Lecture 5 (biol3600) dna replication winter 2012 pw

DNA replicationOverview

• Overview of semiconservative DNA replication

- Two parental strands are unwound and separated- Each of those serves as a template for a new, complimentary strand- End result = Two DNA molecules, each containing 1 parental and 1 new strand

• We will first discuss how DNA replication proceeds in bacteria and then discuss how it occurs in more complex eukaryotic cells - Generally the same process in both cell types (as described above)

• Modes of Replication– Replicons: Units of replication.

• Replication origin

– Theta replication : circular DNA, E.coli; single origin of replication forming a replication fork, and it is usually a bidirectional replication.

12.2 All DNA Replication Takes Place in a Semiconservative Manner

DNA replication in bacterial cellsStep 1: Initiation

• Structure of the bacterial chromosome - Single, circular chromosome - Adopts a supercoiled state (which makes it more compact) • Bacterial DNA replication (also called Theta replication) (1) Initiation - Does replication start anywhere on the chromosome or at specific sites? ANSWER: At specific sites called origins of replication - Bacteria have only a SINGLE origin of replication (DNA replication starts at one place in the chromosome) - The origin of replication in the E.coli chromosome is called oriC - OriC (and other prokaryotic origins of rep.) contain binding sites for an initiator protein called DnaA - A complex of DnaA proteins bind to the chromosome at oriC and causes a slight “bend” to be introduced

relaxed supercoiled

DNA replication in bacterial cellsStep 2: Unwinding the 2 strands

• Bacterial DNA replication (also called Theta replication) (2) Unwinding a) Bending of the DNA at this point creates tension and causes a small replication “bubble” to form - This is a small region of strand separation

b) The bubble serves as a binding site for 2 other proteins called DnaB and DnaC

- These proteins use ATP to further break hydrogen bonds between the strands and separate them - DnaB and C are types of helicases - Helicase = Type of enzyme that uses ATP in order to denature DNA

c) Proteins called single-strand-binding proteins (SSB proteins) bind to the individual strands and keep them apart file:///E:/media/ch12/Animations/1201_replication.html

DNA replication in bacterial cellsStep 2: Unwinding the 2 strands

• Bacterial DNA replication (also called Theta replication) (2) Unwinding d) Unwinding the strands at oriC produces tighter supercoiling ahead of the replication fork - This tension needs to be relieved or the strands may break - An enzyme called DNA gyrase (a type of topoisomerase) binds to the chromosome “ahead” of the replication fork and relieves the tension - They introduce small cuts in the strands, unwind, and reseal

Notes on unwinding: - Proceeds in both directions (aka bidirectional) - Produces a theta looking structure (see pict above) - It is unwound a little at a time - Unwound a little, new strands made, unwound a little more, .....

theta

DNA replication in bacterial cellsStep 3: Primer synthesis

• Bacterial DNA replication (also called Theta replication) (3) Primer synthesis - The enzyme that makes a new DNA strand from the template (called DNA polymerase III) can’t start the new strand from scratch - It only can add nucleotides to an existing 3’ OH group (It needs help getting things started)

- What does the cell do? 1. Once the strands are separated, an enzyme called primase creates a short (5-10 nucleotides) RNA chain called a primer - This primer is complimentary to the template 2. DNA polymerase III can then come in and create a new strand by extending from the primer (called elongation)

NO PRIMERS, NO DNA REPLICATION!!!

X

http://www.youtube.com/watch?v=E8NHcQesYl8&feature=autoplay&list=PL1367038CB0BF6BDA&lf=view_all&playnext=1

DNA coiling-up

DNA replication in bacterial cellsStep 4: Synthesis of new DNA strands

• Bacterial DNA replication (also called Theta replication) (4) Elongation (synthesis of new strands) - First, let’s talk more about DNA polymerase III - Arthur Kornberg discovered DNA polymerases in 1956 (actually discovered a different DNA pol – discussed later) - Arthur’s son Thomas Kornberg discovered DNA pol III in 1970 - Properties of DNA polymerase III a) Only adds new nucleotides onto the 3’ end of a growing strand - Makes a new DNA strand in the 5’ 3’ direction - A dNTP is brought in, pyrophosphate (P-P) is removed - It reads what is on the template strand and adds in complementary nucleotide - Reads T, adds A; reads G, adds C

b) Again, it can’t start a strand from scratch. It only can extend an existing strand

