Karthika Sriskantharajah - University of Guelph Atrium

Enhancement of Fruit Retention and Postharvest Quality in ‘Honeycrisp’ Apples (Malus domestica Borkh) using Hexanal

by Karthika Sriskantharajah

A Thesis presented to

The University of Guelph

In partial fulfilment of requirements for the degree of

Doctor of Philosophy

in Plant Agriculture

Guelph, Ontario, Canada © Karthika Sriskantharajah, December 2021

ABSTRACT

ENHANCEMENT OF FRUIT RETENTION AND POSTHARVEST QUALITY IN ‘HONEYCRISP’ APPLES (Malus domestica borkh) USING HEXANAL

Karthika Sriskantharajah University of Guelph, 2021

Advisor: Dr. Jayasankar Subramanian

‘Honeycrisp’ (Malus domestica Borkh), a premium apple cultivar, is prone to preharvest

fruit drop (PFD), bitter pit (BP) and decline in quality during long-term storage. To enhance

the fruit retention and storage quality in ‘Honeycrisp’, an aqueous composition containing

hexanal was applied as a preharvest spray. Hexanal treated trees retained 18% more

fruit compared to control trees. Fruit firmness was significantly improved by hexanal while

fresh weight, and total soluble solids (TSS) did not vary in response to the treatment at

the field. Abscisic acid (ABA) in the fruit abscission zone (FAZ) was substantially reduced

by hexanal at commercial maturity. At this stage, a total of 726 differentially expressed

genes (DEGs) were identified between treated and control FAZ. Functional classification

of the DEGs showed that hexanal downregulated ethylene biosynthesis genes (SAM2,

ACO3, ACO4,and ACO4-like),while it upregulated the receptor genes (ETR2 and ERS1).

Genes related to ABA biosynthesis (FDPS and CLE25) and signaling were also

downregulated. Further, hexanal downregulated the expression of genes related to cell

wall degrading enzymes, including polygalacturonase, glucanase, and expansin. These

findings revealed that hexanal reduced the sensitivity of FAZ cells to ethylene and ABA.

Simultaneously, hexanal reduced the cell wall degradation of FAZ cells by regulating

genes involved in cell wall modifications. Thus, delayed fruit abscission by hexanal in

III

‘Honeycrisp’ is most likely achieved by minimizing ABA through an ethylene-dependent

mechanism. Further investigation of effects of hexanal on long-term storage quality in

‘Honeycrisp’ revealed that treated apples had higher TSS under both cold and cold

followed by room temperature storages. In addition, treated apples had lower incidence,

and progression of BP, lower phospholipase D (PLD) enzyme activity and decreased

expression of MdPLDα1, MdPLDα4, MdCaM2, MdCaM4 and MdCML18 genes.

Therefore, improved postharvest quality, including the lower incidence of BP in hexanal

treated ‘Honeycrisp’ apples may be associated with lower membrane damage due to

downregulation of PLD. Thus, hexanal application promises to be a great technology to

control fruit drop, reduce bitter pit, enhance fruit qualities, and marketability in

‘Honeycrisp’ apples, given that this cultivar is categorized as susceptible to fruit drop and

bitter pit.

IV

DEDICATION

I dedicate this thesis to our little girl, Aaranya Kokulan. She is a most precious gift that

we received during this Ph.D. journey.

V

ACKNOWLEDGEMENTS

This project was made possible by the generous support from Global Affairs Canada

through their Canadian International Food Security Fund (CIFSRF) and the Arrell

Foundation through the Arrell scholarship by the Arrell Food Institute at the University of

Guelph. I would also like to acknowledge the Department of Plant Agriculture, University

of Guelph, and kind donors for the following scholarships: Margaret and Angus Hamilton

Apple Tree Fruit Research Scholarship, Keith and June Laver Scholarship in Horticulture,

Hoskins Scholarships, Manton Memorial Scholarship, H.L. Hutt Memorial Scholarship,

Vineland Centennial Horticultural Scholarship, and MAC-FACS-FRAN Alumni

Association Graduate Scholarship.

First and foremost, I would like to express my sincere gratitude to my advisor Dr.

Jayasankar Subramanian for his impeccable supervision, continuous support, and

encouragement throughout the past four years. His guidance helped me in all the time of

research and writing of manuscripts and the thesis. His advice and sense of humor were

always a source of inspiration and enjoyment, even during rigorous projects. Besides my

advisor, I would like to thank the rest of my thesis committee members: Dr. J. Alan

Sullivan, Dr. Gopinadhan Paliyath and Dr. Evan Fraser, for their encouragement,

insightful comments, motivation, and continuous support. Their vast knowledge in

different subject areas was always a treasure for enthusiasts like me. Moreover, their

kindness always led me in the right direction from the beginning.

My sincere thank also goes to former senior technician Mr. Glen Alm for assistance

in the field for the past three years. His depth of knowledge in the field and lab works has

VI

always admired me. Thank you for teaching me to prepare for any and every eventuality

when conducting field and lab experiments. I could not have conducted many of the field

works without your assistance.

My sincere thanks to Dr. Davoud Torkkamaneh for his encouragement and

guidance, especially during the COVID 19 pandemic, to complete several bioinformatics

analyses and assisting in completing a big portion of this thesis and publishing it in a

prestigious journal. I also could not have conducted many of the experiments if not for

help from Dr. Walid El Kayal, who taught me how to operate PCR and RT-PCR. Your help

allowed me to carry out all the gene expression works in a timely fashion. Thank you also

to Dr. Murali M. Ayyanath and Dr. Praveen K. Saxena, Dr. Mukund Shukla, Dr. Vasanth

Ragavan and Dr. Michael Stasiak, Dr. Michelle Edwards for helping me in carrying out

various biochemical and statistical analyses.

I am grateful to Mr. Rich Feenstra and Mr. Art Moyer, and their families for

providing their orchard for the experimentation. Also, my sincere thanks to Dr. Gale Bozzo

and Mr. Gordon Hoover, who helped in storage experiments by checking the coolers and

updating me if anything went wrong. Thank you very much to all the Vineland Research

and Innovation Centre staff for your support throughout the research period.

I am so grateful and honoured to be selected as one of the inaugural Arrell

Scholars by the Arrell Food Institute at the University of Guelph. My sincere thank you to

the Arrell Foundation for selecting young minds worldwide and financially supporting them

to uplift their education and enlighten their lives. Throughout the past four years, your

guidance, support, and the extracurricular opportunities you provided me to showcase

many of my works to the world through different platforms are unmeasurable. Thank you

VII

to all the staff, my fellow scholars, and many academics and scholars who adjunct to the

Arrell Food Institute.

My sincere thanks to my lab members and colleagues Erika DeBrouwer, Robert

Brandt, Dr. Syndhiya Ranjan, Renu Chandrasekaran, Ranjeet Sinde and Shanthanu

Krishnakumar for your physical and mental support. It was always my pleasure to have

you all around me. Thanks are due to two mother figures I am blessed to have in Canada,

Mrs. Sivagamasundhari Sikamani and Mrs. Vasantha Ramkumar, whose care, love, and

advice in raising our child and providing us with delicious food during the past four years.

It was not always the easiest thing to have a child while doing a Ph.D., but your care and

support made me balance and enjoy both simultaneously.

I want to extend gratitude to my family for their continuous support. My husband,

Dr. Kokulan Vivekananthan, always encouraged me to reach great heights and supported

me in many ways, from carrying out the research activities to advising in writing

manuscripts. Thank you for being such a lovely friend, husband, father, and advisor. My

mother, Mrs. Yogambikai Sriskantharajah, always encouraged me and flew multiple times

to take care of our baby girl, and you made Canada home for us with your care and love.

Thank you to my in-laws, cousins and friends and families in Canada and back in my

home country for your greatest support throughout this journey.

Last but not least, but I do not know how to express my sincere gratitude to you.

DAD, I hope somewhere in the universe you are looking and enjoying, your daughter is

going heights and completing her fourth degree. Thanks to you from the bottom of my

heart, and I miss you every day.

VIII

TABLE OF CONTENTS

Abstract ............................................................................................................................ii

Dedication .......................................................................................................................iv

ACKNOWLEDGEMENTS ............................................................................................... v

Table of Contents .......................................................................................................... viii

List of Tables .................................................................................................................. xii

List of Figures ................................................................................................................ xiii

List of Abbreviations ..................................................................................................... xvii

List of Appendices ......................................................................................................... xix

1 CHAPTER ONE: INTRODUCTION .......................................................................... 1

2 CHAPTER TWO: LITERATURE REVIEW ............................................................... 6

2.1 Apple Origin and Varietal Evolution .................................................................... 6

2.2 'Honeycrisp' Apple .............................................................................................. 7

2.3 Physiology of Apple Fruit Ripening .................................................................... 9

2.3.1 Hormonal Regulation in Apple Fruit Ripening ............................................ 10

2.3.2 Effect of Fruit Ripening on Fruit Abscission ............................................... 16

2.4 Physiology of Preharvest Fruit Drop in Apple ................................................... 17

2.4.1 Influence of Plant Hormones in Preharvest Fruit Drop in Apple ................. 18

2.4.2 Involvement of Cell Wall Hydrolases in Preharvest Fruit Drop in Apple .... 20

2.5 Role of Calcium in Ripening and Storage ........................................................ 22

2.5.1 Role of Calcium in Cell Wall Structure ....................................................... 22

2.5.2 Fruit Calcium Transport ............................................................................. 22

2.5.3 Calcium and Bitter Pit Development in Apple ............................................ 24

IX

2.6 Longevity protection technologies in apple ...................................................... 25

2.6.1 Ethylene Control Technologies .................................................................. 25

2.6.2 Membrane Preservation Technologies ...................................................... 26

2.7 Purpose of the thesis work ............................................................................... 30

3 CHAPTER THREE: HEXANAL INDUCED FRUIT RETENTION IN ‘HONEYCRISP’ APPLES ........................................................................................................................ 32

3.1 Introduction ...................................................................................................... 33

3.2 Materials and Methods ..................................................................................... 37

3.2.1 Trial Location, Preharvest Treatment and Plant Material Collection .......... 37

3.2.2 Fruit Retention and Fruit Quality Measurements ....................................... 39

3.2.3 Plant Hormone Measurement .................................................................... 39

3.2.4 RNA-Isolation, Library Preparation and Sequencing ................................. 41

3.2.5 Trimming, Assembly, and Annotation of Paired-End Sequenced Reads ... 41

3.2.6 Differentially Expressed Gene Analysis ..................................................... 42

3.2.7 Enrichment Analyses ................................................................................. 43

3.2.8 Quantitative RT-PCR ................................................................................. 44

3.2.9 Statistical Analysis ..................................................................................... 44

3.3 Results ............................................................................................................. 45

3.3.1 Effect of Hexanal on Fruit Retention and Fruit Quality ............................... 45

3.3.2 Quantitation of Plant Hormones in Fruit and FAZ ...................................... 47

3.3.3 Identification of Differentially Expressed Genes ........................................ 48

3.3.4 Identification of Enriched Gene Ontology (GO) and Functional Pathways 51

3.3.5 Characterization of Genes Related to Various Plant Hormone Responses54

3.3.6 Characterization of Genes Encoding Transcription Factors....................... 57

3.3.7 Characterization of Genes Related to Cell Wall Modification..................... 57

X

3.3.8 Characterization of Genes Related to Abscission ...................................... 59

3.3.9 Confirmation of Gene Expression Patterns by qRT-PCR .......................... 60

3.4 Discussion ........................................................................................................ 62

3.4.1 Delay in Fruit Ripening by Hexanal ........................................................... 62

3.4.2 Hexanal Reduces Ethylene Biosynthesis and Perception in the FAZ ........ 63

3.4.3 Hexanal Mediates Hormonal Crosstalk in the FAZ .................................... 64

3.4.4 Hexanal Slows down Cell Wall Degradation and Abscission ..................... 66

4 CHAPTER FOUR: HEXANAL INDUCED POSTHARVEST QUALITY IN ‘HONEYCRISP’ APPLES .............................................................................................. 69

4.1 Introduction ...................................................................................................... 70

4.2 Materials and Methods ..................................................................................... 74

4.2.1 Experimental Location and Treatments ..................................................... 74

4.2.2 Storage Studies ......................................................................................... 75

4.2.3 Standard Quality Assessment during Storage ........................................... 76

4.2.4 Measurement of Plant Hormones .............................................................. 76

4.2.5 Phospholipase-D Assay............................................................................. 77

4.2.6 Bitter Pit (BP) Assessment ........................................................................ 78

4.2.7 Gene Expression Analysis ......................................................................... 78

4.2.8 Statistical Analysis ..................................................................................... 79

4.3 Results ............................................................................................................. 80

4.3.1 Effect of Preharvest Spray on Quality Parameters and Phytohormones at Harvest 80

4.3.2 Effect of Preharvest Spray on Ethylene and Phospholipase D Enzyme at Cold Storage .......................................................................................................... 82

4.3.3 Effects of Preharvest Spray on Bitter Pit (BP) Development ..................... 84

4.3.4 Effect of Preharvest Sprays on Fruit Quality Traits During Cold Storage .. 86

XI

4.3.5 Expression Profiles of Genes Encoding PLD and Calcium Sensor Proteins 89

4.3.6 Effects of Hexanal and HarvistaTM on Fruit Quality Traits at Room Temperature Storage ............................................................................................... 2

4.4 Discussion ........................................................................................................ 93

5 CHAPTER FIVE: ASSESSMENT OF BITTER PIT IN ‘HONEYCRISP’ APPLES: A COMMERCIAL-SCALE STUDY .................................................................................... 98

5.1 Introduction ...................................................................................................... 98

5.2 Materials and Methods ................................................................................... 100

5.2.1 Experimental Location and Treatments ................................................... 100

5.2.2 Storage Studies ....................................................................................... 101

5.2.3 Incidence of Bitter Pit ............................................................................... 101

5.2.4 Progression of Bitter Pit ........................................................................... 102

5.2.5 The severity of Bitter Pit........................................................................... 102

5.2.6 Percentage of Marketable Fruit ............................................................... 104

5.2.7 Grower Return from the Marketable Fruit ................................................ 104

5.2.8 Statistical analysis ................................................................................... 105

5.3 RESULTS....................................................................................................... 106

5.3.1 Effect of Hexanal on Incidence of Bitter Pit.............................................. 106

5.3.2 Effect of Hexanal on Progression of Bitter Pit .......................................... 107

5.3.3 Effect of Hexanal on Severity of Bitter Pit ................................................ 108

5.3.4 Effect of Hexanal on Marketable Fruit ..................................................... 110

5.3.5 Effect of Hexanal Application on Financial Return to the Grower ............ 111

5.4 DISCUSSION ................................................................................................. 112

6 CHAPTER SIX: SUMMARY ................................................................................. 115

References or Bibliography ......................................................................................... 121

XII

LIST OF TABLES

Table 3.1 Fruit quality parameters of control and hexanal treated ‘Honeycrisp’ apples at commercial maturity (0th day) and 49 days after commercial maturity .......................... 47

Table 3.2 Variation of plant hormones in control and hexanal treated ‘Honeycrisp’ fruit and in fruit abscission zone (FAZ) ................................................................................. 48

Table 4.1 Variations in fruit quality traits and phytohormones at harvest (commercial maturity) ........................................................................................................................ 81

Table 4.2 Variation in firmness and TSS in ‘Honeycrisp’ apples throughout the storage. ...................................................................................................................................... 87

Table 4.3 Effects of preharvest sprays on fruit quality traits fresh weight, firmness and TSS in ‘Honeycrisp’ apples after removal from cold storage (2.5 °C) to room temperature storage (~20 °C).......................................................................................... 2

Table 5.1 Parameters used to calculate the grower income from additional marketable fruit .............................................................................................................................. 104

Table 5.2 The increased yield, income from additional marketable fruit, if they were quality enough and were able to sell either at 60 days or 90 days or 120 days postharvest. ................................................................................................................. 111

XIII

LIST OF FIGURES

Figure 2.1 Schematic diagram of hormonal changes during maturation and ripening of apples. Adapted from Eccher et al. (2014). ................................................................... 16

Figure 2.2 General schematic representation of (a) PLD accumulation causing membrane degradation and (b) primary alcohols/aldehydes inhibits PLD accumulation to slow down membrane degradation. The schematics processes were based on Paliyath et al. (2008). .................................................................................................... 28

Figure 3.1 Anatomical observation of the fruit abscission zone (FAZ) of ‘Honeycrisp’ apple. (a) photograph shows the abscission zone (AZ) of the fruit located between the spur and pedicel of the fruit stalk; (b) photograph shows about 1 mm size of the AZ was manually dissected with a razor blade at each side of the abscission fracture plane; (c) microscopic view of the AZ region. The AZ looks like a funnel shape with constrictions in both sites. The broken line indicates the position of the abscission fracture plane. The AZ was stained using lactophenol cotton blue. ............................................................. 38

Figure 3.2 Percentage of fruit retention in control and hexanal treated ‘Honeycrisp’ trees throughout the 49 days of study period. The fruit in the orchard (site A) reached to commercial maturity at 0th day. Each value represents the mean ± SE of 4 trees. Asterisks indicate significant differences between control and hexanal treatment at the same sampling time based on Tukey’s HSD test at α = 0.05. ....................................... 46

Figure 3.3 Identification of the differentially expressed genes (DEGs) between control and hexanal treated FAZ samples. (a) layout of the overall experimental procedure where samples for the RNA-seq analysis were collected at commercial maturity; (b) represents the MA plot shows the relationship between the expression change (M) and average expression strength (A) of the 353 up (red) and 373 down regulated genes (blue). Genes that pass a threshold of p ≤ 0.05 and |log2foldchange|> 1 in differential expression analysis are considered as upregulated. Whereas genes pass a threshold of p ≤ 0.05 and |log2foldchange|> −1 are considered as downregulated. If any gene did not meet the above requirements are considered as non-significant (NS); (c) heat map of the 726 DEGs shows the variation across the four samples harvested from two sites. H1 and H2 represent the hexanal treated samples harvested from site A and B, respectively. Similarly, C1 and C2 represent the control samples harvested from site A and B, respectively. Additional information about the DEGs is presented in appendix A3. ...................................................................................................................................... 50

Figure 3.4a Interactive enrichment networks plot of first 30 enriched functional categories belonged to BP (FDR, p < 0.001, at edge cutoff 0). In the network analysis, two pathways (nodes) are connected if they share 20% (default) or more genes. Darker nodes are more significantly enriched gene sets. Bigger nodes represent larger gene sets. Thicker edges represent more overlapped genes. A hierarchical clustering tree summarizing the correlation among these top 30 significant pathways was included in

XIV

Figure 3.4b. Additional information about the functional pathways is presented in appendix A4. ................................................................................................................. 52

Figure 3.5 Expression profiling of genes related to biosynthesis and signalling of plant hormones (a) ethylene, (b) ABA, (c) auxin, and (d) GA. Blue and red represent down and upregulated gene expression due to hexanal application in the FAZ at harvest. The left column shows the Malus domestica gene id, the middle column shows the gene expression with |log2foldchange| values, and the right column shows the corresponding gene id. Additional information on the hormone-related genes is presented in appendix A5. ................................................................................................................................. 56

Figure 3.6 Expression profiling of genes related to cell wall modification. Blue and red represent down-and upregulated gene expression due to hexanal application in the FAZ at harvest. The left column shows the Malus domestica gene id, the middle column shows the gene expression with |log2foldchange| values, and the right column shows the corresponding gene id. Additional information on the cell wall modification genes is presented in appendix A7. ............................................................................................. 59

Figure 3.7 qRT-PCR confirmation of gene expression pattern of selected eight genes representing (a–d) ethylene biosynthesis and signalling and (e–h) cell wall modification. The data represents the mean ± SE of four biological replicates and three technical replicates representing the samples harvested at commercial maturity from both commercial orchards. Fold change values were calculated based on 2−ΔΔCt method by Livak, and Schmittgen (2001). Means followed by asterisks indicate significant differences between control and hexanal formulation treatment based on unpaired t-test with Welch’s correction at α = 0.05. FPKM values of each gene were calculated from RNA-Seq reads counts normalized to a per million total reads counts. Genes and the primers are shown in the appendix A1. ......................................................................... 61

Figure 3.8 Proposed model of hexanal improved fruit retention in ‘Honeycrisp’ apples. Preharvest hexanal spray downregulated the expression of genes involved in ethylene biosynthesis in the FAZ and thus decreased the ethylene. Lower ethylene, in turn slows down the expression of the ABA biosynthesis genes and substantially minimize the ABA level in the FAZ. At the same time, GA biosynthesis genes were upregulated by hexanal and may enhance the GA concentration. Hence, the sensitivity of FAZ cells to ABA decreased. Parallelly, hexanal also downregulated genes related to cell wall degrading enzymes such as EG, PG, and expansins. Consequently, cell wall integrity of the FAZ cells improved in the treated fruit. Collectively, these events improved the fruit retention of the hexanal treated fruit. “Solid arrows represent known mechanism; broken arrows represent unknown mechanism; blue represent downregulation/decrease events, red represent upregulation/increase events”. ...................................................................... 68

Figure 4.1 Effects of preharvest sprays hexanal and HarvistaTM on ethylene in ‘Honeycrisp’ apple throughout 120 days postharvest. Each value represents the least-squares means ± SE of eight fruit. LS-means with the same letter are not significantly

XV

different when comparing treatments with days postharvest based on the Tukey-Kramer test at α = 0.05. ............................................................................................................. 83

Figure 4.2 Effects of preharvest sprays hexanal and HarvistaTM on phospholipase D (PLD) activity in ‘Honeycrisp’ apple throughout 120 days postharvest. Each value represents the least-squares means ± SE of nine replicates. LS-means with the same letter are not significantly different when comparing treatments with days postharvest based on the Tukey-Kramer test at α = 0.05. ................................................................ 84

Figure 4.3 Effects of preharvest sprays hexanal and HarvistaTM on (a) incidence and (b) progression of bitter pit (BP) in ‘Honeycrisp’ apple throughout 120 days postharvest. Incidence of BP was calculated based on visual observation on present or absent of BP signs in the fruit. Progression of BP was calculated based on the difference in incidence of BP between 0 days postharvest and 120 days postharvest. Each value represents the least-squares means ± SE of three replications, and each replication had 14 fruit. LS-means with the same letters are not significantly different when comparing treatments with days postharvest based on the Tukey-Kramer test at α = 0.05. ........... 85

Figure 4.4 The effects of preharvest sprays on variations in color parameters (a-c) of blush and (d-f) of background of ‘Honeycrisp’ throughout the cold storage (2.5 oC). L indicates the brightness in the CIE lab system readings. Chroma and Hue angel were calculated using the software available at http://www.easyrgb.com (accessed 5, August 2020). Each value represents the least-squares means ± SE of eight fruit. LS means with the same letter are not significantly different when comparing treatments with days postharvest based on the Tukey-Kramer test at α = 0.05. ............................................. 88

