 differentiation of Kangayam from Hallikar (FST=0.093) and
Ongole (FST=0.075) cattle. Further,
666 Kangayam was also significantly differentiated from other
Mysore type breeds (Alambadi,
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
27
667 Bargur, Umblachery and Pulikulam) with pairwise FST ranging
from 6.3% to 7.7%. The
668 Bayesian clustering analysis showed Kangayam as a
genetically distinct entity from both
669 Ongole and Hallikar cattle. Low levels of admixture observed
in Kangayam cattle, when
670 assumed under K=4 to K=8 (Figure 3), was probably due to
ancestral zebu inheritance common
671 to all South Indian breeds. The genetic uniqueness of
Kangayam cattle might have been the
672 outcome of systematic selective breeding practices of
Pattagars initially, and subsequent
673 introduction of herd book registration followed by
implementation of various genetic
674 improvement programs since1940s by Government of Madras
(Panneerselvam and
675 Kandasamy, 2008).
676 The two bantam cattle breeds, Vechur and Punganur are unique
to South India and are probably
677 among the smallest cattle breeds of the world, with the
average height of adults ranging from
678 60-100 cm and body weight of 125-200 kg (Nath, 1993; Iype,
1996). Vechur and Punganur
679 cattle have retained moderate levels of diversity despite
the small population size and being
680 classified in the critically endangered category. Both these
breeds were distinct from rest of the
681 South Indian breeds, not only in terms of morphology but
also in terms of milk production
682 efficiency. The cows are considered to be efficient milk
producers relative to their size, with
683 peak milk yield scaling up to 3-4 kg/day (Nath, 1993; Iype,
1996). Genetic distance based
684 phylogenetic analysis and multidimensional scaling plot
derived from pairwise FST showed
685 Vechur and Punganur to be genetically distinct from other
South Indian draught type zebu
686 cattle. Although, Bayesian clustering analysis indicated the
influence of Hallikar ancestry in
687 both the breeds (K=3 to K=6), they clustered independently
at K=7 and K=8 (Figure 3). It is
688 also worth to mention that a high degree of genetic
differentiation was observed among these
689 two dwarf cattle (Vechur and Punganur) breeds (FST=0.092).
This is understandable
690 considering the geographical location of their respective
native tracts. The isolation of native
691 tract of Vechur cattle (Kottayam district of Kerala state)
by rivers, canals and backwaters and
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
28
692 the distant location of Punganur cattle habitat (Chittoor
district of Andhra Pradesh state)
693 coupled with selective breeding practiced by farmers, might
have contributed to the genetic
694 differentiation of the two breeds. In addition to restricted
gene flow, genetic drift arising out of
695 small population size of both the breeds could have also
contributed to their genetic divergence.
696 4.3. Breed purity and level of taurine introgression
697 With the mechanization of agricultural operations and
increasing demand for dairy products in
698 the last few decades, the focus of cattle breeding in South
India shifted towards improving milk
699 production. Beginning with the Operation Flood program in
1970s, intensive cattle
700 development projects in Southern India were targeted towards
genetic improvement of local
701 cattle for milk through crossbreeding with exotic commercial
taurine cattle. Although the
702 official breeding policy emphasized the need for selective
breeding of recognized zebu cattle
703 breeds, indiscriminate crossbreeding took place in the
native tracts of many indigenous breeds.
704 In the absence of pedigree recording under small holder
production set up, it is not uncommon
705 that the local cows inseminated with purebred taurine or
crossbred semen were subsequently
706 served by locally available sires or vice versa. Often, the
choice of semen used for artificial
707 insemination (AI) is left to the inseminators and depends on
the availability of purebred zebu,
708 purebred taurine or crossbred semen straws, irrespective of
the breed/genotype of the cows
709 (purebred zebu, non-descript local, crossbred cattle, etc.)
brought for AI. This resulted in
710 dilution of purebred zebu germplasm with varying levels of
taurine admixture in well described
711 zebu cattle populations, thus affecting their breed
purity.