DNA replication in bacterial cellsStep 4: Synthesis of new DNA strands

• Bacterial DNA replication (also called Theta replication) (4) Elongation (synthesis of new strands) - Properties of DNA polymerase III c) It has 3’5’ exonuclease activity - Has the ability to proofread itself and correct its mistakes - If it detects that it accidentally inserted the wrong nucleotide, it will back up, cut it out, and put the correct one in - Analogy: Backspace key on the keyboard

d) Structure - Composed of many different functional subunits 1. Three subunits make up the core enzyme α synthesizer – polymerization of nucleotides ε proofreader – corrects mistakes made θ stimulator – stimulates ε to do its job

2. β clamp – Sliding clamp structure that locks the whole complex onto the DNA strands - Prevents the above core enzyme from falling offGo to 2:25min

http://www.youtube.com/watch?v=-ie4dxx10Ww&list=PL1367038CB0BF6BDA&index=5

DNA replication in bacterial cellsStep 4: Synthesis of new DNA strands

• Bacterial DNA replication (also called Theta replication) (4) Elongation (synthesis of new strands) - Properties of DNA polymerase III d) Structure - Composed of many different functional subunits 3. Tau (τ) subunit - Tethers two DNA pol. III together (creates a dimer)

4. Gamma (γ) loader complex – Helps to load the whole enzyme onto the DNA template at the replication fork (lagging strand)

- How does DNA pol. III actually make new strands of DNA? - Remember the 2 strands of DNA are arranged in opposite (antiparallel) orientations

As new strands are produced, they must also follow this antiparallel rule (Two interacting DNA strands must always run in opposite directions)

5’3’ 5’

3’

http://www.youtube.com/watch?v=-mtLXpgjHL0&feature=related

DNA replication in bacterial cellsStep 4: Synthesis of new DNA strands

5’3’

5’ 3’

5’

3’

5’

5’

3’

3’

3’5’

5’

3’

5’

5’

3’

5’

3’

3’

• Bacterial DNA replication (also called Theta replication) (4) Elongation (DNA synthesis) - Now, for the actual steps - Remember: Starts with localized DNA unwinding at oriC and the addition of RNA primers (in green) by primase - Notice where they are placed on the 2 strands

- DNA pol III then adds nucleotides onto the 3’ end of each primer (in red) - Synthesis continues in the 5’ 3’ direction - Notice one is moving towards the replication fork and the other away Note: Only 1 replication fork is shown

DNA replication in bacterial cellsStep 4: Synthesis of new DNA strands

5’

3’

5’

5’

3’

5’3’

3’5’

3’

5’3’

5’ 3’5’3’

5’5’5’5’ 3’3’ 3’3’

+

• Bacterial DNA replication (also called Theta replication) (4) Elongation (DNA syn.) - Now, for the actual steps - One strand is being made continuously as DNA pol III moves towards the replication fork (this is called the LEADING STRAND) - The other strand is made discontinuously (moving away from the replication fork) and is initially composed of small fragments called Okazaki fragments (this is called the LAGGING STRAND)

Prediction of next steps:1. Can’t have pieces of RNA in our chromosome2. One of the new strands is in pieces

DNA replication in bacterial cellsStep 5: Primer removal and ligation

• Bacterial DNA replication (also called Theta replication) (5) Primer removal and ligation - Another type of DNA polymerase (DNA polymerase I) comes in and removes the RNA primers from both the leading and lagging strands (it has 5’3’ exonuclease activity) and fills in the gaps with DNA (it also has 5’3’ polymerization ability) - It uses the end of each Okazaki fragment as a starting point - Does both in 1 step!

-The enzyme DNA ligase then seals the spaces between each Okazaki fragment on the lagging strand - Creates the last phosphodiester bond

5’3’

5’ 3’5’3’

5’5’5’5’ 3’3’ 3’3’+

5’3’5’ 3’

5’3’5’

3’

5’3’5’ 3’

DNA pol I

DNA ligase

http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter14/animations.html#

DNA replication (GENERAL)Proofreading and error

correction

• The proofreading ability (3’5’ exonuclease activity) of the DNA polymerases prevents massive amounts of errors from being introduced into the genome - How do we know this? - Removal of the 3’5’ exonuclease activity from E.coli DNA pol III results in a large increase in the error rate of the enzyme - MUTATIONS ARE INTRODUCED into newly made DNA strands

• Why is preventing these mutations important? - Two words: DEATH and CANCER!! - Mutation of DNA often leads to cell death because if the wrong gene is crippled, the cell can’t function properly - Worse yet, mutation of specific genes can abnormally lead a cell to divide uncontrollably and prevent the cell from dying properly TUMOR PREVENTING MUTATIONS IS CRITICAL!!!