Figure 4.5 Effects of preharvest sprays hexanal and HarvistaTM on gene expression of two αPLD genes (a,b) and four calmodulin genes (c–f) in ‘Honeycrisp’ apple throughout 120 days postharvest. Transcript levels at all storage time points were expressed relative to their transcript level at 0 days postharvest. Each value represents the mean ± SE of three apples, with three replicates normalized against the housekeeping genes MdAct and MdHis3. Means with the different letters at the same storage time indicate significant differences among control, hexanal and HarvistaTM treatments based on the Tukey-Kramer test at α = 0.01 ....................................................................................... 90

Figure 5.1 (a) the two apples of the left have BP symptoms with a rating of 1 during the assessment. (b) apples on the right did not have bitter pit symptoms and were rated as 0 during the assessment. ............................................................................................ 101

Figure 5.2 A representation of six severity categories in BP. The image on the left end shows no BP symptoms, while the image on the right end shows severe BP. The white line represents a scale of 1 cm. ................................................................................... 103

Figure 5.3 Effects of a preharvest spray of hexanal on the incidence of BP in ‘Honeycrisp’ apples during 120 days of storage. Each value represents the mean ± SE of ten replications (each replication had 40 fruit). Means with an asterisk at the same

XVI

storage time indicate a significant difference between control and hexanal treatments based on the Tukey-Kramer test at α = 0.05. .............................................................. 106

Figure 5.4 Effects of preharvest hexanal spray on the progression of BP in ‘Honeycrisp’ apples during 120 days of storage. The progression of BP has calculated as the percentage difference between the incidence of BP on day X and day 0. Means with an asterisk at the same storage time interval indicate a significant difference between control and hexanal treatments based on the Tukey-Kramer test at α = 0.05. ............ 107

Figure 5.5 Effects of preharvest spray hexanal on the severity of bitter pit (BP) in ‘Honeycrisp’ apples during 120 days of storage. The severity of BP was calculated based on a visual scale ranking system, where 0 - no signs of BP, 1 – minimal signs of BP, 2 – localized signs of BP, 3 – signs of BP spreading, 4 – signs of BP surrounding calyx and 5 - deepening signs of BP ........................................................................... 109

Figure 5.6 Effects of preharvest spray of hexanal on percentage of marketable fruit in ‘Honeycrisp’ apples after storage at 120 days postharvest. Marketable fruit were defined as those fruit with a bitter pit rating of 0 or 1 on a 0 to 5 rating scale. ......................... 110

XVII

LIST OF ABBREVIATIONS

1-MCP 1-Methylcyclopropene

1-NAA 1-Naphthaleneacetic acid

a* Red/green (colour measurement)

ABA Abscisic acid

ACC 1-Aminocyclopropane1-carboxylic acid

ACO 1-aminocyclopropane-1-carboxylic acid oxidase

ACS 1-aminocyclopropane-1-carboxylic acid synthase

ANOVA Analysis of variance

AVG Aminoethoxyvinylglycine

b* Blue/yellow (colour measurement)

BP Bitter pit

BR Brassinosteroids

CA Controlled atmospheric storage

Ca2+ Calcium

CaM Calmodulin

CTR1 Constitutive triple response 1

DEGs Differentially expressed genes

DPH Days post-harvest

EdgeR Empirical analysis of digital gene expression data

EG Endo-glucanases

EIN2 Ethylene insensitive 2

ERF Ethylene response factor

ERS Ethylene response sensor

ETR Ethylene resistant

XVIII

EXP Expansin

FAZ Fruit abscission zone

FSC Food supply chain

GAs Gibberellins

GO Gene ontology

GRAS Generally regarded as safe compound

IAA Indole-3-acetic acid

IEC Internal ethylene concentration

JA Jasmonic acid

L* Brightness (Colour measurement)

LPE Lysophosphatidylethanlamine

PC Phosphatidylcholine

PFD Preharvest fruit drop

PG Polygalacturonase

PGRs Plant growth regulators

PLD Phospholipase D

PM Plasma membrane

PME Pectin methylesterase

SA Salicylic acid

SAM S-adenosylmethionine

TMM Trimmed mean of M-values

TSS Total soluble solids

UPLC-MS Ultra-performance liquid chromatography-mass spectrometry

XIX

LIST OF APPENDICES

Appendix A1: Preparation of hexanal formulation …………………….………………..140 Appendix A2: Forward and reverse primer details of the selected genes in the ethylene biosynthesis and signaling pathway and cell-wall re-modelling………………………...141

Appendix A3: Summary results of the RNA-Seq run……………………………………142

Appendix A4: List of Differentially expressed genes between hexanal and control FAZ at commercial maturity of ‘Honeycrisp’ apples……………………………………………143

Appendix A5: Detail information of enriched biological processes (BP), cellular components (CC) and molecular functions (MF)…………………………………………176

Appendix A6: Detail information of the differentially expressed genes related to various phytohormones……………………………………………………………………………….207

Appendix A7: Detail information of the differentially expressed genes that are putatively encoding different transcription factors…………………………………………………….211

Appendix A8: Detail information of the differentially expressed genes that are related to cell wall remodeling….……………………………………………………………………….215

Appendix A9: Compound microscopic view of fruit-AZ cells sampled at the end of the fruit retention study (49 days after harvest) ………………………………………………217

Appendix B1: Primer sequence of genes putatively encoding phospholipase D and calcium sensor proteins …………………………………………………………………….218

Appendix B2: Effects of preharvest sprays on fruit quality traits fresh weight, firmness and TSS in ‘Honeycrisp’ apples after removal from cold storage (2.5 oC) to room temperature storage (~20 oC)………………………………………………………………219

1

1 CHAPTER ONE: INTRODUCTION

The global population is expected to reach almost 10 billion in 2050 (FAO, 2009). The

predicted population increase will necessitate a 30-70% increase in food production over

the next three decades (FAO, 2019). Hence, increase in food production is a primary topic

of discussion in agriculture due to maintaining the balance between food and nutritional

security and long-term sustainable development. Generally, scholars propose solutions

to sustainably feeding the next generation by "reducing 'yield gaps' on underperforming

lands, increasing cropping efficiency, shifting diets, and reducing food waste" (Foley et

al., 2011; Willett et al., 2019).

Currently, food waste is the most common food production catastrophe. About one-

third of food produced for human consumption is discarded, degraded, or consumed by

pests along the food supply chain (FSC) (Gustavsson et al., 2011; Alexander et al., 2017).

Globally an estimated 14% of food worth 400 billion USD is lost between harvest and

distribution of the FSC (FAO, 2019). At the same time, an estimated 17% of food is wasted

at the later stages of the FSC (10% in households, 5% in foodservice and 2% in retail)

(UN Environment, 2020). Among the agricultural commodities, fruits and vegetables

represent the second-highest food loss group (21.6%) (FAO, 2019). The huge food

wastage in this food group is a challenge in the world that not only undermine the food

security and create environmental issues like greenhouse gases, but also, currently the

2

world faces a chronic shortage of fresh fruits and vegetables (KC et al., 2018) which

exactly the ingredients we should all be consuming more of as they play a substantial role

in agriculture production (Elik et al., 2019) and a healthy and balanced diet (Boeing et al.,

2012).

Apples (Malus domestica Borkh.) are one of the most economically valued fruit crops.

In 2019, the world's apple production volume reached 87.24 million metric tons and

ranked third for global fruit production (Statista, 2021). The global apple production is

primarily focused on the high-value fresh market. Hence, harvesting at optimal maturity

is essential to maintain fruit quality during long-term storage and shipping (McCluskey et

al., 2007; Greene et al., 2014). However, apple trees tend to shed fruit early in the ripening

phase before horticultural maturity causing huge economic loss to producers (Arseneault

and Cline, 2016). This type of fruit drop is often referred to as preharvest fruit drop (PFD),

which can occur in several important apple cultivars and cause yield losses up to 30% at

the beginning of the harvest period (Byers, 1997; Schupp and Greene, 2004; Arseneault

and Cline, 2017).

Similarly, the development of storage disorders, degradation of phytochemical

compounds and breakdown of the cellular membrane due to accelerated ripening reduce

the market value and consumer appeal of apples (Lara et al., 2014). Consequently, it

causes up to 50% postharvest yield losses (Watkins et al., 2004). The severity of PFD

3

and storage issues are cultivar-specific and influenced by several other factors, including

orchard and climate (Robinson, 2011).

In Canada, apples continued to lead the fruit sector in terms of production volume,

representing 40% of the total marketed production of Canadian fruit in 2019 (AAFC,

2020). In the same year, Ontario was responsible for 39% of Canada's total apple

production (Statista, 2018). Roughly 12% of apples grown in Ontario are 'Honeycrisp'

(OAG, 2020). 'Honeycrisp' is a premium apple cultivar that earns almost double fresh

market grower income ($ 0.78/lb) compared to other potential cultivars like ‘McIntosh’ ($

0.26/lb), ‘Gala’ ($ 0.4/lb), and ‘Golden Delicious' ($ 0.35/lb) (OAG, 2020). Although

growing 'Honeycrisp' can be a profitable venture, the cultivar is more prone to PFD, highly

susceptible to several serious physiological problems, including the development of bitter

pit (BP) and decline in quality during long-term storage. PFD in 'Honeycrisp' causes yield

losses of almost 50% in some years (Arseneault and Cline, 2017). In addition, in many

young plantings, more than 50% of 'Honeycrisp' fruit develop BP before harvest or during

storage, leaving the apples unmarketable (Rosenberger et al., 2004). BP is a

physiological disorder that is characterized by small dark depressions mostly found in the

cortical flesh on the calyx end of the fruit, resulted from fruit calcium deficiency (Garman

and Mathis, 1956). At the cellular level, depletion of calcium (Ca2+) within the apoplast

weakens the plasma membrane, increasing the cellular ion leakage and cell death leading

4

to BP symptoms. The application of calcium sprays throughout the growing season is

common practice to mitigate BP.

Application chemicals such as plant growth regulators (PGRs)

(aminoethoxyvinylglycine (AVG; ReTain), 1-methylcyclopropene (1-MCP; HarvistaTM), 1-

naphthaleneacetic acid (1-NAA)), and foliar calcium sprays (CaCl2) are continuously used

within the apple industry. These agrochemicals are commonly used as preharvest sprays

to control the PFD and BP (Robinson, 2011; Arseneault and Cline, 2017). Likewise,

longevity protection technologies such as preconditioning, modified atmosphere storage,

controlled atmosphere storage, wax coatings used as postharvest applications during

long-term storage to mitigate the storage disorders and improve the quality traits of apples

(Fan et al., 1999; Watkins et al., 2004; Chiu et al., 2015; DeEll et al., 2016). Although

these technologies are utilized regularly, they lack consistent results (Green, 2009;

Watkins et al., 2012; Watkins et al., 2019) and do not assist in the preservation of

membranes (Sakaldas et al., 2015). In addition, some of these technologies are not freely

available in many developing countries, including major apple producers like India, Iran,

Turkey, and Chile (FAO, 2017). Therefore, suitable technologies to enhance the fruit

retention and postharvest shelf life of apples are in high demand.

Recent technological advances in inhibiting phospholipase-D (PLD) are a promising

strategy to improve longevity in apples. PLD is a key membrane degradation enzyme that

acts on the phospholipids and initiates a cascade of catabolic events that leads to

5

membrane deterioration during ripening (Paliyath and Droillard, 1992; Paliyath et al.,

2008). Downregulation of PLD can occur with the application of hexanal (Paliyath et al.,

2003; Paliyath and Murr, 2007). Hexanal, a naturally occurring C6 volatile aldehyde, is a

strong inhibitor of PLD activity (Paliyath et al., 2003). The Food and Drug Administration

approved hexanal as a food additive and is generally regarded as a safe compound

(GRAS).

Application of hexanal as an aqueous formulation at the preharvest stage has shown

promising results in improving fruit retention in several fruit, including mango (Anusuya et

al., 2016), raspberry (El Kayal et al., 2017), and orange (Samwel et al., 2021). Likewise,

hexanal also extended shelf life in several fruit, including sweet cherry (Sharma et al.,

2010), guava (Gill et al., 2015), nectarine (Kumar et al., 2018), and apple (DeBrouwer et

al., 2020). However, despite its promise in improving fruit retention and postharvest

quality, there is no information on how hexanal regulates the fruit abscission and improves

postharvest quality in fruit crops, specifically in 'Honeycrisp'. Thus, hexanal technology

has potential to control fruit drop and improve postharvest qualities in 'Honeycrisp' apples.

6

2 CHAPTER TWO: LITERATURE REVIEW

2.1 Apple Origin and Varietal Evolution

Apple (M. domestica Borkh.) is cultivated globally and is the most widely grown species

in the genus Malus. The ancestor of the modern apple is believed to be M. sieversii, which

is native to the Tien Shan Mountain range of central Asia. Over thousand years of

breeding and cross-pollination, M. sieversii evolved into M. domestica (Juniper et al.,

1996). The M. domestica's genetic diversity is immense, and there are more than 7,500

known cultivars of apples and are bred for different purposes, including eating raw,

cooking and cider production (Harris et al., 2002). With the technological advances in

breeding, globally, apples have become one of the economically important fruit crops and

ranked third in production volume. Currently, China, the United States and Turkey are

leading in production (FAO, 2017). In Canada, apples lead in fruit crop production and

fruit farm gate value, generating 240 million Canadian dollars in 2019 (AAFC, 2020)

Apple production in the United States and Canada has evolved greatly since the

early 1800s. However, the diversity of apples present in grocery stores and farmer's

markets has diminished recently. For example, in the US, during the mid-20th century,

commercial apple farming has narrowed and focused on a small list of cultivars, such as

'Granny Smith', 'McIntosh' and 'Red Delicious' (Spaventa, 2020). At the same time, as

fresh fruit became a more popular snack, the popularity of these cultivars has started to

7

fade as these cultivars were bred for yield. Instead, younger consumers are driving

demand for "premium" cultivars such as 'Gala' and 'Honeycrisp' that feature a unique

flavor, crunch, and colour (Herrick, 2016). 'Honeycrisp' is perhaps the best example for

innovations in breeding and marketing new apple cultivars (Gallardo et al., 2015).

2.2 'Honeycrisp' Apple

'Honeycrisp' apple is developed at the Horticultural Research Centre of the Minnesota

Agricultural Experiment Station at the University of Minnesota. The cultivar was released

in 1991(Luby and Bedford, 1990). By that time, it was stated that the apple cultivars

'Macoun' and 'Honeygold' were the parents of 'Honeycrisp' (Luby and Bedford, 1990).

However, later genetics studies verified that the cultivar 'Keepsake' was one parent of

'Honeycrisp' and 'Duchess of Oldenburg' and 'Golden Delicious' were identified as

grandparents through the unknown parent (Howard et al., 2017).

'Honeycrisp' is a medium to large-sized apple (7-9 cm diameter) with a light

green/yellow background with a red-orange blush (Cabe et al., 2005; Cline and Gardner,

2005). These bi-colour apples develop redder blush colour ranging from 50-90% in cooler

climate regions (Schupp et al., 2001; Cline and Gardner, 2005). The flesh is cream and

does not oxidize and does not turn brown readily when this apple is sliced. The fruit has

8

a distinctively crisp texture and maintains a good balance between sweetness and acidity.

These favorable characteristics are creating high demand for 'Honeycrisp' apples.

Although the 'Honeycrisp' apple can be profitable, the cultivar is challenging to

manage in the orchard or during postharvest storage. The cultivar is known for a strong

tendency toward biennial bearing, which can cause poor quality small apples in heavy

bloom years (Embree et al., 2007). Harvesting 'Honeycrisp' at optimum maturity can be

challenging as the maturity indices such as ethylene, starch, soluble solids, and firmness

are not always good indicators of the best time to pick (Cline and Gardner, 2005;

Robinson et al., 2009). Therefore, growers follow a set of indices suited to their growing

region. For example, the Ontario Ministry of Agriculture and Rural Affairs (OMAFRA),

Canada, has developed a maturity guideline for 'Honeycrisp' harvesting decisions,

including starch index is at least 6 (on the Cornell chart), 13.5 lb minimum firmness, and

at least 13% soluble solids, and ground colour change from green to yellow (Cline and

Gardner, 2005). 'Honeycrisp' typically matures around mid-September in Ontario.

However, multiple harvesting is essential because of uneven fruit maturity. Unfortunately,

late harvest dates to achieve greater red colour are undesirable as the fruit quality traits

such as firmness, taste and storage potential can be compromised (Cline and Gardner,

2005; Watkins et al., 2005). Although the harvesting time is imperative for 'Honeycrisp',

PFD causes about 30% to 50% yield losses. Methods and strategies to prevent the PFD

in 'Honeycrisp' have been highly studied (Schupp et al., 2001; Watkins et al., 2004;

9

Robinson et al., 2011). However, viable options for improving fruit retention should be

assessed to address this issue.

In addition to issues in the orchard, storing 'Honeycrisp' apples are also challenging

to producers due to quality decline and development of postharvest disorders, including

low-temperature breakdown (soggy breakdown), BP and soft scald (Watkins et al.,

2005; DeEll and Ehsani-Moghaddam, 2010; Watkins and Nock, 2012). All three disorders

are linked with a late harvest. The application of calcium is highly recommended to control

these disorders. However, BP itself causes more than 50% postharvest yield loss. Storing

apples at control atmospheric storage does not work well for 'Honeycrisp' due to the high

incidence of development of above storage disorders (Cline and Gardner, 2005).

Therefore, new methods to improve the quality and reduce storage disorders are urgently

needed.

2.3 Physiology of Apple Fruit Ripening

Apple fruit development is divided into four partially overlapping stages named as cell

division, cell expansion, maturation, and ripening (Dong et al., 1997). Fruit maturation

and ripening are the last important steps in which apple reaches its full size and acquires

the competence to ripen even without the support of the mother plants. The relative

progression of each stage is controlled by a complex network of both endogenous and

10

exogenous factors. Hormones are one of the endogenous factors that play a pivotal role.

As far as hormones are concerned, ethylene is extremely important in controlling many

processes of ripening (Eccher et al., 2014). With the onset of ripening, ethylene levels

increase and reach peak concomitant with respiration rate, which is called ‘climacteric

rise’ (Seymour et al., 2013). Apple is a climacteric fruit which requires ethylene for

ripening.

2.3.1 Hormonal Regulation in Apple Fruit Ripening

Phytohormone ethylene is a major cue that controls many aspects of apple fruit ripening

(Bapat et al., 2010). For example, the application of ethephon, an ethylene-releasing

compound, promoted ethylene production and apple fruit ripening (Li et al., 2016). While

1-MCP (an ethylene receptor blocker) significantly blocked ethylene production and

ripening in apples (Li et al., 2016). Although ethylene regulates fruit ripening, other

hormones such as abscisic acid, auxins, jasmonic acid (JA), and brassinosteroids (BR)

are also involved in the ripening process (Onik et al., 2018; Yue et al., 2020; Ji et al.,

2021).

11

2.3.1.1 Ethylene

Ethylene, a gaseous plant hormone, plays a central role in apple fruit ripening. Ethylene

production gradually increases with the onset of ripening reaches a peak and gradually

decreases; the fruit then moves into the ageing process (Li et al., 2016). Ethylene in fruit

is regulated by two well-known pathways: the ethylene biosynthesis pathway and the

signal-transduction pathway. Climacteric fruit possess two systems in ethylene

biosynthesis named system 1 and system 2. System 2 is responsible for the autocatalytic

increase in ethylene biosynthesis in the climacteric ripening phase (Van de Poel et al.,

2012). System 2 ethylene induces transcription of many ripening-related genes resulting

in the ripening of fruit (Maunders et al., 1987; Giovannoni, J., 2001). Ethylene

biosynthesis consists of two rate-limiting steps; in the first step, S-adenosylmethionine

(SAM) is converted into 1-aminocyclopropane1-carboxylic acid (ACC) by ACC synthase

(ACS). In the second step, ACC is oxidized by ACC oxidase (ACO) to form ethylene

(Kende, 1993). However, ethylene biosynthesis in fruit is a complex process involving the

cooperative action of multiple ACS and ACO genes. For example, out of three MdACS

genes (MdACS6, MdACS3a, and MdACS1), MdACS6 is expressed mainly during the

preliminary stage of apple fruit development, and its expression decreases before

maturation. However, at this time, the expression of MdACS3a is initiated. Likewise,

MdACS1 is abundantly expressed at the onset of ripening, and this gene is responsible

for ethylene production during apple fruit ripening (Sunako et al., 1999; Harada et al.,

12

2000; Tan et al., 2013). For example, MdACS1 silenced transgenic apples produced very

low ethylene, were significantly firmer and had longer shelf life than control fruit (Dandekar

et al., 2004). Previous studies have shown that ACO is another rate-limiting enzyme in

the ethylene biosynthesis pathway. MdACO1 silenced apples significantly inhibited

ethylene production and fruit softening (Dandekar et al., 2004).

Once ethylene is synthesized, it moves to the ethylene signaling transduction

pathway via binding to ethylene receptors (Guo and Ecker, 2004). Nine ethylene

receptors belonging to two receptor families (ethylene resistant – ETR; ethylene

response sensor - ERS) have been identified in apple. These receptors include

MdETR1, MdETR1b, MdETR2, MdETR5, MdETR101, MdETR102, MdETR105,

MdERS1 and MdERS2 (Ireland et al., 2012). All these receptor genes are expressed in

the apple fruit except MdETR101. Constitutive triple response 1 (CTR1) acts

downstream of the receptors as an on and off switch (Gao et al., 2003). Ethylene

insensitive 2 (EIN2) and EIN3-like (EIL) families act downstream positive responses to

ethylene and regulate transcription factors. Upregulated expression of MdEIL1 and

promoted fruit coloration have occurred in response to ethylene treatment (An et al.,

2018). Ethylene response factor (ERF) acts downstream to EIN3/EIL. ERF is a

secondary transcription factor (TF) that triggers ethylene progression. However, ripening

involved MdERFs needs to be further isolated by gene expression profiling. For

example, apple with MdERF2 silenced led to rapid fruit ripening, while MdERF2

13

overexpression led to delayed fruit ripening compared with the control fruit (Li et al.,

2016).

2.3.1.2 Abscisic acid (ABA)

Although ABA has long been described to be mainly involved in the ripening of non-

climacteric fruit, an increasing number of recent studies have proven that ABA also

regulates climacteric fruit ripening (Vendrell and Buesa, 1988; Buesa et al., 1994; Lara

and Vendrell, 2000; Zang et al., 2009; Mou et al., 2018). ABA concentration in apples is

low in green fruit but increases towards maturation and ripening and reaches a peak just

before commercial harvest (Vendrell and Buesa, 1988; Lara and Vandrell, 2000). For

example, the ABA concentration of ‘Red Winesap’ apple changes from 100-120 ng/g FW

at green fruit stage to 230-240 ng/g FW at maturation and reaches a peak at commercial

harvest (300 ng/g FW) (Vendrell and Buesa, 1988). Vendrell and Buesa (1988) also

showed that maximum endogenous ABA preceded ethylene burst in apple fruit. Later

studies also demonstrated this pattern in apple (Lara and Vendrell, 2000) and other

climacteric fruit, including tomato (Zang et al., 2009; Mou et al., 2016). These findings

suggest that ABA may be the other regulatory factor that acts upstream for ethylene in

apple fruit ripening.