712 Bayesian clustering analysis was performed to assess the
taurine admixture in South Indian
713 zebu cattle using purebred Jersey and Holstein-Friesian as
reference genotypes. Samples from
714 Bos taurus X Bos indicus crossbreds were also genotyped to
evaluate the range of taurine
715 inheritance under field conditions. The proportion of
membership coefficient obtained for
716 individual animals in the inferred zebu and taurine clusters
were utilized to estimate taurine
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
29
717 admixture and purity of the investigated zebu cattle breeds
(Table 8). Ongole had zero
718 individuals with >6.25% taurine admixture while Punganur
had the highest proportion (44.4%)
719 of individuals with >6.25% taurine admixture. Among the
South Indian cattle, Ongole,
720 Kangayam, Deoni, Alambadi and Bargur breeds showed majority
of their individuals (>95%
721 of each of these populations) with less than 6.25% taurine
admixture. The relatively low level
722 of taurine admixture in Ongole, Kangayam and Deoni can be
attributed to the following factors:
723 (i) better artificial insemination coverage in their
respective breed tracts (ii) availability of
724 purebred zebu, true to the type breeding bulls (iii)
availability of purebred zebu semen for AI
725 and (iv) better implementation of breeding policy in favour
of selective breeding of purebred
726 zebu cattle (Panneerselvam and Kandasamy, 2008; Natarajan et
al. 2012; Dongre et al. 2017).
727 In case of Alambadi and Bargur cattle raised in a unique,
extensive production system of hilly
728 areas, the access to artificial insemination services is
little or absent. The cows in heat are
729 normally served by the bulls that accompany the herd while
grazing in the forest areas. For
730 example, in Bargur cattle, the herd composition includes at
least 2% of total size as breeding
731 bulls and young male stocks (Ganapathi et al. 2009) in
addition to 18-20% bullocks. The
732 farmers select the breeding bulls based on certain
phenotypic characteristics including
733 uniformity of coat colour (Pundir et al 2009). The absence
of AI facility and natural service
734 being the main breeding practice in the native tract, the
introduction of exotic bull semen was
735 limited in Bargur and Alambadi cattle resulting in low
levels of taurine admixture in these
736 breeds. With respect to Hallikar cattle, the proportion of
individuals with >6.25% taurine
737 admixture was estimated to be 16.7%. This was surprisingly
higher, considering the significant
738 and stable population size of this breed (DADF, 2015). Singh
et al. (2008) reported the demand
739 for purebred Hallikar semen was higher than the available
supply in the native tract and thus
740 the lack of quality breeding bulls might have contributed to
increased levels of taurine
741 admixture in this breed.
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
30
742 Breeds with highest proportion of individuals with >6.25%
taurine admixture included
743 Punganur (44.4%), Vechur (42.3%), Umblachery (33.3%) and
Pulikulam (23.5%) cattle.
744 Significant proportion of individuals belonging to these
breeds also had >12.5% taurine
745 admixture. Among these, Vechur and Pulikulam have been
reported to have severe shortage of
746 breedable males (DADF, 2015; Singh and Sharma, 2017) in
their respective native tracts.
747 However, the AI coverage in these areas is high and the
semen of purebred, commercial taurine
748 cattle are readily available for insemination in local cows.
This might have resulted in
749 indiscriminate crossbreeding of purebred zebu cattle,
thereby increasing the level of taurine
750 admixture in them. In case of Punganur cattle, although
reasonable number of breedable males
751 are available in the native tract, the level of taurine
admixture is relatively higher, possibly due
752 to well established AI programs and readily available exotic
taurine semen for insemination.
753 Kannadhasan et al. (2018) utilized community based
participatory approach to identify and
754 prioritize the constraints in Umblachery cattle farming: (i)
shift in farmers’ preference towards
755 crossbreds for better milk production (ii) lack of interest
among farmers in using Umblachery
756 bullocks for agricultural operations (iii) lack of grazing
lands (iv) lack of quality purebred
757 breeding bulls and (iv) inadequate efforts of breeders’
association in promoting and improving
758 Umblachery breed. The above factors coupled with high
coverage of AI and easy access to
759 taurine/crossbred semen might have contributed to relatively
higher levels of taurine admixture
760 in Umblachery cattle.