http://www.youtube.com/watch?v=tOi88novQV0&feature=related

DNA replication in eukaryotic cellsSimilarities and differences to bacteria

• DNA replication in eukaryotic cells is very similar to what occurs in bacterial cells - DNA unwinding at origin of replication, 2 replication forks are formed, RNA primers are made, and DNA polymerases make new strands on leading and lagging strands

• However, differences between bacterial and eukaryotic genomes leads to some differences in how the DNA is replicated - Bacteria: Single, circular chromosome (Avg size: 4.6 x 106 base pairs) Humans: Multiple, linear chromosomes (Total size: 3.3 x 109 base pairs)

• Difference 1: Eukaryotic chromosomes have multiple origins of replication - Example: Copying your textbook - Option A - You photocopy it by yourself from start to finish - Option B – You and 30 of your friends each copy a chapter Eukaryotic genomes are gigantic. Need to start replication at multiple sites in order to complete it in a timely manner

DNA replication in eukaryotic cellsSimilarities and differences to bacteria

• Difference 1: Eukaryotic chromosomes have multiple origins of replication - How do our cells recognize all of these origins of replication and how do they keep from accidentally copying the same thing twice (before mitosis)? 1) In order to function, origins must be “licensed” or approved for replication by origin recognition complexes (ORCs) - ORCs function to recruit helicase, SSB protein, DNA pols, etc. - No ORC binding, no replication - After replication, ORCs come off

2) Unreplicated DNA is coated with MCM proteins (helicases) - Its one way that the cell has of distinguishing between replicated and unreplicated DNA - No MCM proteins, no replication - Following replication, MCM proteins come off the DNA and are prevented from going back on

DNA replication in eukaryotic cellsSimilarities and differences to bacteria

• Difference 2: Eukaryotic DNA polymerases - Bacteria have at least 5 different DNA polymerases - Already discussed DNA pol I and III. DNA pol II, IV, and V are thought to function in DNA repair - At least 13 different DNA polymerases exist in eukaryotic cells - Some of the “important” ones are as follows: 1/2. Polymerase α (Pol α) and Pol δ (delta) – Major polymerases involved

in nuclear DNA replication - Pol α – Two of its 4 subunits function as the primase - Adds primer to leading and lagging strand templates and starts extending them - This enzyme has low processivity and falls off of the templates after a short time - Pol δ – Replaces pol α and finishes the job (lagging strand) - Has high processivity and 3’5’ exonuclease activity (pol α does not) This is called polymerase switching

3. Pol ε – Similar abilities as pol δ, may be major leading strand polymerase (Still debated!!)

DNA replication in eukaryotic cellsSimilarities and differences to bacteria

• Difference 2: Eukaryotic DNA polymerases - At least 6 different DNA polymerases exist in eukaryotic cells 4. Pol γ – Functions to replicate mitochondrial DNA - Mitochondria contain their own 16, 500 base pair, circular genome - Derived from bacteria?? - This DNA contains genes that are required for life - Most function in oxidative phosphorylation - Passed from mom to child (sperm don’t have lots of mitochondria) - Note: Chloroplasts also contain their own DNA and utilize a different DNA pol for DNA replication (still not fully characterized)

5-13. Many other eukaryotic DNA polymerases play specialized roles in DNA repair - You don’t need to know them

DNA replication in eukaryotic cellsSimilarities and differences to bacteria

• Difference 3: Removal/assembly of histones - Eukaryotic nuclear DNA is tightly coiled around proteins called HISTONES (unlike bacterial DNA) - Remember: Chromosomes are DNA + protein - Histones are very basic proteins (+ charged) that interact with the negatively-charged DNA - Need to alter histones in order to make the DNA accessible for replication - Histones are typically altered by adding an acetyl group (called acetylation) - Adding an acetyl group (COCH3) neutralizes their positive charge, causes them to lose their attraction for DNA - DNA loosens up and is able to be replicated

- After replication, histones are deacetylated and go back onto the DNA (and new histones are made)

DNA replication in eukaryotic cellsSimilarities and differences to bacteria

• Difference 4: Chromosome ends/telomeres - Remember: Bacterial chromosomes are circular and eukaryotic chromosomes are linear - Remember: DNA polymerases can only add on to an existing 3’ end (all need a head start) - Remember: What does DNA pol I do in bacteria? - Removes the RNA primers and fills in the gaps with DNA (using the ends of the Okazaki fragments as a starting point)

- Problem: Once DNA Pol /δ (EUK)removes the primer at the absolute end of the chromosome on the lagging strand, there is no free 3’ end ahead of it - In theory, our chromosomes should shorten each time they are replicated - Would lose important genes very quickly DEATH!!