Several pieces of evidence suggest the involvement of ABA in apple fruit ripening.

Onik et al. (2018) found overexpression of an ABA biosynthetic gene (MdNCED1), a

14

signalling gene (MdPP2C) and downregulation of several genes encoding serine or

threonine protein kinases at the post-ripening stage. The authors suggest that ABA may

mediate protein-phosphorylation modification to affect apple ripening. However, the

mechanisms that might explain how ABA regulates these processes are unclear.

2.3.1.3 Other Phytohormones

In general, ABA and gibberellins (GAs) are two groups of phytohormones, which

antagonistically mediate several plant developmental processes, including fruit ripening.

Among the several hundred plant GAs, only GA1, GA3, GA4 and GA7 are bioactive in

higher plants. GA1 and GA4 are highly abundant within these bioactive forms, while GA3

and GA7 are less abundant (Li et al., 2019). During tomato fruit development,

accumulation of GAs was observed at the immature stage but then decreased to a low

concentration during fruit ripening (Li et al., 2019). However, knowledge on GA regulating

apple fruit ripening is very limited. Ji and Wang (2021) found that the application of GA3

substantially suppressed ethylene production in apples. Also, an APETALA (AP2) family

gene, MdRAV1, is activated by the GA3 application in apple. Whereas silencing MdRAV1

in apple fruit led to more rapid fruit ripening compared to control.

Auxin is another phytohormone, which also acts as a fruit ripening regulator. Indole-

3-acetic acid (IAA) is the most abundantly present auxin (Buta and Spaulding, 1994). IAA

is extremely high during the initial growth and development of fruit. However, it tends to

15

decline to a low level at the onset of ripening. External application of naphthalene acetic

acid (NAA, a synthetic auxin) promoted ethylene production and ripening in apples (Yue

et al., 2020). An auxin TF, MdARF5, was identified as a positive regulator of apple fruit

ripening (Yue et al., 2020).

JA concentration was high during early fruit development and then gradually

decreased until maturation. However, the concentration of JA steadily increased again

shortly before the maturation of apple fruit (Kondo et al., 2000). External application of JA

(methyl jasmonate – MeJA) increased ethylene production (Li et al., 2016), enhanced fruit

colour (Liu et al., 2018), and accelerated ripening (Rudell et al., 2005). BRs are steroid

hormones that suppress fruit ripening and senescence. The application of epibrassinolide

(EBR, 3 µM) suppressed ethylene production and maintained firmness during apple

storage (Ji et al., 2021). On the contrary, brassinazole (Brz, 10 µM), an inhibitor of BR

biosynthesis, enhanced ethylene production and reduced firmness in apples (Ji et al.,

2021).

16

Figure 2.1 Schematic diagram of hormonal changes during maturation and ripening of

apples. Adapted from Eccher et al. (2014).

2.3.2 Effect of Fruit Ripening on Fruit Abscission

Fruit ripening positively correlates with fruit abscission. Fruit abscission is an irreversible,

complex, developmentally regulated and genetically programmed process in which cell-

separation occurs within the fruit abscission zone (FAZ) (König, 1994; Nakano et al.,

2012). FAZ is located at the pedicel-spur junction, often referred to as the constriction

zone (McCown, 1943). There are four key events associated with the abscission process:

abscission zone cell differentiation, induction for response to developmental changes in

17

metabolism, cell separation and development of protective layer. Taylor and Whitelaw

(2001) have mentioned that "perception of changes in metabolism by FAZ cells induces

abscission accompanied by hydrolases to initiate cell separation". The stimuli primarily

the phytohormones, which bind to receptors on the cell to trigger a signal transduction

pathway. Signal perception leads to gene expression that triggers the formation of cell

wall hydrolases. The hydrolases catalyze cell wall breakdown contributing to fruit

detachment at the FAZ, and eventually, the fruit detaches and falls (Addicott, 1982).

In the northern hemisphere, there are two types of fruit drop that have been

identified in apples. The first period of fruit drop occurs 5-6 weeks after full bloom, and

this type of fruit drop is referred to as 'June drop' (Luckwill, 1948). The second period of

fruit drop begins approximately 3-4 weeks before harvest and continues throughout the

harvesting period, referred to as preharvest fruit drop (PFD). PFD in apples causes yield

losses of about 30% at the beginning of the harvest.

2.4 Physiology of Preharvest Fruit Drop in Apple

Preharvest fruit drop occurs early in the ripening phase before horticultural maturity can

occur in several important apple cultivars. The severity of the PFD is cultivar-specific and

influenced by several factors, including soil and plant mineral nutrients, summer pruning,

water availability, temperatures during the growing season and internal ethylene

18

concentration. Cultivars have been classified based on their propensity to drop fruit as

less prone, intermediate, and more prone (Irish-Brown et al., 2011). A previous study by

Arseneault and Cline (2017) in ‘Honeycrisp’ observed that PFD (cumulative value) due to

abscission varied from 10-50% based on the location and orchard. Also, PFD is

comparatively lower before commercial harvesting, but this issue is exacerbated when

harvesting is extended. For example, around 50% PFD has been observed in

'Honeycrisp' when the fruit is left on the tree for better colour development (Robinson et

al., 2011).

2.4.1 Influence of Plant Hormones in Preharvest Fruit Drop in Apple

Plant hormones act as chemical messengers that influence plant growth and

development. Generally, plant hormones such as ethylene and ABA promote the

abscission process while auxins and gibberellins inhibit abscission (Addicott, 1982;

Estornell et al., 2013). Several studies using various crops, including apples have

supported the theory that auxin decline, and ethylene increase are key signals in

abscission (Thompson and Osborne, 1994; Vriezen et al., 2008).

Ethylene appears to be closely associated with abscission. Higher internal ethylene

concentration (IEC) was closely associated with PFD in apples (Greene et al., 2014).

Further, climacteric ethylene rise may not be a prerequisite for abscission (Sun et al.,

19

2010). However, exogenous application of ethylene just before harvest markedly

increased fruit abscission in apples (Robinson and Lopez, 2010). During ripening, 'Golden

Delicious’, a PFD-prone cultivar showed enhanced ethylene production and upregulated

MdACS5a and MdACO1 gene expression in FAZ compared to non-prone cultivar, 'Fuji'

(Li et al., 2010). Although an association of ethylene with abscission is apparent, ethylene

may not be the sole factor that controls abscission. For example, IEC of abscission-prone

apple fruit accessions greatly varied from 0.03 µl/L to 900 µl/L, whereas accessions

characterized by non-abscising fruit also produced ethylene up to 580 µl/L (Sun et al.,

2009; Harb et al., 2012).

Perception of ethylene by the FAZ cells is essential to proceed with cell separation

in a localized area of the FAZ. AZ of the vascular plants has type II target cells and

expands in response to ethylene compared to neighboring cells (McManus, 2008). PFD

in apple coincides with upregulated ethylene receptors such as MdETR2, MdERS2 in the

FAZ (Li et al., 2010). However, the authors mentioned that this observed association is

controversial to the model that ethylene receptors negatively regulate ethylene response

(Li et al., 2010) and there is an inverse relationship between receptor levels and ethylene

sensitivity of a tissue (Hua and Meyerowitz, 1998). Lowered sensitivity of the receptors

increases the concentration of a hormone required to activate a response. Eccher et al.

(2015) predicted an inverse relationship where low receptor abundance contributes to

high ethylene sensitivity because the receptors require less ethylene to be saturated.

20

The phytohormone ABA was previously linked to abscission and subsequently

named for this association (Schwartz and Zeevaart, 2009). Although ABA accelerates

ripening, its role in abscission remains unclear. However, earlier studies have observed

an upregulated ABA during floral organ abscission in Arabidopsis (Ogawa et al., 2009)

and PFD in Olive (Gil-Amado and Gomez-Jimenez, 2013). It has been suggested that

ABA acts as a modulator of ACC and therefore stimulates ethylene biosynthesis, leading

to increased abscission (Guinn, 1982; Wilmowicz et al., 2016).

Auxin also appears to be involved in fruit abscission and interacts with ethylene. The

ethylene-auxin interaction in fruit abscission may be appropriate in terms of gradient

rather than the absolute concentration (Addicott et al., 1955). For example, phloem

girdling, and polar auxin transport inhibitor applied to sweet cherry resulted in 30% more

abscised fruit than untreated control (Blanusa et al., 2005). The role of auxin in PFD in

apple is poorly understood.

2.4.2 Involvement of Cell Wall Hydrolases in Preharvest Fruit Drop in Apple

Although there is a lack of direct link between fruit ripening and abscission, the extensive

changes in the ripening process and fruit abscission often occur concurrently (Addicott,

1982). A parallel increase in ethylene production as well as genes and enzymes related

to cell wall degradation in the FAZ suggests a relationship between ethylene and

21

hydrolase production. As a result, the middle lamella of the abscission zone cells

collapses completely, and eventually, the organ abscises (Roberts et al., 2002). For

example, the application of 1-MCP to the 'Golden Delicious' apple suppressed MdPG2

and MdEG1 gene expressions during ripening (Yuan and Li, 2008). 1-MCP inhibited

abscission and the activity of several hydrolyses in the AZ of Dendrobium flowers. These

hydrolases include pectin methylesterase (PME), polygalacturonase (PG), β-1,4

glucanase, and β-galactosidase (β-GAL). A study by Wu and Burns (2004) also detected

a β-galactosidase mRNA during mature fruit abscission of 'Valencia' orange.

The above studies have identified various hydrolases during fruit abscission by

studying individual gene expression. However, recent transcriptomic studies helped in

identifying the gene expression of several genes encoding multiple family protein

hydrolases. For example, Corbacho et al. (2013) have identified 79 differentially

expressed genes that encode various proteins related to cell-wall remodeling during

mature fruit of abscission. Likewise, a set of genes involved in cell wall remodeling in

citrus FAZ were identified (Merelo et al., 2017). However, there is no information on global

gene expression related to cell wall modification and how it might affect PDF in apples.

22

2.5 Role of Calcium in Ripening and Storage

2.5.1 Role of Calcium in Cell Wall Structure

Calcium (Ca2+) plays a pivotal role in the cell wall structure as approximately 60-75%

of calcium is mainly localized in the cell walls of plant tissues (Demarty et al., 1984). Ca2+

also links with pectin and form a gel-like structure, creating a cell-to-cell cohesive barrier

that maintain cell wall stability of plant tissues (Gilliham et al., 2011; Hocking et al., 2016).

Ca2+ in the fruit cell wall forms an egg-box structure with homogalacturonan and helps

maintain the cell wall structural integrity (Hocking et al., 2016). Moreover, it was

hypothesized that local extracellular Ca2+ affects the loosening and separation of the cell

wall. Cell wall integrity plays a substantial role in the prevention of physiological disorders.

For example, many agricultural crops are susceptible to physiological disorders that

originate from a low concentration of Ca in fruit which reduces cell-wall strength,

resistance to biotic and abiotic stress, and inhibits necessary cell signaling (de Freitas

and Mitcham, 2012).

2.5.2 Fruit Calcium Transport

Ca2+ is a biologically active ion, and its concentration and transport must be tightly

controlled within plant tissue down to the level of cellular and extracellular compartments.

The rate of xylem water mass flow, the competition between ions for binding sites in xylem

vessel walls and pit membranes, formation of low soluble complexes such as calcium

23

oxalate and cellular water ionic transport mechanisms can greatly influences Ca2+

delivery and distribution to fruit (Barberon and Geldner, 2014). Moreover, long-distance

Ca2+ transport also influences fruit Ca2+ levels.

Ca2+ uptake usually occurs through roots and is then delivered to the xylem via

one of the three potential pathways: apoplastic pathway, symplastic pathway, and

coupled trans-cellular pathway (Gilliham et al., 2011; Barberon and Geldner, 2014). The

apoplastic pathway transports water and nutrients, including Ca2+, to the stele via the

epidermis and cortex's free spaces and cell walls (Barberon and Geldner, 2014).

However, if any barriers occur, the nutrients access to the stele is done via the

endodermal plasma membrane (PM) using a short symplastic pathway. The symplastic

pathway is a controlled passage to the shoot where transportation occurs using cell-to-

cell connection via plasmodesmata (Hocking et al., 2016). Ca2+/ATPases, Ca2+/H+

antiporters in the PM help pump the Ca2+ from the symplast into the stele (White and

Broadley, 2003; Barberon and Geldner, 2014). In the trans-cellular pathway, nutrients

moved from cell to cell using influx and efflux transporters through paracellular

conveyance (Barberon and Geldner, 2014). Ca2+ accumulation relies on the xylem

stream, which is dependent on the level of transpiration. In addition, Ca2+ deficiencies are

a consequence of low Ca2+ mobility at the local tissue level (Montanaro, 2005; Hocking et

al., 2016).

24

2.5.3 Calcium and Bitter Pit Development in Apple

The development of BP disorder is highly related to PM breakdown and cell death (de

Freitas et al., 2010). A decrease in Ca2+ within the apoplastic pool causes leakage in the

PM and creates pits within the tissue, leading to the lesions/depressions seen with BP

(de Freitas et al., 2010; Hocking et al., 2016). Previously, it was hypothesized that a low

level of total Ca2+ was correlated with BP development. However, later studies have found

that the relation of Ca2+ to other nutrients such as potassium, magnesium, and nitrogen

also have implications for development of BP. Miqueloto et al. (2014) found that an

increase in severity of BP is correlated with a low Ca2+ content within the peel and flesh

in response high magnesium, nitrogen, and potassium. Xylem function decreases as the

growing season progresses mainly due to the expansion of the apple flesh, resulting in a

lack of Ca2+ mobility and development of BP (Saure, 2005).

Ca2+ and water absorbed by the roots move into the xylem and then to mature

leaves. It is taken up into fruit until mid-July, after which and then there is very little

transport of Ca2+ into the fruit. As the fruit grows, Ca2+ is diluted within the fruit (Bender,

2016). Cultivar ' Honeycrisp' is more vulnerable to BP because the fruit has higher K: Ca,

Mg: Ca, P: Ca ratios in both peel and flesh than 'Gala'. Foliar application of Ca2+ sprays

to increase fruit Ca2+ concentrations during the time of fruit enlargement is one of the

recommended orchard practices to mitigate the development of BP.

25

2.6 Longevity protection technologies in apple

2.6.1 Ethylene Control Technologies

Plant hormone ethylene is a key regulator of fruit ripening and abscission. Therefore,

controlling ethylene activity by following safe and effective approaches is the key to

extending fruit' postharvest life. Many ethylene controlling technologies have been

adopted in the apple industry, including ethylene synthesis suppression and receptor

blocking. The application of plant growth regulators (PGRs) or plant bioregulators (PBRs)

are commonly used chemicals at pre and postharvest stages. However, some PGRs

control auxin and other phytohormones (Li and Yuan, 2008; Cline, 2019). The application

of PGRs such as AVG, ReTain, 1-MCP, and HarvistaTM which can suppress ethylene

biosynthesis and reception are commonly used within the apple industry (Yuan and

Carbaugh, 2007; Greene, 2009; Watkins et al., 2012; DeEll et al., 2016). For example,

AVG and 1-MCP substantially reduced the ripening and PFD in the 'Brisbee Delicious'

apple (Yuan and Li, 2008). Likewise, the application of 1-MCP reduced the ethylene

production, and postharvest disorders during long-term storage of apples (Watkins et al.,

2004; DeEll et al., 2007, DeEll et al., 2008). Storing apples in cold temperature (2.5 oC to

3.0 oC) is a common practice to maintain quality longer-term (Cline, 2009). Although

control atmosphere storage is good for apple storage, it does not work for certain cultivars

like 'Honeycrisp' due to the development of storage disorders (Watkins et al., 2004; Chiu

et al., 2015; DeEll et al., 2016).

26

The efforts to suppress ethylene and the expression of ethylene-related genes using

PGRs effectively worked only in combined applications (Greene, 2009; Robinson et al.,

2011). Moreover, inconsistent results were observed among the quality traits (Watkins et

al., 2004; Watkins et al., 2010). For example, although 1-MCP treatments are commonly

used at pre and postharvest stages for additional preservation, variable in results were

observed in quality traits such as firmness (Watkins et al., 2010), starch indices (Robinson

et al., 2010), colour (Tiwari and Paliyath, 2011) and quality. Moreover, these technologies

did not assist in preserving the membrane, thus warranting new methods and strategies

to enhance fruit retention and postharvest qualities of apple.

2.6.2 Membrane Preservation Technologies

Most of the current longevity protection technologies to preserve the horticultural produce

are primarily focused on controlling ethylene or the elements of its pathway. However,

metabolite channeling from degradative biochemical pathways into quality enhancing

pathways can improve quality characteristics and increase the shelf life. Thus, if the

membrane can be preserved by reducing membrane lipid degradation, shelf life can be

potentially enhanced. Phospholipase D is a ubiquitous enzyme responsible for initiating

membrane phospholipid catabolic cascade and eventually leads to the senescence

process. The previous studies on inhibiting PLD during ripening and senescence in

27

various fruit and vegetables have led to successful PLD inhibition technologies. For

example, application of lysophosphatidylethanolamine (LPE) to apple (Farag and Palta,

1991c), banana (Ahmed and Palta, 2016), cranberries (Özgen et al., 2005), and

strawberries (Choi et al., 2016) inhibited PLD activity, enhanced postharvest qualities,

and shelf life. Although the exogeneous application of LPE is widely used and can help

preserve fruit, its mode of action is poorly understood (Amaro and Almeida, 2013).

The active site of the PLD enzyme consists of 2 HKD motifs that hydrolyze

phospholipids in a two-step process generating a PLD-phosphatidate intermediate.

Further action of this complex at the aqueous medium produces downstream molecule

phosphatidic acid (PA). PA is a lipid secondary messenger responsible for the

continuation of downstream membrane degradation events. However, when the PLD-

phosphatidate intermediate reacts with primary alcohol, it will produce phosphatidyl

alcohol instead of PA. Many aliphatic primary alcohols and aldehydes can inhibit PLD

activity (Paliyath et al., 2008). These compounds inhibited soluble and membrane forms

of PLD (Paliyath et al., 2008).

28

Figure 2.2 General schematic representation of (a) PLD accumulation causing

membrane degradation and (b) primary alcohols/aldehydes inhibits PLD accumulation to

slow down membrane degradation. The schematics processes were based on Paliyath

et al. (2008).

2.6.2.1 PLD Inhibition by Hexanal Formulation

Hexanal, a primary 6-carbon aldehyde, is naturally present in all plants. Hexanal is usually

produced during the ripening process as a volatile ester compound. It is Generally

Regarded as Safe Compound (GRAS) and has been approved for use as a food additive

by the Food and Drug Administration, USA. The aldehyde nature of hexanal inhibits the

water-binding site of the intermediate enzyme complex (Figure 2.2). The volatile nature

of hexanal showed more promise in inhibiting PLD activity compared to other PLD

inhibition compounds. Hence, this ability made hexanal useful as a potential vapor, dip,

or spray to inhibit PLD activity (Paliyath and Subramanian, 2008). Due to the hydrophobic

nature of hexanal, it should be mixed with other compounds to make a spray formulation.

Generally, hexanal (1%, v/v) is mixed other ingredients such as geraniol (1%, v/v), α-

tocopherol (1%, v/v), ascorbic acid (1%, v/v), Tween 20 (10%, v/v) and ethanol (10%, v/v)

(a) (b)

29

to make a formulation which is refereed as hexanal formulation. The HF is a US and

international patented solution (US patent # 6,514,914; 7,198,811) developed by

scientists at the University of Guelph (Paliyath and Murr, 2007).

The HF has been tested in various temperate and tropical crops including, apple,

nectarine, raspberry, banana, sweet cherry, guava. HF as a preharvest spray enhanced

several marketable qualities at the postharvest storage. For example, hexanal enhanced

firmness, colour and brightness, delayed deep pulp coloration and discoloration of the

pedicel in sweet cherries (Sharma et al., 2010). The recent studies also showed that the

formulation decreased ethylene in fruit such as mango (Anusuya et al., 2016) and banana

(Yumbya et al., 2018). Hexanal treatment showed several advantages over 1-MCP

treatment as it did not impair colour, flavour development in the ripening fruit (Kondo et

al., 2005; Cliff et al., 2009). Hexanal also did not inhibit secondary metabolism such as

isoprenoid, carotenoid and aromatic acid synthesis pathways compared to 1-MCP. Apart

from the enhancement of these qualities, recent studies showed that HF also improved

fruit retention in mango (Anusuya et al., 2016), banana (Yumbya et al., 2018) and

raspberry (El Kayal et al., 2017). All these effects of hexanal are associated with

improving qualities of fruit to reduce food loss and waste.

30

2.7 Purpose of the thesis work

‘Honeycrisp’, a premium apple cultivar and is known as the variety that provided

rejuvenation within the apple industry worldwide. Although ‘Honeycrisps’ are popular

among Ontario consumers, it is expensive to grow due to fruit drops from the trees

prematurely causing apples to spoil at the field. The apple cultivar also tends to develop

BP during storage that impairs fruit quality and causes substantial percentage of fruit to

spoil. Therefore, technological interventions are essential to mitigate the field and

postharvest losses and to ensure the year-round supply.

Hexanal improved fruit retention and postharvest qualities in various temperate

and tropical fruit crops. However, the mechanisms by which hexanal improves fruit

retention have not been well studied. Further there is no detailed research related to

hexanal in apple, especially ‘Honeycrisp’ (susceptible cultivar for fruit drop) on improving

fruit retention and underlying mechanisms on how hexanal improves postharvest qualities

in ‘Honeycrisp’ during long-term storage. Based on all these information we hypothesize

that:

• Hexanal improves fruit retention in 'Honeycrisp' either by regulating abscission

through an ethylene dependent mechanism or by modifying unknown pathways

(ethylene independent mechanisms)

31

• Hexanal enhances the quality of 'Honeycrisp' apples by improving membrane integrity

by regulating PLD activity via minimizing ethylene production and downregulating

genes encoding the PLD enzyme

The objectives of the thesis work were to,

1. study the effects of preharvest hexanal spray on fruit retention in 'Honeycrisp'

apples

2. analyze the mechanisms of fruit retention using biochemical and transcriptomic

characterization, including quantification of plant hormones, and identification of

differentially expressed genes (DEGs) at the Fruit Abscission Zone (FAZ)

3. study the functional profiling of the DEGs through Gene Ontology (GO) annotation

and enrichment analysis

4. evaluate the changes in fruit quality during long-term storage after preharvest

application of hexanal and HarvistaTM in ‘Honeycrisp’ apples

5. analyze the changes in the transcription level of selected PLD and calcium sensor

proteins genes in ‘Honeycrisp’ apples

6. evaluate the effectiveness of field applied hexanal spray on mitigating bitter pit

(BP) during cold storage of ‘Honeycrisp’ apples

32

3 CHAPTER THREE: HEXANAL INDUCED FRUIT

RETENTION IN ‘HONEYCRISP’ APPLES

This chapter is reformatted and detailed version of the following publication.

