<Analytical conditions> Instrument : Shimadzu Nexera / LCMS-8030 Plus Column : Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm) Eluent : (A) 50 mM HCOONH 4 aq. / (B) CH 3 CN Linear gradient (High pressure) Flow rate : 0.2 mL/min Detector : PDA (190-350 nm) & ESI-MS SIM(-) Column temp. : 40℃ Injection vol. : 1 μL 260 nm 19 12 13 14 15 16 17 11 7 9 10 8 6 5 4 2 3 20mer 18 0 5 10 15 20 min ・Packing material: Poly vinyl alcohol particle with diol group ・Housing: PEEK ・Usable pH: 2~13 ・Usable temp.: 4~60℃ ・Usable solvent: H 2 O, CH 3 CN, CH 3 OH (mixable at any ratio) ・Hydrophilic substance can be retained without derivatization or ion pair agent ・Suitable for HILIC analysis of oligosaccharides and oligonucleotides LC/MS analysis of oligonucleotides using new polymer - based HILIC column having diol group Introduction Experimental Nucleic acid drug development and quality control are expected to drastically increase within the pharmaceutical sector. LC/MS measurements are a highly sensitive and highly selective analytical tool required for quality control. Conventional ion pair reverse phase mode has been widely used for the analysis of oligonucleotides. However, the ion pair agent tends to remain in the instrument. In this study, a novel column Shodex TM HILICpak TM VN-50 2D column was applied for LC/MS measurement of oligonucleotides. A method was developed to separate oligonucleotides under a gradient condition of volatile salt solution and acetonitrile without using ion pairing agent and to conduct highly sensitive analysis. Conclusions Shodex ® HILICpak ® VN-50 series Shodex TM HILICpak TM VN-50 2D, a newly developed polymer-based diol-type HILIC column, was used with LC/UV/ESI-MS to elute oligonucleotides in order of polymerization degree. It was confirmed that highly selective analysis was possible. The eluent was a gradient of 50 mM ammonium formate aqueous solution and acetonitrile, a condition that does not require the addition of an ion pair reagent in reverse phase mode or addition of a high concentration salt in ion exchange mode. This condition seems to have superiority in terms of simplification of desalting process even for preparative applications. Alkaline washing is also possible. The VN-50 series is a useful column for the development and quality control of nucleic acid medicine. LC/MS of Oligo DNA 20mer Wide pH range not using ion pair agent and HFIP Results and Discussion PVA OH OH 20mer 0 5 10 15 min 1533.3(-) <Sample> Synthetic oligodeoxyribonucleotides(salt-free grade) (1) 20mer 5’-ATACCGATTAAGCGAAGTTT-3’ (2) 20mer 5’-ATACCAATTAAACAAAATTT-3’ (3) 62mer 5’-CATGAGAAGTATGACAACAGCCCCACACCGG CTGTTGTCATACTTCTCATGGTTCTTCGGAA-3’ * All samples contain trace amounts of imperfect oligo-DNAs as impurity LC/MS of Oligo DNA 62mer <Comparison of eluent conditions> expanded 260 nm 0 5 10 15 20 25 min Condition of (A=50mM / B%=62%56%) is suitable 260 nm 0 5 10 15 20 25 min Sample 1 2.2 mg/mL(in H 2 O) B%=57%(constant) B%=60%(0min)→50%(10-15min)→60%(15.01-20min) B%=60%(0min)→55%(10-15min)→60%(15.01-20min) B%=62%(0min)→56%(10-20min)→62%(20.01-25min) B%=62%(0min)→57%(10-25min)→62%(25.01-30min) B%=62%(0min)→57%(10-25min)→62%(25.01-30min) B%=62%(0min)→57%(10-25min)→62%(25.01-30min) A=100mM A=50mM A=20mM <Comparison of chromatograms> <Calibration curve of sample 1> <Mass spectrum of sample 1> * B%=60%(0min)→55%(10-15min)→60%(15.01-20min) * B%=62%(0 min)→56%(10-20 min)→62%(20.01-25 min) 2mer (TT) 4mer (GTTT) 3mer (TTT) 5mer (AGTTT) 6mer (AAGTTT) 7mer (GAAGTTT) 8mer (CGAAGTTT) 