761 4.4. Maternal lineage diversity and zebu cattle
domestication
762 The present study revealed no additional maternal
haplogroups in the South Indian cattle other
763 than the typical I1 and I2 zebu lineages reported earlier
(Chen et al. 2010). A relatively high
764 average number of nucleotide differences, nucleotide and
haplotype diversity was observed in
765 I2 lineage as compared to that of I1lineage. Mismatch
distribution analysis of mtDNA control
766 region sequences revealed the modal value at two mismatches
for I1 lineage, while it was
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
31
767 observed at two to four mismatches for I2 lineage in most of
the South Indian breeds. The
768 mismatch distribution analysis thus clearly showed high
levels of mitochondrial control region
769 diversity in South Indian zebu cattle. In general, extant
populations located nearby centres of
770 domestication retain high levels of diversity, while
populations located farther away from the
771 domestication centre show reduced diversity. The high levels
of mtDNA control region
772 diversity observed in South Indian zebu cattle is
interesting. Particularly, the pairwise
773 differences among the I2 haplotypes of South Indian cattle
were relatively higher than West
774 Indian (Indus valley site) zebu cattle and comparable to
that of North Indian and Nepalese zebu
775 cattle (Gangetic plains zebu) (Chen et al. 2010).
776 Several studies have demonstrated independent domestication
and origin of Bos tauus and Bos
777 indicus cattle based on mtDNA variations (Loftus et al.
1994). It is also clearly established that
778 the humpless Bos taurus cattle were domesticated in the Near
East during the Neolithic
779 transition about 10 thousand years before present (Troy et
al. 2001; Beja-Pereira et al. 2006;
780 Edwards et al. 2007; Kantanen et al. 2009; Bonfiglio et al.
2010). Similarly, the report of Chen
781 et al. (2010) shed much light on the origin and
domestication of humped zebu cattle in the
782 Indian sub-continent. They analyzed mitochondrial control
region sequences from six different
783 regions of Asia (i) Indus valley region (ii) Gangetic plains
(iii) South India (iv) North East
784 India (v) West Asia (vi) East Asia (vii) Central Asia and
(viii) South East Asia. Among these,
785 nucleotide diversity was reported to be notably higher in
four regions of the Indian sub-
786 continent (Indus Valley, Gangetic Plains, South India and
North East India), indicating a vast
787 expanse of area as the probable centre of domestication.
Chen et al. (2010) identified the greater
788 Indus valley (West India and present-day Pakistan) as most
likely location for the origin and
789 domestication of I1 maternal lineage. They made the above
conclusion based on the following
790 evidences: (i) the backbone structure of I1 haplogroup
network being formed by cattle
791 populations in the Indus valley region (ii) modal value of
mismatch distribution of pairwise
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
32
792 differences being higher in Indus valley cattle (two
mismatches) as compared to those located
793 in Gangetic plains (one mismatch) and South India (one
mismatch) and (iii) relatively high I1
794 haplotype diversity observed in Indus valley cattle as
compared to cattle in Gangetic plains and
795 South India. However, analysis of I2 haplogroup sequences
showed more complex pattern of
796 diversity among cattle located in these regions. Identical
modal values of I2 mismatch and
797 nearly identical haplotype diversity were observed in Indus
valley and South Indian cattle while
798 the frequency of I2a (an intermediate I1-I2 haplotype) was
relatively higher in cattle from
799 Gangetic plains. Hence, Chen et al. (2010) reported the lack
of genetic evidence to pin-point
800 a single location/region for the origin of the I2
haplogroup. However, they opined the possible
801 initial domestication of this lineage in the northern part
of the Indian sub-continent based on
802 the chronology of available archaeological evidence for
domesticated zebu cattle and probable
803 wild aurochs in the Indian subcontinent.