5’3’5’ 3’

5’3’

5’ 3’

5’3’5’ 3’

5’3’5’

3’

end of chromsome

DNA replication in eukaryotic cellsSimilarities and differences to bacteria

• Difference 4: Chromosome ends/telomeres - Another view of this problem - Solution to the problem: The end of our chromosomes (called telomeres) are modified to prevent the loss of important genes - An enzyme called telomerase is activated and adds >1,000 copies of a repeated sequence (e.g. TTAGGG) onto the ends of each chromosome - It is only active in gametes, embryos, and stem cells

- Telomerase has a RNA template in a pocket that binds to the chromosome end - Uses this to keep adding more copies of the repeated sequence onto the telomere - Again, it is normally only active in sperm/eggs and in early embryos (simultaneous interpretation…)

TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG

http://www.youtube.com/watch?v=NddqInmwnig&feature=related

DNA replication in eukaryotic cellsSimilarities and differences to bacteria

• Difference 4: Chromosome ends/telomeres - Telomeres still shorten each time the DNA is replicated (problem wasn’t truly solved) - Instead of losing important genes, chromosomes only lose a portion of the “garbage” repeated sequence

- These repeated sequences at our telomeres also function to protect chromosomes by: 1) Serving as binding sites for protective proteins - Some enzymes love to degrade DNA by starting at ends (free ends are bad) - Repetitive sequences help recruit proteins to the telomeres - These proteins bind to the telomere and block the “bad” enzymes from destroying the chromosomes 2) Prevent chromosomes from fusing - If you cut chromosomes into small pieces and mix them, they tend to randomly fuse together - Repeated sequences prevent chromosomes from randomly fusing together

TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG

TTAGGGTTAGGGTTAGGGTTAGGG

TAGGGTTAGGGTTAGGG

DNA replication in eukaryotic cellsSimilarities and differences to bacteria

• Difference 4: Chromosome ends/telomeres - The more a cell divides, the shorter the telomeres get (remember: telomerase is not normally active in somatic cells) - As cells age, the telomeres get shorter and shorter - Eventually the repeated sequence runs out and important genes in the chromosomes get removed - Once this happens, the cell dies!

- Telomere shortening acts as a cell clock

- Does telomere shortening lead to human aging? - Possibly. Elderly people have shorter telomeres as do individuals with some aging diseases - Not all tissues are “aged” by shortened telomeres

TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG

TTAGGGTTAGGGTTAGGGTTAGGG

TAGGGTTAGGGTTAGGG

GGGTTAGGG

celldeath

Replication - Recapitulating….

• DNA Polymerases Problems: Activities that are not inherited in the DNA polymerase itself. - There are certain polymerases that are specialized for different functions. - Not all DNA polymerases can replicate the genome - DNA Pol I in bacteria is a repair pol: Has 3 activities: 1) Polymerase activity

2) Proofreading exonuclease that goes 3’5’3) Exonuclease that chews-up the strand ahead in the 5’3’ direction

- The structures of polymerases are conserved (they are ancient!) - Polymerases can’t start the polymer without a primer (needs a free 3’OH) - they can only synthesize in ONE direction!

that creates a problem that is solved by a molecular machine called the replication fork (which includes ~10 different proteins that need to cooperate to replicate DNA)

How does replication happen:•1st problem: How to get the templates; how to separate the DNA strands? - Helicases unwind the double-stranded DNA. - Helicase loading triggers the assembly of the replication fork machine. dnaB helicase uses ATP hydrolysis to pry the strands apart (~1ATP/3 nucleotides).

•2nd problem: ssDNA is a signal for induction of cell death (EUK), and is unstable. •There are ss-nucleases floating around that can chew-it-up! Also, hairpins can block synthesis. so how do you mask the ssDNA?

need stabilizing proteins (SSBP in Prok; or replication prot.A in Euk) - ss stabilizing proteins do not use ATP to bind. - creates a filament that is a better substrate for DNA polymerase (better than naked DNA).

(Probably allosteric regulation on the polymerase)

• DNA Polymerase Problems: Activities that are not inherited in the DNA polymerase itself.