Sriskantharajah, K., El Kayal, W., Torkamaneh, D., Ayyanath, M. M., Saxena, P. K.,

Sullivan, J. A., Paliyath, G. and Subramanian, J. Transcriptomics of Improved Fruit

Retention by Hexanal in ‘Honeycrisp’ Reveals Hormonal Crosstalk and Reduced Cell Wall

Degradation in the Fruit Abscission Zone. Int. J. Mol. Sci. 2021; 22(16):8830.

https://doi.org/10.3390/ijms22168830

Contributions

Sriskantharajah, K., conducted the experiments, analysed the data, and wrote the

manuscript, El Kayal, W., helped in running and analysing the qRT-PCR results,

Torkamaneh, D., helped in RNA-Seq data analysis, Ayyanath, M, M., and Sexena, P.

K., helped in running and interpreting the hormone analysis results, Sullivan, J. A., and

Paliyath, G., helped in the conceptualization and planning of the experiment and

Jayasankar, S., conceptualized the experiments, supervised, and edited the manuscript.

33

3.1 Introduction

Apple (Malus domestica Borkh.) is one of the most widely cultivated fruit and ranks third

in global fruit production (Statista, 2019). Most apple trees tend to shed fruit just before

the harvest, often referred to as preharvest fruit drop (PFD), which renders a huge

economic loss to growers. The PFD usually begins 3–4 weeks before the anticipated

harvest and causes yield losses up to 30% at the beginning of the harvest (Robinson,

2011; Arseneault and Cline, 2016) The severity of the PFD is cultivar specific and

influenced by several factors such as mineral nutrients, summer pruning, water

availability, growing season temperatures (Robinson, 2011), lower starch content, and

higher internal ethylene concentration (Greene et al., 2013). Moreover, this issue is

exacerbated when the fruit are left on the tree for better colour development, as colour

has a huge consumer appeal. ‘Honeycrisp’, a premium apple cultivar, is categorized as

more prone to PFD (Irish-Brown et al., 2011), which causes yield losses of almost 50%

in some years (Arseneault and Cline, 2017).

PFD is a consequence of abscission, whereby cell separation occurs rather pre-

maturely at the constriction region of the pedicel, resulting in fruit drop (Addicott, 1982;

Taylor and Whitelaw, 2001). The PFD control measures in apples have largely relied upon

the use of plant growth regulators (PGRs) and are often cultivar specific. Moreover,

abscission is an irreversible physiological process, thus warranting suitable technologies

to improve fruit retention. The application of hexanal as an aqueous formulation at the

34

preharvest stage has shown promising results in improving fruit retention in several fruit,

including apple (DeBrouwer et al., 2020), raspberry (El Kayal et al., 2017), mango

(Anusuya et al., 2016), and orange (Samwel et al., 2021). Hexanal application also

extends the shelf life of several horticultural commodities through inhibiting the membrane

degradation enzyme, phospholipase D (Paliyath et al., 2003; Paliyath and Subramanian,

2008). Previous studies on fruit abscission have reported that the cell-separation within

the FAZ is the result of a cascade of physiological events due to the coordinated

expression of PGR related genes resulting in abrupt changes in endogenous levels of

plant hormones (Addicott, 1982; Estornell et al., 2013; Kumar et al., 2013).

Plant hormone ethylene is the key regulator of abscission (Osborne, 1989; Meir et

al., 2006). The application of ethylene inhibitors such as aminoethoxyvinylglycine (AVG)

and 1-methylcyclopropene (1-MCP) reduced the PFD in ‘Bisbee Delicious’ apples (Yuan,

and Li et al., 2008). On the contrary, ethylene releasing compound, ethephon, promoted

fruit abscission in ‘Golden Delicious’ (Yuan, 2007) ‘Honeycrisp’ (Cline, 2019) apples,

indicating that both ethylene biosynthesis and signaling pathways are involved in fruit

abscission. Ethylene production and fruit softening increased more rapidly during fruit

ripening of PFD-prone cultivar ‘Golden Delicious’ than non-prone cultivar ‘Fuji’ (Li et al.,

2010). Moreover, transcript levels of ethylene biosynthesis genes MdACS5A and

MdACO1 as well as receptor genes MdETR2 and MdERS2 increased in the FAZ of

‘Golden Delicious’ (Li et al., 2010). Similarly, early induction of fruit abscission in melon

35

was associated with upregulated expression of SAMS, ACS, ACO, and ETRs in the FAZ

(Corbacho et al., 2013). However, efforts to suppress the expression of ethylene related

genes using PGRs effectively worked only in combined applications (Yuan and Carbaugh,

2007; Greene, 2009; Robinson et al., 2010). Previous studies have observed that hexanal

decreased ethylene production in the ripening fruit (Jincy et al., 2017) and significantly

downregulated the expression of the ACS gene (Tiwari and Paliyath, 2011). However, in

spite of its promise in improving fruit retention, there is no information on how hexanal

regulates the fruit abscission.

Plant hormones, particularly abscisic acid (ABA), auxin, and gibberellins (GA), also

play substantial roles in fruit abscission. ABA levels generally increase towards fruit

maturity and ripening and contribute to senescence and seed dormancy (McAtee et al.,

2013). Although a high level of ABA in the AZ, prior to abscission, has been reported in

several species, the direct involvement of ABA in the abscission process remains unclear.

It has been suggested that ABA acts as a modulator of ACC levels, and therefore

stimulates ethylene biosynthesis, leading to increased abscission (Guinn, 1982;

Wilmowicz et al., 2016). Exogenous application of ABA contributed to PFD in ‘Golden

Delicious’ apples (Masia et al., 1998). Abscission was delayed in the ethylene-JA-ABA

deficient triple mutant in Arabidopsis and showed an association between abscission and

ABA levels (Ogawa et al., 2009). In addition to ethylene and ABA, other phytohormones

including auxin (Taylor and Whitelaw, 2001; Blanusa et al., 2005; Estornell et al., 2013)

36

and jasmonic acid (JA) (Ogawa et al., 2009) contributed to improving fruit retention in

various crops.

Cell wall breakdown and cell separation are required within the FAZ for the fruit to

abscise from the tree. Cell wall hydrolysis enzymes, such as polygalacturonase (PG) and

cellulase (EG) pectate lyase, and cell wall loosening enzymes such as expansin promote

fruit detachment at the AZ (Bonghi et al., 1993; Li and Yuan, 2008). Ethylene is strongly

correlated with the activity of these hydrolases and the expression of genes, including

MdPG2 and MdEG1, in the FAZ (Li et al., 2010). These findings suggest that ethylene

plays a regulatory role in fruit abscission and can accelerate the abscission process.

Ethylene also interacts with other plant hormones in fruit drop, particularly with ABA

(Masia et al., 1998) and auxin (Blanusa et al., 2005).

Based on the previous observations, we hypothesize that hexanal improves fruit

retention either by regulating the abscission through an ethylene dependent mechanism

or ethylene independent unknown mechanisms. To test this hypothesis, the present

research studied the mechanism of action of hexanal in improving fruit retention in

‘Honeycrisp’ using physiological, biochemical, and transcriptomic characterization. The

differentially expressed genes (DEGs) due to the application of hexanal in the FAZ were

identified via RNA-seq analysis. The functional profiling of the DEGs were studied through

gene ontology annotation and enrichment analysis. Plant hormones present in the FAZ

37

were quantified using reverse-phase ultra-performance liquid chromatography-mass

spectrometry (UPLC-MS).

3.2 Materials and Methods

3.2.1 Trial Location, Preharvest Treatment and Plant Material Collection

Field trials were conducted at two commercial apple orchards located within the Niagara

region of Ontario, Canada (Site A; 43°08′53.7″ N, 79°29′50.2″ W and Site B; 43°11′00.1″

N, 79°34′44.4″ W). Both sites had ‘Honeycrisp’ trees grafted onto M9 rootstocks

supported by a trellis system. The trees at Site A were eight years of age, and the trees

at Site B were nine years of age. Hexanal formulation (HF) was prepared as described

earlier (El Kayal et al., 2017; Kumar et al., 2018) containing hexanal at a concentration of

0.02 % (v/v) in the final spray (appendix A1). Honeycrisp’ trees were subjected to two

preharvest sprays of HF approximately four and two weeks before the commercial

harvest. A custom-built pressurized sprayer (Rittenhouse sprayers, St. Catharines, ON,

Canada) was used for applying the hexanal solution at a rate of 1 L per tree to ensure

that fruit was covered to the point of dripping with the treatment. Trees sprayed with water

served as control. Buffer rows were maintained between the treatments to avoid spray

contamination. A total of 48 trees from each site were used for the study.

FAZ samples were collected by cutting about 1 mm at each side of the abscission

fracture plane at the base of the pedicel (Figure 3.1) as described by Zhu et al. (2010).

38

Freshly excised FAZs were flash frozen in liquid nitrogen at the field and stored at −80 °C

for hormone analysis and RNA extraction for the RNA-Seq and gene expression studies.

FAZ samples were collected only at commercial maturity stage as our intention here is to

study the potential effect of hexanal on controlling the genes associated with abscission

zone formation at this stage. Fruit that were uniform in both size and development at

commercial maturity (starch index 6 and ground color change from green to yellow) and

42 days after commercial maturity were also harvested and immediately brought to the

laboratory for the quality traits measurements.

Figure 3.1 Anatomical observation of the fruit abscission zone (FAZ) of ‘Honeycrisp’

apple. (a) photograph shows the abscission zone (AZ) of the fruit located between the

spur and pedicel of the fruit stalk; (b) photograph shows about 1 mm size of the AZ was

manually dissected with a razor blade at each side of the abscission fracture plane; (c)

microscopic view of the AZ region. The AZ looks like a funnel shape with constrictions in

both sites. The broken line indicates the position of the abscission fracture plane. The AZ

was stained using lactophenol cotton blue.

39

3.2.2 Fruit Retention and Fruit Quality Measurements

Four trees from site A with uniform growth, similar maturity, comparable fruit count, and

similar location for wind direction were marked for fruit retention study. Fruit retention (FR)

was monitored on a biweekly basis from the first day of commercial harvesting in

September to before the first frost in November and expressed as a percentage using the

following formula:

Fruit Retention % = 100 − [(initial fruit count − final fruit count)/initial fruit count) × 100]

Ten randomly selected, similar-sized fruit at commercial maturity (0 days) and end of

the fruit retention study (49th day) were used for the quality measurements. Fresh weight

(g) was measured using an electronic balance. Two firmness readings (N) were taken

using a handheld penetrometer with an 11-mm diameter tip (Effegi pressure tester,

Via Reale, 63, Facchini 48011, Alfonsine, Italy) on the opposite sides of each fruit. Two

vertical slices from each side of the apples were freshly juiced, and TSS (°Brix) readings

were measured using a prism refractometer (Fisher Scientific, Mississauga, ON,

Canada).

3.2.3 Plant Hormone Measurement

Eight randomly selected apples were used for the ethylene measurement. Fruit were

weighed and placed in 2 L glass bottles. Bottles were sealed for an hour with a lid

containing a rubber port where a syringe was used to collect 1 mL of headspace gas after

gently shaking the bottles to mix up the air inside. The gas sample was immediately

40

injected into an SRI-8610c gas chromatograph equipped with a 0.5 mL sample loop. The

samples were separated by a capillary column (15 m × 0.32 mm Restek Rt-SPLOTTM,

Chromatographic Specialties Inc., Brockville, ON, Canada). The ethylene was detected

using a flame ionization detector and the readings were obtained at ppb (Varian Inc.,

Mississauga, ON, Canada). Pure ethylene (5 ppm) was used as the standard (BOG

Gases, Mississauga, ON, Canada).

Plant hormones present in the FAZ (Figure 3.1) were extracted using the methanol

double extraction method. Briefly, 25 mg of freeze-dried, powdered FAZ samples were

extracted with a solvent (methanol: formic acid: milli-Q H2O = 15:1:4), and the

homogenate was kept at −20 °C for an hour. The supernatant was then collected through

centrifugation (15 min, 14,000 rpm). The pellet was re-extracted using the same protocol,

and the supernatants were pooled. The pooled supernatant was then evaporated to

dryness using nitrogen gas in a fume hood. The dried samples were reconstituted using

a buffer solution (0.1% formic acid: acetonitrile = 97:3), then filtered through a 0.45-µm

centrifuge filter (Millipore; 1 min, 13,000 rpm). The supernatant was then transferred to a

96-well collection plate. Metabolites were separated by reverse-phase ultra-performance

liquid chromatography (UPLC) system with detection using an Aquity QDa single

quadruple mass spectrometer (MS) controlled by Empower 3 (Waters limited,

Mississauga, Canada) by injecting a 5 μL aliquot of sample onto an Acquity BEH Column

41

(2.1 × 50 mm, i.d. 2.1 mm, 1.7 μm). Metabolite peaks were monitored in single ion

recording mode and quantified using a standard curve (Erland et al., 2017).

3.2.4 RNA-Isolation, Library Preparation and Sequencing

Total RNA was extracted from FAZ tissues using an RNA isolation kit (Norgen Biotek,

Thorold, ON, Canada). RNA quality was verified and quantified using NanodropTM

(2000/2000c Spectrophotometers, Thermo Fisher Scientific, Wilmington, DE 19810,

USA). One microgram of mRNA was used as a template for first-strand cDNA synthesis

using NEBNext® Poly(A) kit (NEB #E7490, New England Biolabs, Inc., Ipswich, MA

01938, USA) and NEBNext® ultra™ II directional RNA library prep kit for Illumina (NEB

#E7760, New England Biolabs, Inc., Ipswich, MA 01938, USA). Paired-end sequencing

(75 bp) was performed for four samples using NextSeq 500/550-mid output kit v2.5 (2 ×

75 cycles) on an Illumina NextSeq500 sequencer (Norgen Biotek, Thorold, ON, Canada).

3.2.5 Trimming, Assembly, and Annotation of Paired-End Sequenced Reads

The quality of raw sequences was measured with FastQC (v 0.11.9) using per base and

sequence GC content (Andrews, 2010) and were trimmed by Trimmomatic (v.0.36) using

default parameters (Bolger et al., 2014). Then adapter sequences used for library

preparation were removed with Cutadapt (v 2.8) using sequencing by oligonucleotide

42

ligation and detection colour space algorithm (SOLiD) (Martin, 2011). Trimmed reads

were assembled with STAR aligner (v2.1.3) with default parameters. Apple genome

project GDDH13, version1.1 was used as a reference genome (Daccord et al., 2017).

FeatureCounts program (v 1.22.2) was used to assign sequence reads to each gene in

the samples corresponding to the apple reference genome, GDDH13, version 1.1. A table

of count reads was created with rows corresponding to genes and columns to samples

(Liao et al., 2014).

3.2.6 Differentially Expressed Gene Analysis

Empirical analysis of digital gene expression data-EdgeR (Robinson et al., 2010), an R

Bioconductor package deposited in the DEBrowser (v1.16.1) (Kucukural et al., 2019),

was used to analyze the differentially expressed genes (DEGs) between hexanal treated

and control samples at p ≤ 0.05 and gene expression fold change ≥ 2. The EdgeR models

count data using an over-dispersed Poisson model and an empirical Bayes procedure to

moderate the degree of overdispersion across genes. The table of count reads of the

samples was fed to the EdgeR program (v 3.14.0). DEGs were analyzed through data

assessment, normalization, and DEG detection using EdgeR models. The EgdeR

modelled data to negative binomial (NB) distribution, Ygs~NB(XsZgs, ɸg) for gene g and

sample s. Here Xs is the library size, ɸg is the dispersion, and Zgs is the relative abundance

43

of gene g into which sample s belongs. The NB distribution reduces to Poisson when ɸg

= 0 (Robinson et al., 2010). M values Trimmed mean of M-values (TMM) normalization

method was used to normalize the reads counts during internal modelling of the samples

using EdgeR package (Robinson et al., 2010).

3.2.7 Enrichment Analyses

Gene ontology (GO) and functional pathway enrichment analyses were performed in

ShinyGO (v0.61), based on hypergeometric distribution followed by Benjamini–Hochberg

correction with a false discovery rate (FDR) at p ≤ 0.05 (Ge et al., 2020). Three different

gene ontologies, i.e., biological process (BP), molecular function (MF), and cellular

components (CC), were analyzed separately. The relationship between enriched

functional pathways was visualized using an interactive plot. A hierarchical clustering tree

was also used to summarize the correlation among the enriched pathways. Arabidopsis

thaliana (TAIR10) ortholog genes for the identified M. domestica DEGs (726) were

retrieved from the phytozome database (v13.1.6) and were used for the enrichment

analysis (Balan et al., 2018). Query-based gene information of all detected DEGs was

obtained using the phytozome database for the M. domestica (GDDH13, v1.1).

44

3.2.8 Quantitative RT-PCR

Quantitative reverse transcription PCR was conducted for eight genes chosen to

represent ethylene biosynthesis and signaling pathway and cell wall modification. Gene-

specific primers were designed using Primer3Plus software. Two micrograms of total

RNA extracted from FAZ were reverse transcribed with Superscript II reverse

transcriptase (Invitrogen, Burlington, ON, Canada). qPCR reactions were performed in

10 μL, containing 5 μL SYBR® Green Supermixes (Invitrogen, Burlington, ON, Canada),

50 ng of cDNA and 2.5 μL of 400 nM of each primer (appendix A2). Four biological and

three technical replicates for each gene were analyzed using a CFX96 Real-Time PCR

detection system (BioRad, Mississauga, ON, Canada). M. domestica Actin (MdACT) and

Histone-3 (MdHIS-3) genes were used as reference genes to normalize the gene

expression of a target gene. The gene expression was quantified using the 2−ΔΔCt method

(Livak and Schmittgen, 2001).

3.2.9 Statistical Analysis

The experiment was conducted in randomized complete block design with two treatments

(hexanal and control), four replication and each replication had six trees per site. Data

were analyzed using general linear mixed models (proc GLIMMIX) in SAS v9.4 (SAS

Institute, Raleigh, NC, USA). Variances of fixed effects, such as location and treatment,

45

were partitioned from random effects, which include replication. Shapiro–Wilk normality

tests and studentized residual plots were used to test error assumptions of variance

analysis, including random, homogenous, and normal distributions of error. Means were

calculated using the LSMEANS statement, and significant differences between the

treatments were determined using a post-hoc Tukey–Kramer HSD test with α = 0.05 and

are mentioned in each figure or table.

3.3 Results

3.3.1 Effect of Hexanal on Fruit Retention and Fruit Quality

Hexanal application significantly and consistently increased fruit retention in ‘Honeycrisp’

(Figure 3.2). All trees showed a continuous decline in fruit retention throughout the study

period, but the rate of decline was significantly slower in the treated trees than in control.

During the first 14 days of sampling, there was a steep drop in control trees (24–29%),

then the drop seemed to slow down, whereas the drop was low (7–9%) and more stable

in the treated fruit. At the end of the fruit retention study period of 49 days, treated trees

retained three quarters of the total fruit while control trees retained less than half of the

total fruit. Under field conditions, it was very noticeable that control fruit were starting to

show cracks and were much softer while the hexanal treated fruit did not show any of

these defects.

46

Figure 3.2 Percentage of fruit retention in control and hexanal treated ‘Honeycrisp’ trees

throughout the 49 days of study period. The fruit in the orchard (site A) reached to

commercial maturity at 0th day. Each value represents the mean ± SE of 4 trees.

Asterisks indicate significant differences between control and hexanal treatment at the

same sampling time based on Tukey’s HSD test at α = 0.05.

The effect of hexanal on fruit quality and physiological parameters that determine

the maturation and ripening of ‘Honeycrisp’ apples were analyzed and presented in Table

3.1. As expected, hexanal treated fruit had significantly higher firmness than control fruit.

The firmness rapidly declined in the control fruit while the decline was very gradual in the

hexanal treated fruit. However, other quality parameters, such as total soluble solids

(TSS) and fresh weight, did not vary significantly between treated and control fruit at

commercial maturity and 49 days after commercial maturity, indicating that hexanal does

not alter any other fruit quality traits (Table 3.1).

47

Table 3.1 Fruit quality parameters of control and hexanal treated ‘Honeycrisp’ apples at

commercial maturity (0th day) and 49 days after commercial maturity

Parameter Treatment Days (d)

0 49

Firmness (N) Control 76.00 ± 1.13 65.35 ± 1.22 HF 78.63 ± 0.84 71.46 ± 1.20 *

TSS (°Brix) Control 13.47 ± 0.17 14.92 ± 0.11 HF 13.37 ± 0.16 15.07 ± 0.16

Fresh weight (g) Control 209.30 ± 8.98 237.8 ± 15.5 HF 239.10 ± 15.37 250.20 ± 9.21

Values represent the mean ± SE of 10 randomly selected fruit. Means followed by

asterisks indicate significant differences between control and hexanal treatment at the

same sampling time based on student’s t test at p < 0.05.

3.3.2 Quantitation of Plant Hormones in Fruit and FAZ

Phytohormones present in the fruit and FAZ were quantified in order to better understand

the hormonal regulations underlying the correlation between hexanal application and the

improvement in fruit retention. For hormonal analysis, we used the samples that were

harvested at commercial maturity as our intention here is to study the hormonal changes

that occur in the fruit and FAZ at commercial maturity (Figure 3.3a), at which time it is

anticipated that ethylene and ABA levels will be high, based on earlier observations (Li et

al., 2010; Robinson, 2011). Ethylene evolution rate was not statistically different (p =

0.0879) between hexanal treated and control fruit at commercial maturity stage (Table

3.2). At this stage, hexanal treatment significantly reduced both abscisic acid (ABA) and

melatonin concentrations in the FAZ. However, hexanal did not alter the zeatin

48

concentration in the FAZ (Table 3.2). The UPLC-MS did not detect any other plant

hormones, such as indole-3-acetic acid (IAA), gibberellic acid (GA3), salicylic acid (SA),

and jasmonic acid (JA), in the FAZ samples. Presumably, those are present below the

detection limit of the UPLC-MS (Waters limited, Mississauga, Canada)

Table 3.2 Variation of plant hormones in control and hexanal treated ‘Honeycrisp’ fruit

and in fruit abscission zone (FAZ)

Ethylene was measured in randomly selected eight fruit per treatment, and other plant

hormones represent the mean ± SE of 18 replications of FAZ tissues harvested from two

commercial orchards. Means followed by asterisks indicate significant differences

between control and hexanal treatment based on Tukey’s HSD test at α = 0.05.

3.3.3 Identification of Differentially Expressed Genes

RNA-seq analysis was conducted to study the variations in hexanal regulated genes

expressions and their functions that are primarily related to hormonal regulation and

associated functional pathways at the commercial maturity stage (Figure 3.3a). Mapping

the rRNA depleted 96.89 million RNA-seq reads from our samples against the apple

reference genome (Malus domestica, GDDH13 v1.1.) showed that 92.99 million reads

Treatment Ethylene Abscisic Acid Zeatin Melatonin

(μL·L−1·kg−1·h−1) (ng. g−1, DW) (ng. g−1, DW) (ng. g−1, DW)

Control 5.38 ± 0.88 320.17 ± 33.25 465.23 ± 45.65 56.58 ± 6.37

Hexanal 4.24 ± 0.53 192.99 ± 11.83 * 441.03 ± 16.53 39.81 ± 2.47 *

49

(96%) were mapped in total. The mean mapped reads per sample were 23.25 ± 0.28

million. After removing low expressed genes with less than ten raw reads across all

samples, average of 30,709 genes in at least one of the samples were identified

(appendix A3). EdgeR modelling following the ComBat batch correction and trimmed

median of means (TMM) normalization yielded 726 DEGs between hexanal treated and

control samples at p ≤ 0.05 with an expression foldchange cut off (FC) ≥ 2. Among the

726 DEGs, 353 were upregulated (p ≤ 0.05; |log2foldchange ≥ 1|) while 373 were

downregulated (p ≤ 0.05; |log2foldchange ≥ −1|) (Figure 3.3b, c, appendix A4) by hexanal.