804 The present study based on comprehensive sampling of diverse
breeds of South Indian zebu
805 cattle, showed the mismatch modal value of I1 haplogroup to
be higher (two mismatch) than
806 reported by Chen et al. (2010). More interestingly, the
mismatch distribution analysis of I2
807 haplogroup sequences revealed modal values around two to
four mismatches in most South
808 Indian breeds. This was higher than the modal value observed
for West Indian (Indus valley)
809 cattle, but comparable to that of North Indian and Nepalese
(Gangetic plains) cattle. The
810 intermediate I1-I2 haplotype sequences (I2a) were also
observed in certain South Indian cattle
811 breeds like Pulikulam, Deoni and Kangayam. Further, it is
worth to mention that the haplotype
812 diversity within South Indian I2 lineage was higher in most
South Indian cattle breeds.
813 Principal components analysis of pairwise FST derived from
frequency of I2 haplotypes showed
814 the distinctness of Vechur, Kangayam, Punganur and Alambadi
cattle, thus indicating the
815 diversity of this lineage within South Indian cattle. The
results showed the need for additional
816 sampling of zebu breeds from North, East and North-East
Indian cattle to explore and gather
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
33
817 new evidence on the potential location for the origin and
domestication of I2 lineage in the
818 Indian sub-continent.
819
820 Conclusions
821 The present study revealed moderate levels of genetic
diversity existing in South Indian zebu
822 cattle. It also established the genetic distinctness of
Kangayam, Vechur and Punganur cattle
823 from the rest of the South Indian zebu cattle. The influence
of Hallikar breed was observed in
824 the development of most Mysore type cattle breeds of South
India with the exception of
825 Kangayam. Analysis of mtDNA control region sequences
revealed two major maternal
826 haplogroups, I1 and I2, with the former being predominant
than the later. The results indicated
827 the need for additional sampling and comprehensive analysis
of mtDNA control region
828 variations to unravel the probable location of origin and
domestication of I2 zebu lineage. The
829 present study revealed two major concerns about the status,
conservation and improvement of
830 South Indian draught type zebu cattle breeds: (i) Four of
the ten investigated zebu cattle breeds
831 are under the risk of endangerment due to small effective
population size and high rate of
832 inbreeding (ii) the lack of sufficient purebred zebu bulls
for breeding and increasing level of
833 taurine admixture in the native breeds tracts. Recently, the
state governments of South India
834 have started establishing conservation units and research
centres for improvement of breeds
835 like Alambadi, Bargur, Kangayam and Umblachery. Parental
stocks of these breeds are being
836 established by procuring true to the type animals from small
holder farmers. However, in the
837 absence of pedigree records, it has been difficult to
estimate genetic purity or taurine admixture
838 in those animals. Considering the relatively higher levels
of taurine admixture in some of the
839 breeds, it is advisable to perform molecular/genomic
evaluation of local cattle to improve breed
840 purity in these units/centres. It also needs to be mentioned
that additional efforts are necessary
841 to make the farmers aware of scientific breeding practices
and limit the levels of inbreeding
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
34
842 and taurine admixture in purebred zebu populations.
Availability of purebred semen for
843 artificial insemination, incorporation of genomic/molecular
information to identify purebred
844 animals and increased awareness among farmers will help to
maintain breed purity, conserve
845 and improve these important draught cattle germplasms of
South India
846
847 Acknowledgement
848 The present study is part of the Coordinated Research
Project D3.10.28 of Joint FAO/IAEA
849 Division of Nuclear Techniques in Food and Agriculture,
International Atomic Energy Agency
850 (IAEA), Vienna, Austria. The funding provided by IAEA for
internship training of the first
851 author at Animal Production and Health Laboratory,
Seibersdorf, Austria is gratefully
852 acknowledged. The authors also thank Dean, Veterinary
College and Research Institute,
853 Namakkal, Tamil Nadu, India for providing necessary
facilities for the study.
854
855 References
856 Antao T, Lopes A, Lopes RJ, Beja-Pereira A, Luikart G.
LOSITAN: a workbench to detect
857 molecular adaptation based on a FST outlier method. BMC
Bioinformatics. 2008; 9: 323.