• 3nd problem: Polymerase can’t start synthesis without a 3’OH. It needs a primer!First, helicase opens up the DNA, RNA primase is sitting on the fork (attracted by SSB) and takes care of the primer job. It lays a primer (10 nucleotides long) at the beginning of the leading strand and it lays primers every ~1000 nucleotides (in prokaryotes) on the lagging strand. There is no proofreading in primase (no backwards motion), so those primers have lots of errors. Then primase hands the primer to the polymerase (via clamp affinity).

file:///E:/media/ch12/Animations/1202_bidirectional_replic.html

•4th problem: DNA gets supercoiled (entangled) as it unwinds •during replication.Enzymes relieve the supercoiling: gyrases in prokaryotes;

topoisomerases (type I and type II) in eukaryotes. they control the topology (# of turns) of the chromosomes.

So… PROK: Here is the structure: 2 copies of DNA pol III bound together by the tau unit (holoenzyme).

DNA Polymerase III: has (a) the polymerase subunit, (b) the proofreading subunit, (c) the exonuclease subunit,

EUK: (a) DNA Pol has the primase activity (30 – 40 nucleotides); (b) DNA Pol polymerises the lagging strand; (c) DNA Pol polymerises the leading strand.the changing oftoandis called polymerase switching.

Replication - Recapitulating….

• DNA Polymerases Problems: Activities that are not inherited in the DNA polymerase itself.

•5th problem: polymerase actually has low affinity to the ssDNA!solution: Use a beta clamp to keep the polymerase on the ssDNA. Clamp loader (does the ring-and-string magic): gamma complex in prokaryotes and

replication factor C (made-up of A, B, C, D, E) in eukaryotes. The clamp loader uses ATP to load the clamp on the DNA.

http://www.youtube.com/watch?v=-ie4dxx10Ww&feature=related (heavy accent, but good explanation…)

The clamp itself is shaped like a donut and can not “magically” get into the ssDNA. clamp: beta in prokaryotes.

The prokaryotic beta clamp (shown in the pic) recognizes the gamma complex clamp loader, then grabs the ssDNA strand. Qt: What does the clamp loader recognize?

clamp: PCNA in eukaryotes.The eukaryotic DNA sliding clamp that keeps DNA polymerase engaged at a replication fork is called proliferating cell nuclear antigen (PCNA), is loaded onto the 3′ ends of primer DNA through its interaction with a heteropentameric protein complex called replication factor C (RFC) – the clamp loader.http://www.youtube.com/watch?v=HN7FQwogusY&feature=related

So…. In prokaryotes: The subunits that hold the complex on each DNA strand are the beta/sliding clamps: there are lots of +charges on the clamps, so DNA levitates in the donut. Once the clamp goes in by association w/ the RNA primer, it does not come off the leading strand. On the lagging strand, the clamp associates with the RNA primer just as it did on the other strand, then attracts Polymerase III to synthesize the DNA. When beta senses the adjacent Okasaki fragment of DNA, it falls off, therefore Pol III looses its grip and falls off too. Pol III then finds the next beta clamp on the next RNA primer and joins for the synthesis again.

Replication - Recapitulating….

• DNA Polymerases Problems: Activities that are not inherited in the DNA polymerase itself.

•5th problem: how to remove the RNA primers?solution: in prok: DNA Pol I binds and replaces the RNA for DNA. Pol I has proofreading capacity. Now… At the nick there is a 3’OH and a 5’ phosphate. We could have an electrophilic attack from the OH onto the –P, but there is no “leaving group,” so the electrons would just go back and forth. We can’t seal the nick if the –P is not activated. DNA ligase first activates the –P (using ATP), then catalises the attack of the 3’OH on the activated –P. Now the nick is sealed!

In euk: RNaseH1 endonuclease, cleaves RNA primer. Proofreading (with help of other subunits). DNA ligase I ligates Okazaki fragments, binds to PCNA. (Note: Unlike E. coli, which has only one DNA ligase, there are at least four known human DNA ligases). Uses ATP as an energy cofactor.

Replication - Recapitulating….

euk

Replication - Recapitulating….

Two DNA polymerases are involved in eukaryotic replication

DNA polymerase has no primase activity and is thought to be the polymerase that synthesizes the leading strand.

DNA polymerase has associated primase activity and is thought to be the polymerase that synthesizes the lagging strand.

DNA Synthesis at the Origin

Additional factors:PCNA (proliferating cell nuclear antigen)DNA helicase Replication factor C

OTHERS

Replication of Nucleosomes

euk

Replication - Recapitulating….