9mer (GCGAAGTTT) 10mer (AGCGAAGTTT) 11mer (AAGCGAAGTTT) 12mer (TAAGCGAAGTTT) 13mer (TTAAGCGAAGTTT) 14mer (ATTAAGCGAAGTTT) 15mer (GATTAAGCGAAGTTT) 16mer (CGATTAAGCGAAGTTT) 17mer (CCGATTAAGCGAAGTTT) 18mer (ACCGATTAAGCGAAGTTT) 19mer (TACCGATTAAGCGAAGTTT) 20mer (ATACCGATTAAGCGAAGTTT) 545.1(-) 849.2(-) 1178.2(-) 745.2(-) 901.7(-) 1066.2(-) 1210.7(-) 1375.3(-) 1531.8(-) 1688.0(-) 1226.6(-) 1327.9(-) 1432.3(-) 1542.0(-) 1638.3(-) 1734.7(-) 1839.0(-) 1940.4(-) 1533.3(-) 0 5 10 15 20 min 試料1 試料2 2mer (TT) 4mer (ATTT) 3mer (TTT) 5mer (AATTT) 6mer (AAATTT) 7mer (AAAATTT) 8mer (CAAAATTT) 9mer (ACAAAATTT) 10mer (AACAAAATTT) 11mer (AAACAAAATTT) 12mer (TAAACAAAATTT) 13mer (TTAAACAAAATTT) 14mer (ATTAAACAAAATTT) 15mer (AATTAAACAAAATTT) 16mer (CAATTAAACAAAATTT) 17mer (CCAATTAAACAAAATTT) 18mer (ACCAATTAAACAAAATTT) 19mer (TACCAATTAAACAAAATTT) 545.1(-) 849.2(-) 1162.2(-) 737.2(-) 893.7(-) 1050.2(-) 1194.8(-) 1351.3(-) 1507.8(-) 1664.4(-) 1210.6(-) 1311.9(-) 1416.3(-) 1520.7(-) 1617.0(-) 1713.4(-) 1817.7(-) 1919.1(-) 0 5 10 15 20 min 1517.3(-) 20mer (ATACCAATTAAACAAAATTT) Sample 1 <monitored ions> 2-4mer : [M-H] - 5-11mer : [M-2H] 2- 12-19mer : [M-3H] 3- 20mer : [M-4H] 4- 260nm 20 21+22 23 24+25 26 26+27+28 29+30 31 10 11 12+13 14 15+16 17+18+19 1723.7(-) 563.1(-) 892.2(-) 1221.3(-) 754.7(-) 906.7(-) 1203.2(-) 1058.7(-) 1355.3(-) 1507.3(-) 1671.8(-) 1836.4(-) 1988.4(-) 1429.6(-) 1526.0(-) 1627.3(-) 1825.0(-) 1926.4(-) 1516.8(-) 1595.1(-) 1749.3(-) 1671.1(-) 1821.6(-) 1897.6(-) 1979.9(-) 1705.3(-) 1644.5(-) 1771.1(-) 1832.0(-) 1889.8(-) 0 5 10 15 20 min 1955.6(-) 2mer (AA) 10mer (TTCTTCGGAA) 20mer (CTTCTCATGGTTCTTCGGAA) 31mer (CTGTTGTCATACTTCTCATGGTTCTTCGGAA) 62mer * B%=60%(0 min)→50%(10-20 min)→60%(20.01-25 min) <monitored ions> 2-4mer : [M-H] - 5-13mer : [M-2H] 2- 14-19mer : [M-3H] 3- 20-26mer : [M-4H] 4- 27-32mer : [M-5H] 5- 33-39mer : [M-6H] 6- 40-45mer : [M-7H] 7- 46-52mer : [M-8H] 8- 53-58mer : [M-9H] 9- 59-62mer : [M-10H] 10- ・Oligo DNAs are eluted in order of degree of polymerization ・As oligo DNA contains G, the retention becomes stronger Hydrogen bonding may also be involved in separation ・Good linearity ・Capable of high selective quantification Separable up to 31 mer Sample 1 22 μg/mL(in H 2 O) Sample 1, 2 1 mg/mL(in H 2 O) each Product name Plate number (TP/Column) Functional group Particle size (μm) Pore size (Å ) Column size (mm) I.D. × Length HILICpak VN-50 4D ≥ 10,000 Diol 5 100 4.6 × 150 HILICpak VN-50G 4A (guard column) Diol 5 100 4.6 × 10 HILICpak VN-50 2D ≥ 3,500 Diol 5 100 2.0 × 150 HILICpak VN-50G 2A (guard column) Diol 5 100 2.0 × 10 Sample 3 2.8 mg/mL(in H 2 O) 100 500 1000 1500 m/z 1533.4 [M-4H] 4- <monitored ions> 2-4mer : [M-H] - 5-11mer : [M-2H] 2- 12-19mer : [M-3H] 3- 20mer : [M-4H] 4- Sample 2 5’-ATACCGATTAAGCGAAGTTT-3’ Mass Intensity 6137.073 29.98 6138.073 74.73 6139.073 100.00 6140.073 94.48 6141.073 70.30 6142.073 43.67 6143.073 23.48 6144.073 11.20 6145.073 4.82 6146.073 1.90 6147.073 0.69 6148.073 0.24 6149.073 0.08 6150.073 0.02 6151.073 0.01 Isotopic Abundances for C 197 H 247 O 117 N 76 P 19 detected as multivalent negative ion 6135.00 6140.00 6145.00 6150.00 0.0 20.0 40.0 60.0 80.0 100.0 Shodex CAPTURE THE ESSENCE TM Junji Sasuga 2 , Yuzuru Kokido 2 , Hirobumi Aoki 2 , Eiji Kagawa 2 , Leah Block 1 , and Ronald Benson 1 1 Showa Denko America, Inc., 420 Lexington Avenue, Suite 2335A, New York, NY 10170, USA 2 Showa Denko K.K., 5-1 Ohgimachi Kawasaki-ku, Kawasaki, 210-0867, Japan Contact us at [email protected] For more information, visit www.shodexHPLC.com