858 Bandelt HJ, Forster P, Rohl A. Median-Joining networks for
inferring intraspecific
859 phylogenies. Molecular Biology and Evolution. 1999; 16:
37-48.
860 Beja-Pereira A, Caramelli D, Lalueeza-Fox C, Vernesi C,
Ferrand N, Casoli A, et al. The origin
861 of European cattle: evidence from modern and ancient DNA.
Proceedings of National
862 Academy of Sciences, USA. 2006; 103: 8113-8118.
863 Bonfiglio S, Achilli A, Olivieri A, Negrini R, Colli L,
Liott L., et al. The Enigmatic Origin of
864 Bovine mtDNA Haplogroup R: Sporadic Interbreeding or an
Independent Event of Bos
865 primigenius Domestication in Italy? PLoS One. 2010; 5(12):
e15760.
866 doi:10.1371/journal.pone.0015760.
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
35
867 Chen S, Lin B-Z, Baig M, Mtra B, Lopes RJ, Santos AM, et al.
Zebu cattle are an exclusive
868 legacy of the South Asia Neolithic. Molecular Biology and
Evolution. 2010; 27 (1): 1-
869 6.
870 DADF. Estimated livestock population breed-wise based on
breed survey 2013. Published by
871 Department of Animal Husbandry, Dairying and Fisheries,
Ministry of Agriculture,
872 Government of India, New Delhi; 2015.
873 de Oliveira JFC, Neves JP, Almeida EA, Steigleder CS, Moraes
JCF, Gonçalves PBD, Weimer
874 TA. Association between reproductive traits and four
microsatellites in Brangus-Ibagé
875 cattle. Genetics and Molecular Biology. 2005; 28 (1):
54-59.
876 Dieringer D, Schlötterer C. MICROSATELLITE ANALYSER (MSA): a
platform indpendent
877 analysis tool for larger microsatellite data sets. Molecular
Ecology Resources. 2003; 3
878 (1): 167-169.
879 Dongre VB, Gandhi RS, Salunke VM, Kokate LS, Durge SM,
Khandait VN, Patil PV. Present
880 status and future prospects of Deoni Cattle. Indian Journal
of Animal Sciences. 2017;
881 87 (7): 800–803.
882 Edwards CJ, Bollongino R, Scheu A, Chamberlain A, Tresset A,
Vigne J-, et al. Mitochondrial
883 DNA analysis shows a near eastern Neolithic origin for
domestic cattle and no
884 indication of domestication of European aurochs. Proceedings
of the Royal Society B.
885 2007; 274:1377-1385.
886 Evanno G, Regnaut S, Goudet J. Detecting the number of
clusters of individuals using the
887 software structure: a simulation study. Molecular Ecology.
2005; 14: 2611-2620.
888 Excoffier L, Hofer T, Foll M. Detecting loci under selection
in a hierarchically structured
889 population. Heredity. 2009; 103: 285–298.
890 Excoffier L, Laval G, Schneider S. Arlequin ver. 3.0: An
integrated software package for
891 population genetics data analysis. Evolutionary
Bioinformatics Online. 2005; 1: 47-50.
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
36
892 FAO. In vivo conservation of animal genetic resources. FAO
Animal Production and Health
893 Guidelines. No. 14. Rome; 2013.
894 FAO. Molecular genetic characterization of animal genetic
resources. FAO Animal Production
895 and Health Guidelines. No. 9. Rome; 2011.
896 FAO. The second report on the state of the World’s Animal
Genetic Resources for Food and
897 Agriculture, edited by Scherf BD and Pilling D. FAO, Rome;
2015.
898 Felsenstein J. PHYLIP: Phylogeny inference package, version
3.5. Department of Genetics,
899 Washington University, Seattle, Washington; 1993.
900 Ganapathi P, Rajendran R, Subramanian A. Distribution and
Population Status of Bargur cattle.
