Top Banner
Lecture 5 • Assignment 1 • Polymorphic markers • MusY marker • Polyacrylamide electrophoresis • Article 2 discussion
41

Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Jan 20, 2016

Download

Documents

Duane Ray
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Lecture 5

• Assignment 1

• Polymorphic markers

• MusY marker

• Polyacrylamide electrophoresis

• Article 2 discussion

Page 2: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Assignment 1

Would you like the due date for the assignment moved to Oct 27, 2008?

The sequence marked with an X is the one that you are to analyze.

If you have another sequence file that does not have an X in its name do not analyze for the assignment!!!!!!!!!!!!!!

Page 3: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Example sequence

GGTAANGGAACTGGAATCCAAACTCTCTGAAGCTGAGAAGGAATTCATCGAAGGAGCACCAACACGTAGCAAACGATCACCATCCGAGTGGATACCAAGGCCACCCGAAAAATACAGTCTTACTGGGCACAGAGCTCCTATCAACAGAGTTATTTTCCATCCGGTCTTTAGTCTTATAGTATCTGCCAGCGAAGATGCCACTATCAAGGTG

TGGGACTTCGAGAGCGGCGAATTCGAAAGAACGTTGAAGGGGCACACCGACAGCGTGCAGGACGTTTCCTTCGACGTCTCCGGGAAACTGTTAGTCTCATGCAGTGCGGACATGTCTATTAAGTTATGGGACTTTCACCAGTCATTCGCCTGCGTGAAAACCATGCACGGACATGATCACAGTGTCAGCTCTGTCGCATTTGTGCCACAAGGGGATTTCGTAGTGAGCGCCTCTAGGGATAAGACCATCAAAATATGGGAAGTAGCGACAGGGTATTGTGTCAAAACGTTAACGGGGCACAGAGAATGGGTACGGATGGCCAGAGTCAGTCCTTGTGGAGAATTAATAGCTAGTTGCTCGAACGATCAAACAGTACGGGTTTGGCACGTGGCAACAAAGGAAACGAAGGTCGAACTCAGAGACCACGAACACGTAGTGGAGTGTATCGCATGGGCACCGGACAGTGCAAGAGCATCGATCAACGCTGCTGCAGGGGCGGACAATAAGGGAGCCCATGAAGGACCTTTCCTCGCATCTGGCTCGCGAGACAAAGTAATTCGTGTATGGGATGTCGGTGCCGGTGTTTGTCTCTTCGCCCTATTGGGCCACGACAACTGGGTTCGCGGCATCGTCTTCCATCCTGGTGGCAAGTTCATCGTCAGTGNCTCTGACGACAAGANCCTGCGAGTATNGGANACGCGCAACANANGGGTAATGAAA

ACCCTCNAAGCGCACGTCCACTTCTGCNCCTCCNTTGATTTCACAAAAGCCATCCTTACGTGGTCNCCGGTAGTG

Page 4: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Step into liquid

Page 5: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Taken from Vallee et al., 2001

Page 6: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Taken from Tarricone et al., Neuron 2004

Page 7: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Mouse Murder Mystery 5Greta’s last case

Page 8: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

DNA isolation

• Why can we isolate ancient DNA but not RNA?

• What should a good DNA isolation protocol do?

• What will the agarose gel in experiment 2 tell us?

Page 9: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Isolation of Genomic DNA using Commercial DNAzol

DNAzol

Homogenize

100%Ethanol

DNA

75%Ethanol

Precipitate Wash X2

dH2O

Page 10: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

You will be assigned primer pairs individually for Experiment 2

These are your primers no help may be given to you by yourgroup mates.

Look up your assigned primer pair before arriving in the lab!You are expected to have worked out the master mix beforeyou arrive. The TA will check for this.

The assigned primer pairs are posted on the web.

Page 11: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

What do the primers detect?

• 3G5, 5G4, and 6G2 detect autosomal DNA polymorphisms.

• MusY detects Y chromosome DNA.

Page 12: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

List of primers for PCR

Name Primer Name Primer

3G5 For TGTCCCTGCTCAGAGAACAGAT

6G2 For TTCTTCACCTGCCTTCTTCCAC

3G5 Rev AAACACGATAA CACTGGGGG

6G2 Rev CCCTTTGCTTACCCAAGTTGCT

5G4 For AGTAGGCAGATAAGGGGTTTCC

MusY For TCCTTGGGCTCTTCATTATTCTTAAC

5G4 Rev TACAGCATCTAGTGAATGGGGG

MusY Rev GAGAACCACGTTGGTTTGAGATG

Page 13: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

What is a DNA polymorphism?

Page 14: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

How are you going to use DNA polymorphisms in this

experiment?

Page 15: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.
Page 16: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

5G4

1 2 3 4 5 6 7

6G2

1 2 3 4 5 6 7

Example from previous Year

Page 17: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

What do we need to know about the DNA polymorphisms to have an effective analysis?

Page 18: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

What does it mean when we get a PCR product with MusY

primers?

Page 19: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Androgen insensitivity syndrome

Page 20: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Polyacylamide gel electrophoresis

Page 21: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Polyacrylamide Gel ElectrophoresisTo separate PCR products differing in only a few bp in length (for example, microsatellite markers), 6-10% PA gels are used.

Mixture of DNA molecules

Page 22: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Step by Step Instructions on how to assemble the polyacrylamide gel apparatus is posted on the course website

The TAs will be providing a demonstration in this week’s lab

Page 23: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Taken from Morrison and Boyd 3rd ed.

Page 24: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

So what do we need to spot when looking at the

procedure?

• What molecule has the double bond.

• What produces the free radicals.

Page 25: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

The reaction

Component Volume30% acrylamide/bis 4ml5X TBE 3ml10% APS 45μltemed 15μlwater 7.9total 15ml

Page 26: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Questions

• What has the double bonds?

• What is the function of bis acrylamide?

• What is the source of free radicals?

• What does temed do?

Page 27: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

How the gel is made

Page 28: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Paper 2

The antiobesity gene

Page 29: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Obesity rates and calories available

Marion Nestle Scientific American Vol 297 2007

Page 30: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Supermarkets Ground Zero

Reagan in the early 1980s deregulated agriculture.

Farmers grow more food due to competitive forces.

The “shareholder value movement” of early 1980s.

Forced food companies to expand sales promoting:Between meals snackingLarger portionsEating in Book and Clothing stores.These were once taboo.

Marion Nestle Scientific American Vol 297 2007

Page 31: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Supermarkets Ground Zero

On entering a store see something colourful, aromatic and enticing.

Aisles and aisle-ends jam-packed with products: impulse buying.

Food companies pay supermarkets for prominent positions and large displays.

Checkout lines plastered with candy and other junk food items.

Marion Nestle Scientific American Vol 297 2007

Page 32: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

1,000 calories: 59 sugar cubes

Marion Nestle Scientific American Vol 297 2007

Page 33: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Global obesity and global famine

Scientific American Vol 297 2007

Page 34: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Mexico’s problem living next to Coca Cola nation

Scientific American Vol 297 2007

Page 35: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Figure 1

Page 36: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Figure 2

Page 37: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Figure 3

Page 38: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Figure 4

Page 39: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Figure 5

Page 40: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Figure 6

Page 41: Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Figure 7