50

Figure 3.3 Identification of the differentially expressed genes (DEGs) between control

and hexanal treated FAZ samples. (a) layout of the overall experimental procedure where

samples for the RNA-seq analysis were collected at commercial maturity; (b) represents

the MA plot shows the relationship between the expression change (M) and average

expression strength (A) of the 353 up (red) and 373 down regulated genes (blue). Genes

that pass a threshold of p ≤ 0.05 and |log2foldchange|> 1 in differential expression

analysis are considered as upregulated. Whereas genes pass a threshold of p ≤ 0.05 and

|log2foldchange|> −1 are considered as downregulated. If any gene did not meet the

above requirements are considered as non-significant (NS); (c) heat map of the 726

DEGs shows the variation across the four samples harvested from two sites. H1 and H2

represent the hexanal treated samples harvested from site A and B, respectively.

Similarly, C1 and C2 represent the control samples harvested from site A and B,

respectively. Additional information about the DEGs is presented in appendix A4.

51

3.3.4 Identification of Enriched Gene Ontology (GO) and Functional Pathways

In order to understand the functions of the DEGs, gene ontology (GO) functional classes

and pathway enrichment analyses were conducted. The A. thaliana ortholog genes of the

M. domestica DEGs were used for this analysis. A total of 659 A. thaliana ortholog genes

were retrieved from the 726 M. domestica DEGs. Enriched functional pathways were

identified under all three GO term functional classes, biological process (BP), cellular

component (CC), and molecular function (MF). The highest number of enriched

pathways, representing 68% of the total enriched GO pathways, were identified under BP

(231 pathways), while the lowest was under CC (nine pathways; 3%) functional classes

(appendix A5). Interactive enrichment networks plot (Figure 3.4a) and hierarchical

clustering (Figure 3.4b) of first 30 top pathways of BP at p < 0.001 (FDR) showed the

relationship and correlation among the significant pathways, respectively. Although

various pathways could be identified under each GO term class, enriched specific

pathways that could contribute to fruit retention at commercial maturity were focused

hereafter. These pathways were grouped into three main categories: plant hormone

responses, transcription factors, and cell-wall modification. The DEGs belonging to

selected enriched functional pathways were further characterized.

52

Figure 3.4a Interactive enrichment networks plot of first 30 enriched functional categories

belonged to BP (FDR, p < 0.001, at edge cutoff 0). In the network analysis, two pathways

(nodes) are connected if they share 20% (default) or more genes. Darker nodes are more

significantly enriched gene sets. Bigger nodes represent larger gene sets. Thicker edges

represent more overlapped genes. A hierarchical clustering tree summarizing the

correlation among these top 30 significant pathways was included in Figure 3.4b.

Additional information about the functional pathways is presented in appendix A5.

53

Figure 3.4b Hierarchical clustering tree summarizing the first 30 enriched functional

categories belonged to BP (FDR, p < 0.001). Pathways with many shared genes are

clustered together. Bigger dots indicate more significant P-values. Additional information

on the functional pathways is presented in the appendix A5.

54

3.3.5 Characterization of Genes Related to Various Plant Hormone Responses

A total of 61 DEGs (30 and 31 up and downregulated) related to various plant hormone

responses were identified and grouped. Of these, genes related to ethylene (16), ABA

(16), and auxin (nine) were the most represented, followed by JA (six), GA (five), SA (four

genes), cytokinin (four), and BR (one) as a result of hexanal treatment (appendix A6).

Four genes involved in the ethylene biosynthesis pathway were identified, and all were

downregulated by hexanal, including S-adenosylmethionine synthase 2 (SAM2) and

three 1-aminocyclopropane-1carboxylic acid oxidases (ACO3, ACO4, and ACO4-like).

Two classes of ethylene receptors (ETR2-like, ERS1) were also identified, and both were

up-regulated by hexanal. Ethylene signalling pathway elements were differentially

expressed. Some transcriptional activators, e.g., AP2/ERF023 and MYB113-like, were

down-regulated, while others (AP2/ERF017, AP2/ERF5, AP2/EREBP6, AP2/EREBP105

and AP2/ERF-B3-RAV1) were upregulated by hexanal (Figure 3.5a).

Out of 16 ABA-related DEGs, hexanal up and downregulated four and twelve

genes, respectively (Figure 3.5b). However, two key ABA biosynthetic genes, farnesyl

diphosphate synthase (FDPS) and CLAVATA3-related protein-25 (CLE25), were

significantly downregulated by three and four folds, respectively. Hexanal also

downregulated ten genes related to ABA signalling, including serine/threonine

phosphatases PP2C (PP2C-34-like, PP2C-73), ninja-family protein-AFP1-like, and ABC

transporter G family member, ABCG12-like. On the contrary, most of the GA related

55

genes were upregulated. The key genes involved in GA biosynthesis, such as gibberellin

20 oxidase1-like (GA20OX-like) and ent-kaurene oxidase (KO) were upregulated by nine

and two folds, respectively by hexanal. Besides, a receptor gene GIDIB was upregulated

by two folds compared to control (Figure 3.5d). Gene expression showed a divergent

pattern in auxin biosynthesis, signalling, transport, and response. Genes related to auxin

biosynthesis, tryptophan aminotransferase-related protein 3 (TAR3), and response (CHS,

MYB113-like, and CYP75B1) were downregulated by hexanal in the FAZ, while genes

involved in auxin transports, such as protein big grain 1-like (BG1), protein walls are thin-

1 (WAT1), and thermospermine synthase-5, (ACL5) were upregulated (Figure 3.5c).

Altogether, fifteen DEGs were identified related to SA, JA, cytokinin, BR

biosynthesis and signalling. The expression of these genes was greatly varied. For

example, three out of four genes related to SA were up regulated, whereas three out of

six genes related to JA were downregulated with the expression fold change between two

and seven. Genes related to cytokinin were mostly downregulated (appendix A6). Since

none of these genes have been associated with fruit abscission, they were not studied

further. The above results suggested eight classes of plant hormones were altered by

hexanal at the commercial maturity stage.

56

Figure 3.5 Expression profiling of genes related to biosynthesis and signalling of plant hormones (a) ethylene, (b) ABA, (c) auxin,

and (d) GA. Blue and red represent down and upregulated gene expression due to hexanal application in the FAZ at harvest. The

left column shows the Malus domestica gene id, the middle column shows the gene expression with |log2foldchange| values, and the

right column shows the corresponding gene id. Additional information on the hormone-related genes is presented in appendix A6.

57

3.3.6 Characterization of Genes Encoding Transcription Factors

Genes encoding transcription factors (TFs) were also studied to identify their response

to the hexanal treatment. A total of 21 genes putatively encoding TFs of diverse

families were differentially expressed (17 and four up and downregulated,

respectively) in the FAZ (appendix A7). Of those, most genes (eight) belonged to the

APETALA2/ERF (AP2/ERF) superfamily. Seven genes representing the AP2/ERF

family were upregulated while one was downregulated by hexanal. These genes either

act as repressors (AP2/ERF4) or activators (AP2/ERF017, AP2/EREBP6, AP2/ERF5,

AP2/ERF023, AP2/EREBP105 and AP2/ERF-B3-RAV1) of GCC-box mediated gene

expression in the ethylene-activated signalling pathway. Besides, a few genes that

belonged to TF families bHLH, GATA, MADS-box, MYB, TCP, and WRKY were also

identified. MYB113-like gene representing MYB transcription factor family,

participating in the anthocyanin biosynthetic process, was downregulated by hexanal

at harvest.

3.3.7 Characterization of Genes Related to Cell Wall Modification

DEGs that are related to cell wall modifications were also characterized to understand

their functions in hexanal regulated cell wall integrity of the FAZ cells. A total of 31

genes were differentially expressed (six and 25 up and downregulated, respectively)

at commercial maturity (Figure 3.6, appendix A8). The genes encoding enzymes

58

related to callose, polygalacturonase, and expansins were downregulated by hexanal.

Of those downregulated genes, eight were related to callose degradation, including

endoglucanase 19-like, endo 1,4-β-glucanase, endo-glucanase-45-like, and glucan

endo-1,3 β-glucosidase 8-like. Two genes were related to polygalacturonase (PG),

including polygalacturonase 1 and endo-polygalacturonase-like-protein-like. Further,

seven genes were related to expansin, including EXPA1-like, EXPA6, EXPA8,

EXPA10-like, EXPA16-like (Figure 3.6). All these genes encoding enzymes related to

callose, PGs, and expansins could be involved in maintaining the cell wall integrity of

the FAZ cells.

59

Figure 3.6 Expression profiling of genes related to cell wall modification. Blue and red

represent down-and upregulated gene expression due to hexanal application in the

FAZ at harvest. The left column shows the Malus domestica gene id, the middle

column shows the gene expression with |log2foldchange| values, and the right column

shows the corresponding gene id. Additional information on the cell wall modification

genes is presented in appendix A8.

3.3.8 Characterization of Genes Related to Abscission

Two genes specifically involved in abscission were identified. Senescence-associated

carboxylesterase 101-like (SAG101-like; MD17G1039700) encodes an acyl hydrolase

60

involved in senescence/floral organ abscission that was downregulated. In contrast,

zinc finger protein 2-like (ZFP2-like; MD00G1113500), that acts as a negative

regulator of floral organ abscission, was upregulated by hexanal.

3.3.9 Confirmation of Gene Expression Patterns by qRT-PCR

To further confirm the RNA-seq data, selected genes representing ethylene

biosynthesis and signalling pathway and cell wall metabolism were quantified using

qPCR in the FAZ samples. All tested genes belonging to ethylene biosynthesis and

signalling (SAM2; MD13G1141700, ACO3; MD09G1114800, ETR2-like;

MD13G1209700 and AP2/ERF17; MD15G1221100) (Figure 6a–d) and cell wall

metabolisms (EXPA6; MD03G1090700, EXPA8; MD07G1233100, EG19-like;

MD06G1105900 and 1,4-β-EG3; MD10G1003400) (Figure 3.7e–h) were confirmed by

the qRT-PCR analysis. The results further revealed the decreased expression of six

genes related to ethylene biosynthesis (SAM2, ACO3) and cell wall modification

(EXPA6, EXPA8, EG19-like, and 1,4-β-EG3). In contrast, ethylene receptor gene

ETR2-like and ethylene responsive factor AP2/ERF017 showed increased expression

by hexanal. These data confirmed the presence of the above tested genes in the FAZ,

and their expression patterns confirm the RNA-Seq results.

61

Figure 3.7 qRT-PCR confirmation of gene expression pattern of selected eight genes representing (a–d) ethylene biosynthesis and

signalling and (e–h) cell wall modification. The data represents the mean ± SE of four biological replicates and three technical

replicates representing the samples harvested at commercial maturity from both commercial orchards. Fold change values were

calculated based on 2−ΔΔCt method by Livak, and Schmittgen (2001). Means followed by asterisks indicate significant differences

between control and hexanal formulation treatment based on unpaired t-test with Welch’s correction at α = 0.05. FPKM values of

each gene were calculated from RNA-Seq reads counts normalized to a per million total reads counts. Genes and the primers are

shown in the appendix A2.

62

3.4 Discussion

3.4.1 Delay in Fruit Ripening by Hexanal

Fruit dropping shortly before harvest is a challenge to apple growers due to significant

economic losses. In climacteric fruit like apples, the production of ethylene by the

ripening fruit stimulates the production of cell wall degrading enzymes and forms an

abscission zone in the pedicel (Taylor and Whitelaw, 2001). Growers extensively

resort to multiple PGR applications to reduce ethylene production, slow down the

ripening, and improve fruit retention. However, the application of PGRs has its own

limitations and further increases the cost of production (Li et al., 2010; Robinson et al.,

2010). ‘Honeycrisp’ is a premium apple variety that fetches higher returns for the

growers but is also more prone to preharvest fruit drop. Hence, reducing the

preharvest drop in such premium varieties will boost the economic returns for the

growers as well as reduce preventable food loss.

Hexanal treated fruit retained firmness for a longer time compared to control

fruit (Table 3.1). Moreover, hexanal spray had a striking effect on fruit retention for an

extended time (Figure 3.2). Extending fruit retention time would be valuable to growers

as it can extend the harvesting window and reduce postharvest loss. Moreover,

enhanced fruit firmness is an added advantage for premium apple varieties like

‘Honeycrisp’ as they are mainly cultivated for the fresh market. Although hexanal

significantly reduced the ethylene evolution during storage of other climacteric fruit

such as mango (Jincy et al., 2017) and banana (Yumbya et al., 2018), we could not

63

detect a significant treatment effect on fruit ethylene production at commercial

maturity. The improvement in fruit retention and firmness due to hexanal may be

associated with a slowdown in the ripening process, thus delaying the abscission.

Further, ‘Honeycrisp’ is not amenable to controlled atmospheric storage (CA)

(Robinson et al., 2010), and thus it warrants alternate methods of extending shelf life,

without developing bitter pit.

3.4.2 Hexanal Reduces Ethylene Biosynthesis and Perception in the FAZ

Ethylene biosynthesis increases before abscission in many senescing organs,

including fruit (Bonghi t al., 1993). In apple fruitlet, the application of chemical thinner

ethephon stimulated the ethylene biosynthesis in parallel with the upregulation of key

regulatory genes, MdACO1, MdACS5A, and MdACS5B in the FAZ (Kolarič et al.,

2011), suggesting that ethylene biosynthesis and signalling in FAZ is involved in

abscission. We have identified four key regulatory genes involved in the ethylene

biosynthesis pathway, including SAM2, ACO3, ACO4, and ACO4-like (Figure 3.6a,

appendix A6). Interestingly, the transcript levels of all four genes in the FAZ were

substantially decreased by hexanal at commercial maturity. A similar observation was

found in ‘Red Delicious’ apples sprayed with ethylene suppressors AVG and 1-MCP

resulted in concomitant decreased expression of ethylene biosynthesis genes

MdACS5A and MdACO1 in the FAZ and fruit drop (Li and Yuan, 2010).

64

An important aspect of ethylene action in abscission is its perception and tissue

sensitivity (Taylor and Whitelaw, 2001; Botton and Ruperti, 2019). Ethylene receptors

serve as negative regulators to regulated ethylene response, and there is an inverse

relationship between receptor levels and ethylene sensitivity of a tissue (Hua and

Meyerowitz, 1998). The present results show an increase in transcript levels in

ethylene receptors ERS1 and ETR2-like in response to hexanal in the FAZ at

commercial maturity (Figure 3.6a, appendix A6). The expression of both receptors

could be due to the compensatory mechanism existing within the complex of ethylene

receptors. A similar result was observed in AVG-treated nectarine, where PpETR1 and

PpERS1 transcripts were overexpressed at harvest (Ziosi et al., 2006). Moreover, an

increased expression of Pp-ERS1 was observed in 1-MCP treated peach (Rasori et

al., 2002), muskmelon (Lashbrook et al., 1998), and tomato (Sato-Nara et al., 1999).

Likewise, LeETR4 was overexpressed in the Never-ripe (NR) antisense tomato

besides the expected repression of the NR transcript (Tieman et al., 2001). Together,

the expression pattern of ethylene biosynthesis and receptor genes in the FAZ prove

that improved fruit retention in ‘Honeycrisp’ by hexanal is likely to be ethylene

dependent.

3.4.3 Hexanal Mediates Hormonal Crosstalk in the FAZ

Plant hormones, such as ABA and JA, have a stimulatory effect in abscission (Zhu et

al., 2011). However, when it comes to ABA, whether the stimulatory effect is due to

65

the direct involvement of ABA or mediated by the production of ethylene is still unclear.

At commercial maturity, a parallel reduction in the ABA level and expression of ABA

biosynthetic related genes FDPS and CLE25 was observed in the hexanal treated FAZ

(Figure 3.6a, appendix A6). Likewise, ABA signaling components PP2C-34-like,

PP2C-37, and ABA response proteins including allergen-like proteins (Mal d1, Mal

d1.03G, Mal d1-like and Mald.06A) showed decreased expression in the treated FAZ.

Earlier studies in melon mature fruit abscission revealed an upregulation of

SnRK2/PP2Cs that was attributed to early fruit abscission (Corbacho et al., 2013),

suggesting that the regulation of abscission related signaling compounds trigger the

onset of fruit drop and controlling them could lead to preventing such drops.

A key observation by Mou et al. (2016) at the onset of tomato fruit ripening

revealed a crosstalk between ABA and ethylene, where the authors explained that

ethylene might be essential for the induction of ABA biosynthesis and signaling.

However, the application of 1-MCP negatively affects this process. The difference of

ethylene level in FAZ could not be significantly detected between the control and

hexanal treated samples. However, reduced transcripts of key ethylene biosynthesis

genes by hexanal in the FAZ may have reduced the ethylene level and thus potentially

contributed to a reduction of ABA biosynthesis and signaling in the FAZ, compared to

control. In general, ABA and gibberellins (GA) are one pair of classic phytohormones,

which antagonistically mediate several plant developmental processes including, fruit-

abscission (Chen et al., 2008; Liu and Hou, 2018). Interestingly, all the DEGs related

66

to GA biosynthesis and signaling were upregulated (Figure 3.6a, appendix A6),

suggesting that hexanal may mediate hormonal crosstalk between ABA and GA. In

addition to the above hormones, in plants, melatonin regulates diverse functions

including the acceleration of fruit ripening (Arnao and Hernández-Ruiz, 2013). A

proposed role of melatonin in fruit ripening indicated that melatonin acts by

upregulating both ethylene and ABA biosynthesis elements, suggesting a crosstalk

mechanism between melatonin and other phytohormones (Choe and Cosgrove,

2010). In our study, a significant reduction in melatonin and ABA levels (Table 3.2),

transcripts of ethylene biosynthesis genes by hexanal in the FAZ may have collectively

contributed to delay the fruit ripening of treated fruit. However, further research is

essential to validate their role in fruit retention.

3.4.4 Hexanal Slows down Cell Wall Degradation and Abscission

The abscission starts with the expression of several wall-loosening enzymes, such as

cellulases, polygalacturonase, and expansin. The collective action of all these

enzymes accelerates the dissolution of the middle lamella, resulting in organ

separation (Li et al., 2010). Enlargement of AZ cells involves cell wall loosening, which

can be aided by expansin (Choe and Cosgrove, 2010). Several authors have reported

that expansin are expressed abundantly in AZ, including tomato flower (Tsuchiya et

al., 2013) and apple fruit (Osborne and Sargent, 1976). The present study has

identified seven genes encoding expansins (EXPs), which showed decreased

67

expression due to hexanal (Figure 3.6; appendix A8). Certain AZ cells enlarge in

response to ethylene (Tonutti et al., 1995). Microscopic visualization of hexanal treated

FAZ cells were smaller, more organized with more defined horizontal layers than

control cells (appendix A9). Hexanal presumably reduced ethylene-mediated

abscission by the suppression of expansin.

The results showed that MdPG1 expression was decreased by hexanal in the

FAZ (Figure 3.6; appendix A8). An increase in polygalacturonase (PG) activity

correlates with fruit abscission (Osborne and Sargent, 1976). MdPG1 was involved in

apple fruit softening, whose expression was reduced by 1-MCP and AVG treatments

(Li and Yuan, 2008). An increase in endo-β-1,4-glucanase (EG) activity has been

related to fruit abscission in several crops, including apple. Interestingly, all identified

EGs were downregulated by hexanal (Figure 3.6; appendix A8). Moreover, decreased

expression of an abscission specific gene, SAG101-like (MD17G1039700), encodes

an acyl hydrolase involved in senescence/floral organ abscission may assist in

retaining the fruit in hexanal treated trees.

In conclusion, this work demonstrates the crucial role of hexanal in improving

fruit retention and fruit qualities. The mechanism of improved fruit retention by hexanal

in ‘Honeycrisp’ is likely mediated through an ethylene dependent pathway. Hexanal

downregulated the ethylene biosynthetic genes in the FAZ and thus may reduce the

sensitivity of FAZ cells to ethylene and ABA in the FAZ. Besides, hexanal can reduce

the cell wall degradation of the abscission zone cells by downregulating cell wall

68

degrading enzymes, such as expansin, EGs, and PG (Figure 3.8). Thus, hexanal

application promises to be a great technology to control fruit drop in ‘Honeycrisp’

apples, given that this cultivar is categorized as more prone to fruit drop. Hexanal is a

natural compound produced by all ripening fruit and is generally regarded as safe

(GRAS). Moreover, it has been approved by the FDA as a food additive. Further

studies could be directed to validate how hexanal slows down the ethylene signal from

fruit to the AZ.

Figure 3.8 Proposed model of hexanal improved fruit retention in ‘Honeycrisp’ apples.

Preharvest hexanal spray downregulated the expression of genes involved in ethylene

biosynthesis in the FAZ and thus decreased the ethylene. Lower ethylene, in turn

slows down the expression of the ABA biosynthesis genes and substantially minimize

the ABA level in the FAZ. At the same time, GA biosynthesis genes were upregulated

by hexanal and may enhance the GA concentration. Hence, the sensitivity of FAZ cells

to ABA decreased. Parallelly, hexanal also downregulated genes related to cell wall

degrading enzymes such as EG, PG, and expansin. Collectively, these events

improved the fruit retention of the hexanal treated fruit. “Solid arrows represent known

mechanism; broken arrows represent unknown mechanism; blue represent

downregulation/decrease events, red represent upregulation/increase events”.

69

4 CHAPTER FOUR: HEXANAL INDUCED POSTHARVEST

QUALITY IN ‘HONEYCRISP’ APPLES

This chapter is reformatted and detailed version of the following publication.

Sriskantharajah, K., El Kayal, W., Ayyanath, M. M., Saxena, P. K., Sullivan, J. A.,

Paliyath, G. and Subramanian, J. Preharvest Spray Hexanal Formulation

Enhances Postharvest Quality in ‘Honeycrisp’ Apples by Regulating

Phospholipase D and Calcium Sensor Proteins Genes. Plants. 2021; 10(11):2332.

https://doi.org/10.3390/plants10112332

Contributions

Sriskantharajah, K., conducted the experiments, analysed the data, and wrote the

manuscript, El Kayal, W., helped in running and analysing the qRT-PCR results,

Ayyanath, M, M., and Sexena, P. K., helped in running and interpreting the

hormone analysis results, Sullivan, J. A., and Paliyath, G., helped in the

conceptualization and planning of the experiment and Jayasankar, S.,

conceptualized the experiments, supervised, and edited the manuscript.