901 The Indian Veterinary Journal. 2009; 86: 971–972.
902 Grant WS. Problems and Cautions With Sequence Mismatch
Analysis and Bayesian Skyline
903 Plots to Infer Historical Demography, Journal of Heredity.
2015; 106 (4): 333–346.
904 https://doi.org/10.1093/jhered/esv020.
905 Gunn WD. Cattle of Southern India Vol III. Bulletin No. 60.
Department of Agriculture,
906 Madras, India; 1909.
907 Hiendleder S, Lewalski H, Janke A. Complete mitochondrial
genomes of Bos taurus and Bos
908 indicus provide new insights into intraspecies variation,
taxonomy and domestication.
909 Cytogenetic and Genome Research. 2008; 120:150–156. doi:
10.1159/000118756.
910 ICAR-NBAGR. Guidelines for Management of Animal Genetic
Resources of India. National
911 Bureau of Animal Genetic Resources (Indian Council of
Agricultural Research), Karnal
912 (Haryana), India, 163 p.; 2016.
913 Iype S. The Vechur Cattle of Kerala. Animal Genetic
Resources Information. 1996; 18: 59-63.
914 Joshi NR, Phillips RW. Zebu cattle of India and Pakistan.
FAO Agriculture Studies No. 19,
915 Food and Agricultural Organization of the United Nations,
Rome, Italy. pp. 14-29;
916 1953.
.CC-BY 4.0 International licenseperpetuity. It is made available
under apreprint (which was not certified by peer review) is the
author/funder, who has granted bioRxiv a license to display the
preprint in
The copyright holder for thisthis version posted January 21,
2021. ; https://doi.org/10.1101/2021.01.21.427560doi: bioRxiv
preprint
https://doi.org/10.1101/2021.01.21.427560http://creativecommons.org/licenses/by/4.0/
-
37
917 Kanakraj P, Kathiresan D. Study on the physical and
productive characteristics of Pulikulam
918 breed of cattle and Katchaikatty sheep. Final Report of the
project submitted to SEVA,
919 Madurai; 2006.
920 Kannadhasan MS, Kathirchelvan M, Rajendran R. Identification
and Prioritization of
921 Constraints in Umblachery Breed Cattle Farming Through
Participatory Approach.
922 International Journal of Current Microbiology and Applied
Sciences. 2018; 7(11):
923 1100-1110. https://doi.org/10.20546/ijcmas.2018.711.128
924 Kantanen J, Edwards CJ, Bradley G, Vinalass H, Thessler S,
Ivanova Z, et al. Maternal and
925 paternal genealogy of Eurasian taurine cattle (Bos taurus).
Heredity. 2009; 103: 404-
926 415.
927 Kienzle, Ashburner JE, Sims BG. Mechanization for Rural
Development: A Review of Patterns
928 and Progress from around the World. In Integrated Crop
Management (FAO) No. 20;
929 Food and Agriculture Organization of the United Nations:
Rome, Italy; 2013.
930 Li M-H, Iso-Touru T, Laurén H, Kantanen J. A
microsatellite-based analysis for the detection
931 of selection on BTA1 and BTA20 in northern Eurasian cattle
(Bos taurus) populations.
932 Genetics Selection Evolution. 2010; 42:32.
http://www.gsejournal.org/content/42/1/32.
933 Littlewood RW. Livestock of Southern India. Government of
Madras, Madras, India. pp. 51-
934 69; 1936.
935 Loftus R, MacHugh D, Bradley D, Sharp P, Cunningham P.
Evidence for two independent
936 domestication of cattle. Proceedings of National Academy of
Sciences, USA. 1994; 91:
937 2757-2761.
938 Natarajan A, Chander M, Bharathy N. Relevance of draught
cattle power and its future
939 prospects in India: A review. Agricultural Reviews, 2016; 37
(1): 49-54.
940 Natarajan A, Senthilvel K, Velusamy K. Productivity
performance of Kangayam cattle. Indian
941 Journal of Animal Sciences. 2012; 82 (11): 1440–1441.
.CC-BY 4.0 International licenseperpetuity. It is made available
under ap