70

4.1 Introduction

‘Honeycrisp’, a premium apple variety, is mainly produced for the fresh market. Since

the year 2000, the production area and volume have risen tremendously due to

increasing consumer demands (Cline, 2014; Mailvaganam, 2015). Even though

‘Honeycrisp’ can make a profitable venture, the variety is highly susceptible to several

serious physiological problems in common cold storage. For example, storing apples

in long-term common cold storage frequently results in declining quality traits such as

soluble solids, juiciness, and flavor (Tong, 1999; Cline, 2009). Further development of

storage disorders, including BP, can cause up to 50% postharvest yield losses (Tong,

1999; Watkins et al., 2004). Storing apple in controlled atmospheric storage does not

work well for ‘Honeycrisp’ due to the development of various storage disorders,

including CO2 injury and soft scald development (Watkins et al., 2004; Chiu et al.,

2015; DeEll et al., 2016). Preconditioning can reduce the risk of soft scald

development (Delong et al., 2009), but conditioning exacerbates BP in an already

susceptible variety (Watkins et al., 2004).

Previous studies have suggested that depletion of free apoplastic Ca2+ to the

cell enhance the cytosolic Ca2+ and thus can damage the structure and reduce the

function of plasma membrane (De Freitas et al., 2010). This condition leads to cell

death and the development of BP symptoms (Saure, 1996 and 2005). Likewise,

deteriorative changes in the plasma membrane due to physiological breakdown

reduces the fruit quality. Phospholipase D is a key membrane degradation enzyme

71

that acts on the phospholipids and initiates a cascade of catabolic events that leads to

membrane deterioration (Paliyath et al., 2008). It has been identified that increased

phospholipid degradation was linked to the activation of PLD by external stimuli such

as increased ethylene (Tiwari and Paliyath, 2011) and cytosolic calcium (Brown et al.,

1990; Paliyath et al., 2008).

Plant hormone ethylene is a key regulator of climacteric fruit ripening (Barry and

Giovannoni, 2007). The ethylene concentration in ‘Honeycrisp’ is relatively low and

stable during ripening, compared to ‘McIntosh’, a rapidly softening variety (Harb et al.,

2012). However, a gradual increase in ethylene production during ‘Honeycrisp’

ripening triggers a series of physiological changes, including losses in firmness and

crispness (Johnston et al., 2002). 1-Methylcyclopropene (1-MCP), an ethylene

receptor blocker, prevents ethylene binding to its receptors, thus regulating the tissue

response to ethylene. The application of 1-MCP helped maintain acidity and reduce

ethylene production, skin greasiness (DeEll et al., 2007 and 2008), and certain storage

disorders (Fan et al., 1999; DeEll, and Ehsani-Moghaddam, 2010) in apples. Tomato

treated with 1-MCP showed a marked reduction in PLD transcripts and slowed

ripening process (Dek et al., 2018). HarvistaTM is an orchard spray containing 1-MCP

as an active ingredient that helps control fruit drop, reduce ethylene production, and

retain firmness in ‘Golden Delicious’ (Sakaldas and Gundogdu, 2015) McIntosh apples

(Nock et al., 2009). In addition, HarvistaTM decreased stem end flesh browning in Gala

apples (Doerflinger et al., 2017). In previous studies, a significant effect from

72

HarvistaTM on ‘Honeycrisp’ was noticed in controlling fruit drop and delaying harvest,

but few effects were observed in storage quality traits and disorders (Watkins et al.,

2012; Watkins et al., 2019). However, the effects of HarvistaTM vary with several

application parameters, including concentration, rate, and storage temperature.

Therefore, HarvistaTM may exert beneficial effects on the shelf life and quality of

‘Honeycrisp.’

Phytohormones, particularly abscisic acid (ABA), auxin, gibberellins (GA)

cytokinin, jasmonic acid (JA) and brassinosteroids (BR), are also implicated in fruit

ripening in climacteric fruit. ABA concentration in apples reaches a peak just before

commercial harvest (Vendrell and Buesa, 1988), and maximum endogenous ABA

preceded the ethylene burst in apples (Lara and Vendrell, 2000). In general, ABA and

gibberellins (GAs) are antagonistically mediate several plant developmental

processes, including fruit ripening. Likewise, JA accelerates fruit ripening (Rudell et

al., 2005), whereas BR suppresses fruit ripening and senescence. In plants, melatonin

regulates diverse functions, including the acceleration of fruit ripening (Arnao and

Hernández-Ruiz, 2020). Tryptophan acts a precursor for wide range of metabolites

production that are essential for plant and human health. The climacteric fruit ripening

process is a complex network of ethylene crosstalk with other phytohormones. Hence,

applications technologies to increase longevity are often effectively applied in

combinations (Greene, 2009).

73

The process of membrane degradation initiated by the action of PLD during

ripening and senescence is also enhanced by cytosolic calcium (Ca2+) due to

disruption of membrane compartmentalization and loss in function of plasma

membrane ATPases (Paliyath et al., 1987; Paliyath et al., 2008; De Freitas et al.,

2010). Further, the increased cytosolic Ca2+ can be sensed by calcium sensor proteins

such as calmodulins. The Ca2+/Calmodulin (CaM) complex activates phosphatidate

phosphatase leading to downstream membrane deterioration cascade events

(Paliyath and Thompson, 1987; Paliyath et al., 2008). Calmodulin is a ubiquitously

present, well-characterized calcium sensor protein that has EF-hand motif/s to bind

Ca2+ (Yang and Poovaiah, 2003; Poovaiah et al., 2013; Gao et al., 2019). Li et al.

(2019) have identified four CaM and 58 CML proteins containing functional EF-hand

motifs in apples. Hexanal, a naturally occurring C6 volatile aldehyde, is a strong

inhibitor of PLD activity. Hexanal also decreased ethylene in ripening fruit such as

mango (Jincy et al., 2017) and banana (Yumbya et al., 2018) and downregulated

ethylene biosynthesis genes in tomato (Tiwari and Paliyath, 2011) and apple

(Sriskantharajah et al., 2021). It has been suggested that the application of hexanal

as an aqueous formulation enhanced membrane stability through inhibiting PLD

activity and thereby improved marketable qualities and shelf life of several fruit and

vegetables (Sharma et al., 2010; Cheema et al., 2018).

The previous chapter identified that preharvest spray hexanal formulation

delayed fruit abscission in ‘Honeycrisp’ most likely by minimizing ABA through an

74

ethylene-dependent mechanism (Sriskantharajah et al., 2021). Hexanal formulation

also decreased storage disorder BP (DeBrouwer et al., 2020). However, there is no

information on underlying mechanisms on how hexanal improves postharvest qualities

in ‘Honeycrisp’ during long-term storage. Here, we hypothesized that hexanal

enhances the quality of ‘Honeycrisp’ apples by improving membrane integrity by

regulating PLD activity via minimizing ethylene production and downregulating genes

encoding the PLD enzyme. Thus, the objectives of this study were to evaluate the

changes in storage qualities, gene expression of PLD and calcium sensor proteins in

‘Honeycrisp’ through the pre-harvest application hexanal formulation and compare its

effects with HarvistaTM (an ethylene receptor blocker) and control.

4.2 Materials and Methods

4.2.1 Experimental Location and Treatments

Fruit was harvested from 60, uniform, nine-year-old ‘Honeycrisp’ apple trees grown in

a commercial orchard located within the Niagara region of Ontario, Canada

(43°08′53.7″ N, 79°29′50.2″ W; The orchard is described as Site A in the chapter

3.2.1). The ‘Honeycrisp’ trees have ‘Mark 9’ (M.9) as their rootstock, and the average

height of the canopy was about 3 m. The trees were supported by a trellis system and

drip irrigation. The orchard grew apples for a specialty market that required a larger

fruit size and deeper color.

75

Hexanal formulation was prepared and applied to the trees as described in the chapter

3.2.1. In this case, 20 apple trees were subjected to two preharvest sprays of hexanal

approximately 30 and 15 days before the commercial harvest (26 September 2019).

Fruit was also picked from 20 ‘Honeycrisp’ trees which were sprayed with HarvistaTM.

HarvistaTM solution was prepared according to the manufactured protocol (12 lb/acre

HarvistaTM mixed with 132 L/acre water) and applied seven days before the harvest

using a commercial sprayer, Hol spraying system-CF series sprayer (Trailed sprayer,

H.S.S./CG1000, Meteran, The Netherlands). The next group of 20 trees were not

sprayed with any solution (control group). Three buffer rows and 20 untreated trees

were maintained between the treatments to avoid spray contamination.

4.2.2 Storage Studies

Fruit that are uniform in size, similar maturity and without any defects were harvested,

sorted, and packed into commercial boxes with liners accommodating 42 fruit per box.

The boxes were immediately transported to a cold storage facility and stored at 2.5 °C

(95%, relative humidity) for the next 120 days. Fruit standard quality parameters such

as color, firmness and total soluble solids were assessed monthly.

For the room temperature storage experiment, at the end of every 30 days of

cold storage, 10 randomly selected fruit from each treatment were kept at room

temperature (~ 20 °C) for another 14 days to assess the shelf life and quality changes

76

of the fruit. Same fruit standard quality traits were measured at 7th and 14th days after

the placement in the room temperature.

4.2.3 Standard Quality Assessment during Storage

Two randomly selected fruit from each replication (box) representing eight fruit per

treatment were used for the analysis. Blush and background colors were taken using

a chromameter (CR-400, Konica Minolta Sensing Americas Inc., NJ, USA) according

to the CIE Lab system readings (L—brightness, a—red/green and b—yellow/blue)

values (Taheri-Garavand et al., 2021). Chroma, a measure of color clarity (a2 + b2)1/2,

and Hue angle (𝑡𝑎𝑛−1(𝑏

𝑎) were calculated using the software available at

http://www.easyrgb.com (accessed 5, August 2020). Firmness and TSS readings

were taken as described in the chapter 3.2.2.

4.2.4 Measurement of Plant Hormones

4.2.4.1 Ethylene

Eight randomly selected fruit from each treatment were repeatedly used for the

ethylene measurement. Before each measurement, apples were taken out of the cold

storage and left overnight to reach room temperature. Fruit was weighed and placed

in 2 L glass bottles. Ethylene measurement was taken as described in the chapter

3.2.3.

77

4.2.4.2 Phytohormones and Metabolites

Three randomly selected fruit from each treatment were flash-frozen in liquid nitrogen

and kept at −80 °C for the hormone analysis. Each about 25 mg of freeze-dried

powdered sample (Three technical replicates per biological replicate) were

homogenate with methanol-formic acid- Milli-Q H2O (5:1:4) solution and kept at −20

°C for an hour (methanol double extraction method). The remaining procedures of the

plant hormone and metabolites measurements were same as described in the chapter

3.2.3.

4.2.5 Phospholipase-D Assay

Three randomly selected fruit from each treatment were used for the phospholipase D

assays. A PLD assay kit was used to analyze based on the manufacturer’s

recommended protocol (Cat. No. MAK137, Sigma-Aldrich 3050, St. Louis, MO 63103

USA). Briefly, all reagents were equilibrated to room temperature before use. In this

case, 10 microliter of homogenate samples and standard solutions were separately

added to the 96 well flat-bottom plates. Then the Master Mix was quickly added to

each well and mixed thoroughly using a horizontal shaker (Biotek, Nepean, ON,

Canada). The reaction was incubated at room temperature for 10 min, and the initial

measurements were taken at 570 nm (A570)initial. After the first measurement, the plate

was incubated for another 20 min, and then final measurements were taken (A570)final.

78

The below equation was used to calculate the PLD activity of the sample (One unit of

PLD catalyzes the formation of 1 µmole choline per minute at pH 7.4).

PLD activity (units/L) = (A570)final − (A570)initial)

Slope of the standard curve × t × dilution factor

4.2.6 Bitter Pit (BP) Assessment

In this case, 14 fruit per replicate per treatment were continuously observed for BP

development. Incidence of the BP was assessed based on the presence or absence

of BP signs on the fruit (for example, lesions with light to dark or deep color surrounded

in the calyx end or any localized area of the fruit). Progression of the BP was calculated

based on the difference in the incidence of BP between 0 days and 120 days

postharvest.

4.2.7 Gene Expression Analysis

Quantitative reverse transcription PCR (qPCR) was conducted for six genes

representing phospholipase D enzyme and calcium sensor proteins. One microgram

of total RNA extracted from fruit samples was reverse transcribed with Superscript II

reverse transcriptase (Invitrogen, Burlington, ON, Canada). qPCR reactions were

performed in 20 μL, containing 10 μL SYBRTM Green (Fisher Scientific, Mississauga,

ON, Canada), two μL of cDNA and one μL of 400 nM of forward and reverse primers

(appendix B1) and seven μL of nuclease-free water. Three biological and technical

79

replicates for each gene were analyzed using a CFX96 Real-Time PCR detection

system (BioRad, Mississauga, ON, Canada). Malus domestica Actin (MdACT) and

Histone-3 (MdHIS-3) genes were used as reference genes to normalize the gene

expression of a target gene. The gene expression was quantified using the 2-ΔΔCt

method (Livak and Schmittgen, 2011).

4.2.8 Statistical Analysis

The experiment was conducted as randomized complete block design comprising

three treatments with four replicates. Data collected for fruit quality and gene

expression studies were analyzed using a repeated measured ANOVA with general

linear mixed models (proc GLIMMIX) in SAS v9.4 (SAS Institute, Raleigh, NC, USA).

An F test was used to test the equality of the variance of the fixed effects. The fixed

effect variance was partitioned into fixed effects of treatment, day, and their

combination. The day was considered as a repeated measured sequence of the

analysis. A compound symmetric (cs) covariance type was used for the analysis.

Shapiro-Wilk normality tests and studentized residual plots were used to test error

assumptions of variance analysis, including random, homogenous, and normal

distribution of error. Means were calculated using the LSMEANS statement, and

significant differences between the treatments were determined by the Tukey-Kramer

test with α = 0.05 and are mentioned in each figure or table.

80

4.3 Results

4.3.1 Effect of Preharvest Spray on Quality Parameters and Phytohormones at

Harvest

Changes in color intensity, quality and phytohormones are important indicators of

maturity and quality of fresh apples. No significant differences in any measured quality

traits (except color coordinate b* of the background color) were observed among the

treatments at harvest (Table 4.1). However, significant changes in phytohormones

levels were observed among the treatments (Table 4.1). Apple treated with HarvistaTM

produced 25% significantly lower ethylene compared to control (p = 0.0113). Hexanal-

treated apples, on the other hand, produced 18% and 38% less ABA than control (p =

0.0399) and HarvistaTM (p < .0001), respectively. The concentration of zeatin was

significantly greater in both hexanal and HarvistaTM treatments than in control (p <

0.0001). Similarly, tryptophan level was about 3 and 1.5 times greater in hexanal-

treated apple than in control (p = 0.0001) and HarvistaTM (p = 0.0341), respectively.

We could not detect other metabolites such as JA, indole-3-acetic acid, SA, N-acetyl

serotonin, tryptamine, benzylamino amine, and Z-iP using UPLC-MS (Waters limited,

Mississauga, ON, Canada) in the fruit samples at harvest. Presumably, those

metabolites are present below the detection limit of the UPLC-MS.

81

Table 4.1 Variations in fruit quality traits and phytohormones at harvest (commercial maturity)

Parameter Treatments Control Hexanal HarvistaTM

Firmness (N) 57.07 ± 1.54 a 60.05 ± 1.67 a 59.09 ± 1.24 a

TSS (°Brix) 13.23 ± 0.08 a 13.51 ± 0.0.1 a 13.57 ± 0.08 a

Blush Color a* 32.72 ± 0.24 a 31.58 ± 0.48 a 30.44 ± 0.35 a

b* 15.23 ± 0.08 a 13.11 ± 0.20 a 13.35 ± 0.27 a

Lightness (L) 32.01 ± 1.69 a 35.41 ± 1.68 a 37.95 ± 1.68 a Chroma (C) 36.13 ± 1.86 a 34.28 ± 1.85 a 33.28 ± 1.86 a Hue Angle (H) 24.98 ± 1.88 a 23.11 ± 1.88 a 23.76 ± 1.88 a

Background Color a* −2.84 ± 0. 50 b 08.33 ± 0.62 ab 12.80 ± 0.80 a

b* 25.53 ± 0.21 a 20.63 ± 0.21 a 20.64 ± 0.39 a Lightness (L) 59.79 ± 2.76 a 55.05 ± 4.34 a 52.25 ± 2.78 a Chroma (C) 24.37 ± 1.80 a 23.78 ± 1.73 a 28.54 ± 1.34 a Hue Angle (H) 95.22 ± 10.52 a 69.12 ± 10.52 a 62.96 ± 8.95 a

Phytohormones

and

metabolites

Ethylene (nL/kg/hr) 48.83 ± 1.38 a 39.97 ± 2.29 ab 36.00 ± 2.05 b

ABA (ng/g, DW) 737.73 ± 10.8 b 603.47 ± 12.03 c 968.41 ± 11.71 a

Zeatin (ng/g, DW) 423.49 ± 8.81 b 650.91 ± 8.77 a 735.02 ± 9.61 a

Melatonin (ng/g, DW) 164.19 ± 7.05 a 128.87 ± 5.4 a 135.50 ± 4.31 a

Tryptophan (ng/g, DW) 4496.46 ± 117 c 12,964.0 ± 161 a 9220.23 ± 90 b

Each value of parameters such as color, firmness, total soluble solids (TSS) and ethylene represents the mean ± SE of eight fruit.

Each value of phytohormones represents the mean ± SE of nine replicates (three fruit each with three technical replicates). Means

with the different letters indicate significant differences among control, hexanal and HarvistaTM treatments based on the Tukey-Kramer

test at α = 0.05 at harvest.

82

4.3.2 Effect of Preharvest Spray on Ethylene and Phospholipase D Enzyme at Cold

Storage

4.3.2.1 Ethylene Production

Ethylene production consistently increased over time in all treatments (Figure 4.1), but on

average, HarvistaTM-treated fruit produced lower ethylene compared to control fruit (p =

0.0197) (Figure 4.1). On the other hand, ethylene production in hexanal-treated fruit did not

significantly vary from HarvistaTM (p = 0.2097) or control (p = 0.0716). The rate of ethylene

production from harvest to 90 days postharvest was higher in control (49–174 nL/kg/h),

followed by hexanal (40–153 nL/kg/h) and HarvistaTM (36–143 nL/kg/h). The rate of

increment in ethylene production revealed that preharvest sprays hexanal and HarvistaTM

could reduce ethylene production by 12% and 18% after 120 days postharvest than control,

respectively.

83

Figure 4.1 Effects of preharvest sprays hexanal and HarvistaTM on ethylene in ‘Honeycrisp’

apple throughout 120 days postharvest. Each value represents the least-squares means ±

SE of eight fruit. LS-means with the same letter are not significantly different when

comparing treatments with days postharvest based on the Tukey-Kramer test at α = 0.05.

4.3.2.2 Phospholipase D (PLD) Enzyme Activity

PLD enzyme activity increased throughout the storage in all treatments (Figure 4.2). As

expected, PLD activity in hexanal-treated fruit was significantly lower than HarvistaTM (p =

0.0005) and control (p = 0.0002). Interestingly, a significant effect of hexanal treatment on

PLD activity was maintained throughout storage compared to that of control. Hence, the

PLD activity was consistently lower at all time points, showing a significant difference from

control besides 30 days postharvest. Likewise, a significant difference between hexanal and

HarvistaTM treatments was observed between 60 and 90 days postharvest, where hexanal

maintained significantly lower PLD activity than HarvistaTM. On the contrary, PLD activity in

84

the HarvistaTM treated fruit fluctuated throughout the storage. These results showed that

hexanal could inhibit the PLD activity by 19% compared to control at 120 days postharvest,

while HarvistaTM can reduce only about 5% respective to control.

Figure 4.2 Effects of preharvest sprays hexanal and HarvistaTM on phospholipase D (PLD)

activity in ‘Honeycrisp’ apple throughout 120 days postharvest. Each value represents the

least-squares means ± SE of nine replicates. LS-means with the same letter are not

significantly different when comparing treatments with days postharvest based on the

Tukey-Kramer test at α = 0.05.

4.3.3 Effects of Preharvest Spray on Bitter Pit (BP) Development

The incidence of BP increased throughout the storage in all three treatments (Figure 4.3).

However, the average value of the incidence of BP was significantly lower in hexanal treated

fruit compared to control (p = 0.0002) and HarvistaTM (p = 0.0246). Further, the incidence of

BP was remained largely unchanged throughout the postharvest in hexanal-treated fruit.

However, on average, the incidence of BP did not statistically vary between control and

85

HarvistaTM treated fruit (p = 0.2138). When the postharvest storage days increased, more

fruit from the control group showed bitter pit signs. For instance, between 0 and 60 days

postharvest, control fruit developed around 3.6- and 1.8-fold higher incidence of BP than

hexanal and HarvistaTM treated fruit, respectively. Likewise, the progression of the bitter pit

was significantly lower in hexanal treatment (p = 0.0046) compared to control. At the end of

the 120 days of storage, about 86% of the hexanal-treated apples showed no signs of bitter

pit compared to control (69%) and HarvistaTM (74%). These apples are considered

marketable.

Figure 4.3 Effects of preharvest sprays hexanal and HarvistaTM on (a) incidence and (b)

progression of bitter pit (BP) in ‘Honeycrisp’ apple throughout 120 days postharvest.

Incidence of BP was calculated based on visual observation on present or absent of BP

signs in the fruit. Progression of BP was calculated based on the difference in incidence of

BP between 0 days postharvest and 120 days postharvest. Each value represents the least-

squares means ± SE of three replications, and each replication had 14 fruit. LS-means with

the same letters are not significantly different when comparing treatments with days

postharvest based on the Tukey-Kramer test at α = 0.05.

86

4.3.4 Effect of Preharvest Sprays on Fruit Quality Traits During Cold Storage

Fruit quality attributes such as color, firmness and TSS were measured throughout the

postharvest to assess the effectiveness of treatments in improving/maintaining these fruit

quality traits in ‘Honeycrisp.’ No significant differences in fruit firmness were observed

across the treatments (Table 4.2). On average, TSS level was greater in hexanal (p =

0.0091), and HarvistaTM (p = 0.0195) treated apples compared to control. During the

storage, TSS values fluctuated greatly in control fruit (12.89 to 13.55) whereas, in hexanal

and HarvistaTM-treated fruit, it was maintained between 13.40 to 13.65, 13.44 to 13.58,

respectively (Table 4.2). Color parameters did not show a variation among the treatments

at any sampling time (Figure 4.4).

87

Table 4.2 Variation in firmness and TSS in ‘Honeycrisp’ apples throughout the storage.

Parameter Treatment Storage Time (Days) 0 30 60 90 120

Firmness (N) Control 57.07 (1.54) a–c 54.87 (2.46) a–d 52.58 (1.01) a–d 51.71 (1.01) cd 47.38 (1.84) b-d Hexanal 60.05 (1.67) ab 57.15 (2.36) a–c 54.93 (1.53) a–d 52.73 (1.33) a–d 52.05 (2.18) a–d Harvista 59.09 (1.24) ab 57.94 (1.65) a–c 54.01 (1.82) a–d 52.88 (1.33) a–d 49.79 (1.01) cd TSS (°Brix) Control 13.23 (0.08) a–c 13.55 (0.16) ab 12.89 (0.18) c 12.93 (0.11) bc 13.03 (0.15) a–c Hexanal 13.51 (0.10) ab 13.65 (0.11) a 13.56 (0.19) ab 13.60 (0.05) a 13.40 (0.17) a–c Harvista 13.57 (0.08) a 13.44 (0.17) ab 13.58 (0.19) a 13.44 (0.09) ab 13.45 (0.18) ab

Each value represents the least-squares means ± SE of eight fruit. LS-means with the same letter are not significantly

different when comparing treatments with days postharvest based on the Tukey-Kramer test at α = 0.05.

88

Figure 4.4 The effects of preharvest sprays on variations in color parameters (a-c) of blush and (d-f) of background of ‘Honeycrisp’ throughout the cold storage (2.5 oC). L indicates the brightness in the CIE lab system readings. Chroma and Hue angel were calculated using the software available at http://www.easyrgb.com (accessed 5, August 2020). Each value represents the least-squares means ± SE of eight fruit. LS means with the same letter are not significantly different when comparing treatments with days postharvest based on the Tukey-Kramer test at α = 0.05.

89

4.3.5 Expression Profiles of Genes Encoding PLD and Calcium Sensor Proteins

Gene expression patterns of six genes, including two α-phospholipase D (MdPLDα1 and

MdPLDα4) and four calmodulin genes (MdCaM2, MdCaM4, MdCML1, and MdCML18)

(appendix B1), were quantified throughout the cold storage period. Transcript levels at all

storage time points were expressed relative to their transcript level at harvest (0 days

postharvest) (Figure 4.5). On average, the expression of both MdPLDα1 and MdPLDα4

were substantially lower in hexanal-treated fruit compared to control (p = 0.0001). Likewise,

expression of MdPLDα4 was lower in HarvistaTM treated fruit compared to control (p <

.0001). The transcript levels of MdPLDα1 in control and HarvistaTM treated fruit were

relatively unchanged throughout the storage, while it progressively decreased in hexanal

treated fruit and only trace levels of MdPLDα1 transcripts could be detected beyond 90 days

of storage (Figure 4.5a). However, the transcript of MdPLDα4 in the control fruit was

increased, while a significant reduction was observed in both hexanal and HarvistaTM treated

fruit (Figure 4.5b). The expression of MdCaM2, MdCaM4 and MdCML18 was increased up

to 60 days postharvest and remained unchanged or decreased in the control fruit. A

treatment effect was observed in MdCaM2, MdCaM4, and MdCML18 during this rising

expression period (60 days postharvest) and beyond in MdCaM4 and MdCML18. The

transcript levels of the above genes were lower in the preharvest sprays than in control

(Figure 4.5 c, d, f). On the contrary, the transcript levels of the MdCML1 were progressively

decreased in the control fruit, while expression is significantly higher in both hexanal and

HarvistaTM treated fruit (Figure 4.5e).

90

Figure 4.5 Effects of preharvest sprays hexanal and HarvistaTM on gene expression of two αPLD genes (a,b) and four calmodulin genes (c–f) in ‘Honeycrisp’ apple throughout 120 days postharvest. Transcript levels at all storage time points were expressed relative to their transcript level at 0 days postharvest. Each value represents the mean ± SE of three apples, with three replicates normalized against the housekeeping genes MdAct and MdHis3. Means with the different letters at the same storage time indicate significant differences among control, hexanal and HarvistaTM treatments based on the Tukey-Kramer test at α = 0.01

91

4.3.6 Effects of Hexanal and HarvistaTM on Fruit Quality Traits at Room Temperature Storage

An experiment was conducted to study the effects of treatments on shelf life and quality of

apples after removal from cold storage (2.5 °C) to room temperature) storage (~20 °C). The

fruit was removed from cold storage after 30, 60 and 90 days postharvest and kept for

another 14 days at room temperature. The quality measurements firmness, TSS and weight

were recorded 7 and 14 days after placement at room temperature. Overall, quality traits

did not vary between the 7th and 14th days of storage (Table 4.3). The treatment effects

were observed on weight and TSS. Both hexanal and HarvistaTM treated fruit had higher

TSS than control fruit at all sampling times (except at 14 days after removal from 60 days

of cold storage), irrespective of days at cold and room temperature stored period (Table 3

and appendix B2). Likewise, hexanal-treated fruit maintained significantly greater weight

than control and HarvistaTM when the fruit was removed from 30- and 60-days cold storage

(Table 4.3). HarvistaTM treated fruit had higher firmness than control when the fruit were

removed from 30 (at both 7 and 14 days at room temperature) and 60 (7 days at room

temperature) days of cold storage. Hexanal also maintained greater firmness than control

only after removal of fruit from 30 days cold storage and kept for 14 days at room

temperature.

92

Table 4.3 Effects of preharvest sprays on fruit quality traits fresh weight, firmness and TSS in ‘Honeycrisp’ apples after removal from cold storage (2.5 °C) to room temperature storage (~20 °C).

Removal after 30 d Removal after 60 d Removal after 90 d

Parameter Treatment 7 Days 14 Days 7 Days 14 Days 7 Days 14 Days

Weight (g) Control 261 ± 17.6 bc 263 ± 17.6 bc 259 ± 14.2 b 254 ± 17.5 b 343 ± 22.1 a 334 ± 21.0 a Hexanal 284 ± 17.8 a 285 ± 8.0 a 282 ± 18.0 a 278 ± 18.0 a 339 ± 28.79 a 314 ± 55.45 ab Harvista 258 ± 3.1 c 261 ± 2.7 c 257 ± 3.2 b 252 ± 4.1 b 279 ± 28.49 b 266 ± 28.29 b

Firmness (N) Control 54.31 ± 2.55 c 54.78 ± 3.87 b 55.73 ± 3.83 b 52.82 ± 4.91 a 50.72 ± 4.04 a 52.69 ± 4.51 a Hexanal 59.8 ± 3.99 b 60.82 ± 5.02 a 58.79 ± 5.81 ab 54.99 ± 2.09 a 53.93 ± 2.96 a 51.52 ± 3.87 a Harvista 64.07 ± 2.8 a 64.48 ± 1.38 a 60.76 ± 2.42 a 52.08 ± 7.4 a 52.19 ± 3.32 a 49.27 ± 4.99 a

TSS (°Brix) Control 12.15 ± 0.42 b 12.03 ± 0.82 b 12.30 ± 0.07 b 12.48 ± 0.33 a 12.35 ± 0.07 c 12.82 ± 0.43 b Hexanal 13.06 ± 0.13 a 12.98 ± 0.07 a 13.00 ± 0.11 a 12.86 ± 0.09 a 13.77 ± 0.24 a 13.50 ± 0.5 a Harvista 12.92 ± 0.18 a 12.98 ± 0.26 a 12.85 ± 0.21 a 12.87 ± 1.56 a 13.02 ± 0.49 b 13.72 ± 0.76 a

Fruit was removed from cold storage after 30, 60 and 90 days postharvest and kept for 14 days at room temperature at ~20 °C. Values represent the mean ± SD of 5 randomly selected fruit. Means followed by different letters indicate significant differences among hexanal, HarvistaTM and control treatments at the same sampling time based on the Tukey-Kramer test at α = 0.05.

93

4.4 Discussion

‘Honeycrisp’ is a highly valued apple variety. However, quality decline and

development of storage disorder bitter pit cause up to 50% postharvest losses. The

present study evaluated the effects of preharvest spray hexanal formulation on

postharvest qualities in ‘Honeycrisp’ apples, and the effects were compared with

HarvistaTM (HarvistaTM, AgroFresh Inc., Philadelpha, PA, USA) and control.

The development of quality characteristics in ripening fruit involves several catabolic

reactions that contribute to the organoleptic quality of the fruit (Paliyath and Murr,

2007). However, accelerated catabolic breakdowns lead to quality decline and

senescence process. Ethylene is a key regulatory factor in enhancing the activities of

several enzymes involved in the catabolic reactions. Thus, blocking ethylene

perception with chemicals such as HarvistaTM (an ethylene receptor blocker that

contains active ingredient 1-MCP) is a technology that is currently in use for extending

fruit retention and qualities in apples (Sakaldas and Gundogdu, 2015; Watkins et al.,

2019). Likewise, metabolites channeling from degradative biochemical pathways into

quality enhancing pathways can result in enhanced quality characteristics. Thus, by

reducing membrane lipid degradation with hexanal, potentially enhanced shelf life of

several fruit and vegetables, including raspberry (El Kayal et al., 2017), mango (Jincy

et al., 2017), banana (Yumbya et al., 2018), tomato (Dek et al., 2018) and bell pepper

(Cheema et al., 2018).

One of the significant findings of this study is the consistently improved soluble

solids by hexanal and HarvistaTM in the cold (Table 4.2) and room temperature storage

(Table 4.3). In addition, both hexanal and HarvistaTM have maintained firmness,

specifically at room temperature (Table 4.3). Even though earlier studies (Watkins et

94

al., 2012; Watkins et al., 2019) have mentioned that the HarvistaTM application has

minimal effect on ‘Honeycrisp’ qualities, we could observe some positive effect of

HarvistaTM during storage may be due to different time and rate of application.

Generally, variations in firmness are poorly understood in ‘Honeycrisp’ due to the slow-

softening nature of this variety (Johnston et al., 2002). Yet, higher firmness in the

treated fruit may be associated with greater cell turgor and cell membrane integrity, as

mentioned by Tong et al. (1999) and Johnston et al. (2002). Consumer prefers the

apple with greater firmness and crispness. Hence, improving firmness and taste would

be an advantage for the cultivars such as ‘Honeycrisp’ as they are mainly cultivated

for the fresh market. However, further experiments involving sensory panels, are

required to show how the treatments affect sensory perception of consumers.

In addition to the above quality improvements, both preharvest sprays

enhanced the tryptophan content at harvest. The increment was almost 1.5-fold higher

in hexanal treatment compared to HarvistaTM (Table 4.1). Tryptophan is essential for

protein synthesis and serves as precursors for a wide range of secondary metabolites

such as indole acetic acid and indole alkaloids that are essential for plants and human

nutrition and health (Palego et al., 2016). Tryptophan also acts as a precursor for

melatonin -a signaling molecule in plants and contributes to fruit ripening. The capacity

of melatonin biosynthesis from tryptophan varies with the developmental stages (Back

et al., 2016). For example, senescence induces more serotonin than melatonin. In the

present study, no significant difference in melatonin among the three treatments was

observed. ABA is another phytohormone that accelerates autocatalytic ethylene

biosynthesis and thus accelerates the ripening process (Vendrell and Buesa, 1988)

significant reduction in ABA by hexanal at harvest might have delayed the ripening

process in the treated fruit. Zeatin is a naturally occurring cytokinin, highly present in

95

developing fruit than ripening fruit (Ludford, 2002). Both hexanal and harvista treated

fruit contain more zeatin than control at harvest may have also associated with slow

ripening.

The mode of action of hexanal is so specific in maintaining membrane integrity

by decreasing PLD enzyme activity (Paliyath et al., 2008). As expected, PLD activity

was substantially decreased in the hexanal treatment (Figure 4.2). Ethylene-induced

gene expression is required to produce the PLD enzyme (Paliyath et al., 2008). Even

though we could not notice a significant reduction in ethylene production in the hexanal

treated fruit (Figure 4.1), a lowered expression of PLD genes (MdPLDα1 and

MdPLDα4) (Figure 4.2) might have contributed to lower the PLD turnover (Figure 4.2).

Similar results were observed in the previous studies on raspberry (El Kayal et al.,

2017), mango (Jincy et al., 2017) and tomato (Dek et al., 2018), where hexanal

substantially decreased the PLD activity and PLD genes, thus slowed down the

ripening process and preserved the membrane. On the other hand, HarvistaTM treated

fruit produced lower ethylene compared to hexanal. However, PLD activity fluctuated

throughout the storage in the HarvistaTM treated fruit, suggesting that both orchard

sprays have a different mode of action in regulating quality traits at harvest and during

storage.

With the progression of ripening and senescence, cytosolic calcium level rises

due to several reasons, including increased ethylene production, progressive

membrane degradation and inactivating calcium protons pumps (Paliyath et al., 2008).

Such Ca2+ can be sensed by cytoplasm localized calcium sensor proteins such as

calmodulins (CaM) (Yang and Poovaiah, 2003; Ranty et al., 2016). In tomatoes, CaM

expression, especially SlCaM2, was upregulated by ethylene (Yang et al., 2016).

Similarly, in papaya set of CaM/CML expression were upregulated by ethephon but

96

downregulated by 1-MCP during storage (Ding et al., 2018), indicating that the

expression of CaM/CML is regulated by ethylene. Moreover, CaM/Ca2+ complex

increases the activity of the phosphatidate phosphatase enzyme and thus accelerates

the downstream membrane degradation process (Paliyath et al., 2008). In the present

study, the expressions of three (MdCaM2, MdCaM4, MdCML18) calmodulin protein

genes were significantly lower in the preharvest sprayed fruit compared to control

(Figure 4.5). The lower expression of CaMs during storage in sprayed fruit may partly

support the fact that the cytosolic calcium rises in the sprayed fruit may be lower than

the control fruit.

The intact membrane acts as a barrier for preventing disorders, especially

during long-term storage, as microcracking and softening of the epicuticular wax layer

facilitate the development and progression of physiological disorders (Lara et al.,

2019). Storage disorder BP is characterized by dark deepening depressions that

originated in the outer cortical cells below the skin of the apple as a result of cell

membrane collapse and the death of localized clusters of cells (Fukumoto et al., 1987;

Jemrić et al., 2016). In this study, hexanal treated fruit showed lower incidence and

progression of the BP than control and HarvistaTM treated fruit. The lower incidence

and progression of BP in the hexanal-treated fruit could be associated with lower cell

membrane damage due to low PLD activity and decreased expression of MdPLDα1

and MdPLDα4 genes. The decreased expression of calcium bound-calmodulin protein

genes such as MdCaM2, MdCaM4 and MdCML18 indicates controlled cytosolic

calcium rises throughout the ripening. Hence, this is an indication of the lower

incidence of BP in the hexanal-treated fruit.

In conclusion, the present study demonstrates the crucial role of preharvest

hexanal spray in improving fruit quality traits during the long-term storage of the

97

‘Honeycrisp’ apple. The effects of hexanal and HarvistaTM were comparable at harvest

as well as during storage. Both preharvest sprays have greatly influenced on hormone

and metabolites than quality traits at harvest. However, both sprays enhanced the

solid soluble content under both cold and room temperature storage conditions.

Likewise, firmness was also maintained at room temperature storage. However, the

effects of both sprays are different in maintaining some other quality traits under cold

storage. Hexanal substantially reduced PLD activity, the incidence of BP, and

MdPLDα1 gene expression compared to HarvistaTM and control. Whereas HarvistaTM

substantially reduced ethylene production. At the same time, both hexanal and

HarvistaTM decreased the expression of MdPLDα4, MdCaM2, MdCaM4, and

MdCML18. The mechanism of improved fruit qualities specifically the lower incidence

of bitter pit by hexanal in ‘Honeycrisp’ is partly through inhibiting PLD activity and

downregulating MdPLDα1, MdPLDα4 expressions. Thus, hexanal promises to be a

great technology to enhance the fruit qualities, marketability, and consumer appeal in

the ‘Honeycrisp’ apple, given that this cultivar is categorized as susceptible to

postharvest disorder BP.

98

5 CHAPTER FIVE: ASSESSMENT OF BITTER PIT IN

‘HONEYCRISP’ APPLES: A COMMERCIAL-SCALE

STUDY

5.1 Introduction

‘Honeycrisp’ is a relatively new apple cultivar with a unique crisp and juicy texture that

are unique amongst other commercially available apple cultivars (Tong et al., 1999).

The texture of ‘Honeycrisp’ has rapidly generated considerable interest among the

apple producers and consumers. Moreover, ‘Honeycrisp’ trees grown in the cooler

region produce a deeper red blush, which is also highly desired by consumers, making

Ontario grown ‘Honeycrisp’ apples in high demand (Cline, 2005; DeEll et al., 2007).

For example, ‘Honeycrisp’ apples represented 12% of the total apple production

acreage in Ontario and ranked third, after McIntosh (16.8%) and Gala (16.5%) (OAG

annual report, 2020). In addition, ‘Honeycrisp’ had the highest fresh market return per

pound (0.78 $/lb) to the grower, which is almost double that of other varieties (OAG

annual report, 2020).

Although ‘Honeycrisp’ is a highly valued cultivar, it is characterized as susceptible

to BP (Watkins et al., 2004). In many young plantings, more than 50% of ‘Honeycrisp’

fruit develop BP before harvest or in the early stages of storage, leaving the apples

unmarketable (Prange et al., 2001) and causing severe economic losses to the

growers (Rosenberger et al., 2004). BP is still causing substantial loss in some

plantings after 4 or 5 years of regular bearing (Rosenberger et al., 2004). Therefore,

further expansion of ‘Honeycrisp’ planting is feasible only if the BP can be controlled.

99

Bitter pit is a physiological disorder. The symptoms of BP are characterized by

small dark depressions most commonly found in the distal end of the fruit. The

occurrence of BP is difficult to predict, as the signs can only be seen on the exterior

surface of apples by which time it is already late to remediate (Prange et al., 2001;

Kalcsits et al., 2017). Previous studies have identified that the causes for the BP at the

cellular level are associated with low calcium content and high potassium, magnesium

and nitrogen content of the fruit (Saure, 2005; de Freitas et al., 2010). The breakdown

of flesh cells also causes the BP just beneath the peel (Ferguson and Watkins, 1992;

de Freitas et al., 2015). It is aggravated by orchard and climatic factors including

excessive tree vigour and fruit size, low soil pH, micronutrient deficiency (specifically

boron), and environmental stress such as drought (Faust and Shear, 1968; Ferguson

and Watkins, 1992; Jemrić et al., 2016; Kalscits et al., 2017).

Applying foliar calcium sprays (calcium chloride, CaCl2) during summer is common

to mitigate the BP in many cultivars. However, the effectiveness of spray regimes for

controlling BP has been highly variable as the sprays can be phytotoxic to apple

foliage, especially when the calcium is applied at high concentrations, high

temperatures, or combined with other pesticides (Ferguson and Watkins, 1992).

Moreover, the exact physiological cause of BP is not well understood. Hence,

management techniques such as applying weekly foliar sprays of calcium from fruit

set to maturity to prevent this disorder are often inadequate and causes huge expense

for the grower (Kalscits et al., 2017;).

Application of hexanal as a preharvest spray substantially reduced BP in

‘Honeycrisp’ apples during storage (Sriskantharajah et al., 2021). In the small-scale

studies presented in Chapter 4, hexanal reduced BP in ‘Honeycrisp’ by maintaining

membrane integrity by decreasing phospholipase D activity and lowering the

100

expression of αPLD1 and αPLD4 genes. However, there is still question of the

effectiveness of hexanal formulation in mitigating BP on a commercial scale.

Therefore, the objective of this current experiment was to evaluate the effectiveness

of grower-applied (large scale) hexanal spray on mitigating BP during cold storage of

‘Honeycrisp’ apples.

5.2 Materials and Methods

5.2.1 Experimental Location and Treatments

The experiment was conducted in an orchard of 10-year-old ‘Honeycrisp’ located

within the Niagara region of Ontario, previously described as Site A (chapters 3.2.1

and 4.2.1), in the year 2020. The tree characteristics and the orchard management

have been described in the previous chapters (chapters 3.2.1 and 4.2.1).

Hexanal formulation was prepared as previously described in the chapters 3.2.1

and 4.2.1). The orchard consisted of around 2000 trees (15 rows) on 1.5 Ac and were

subjected to two preharvest sprays of hexanal about two weeks (3rd September 2020)

and one week (10th September 2020) before expected commercial harvest (18th

September 2020). A Hol system-CF series sprayer (Trailed sprayer, H.S.S./CG1000,

Meteran, Netherlands) was used to spray the hexanal formulation at a rate of 102.04

L/Ac. The trees were treated with HF as one block. Control trees were also maintained

for experimental purposes. Five buffer rows were maintained between control and

hexanal formulation-treated trees.

101

5.2.2 Storage Studies

The development of BP was assessed in three different ways at the biweekly intervals.

Fruit were sampled all over the areas of treated and control trees. Fruit with similar

maturity, uniform size, and without any visual defects were sorted and packed into

commercial boxes with liners. Forty fruit were accommodated in each box, and

together ten boxes were maintained for each treatment. The boxes were immediately

transported to a cold storage facility and stored at 2.5 °C for the next 120 days.

5.2.3 Incidence of Bitter Pit

Four hundred fruit from each treatment were continuously monitored for the

development of BP during storage. Incidence of the bitter pit was assessed visually

using a binary scoring system based on the presence (1) or absence (0) of BP

symptoms on the outer surface of each fruit (Figure 5.1).

Figure 5.1 (a) the two apples of the left have BP symptoms with a rating of 1 during the assessment. (b) apples on the right did not have bitter pit symptoms and were rated as 0 during the assessment.

(a) (b) (a)

102

5.2.4 Progression of Bitter Pit

Progression of the BP was calculated using three different intervals namely 60, 90 and

120 days postharvest based on the difference in the incidence of the BP at 0 days and

the postharvest day of measurement.

Progression of bitter pit = incidence of bitter pit (at X days postharvest ˗ 0 days

postharvest)

5.2.5 The severity of Bitter Pit

The severity of the BP was assessed using a visual ranking scale from 0 to 5, as

previously described by DeBrouwer et al. (2020). Figure 5.2 indicates the visual

scaling method used to assess the severity of BP.

103

Figure 5.2 A representation of six severity categories in BP. The image on the left end shows no BP symptoms, while the image on the right end shows severe BP. The white line represents a scale of 1 cm.

0 1 2 3 4 5

No signs of bitter pit.

Minimal signs of bitter pit. 1 to 5 small, light lesions.

Localized signs of bitter pit. 5 to 15 lesions, either small or medium.

Signs of bitter pit spreading. More than 15 lesions, either small or medium.

Signs of bitter pit surrounding calyx. More than 15 deep, dark medium lesions.

Deepening signs of bitter pit. More than 15 deep, dark large lesions.

104

5.2.6 Percentage of Marketable Fruit

Fruit that did not have BP symptoms were considered marketable fruit. The percentage

of those fruit was calculated based on the total number of fruit (400) in each treatment.

The percentage of marketable fruit was calculated at every thirty-day interval during the

storage.

5.2.7 Grower Return from the Marketable Fruit

Grower’s return from the additional marketable fruit was calculated per acre based on the

three parameters (Table 5.1).

Table 5.1 Parameters used to calculate the grower income from additional marketable fruit

Parameters Year Value Average Value

Fresh market yield

(lb) 2018 31,680,200

2019 28,608,873 30,144,537

Grower price ($) 2018 0.693

2019 0.706 0.7

Cultivation area (Ac) 2018 1655

2019 1830 1743

Data source: Ontario Apple Growers Association, Annual Report, 2020.

1. Additional Total Yield (lb) = Total yield (lb) × percentage of yield incement

2. Additional Total Income ($) = Additional yield (lb) × 0.7($/lb)

3. Additional Income per Acerage ($/Ac) = Additional income/area of cultivation

105

5.2.8 Statistical analysis

Data were analyzed using a repeated measure ANOVA with general linear mixed models

(Proc GLIMMIX) in SAS v9.4 (SAS Institute, Raleigh, NC, USA). Each box was

considered as a replicate. An F test was used to test the equality of the variance of the

fixed effects. The variance for fixed effects was partitioned into treatment, day, and

treatment × day interaction. The day of evaluation was considered as a repeated effect.

A compound symmetric (cs) covariance type was used for the analysis as the sampling

was done at an equal time interval. Shapiro-Wilk normality tests and studentized residual

plots were used to test the assumptions for error variance, including random,

homogenous, and normal distribution of error. Means were calculated using the

LSMEANS statement, and significant differences between the treatments were

determined by the Tukey-Kramer test with α = 0.05.

106

5.3 RESULTS

5.3.1 Effect of Hexanal on Incidence of Bitter Pit

The cumulative percentage of incidence of BP increased throughout the storage in both

hexanal treated and control fruit (Figure 5.3). However, on average, hexanal treatment

showed a significantly lower incidence of BP compared to that of control (p=0.0002). In

the early stages of storage period (for example, up to 45 days postharvest), hexanal

treated fruit developed almost four times lower (3.75%) symptoms of BP compared to

control group (12.5%). The progression of BP was slow in the hexanal treated (slope =

1.76) fruit compared to control (slope = 3.08), throughout the storage. Hence, hexanal-

treated fruit showed a significantly lower incidence of BP throughout the storage (Figure

5.3).

Figure 5.3 Effects of a preharvest spray of hexanal on the incidence of BP in ‘Honeycrisp’ apples during 120 days of storage. Each value represents the mean ± SE of ten replications (each replication had 40 fruit). Means with an asterisk at the same storage time indicate a significant difference between control and hexanal treatments based on the Tukey-Kramer test at α = 0.05.

107

5.3.2 Effect of Hexanal on Progression of Bitter Pit

Progression of BP increased in both hexanal treated and control fruit throughout the

storage. On average, the progression of BP in hexanal-treated fruit was significantly lower

(p=0.0001) compared to control (Figure 5.4). Hence, 7.5%, 8.3% and 12.5% lower

progression of BP have observed in hexanal treated fruit at peak selling period (0-60 days

postharvest; p=0.0009), at 0-90 days postharvest period, where most of the fruit are gone

in the outlets (p=0.0006) and at 0-120 (able to store the fruit for an additional month;

p=0.0001) days postharvest, respectively (Figure 5.4).

Figure 5.4 Effects of preharvest hexanal spray on the progression of BP in ‘Honeycrisp’ apples during 120 days of storage. The progression of BP has calculated as the percentage difference between the incidence of BP on day X and day 0. Means with an asterisk at the same storage time interval indicate a significant difference between control and hexanal treatments based on the Tukey-Kramer test at α = 0.05.

108

5.3.3 Effect of Hexanal on Severity of Bitter Pit

At harvest, only around 2.75% and 1.5% of the fruit had a BP severity scale of 1 in both

control and hexanal treated fruit, respectively (Figure 5.5). The remaining fruit were clean

in both treatments. However, as the time in storage increased, more fruit from the control

group showed advanced signs of BP. For example, at the end of 60 days postharvest,

fruit with all six BP ratings were observed in the control group. However, in the hexanal

treated group, the highest severity rating was only 3. Likewise, the percentage of fruit

classified in the severity groups 1-5 substantially increased in the control treatment as the

time in storage increased. However, in hexanal-treated fruit the severity was lower by

10% at the end of 120 days storage (Figure 5.5).

109

Figure 5.5 Effects of preharvest spray hexanal on the severity of bitter pit (BP) in ‘Honeycrisp’ apples during 120 days of storage. The severity of BP was calculated based on a visual scale ranking system, where 0 - no signs of BP, 1 – minimal signs of BP, 2 – localized signs of BP, 3 – signs of BP spreading, 4 – signs of BP surrounding calyx and 5 - deepening signs of BP.

110

5.3.4 Effect of Hexanal on Marketable Fruit

The fruit that had 0 and 1 BP ratings of BP were considered as marketable fruit (Figure

5.2). The percentage of marketable fruit continuously decreased throughout storage in

both control and hexanal treatment (Figure 5.6). However, a greater percentage of fruit

from hexanal treatment were at the marketable condition at each time point. For example,

after three months of storage, more than 95% of the hexanal treated fruit were considered

marketable. While 88% of the control fruit were marketable at this storage time.

Approximately 76% of the fruit from the control group remained marketable at the end of

four months of storage, whereas around 87% of the fruit from the treated group were

considered marketable.

Figure 5.6 Effects of preharvest spray of hexanal on percentage of marketable fruit in ‘Honeycrisp’ apples after storage at 120 days postharvest. Marketable fruit were defined as those fruit with a bitter pit rating of 0 or 1 on a 0 to 5 rating scale.

111

5.3.5 Effect of Hexanal Application on Financial Return to the Grower

Assuming that all the fruit are high quality with no additional defects, and all fruit are sold

by the end of the 60 or 90 days storage period, around 4.7% or 7% more fruit could be

saved due to the application of hexanal, respectively. Likewise, at the end of 120 days

storage, around 11% more fruit could be marketed with the application of hexanal

compared to control. This would yield additional returns for grower of about $569 /Ac, $

847 /Ac and $1332 /Ac at the end of 60, 90 and 120 days postharvest, respectively.

Table 5.2 The increased yield, income from additional marketable fruit, if they were quality enough and were able to sell either at 60 days or 90 days or 120 days postharvest.

Parameters 60 DPH 90 DPH 120 DPH

Total increased marketable yield (lb) 1,416,793 2,110,118 3,315,899

Increased total income ($) 991,047 1,477,082 2,321,129

Increased income/Cultivation area (lb/Ac) 569 848 1,332

The values used for the calculations are based on the 2018 and 2019 values obtained from the Ontario Apple Growers association’s annual report, 2020. The average of total yields 30, 144,537 (lb) was used to calculate the total yield, and a grower return of $0.7/lb was used for the income calculation. The average growing area of 1743 (Ac) was used for the area calculation.

112

5.4 DISCUSSION

Bitter pit is endemic to ‘Honeycrisp’ apple, and growers are paying more attention to the

risk factors that impact the disorder. However, BP may not be evident at harvest but

develops during storage and causes significant losses during storage (around 40-50%)

(Watkins et al., 2004) and economic losses to growers (Prange et al., 2001). Hence,

growers are spending more money on the remediation measures at the field level

including applications of calcium spray, and other management practices (Rosenberger

et al. 2004; Cheng and Sazo, 2018).

A previous study by Hanson (1960) demonstrated the positive correlation between

cell membrane-bound calcium (Ca) and cell membrane function. In addition, membrane-

bound Ca is in equilibrium with Ca in intercellular space. De Freitas et al. (2010) have

also identified that the parenchyma cells of fruit with BP are characterized by leaky

membranes and disintegration of the membranes due to low Ca.

Hexanal is a potent inhibitor of membrane degradation enzyme phospholipase D

(PLD). The activity of PLD during ripening increases in response to increased ethylene

and cytosolic calcium (Paliyath et al., 2008). Previously we have identified that the

hexanal decreased the PLD activity and αPLD1 and αPLD4 genes (Chapter 4). In

addition, transcript levels of three calcium sensor proteins genes, such as CaM2, CaM4

and CML18, were also reduced by the hexanal spray compared to control. This indicates

that the preharvest spray of the hexanal formulation can reduce the rise of cytosolic

calcium during storage of ‘Honeycrisp’ (Sriskantharajah et al., 2021). The membrane

113

integrity and bound Ca enhanced by hexanal may contribute to the reduction of bitter pit

during storage.

The present study also found a reduction in the incidence, progression, and severity

of bitter pit in ‘Honeycrisp’ apples at the commercial scale similar to the results of previous

experiments conducted on a smaller scale (Sriskantharajah et al., 2021).

Due to the high consumer demand generated by the crispy texture and sweet-tart

flavour of ‘Honeycrisp,’ apple growers get a much higher wholesale price for ‘Honeycrisp’

than most other varieties ($600 to $1000 per bin for ‘Honeycrisp’ vs. $125 to $300 per bin

of ‘Gala’) (Cheng and Sazo, 2018). Since the bitter pit causes a huge economic drain to

growers during long-term storage. The application of hexanal as a preharvest spray could

help save about 7-11% of food at the storage level, considering the amount of food loss

occurring for fruit and vegetables before they reach retail (about 21.6%) (Boliko, 2019).

In addition, hexanal can increase grower income by $1332 /Ac, and this will be a huge

advantage for ‘Honeycrisp’ as it is classified as a premium cultivar. The hexanal

application will also be an added advantage for growers as the fruit can be stored directly

in cold storage without any preconditioning or postharvest applications.

In conclusion, the two applications of hexanal as an aqueous formulation at the

preharvest stage, about two weeks and one week before commercial harvest using a

commercial spraying system, substantially reduced the incidence (8.5%) progression

(12.5%), and severity of bitter pit. The formulation also enhanced the marketable fruit

(11% additional fruit at the end of four months storage) and helped in saving food at the

storage level. Hence, this would increase the grower income by $1332/Ac at the end of

114

four months storage. Thus, hexanal promises to be a potential technology to reduce the

bitter pit in ‘Honeycrisp’ apples, given this cultivar is highly susceptible to bitter pit.

However, further research is essential to increase testing of the formulation at commercial

orchard scale, including testing in several environments (locations) and in partnership

with governmental organizations such as the Ontario Ministry of Agriculture Food and

Rural Affairs (OMAFRA) for knowledge mobilization/ knowledge translation and transfer

(KTT).

115

6 CHAPTER SIX: SUMMARY

Most apple trees tend to shed fruits before the harvest, often referred to as preharvest

fruit drop (PFD), which can result in a large economic loss. At the same time, several

apple cultivars lose their quality traits and are susceptible to certain disorders during long-

term storage, which causes up to 50% postharvest yield losses (Watkins et al., 2004).

Unfortunately, the premium apple cultivar 'Honeycrisp' is prone to PFD and highly

susceptible to the storage disorder known as bitter pit. The PFD in 'Honeycrisp' causes

about 30% yield losses at the beginning of the harvest. The losses may increase to 50%

in some years due to several factors, including hot weather, availability of water and

mineral nutrients and summer pruning (Robnson et al., 2011; Arseneault and Cline,

2017). Moreover, the high tendency of this cultivar for the development of storage

disorder bitter pit (BP) diminishes the fruit marketability. Therefore, 'Honeycrisp' often

requires an experienced and committed grower to achieve a high yield of quality fruit.

Although growers adopt several management practices, including applying plant

growth regulators (PGRs) at pre or postharvest stages to control PFD and BP, the results

are often inconsistent (Greene et al., 2011). Moreover, the PGRs effectively worked only

in combined applications (Yuan and Li, 2008). Therefore, new methods and strategies to

improve the fruit retention and postharvest qualities in 'Honeycrisp' are in high demand.

Previous research on fruit crops has identified that the application of hexanal as

an aqueous formulation at preharvest improved fruit retention in several economically

important crops (Anusuya et al., 2016; El Kayal et al., 2017; Yumbya et al., 2018).

116

However, underlying mechanisms on how hexanal improves fruit retention have not been

thoroughly studied. In addition, there is no information on the effects of hexanal spray-on

controlling fruit abscission in 'Honeycrisp' apples. Hexanal also enhanced postharvest

qualities, including improved firmness, sugar content, antioxidant properties, shelf life,

and mitigating storage disorders in various tropical and temperate fruit crops (Sharma et

al., 2010; Jincy et al., 2017; Kumar et al., 2018). However, how hexanal improves storage

quality traits and its mechanisms to mitigate bitter pit have not been investigated.

Therefore, based on the above studies, this thesis explored the effects of hexanal on the

mechanisms that contribute to improving fruit retention and postharvest qualities in

'Honeycrisp'. Moreover, previous studies related to hexanal have been conducted on a

small plot scale with a known experimental setup. Present work also explored the

effectiveness of hexanal spray-on mitigating bitter pit at a commercial scale.

Preharvest hexanal spray improved fruit retention by 18% during the commercial

harvesting period compared to control. Under the field conditions, it was noticeable that

control fruit started to show cracks and was much softer while hexanal treated fruit did

not show any of these defects. Also, hexanal-treated fruit had significantly higher firmness

than the control fruit. Depending on the orchard, about 10-50% of fruit drop occur during

the harvesting period in Ontario (Arseneault and Cline, 2017). Improving fruit retention

during this period would be advantageous as this cultivar requires multiple harvesting due

to uneven maturity. Moreover, 'Honeycrisp' is mainly cultivated for the fresh market; thus,

the consumers prefer a firmer fruit.

117

Fruit abscission occurs at the abscission region (FAZ), where changes in

phytohormones levels and related gene expressions accelerate the cell separation of the

abscission zone cells and, eventually, causing the fruit to drop (Addicott, 1982; Taylor

and Whitelaw, 2001). In fruit, abscisic acid (ABA) level peaks at the beginning of the

commercial harvest and causes an acceleration of the ethylene climacteric peak (Lara

and Vendrell, 2000). Hence, ethylene promotes the synthesis of hydrolases and fruit

abscission. Hexanal substantially reduced the ABA in the FAZ. Two genes related to ABA

biosynthesis (FDPS and CLE25) and 11 genes related to ABA signaling were

downregulated by hexanal. Although the fruit ethylene did not show a significant

difference between hexanal treatment and control, four ethylene biosynthesis genes

(SAM2, ACO3, ACO4 and ACO4-like) and two receptor genes (ETR2 and ERS1) were

down and up-regulated, in the FAZ, respectively. A similar observation was found in 'Red

Delicious' apples sprayed with ethylene suppressers AVG and 1-MCP (Li et al., 2011).

The gene expression patterns of ethylene biosynthesis and receptor genes show that

improved fruit retention in 'Honeycrisp' by hexanal is likely to be ethylene dependent.

Cell separation within the FAZ is required for abscission, and this process starts

with the expression of several wall-loosening enzymes (Taylor and Whitelaw, 2001).

Twenty-five genes that encode various hydrolase enzymes such as callose,

polygalacturonase (PG) and expansins were downregulated by hexanal. Of those, eight

callose genes including, endoglucanase 19-like, endo-β-1,4-glucanase (EG1), endo-

glucanase-45-like, and glucan endo-1,3-glucosidase 8-like, two PG genes such as PG1

and endo-polygalacturonase-like and seven expansins genes, including EXPA1-like,

118

EXPA6, EXPA8, EXPA10-like, EXPA16-like, were down-regulated by hexanal. An

increasing expression in expansins and EG1 was associated with fruit abscission in

several crops, including apple (Yuan et al., 2007; Greene, 2009; Corbacho et al., 2013).

The improved fruit retention by hexanal may be associated with the down-regulated

expression of hydrolases and ethylene and ABA biosynthesis genes.

Although improving fruit retention would fulfill the immediate fresh market demand

of 'Honeycrisp', long-term storage will benefit consumers throughout the year.

'Honeycrisp' can be stored for 6-7 months in common cold storage without adversely

affecting firmness and texture (OMAFRA, 2009). However, other quality traits such as

total soluble solids (TSS), water content, acidity and flavour can be decline over time in

storage. Control atmospheric storage is not recommended for 'Honeycrisp' due to the

high incidence of storage disorders, including BP (DeEll, 2009). BP is a calcium-related

postharvest disorder. Depletion of free apoplastic Ca2+ damages the plasma membrane

leading to the collapse and death of localized clusters of cells and thus leads to the

development of BP (de Freitas et al., 2010). BP is difficult to control due to a variety of

causes assigned to the development of this disorder.

Hexanal decreased incidence and progression of storage disorder BP in

'Honeycrisp' apples. The intact membrane acts as a barrier for preventing disorders,

especially during long-term storage, as microcracking and softening of the epicuticular

wax layer facilitates the development and progression of physiological disorders (Lara,

2009). Further studies on membrane damage, phospholipase D enzyme activity and

genes related to PLD and calcium sensor proteins revealed that hexanal substantially

119

reduced PLD activity, MdPLDα1, MdPLDα4 compared to control and HarvistaTM (an

ethylene receptor inhibitor has 1-MCP as an active ingredient). Hexanal also

downregulated three calcium sensor protein genes (MdCaM2, MdCaM2, MdCML1). The

lower incidence and progression of BP in the hexanal-treated fruit could be associated

with lower cell membrane damage due to lower PLD activity and expression of down-

regulated PLDα genes. The decreased expression of calcium sensor protein genes

indicates controlled cytosolic calcium rises throughout the ripening in the hexanal-treated

fruit.

Maintaining structural integrity can also be linked to higher firmness by maintaining

cell turgor pressure, providing a 'crunch' factor in 'Honeycrisp' apples (Tong et al., 1999).

Hexanal treatment-maintained firmness and improved TSS of the apples during the cold

and room temperature storage. In addition, hexanal enhanced tryptophan content at

harvest. Tryptophan is essential for protein synthesis and serves as a precursor for many

secondary metabolites including indole acetic acid.

The application of hexanal improved fruit retention and qualities in 'Honeycrisp'

and mitigated incidence, progression, and severity of BP at a commercial scale. Hexanal

treatment improved harvestable yield by approximately 18% via increasing fruit retention

more fruit at the field through enhancement of fruit retention. The treatment also increased

the number of marketable fruit by 11% by reducing BP during four months of cold storage.

This would increase the grower's income by $3512/Ac ($2179/Ac due to improved fruit

retention and $1332/Ac due to decreased BP), assuming that all these fruit are in

marketable condition.

120

In conclusion, preharvest hexanal spray improved fruit retention in ‘Honeycrisp’

most likely via minimizing ABA through an ethylene-dependent pathway. Hexanal also

prevented postharvest disorder bitter pit in ‘Honeycrisp’ through preserving membrane

integrity. Hexanal also improved storability and enhanced traits important to the

consumer, such as TSS and firmness in 'Honeycrisp' apples. Hence, the application of

hexanal enhances grower return by preserving more fruit in the field and after long-term

storage.

In future, implementing a wide range of studies related to fruit retention and

postharvest qualities of various apple cultivars on a commercial scale would broaden the

scope of hexanal application in the apple industry. Hexanal application will also be

beneficial for other fruit crops with similar issues in the field and postharvest storage. The

growers who participated in hexanal testing in Canada were happy with the product in

terms of its effectiveness and biosafety. Therefore, the current regulatory process should

support the regulatory clearance in Canada to register the product. Therefore, every effort

should be made to commercialize the hexanal formulation in Canada to make it readily

available for growers. Once the hexanal formulation is registered, it will be a big boon for

growers because it is a naturally occurring, plant-based compound.

121

REFERENCES OR BIBLIOGRAPHY

AAFC, 2020. Horticulture sector reports. Available online at https://agriculture.canada.ca/en/canadas-agriculture-sectors/horticulture/horticulture-sector-reports (accessed on 8 August 2021).

Addicott, F.T. Abscission; University of California Press: Berkeley, CA, USA, 1982.

Addicott, F. T.; Lynch, R. S. Physiology of abscission. Annu. Rev. Plant Physiol., 1955, 6(1), 211-238.

Ahmed, Z. F.; Palta, J. P. Postharvest dip treatment with a natural lysophospholipid plus soy lecithin extended the shelf life of banana fruit. Postharvest Bio. Technol., 2016, 113, 58-65.

Alexander, P.; Brown, C.; Arneth, A.; Finnigan, J.; Moran, D.; Rounsevell, M. D. Losses, inefficiencies, and waste in the global food system. Agric. Syst., 2017, 153, 190-200.

Amaro, A. L.; Fundo, J. F.; Oliveira, A.; Beaulieu, J. C.; Fernández‐Trujillo, J. P.; Almeida, D. P. 1‐Methylcyclopropene effects on temporal changes of aroma volatiles

and phytochemicals of fresh‐cut cantaloupe. J. Sci. Food Agric., 2013, 93(4), 828-837.

An, J.P.; Wang, X.F.; Li, Y.Y.; Song, L.Q.; Zhao, L.L.; You, C.X.; Hao, Y.J. EIN3-LIKE1, MYB1, and ETHYLENE RESPONSE FACTOR3 Act in a Regulatory Loop That Synergistically Modulates Ethylene Biosynthesis and Anthocyanin Accumulation. Plant Physiol. 2018, 178, 808–823.

Andrews, S. FastQC: A Quality control tool for high throughput sequence data. http://www.bioinformatics.babraham.ac.uk/projects/fastqc/. 2010. (accessed on 3 February 2021).

Anusuya, P.; Nagaraj, R.; Janavi, G, J.; Subramanian, K. S.; Paliyath, G.; Subramanian, J. Pre-harvest sprays of hexanal formulation for extending retention and shelf-life of mango (Mangifera indica L.) fruit. Sci. Hortic. 2016, 211: 231–240.

Arnao, M.B.; Hernández-Ruiz, J. Growth conditions influence the melatonin content of tomato plants. Food Chem. 2013, 138, 1212–1214.

Arnao, M.B.; Hernández-Ruiz, J. Melatonin in flowering, fruit set and fruit ripening. Plant Reprod. 2020, 33, 77–87.

Arseneault, M. H.; Cline, J. A. A review of apple pre-harvest fruit drop and practices for horticultural management. Sci. Hortic. 2016, 211, 40-52.

122

Arseneault, M. H.; Cline, J. A. AVG, NAA, boron, and magnesium influence pre-harvest fruit drop and fruit quality of 'Honeycrisp' apples. Can. J. Plant Sci. 2017, 98(3): 741-752.

Back, K.; Tan, D.X.; Reiter, R.J. Melatonin biosynthesis in plants: Multiple pathways catalyze tryptophan to melatonin in the cytoplasm or chloroplasts. J. Pineal Res. 2016, 61, 426–437.

Balan, B.; Marra, F. P.; Caruso, T.; Martinelli, F. Transcriptomic responses to biotic stresses in Malus x domestica: a meta-analysis study. Sci. Rep. 2018, 8(1), 1-12.

Bapat, V. A.; Trivedi, P. K.; Ghosh, A.; Sane, V. A.; Ganapathi, T. R.; Nath, P. Ripening

of fleshy fruit: molecular insight and the role of ethylene. Biotechnol. advances, 2010,

28(1), 94-107.

Barberon, M.; Geldner, N. Radial transport of nutrients: the plant root as a polarized

epithelium. Plant physiol., 2004, 166(2), 528-537.

Barry, C.S.; Giovannoni, J.J. Ethylene and fruit ripening. J. Plant Growth Regul. 2007, 26, 143–159.

Baugher, T.; Schupp, J.; Lara, C.; Watkins, C. Crop load and fruit nutrient studies in commercial Honeycrisp orchards to determine best practices for minimizing bitter pit. PA Fruit News, 2014, 94(2), 37-40.

Bender, 2016. Bitter pit not just a calcium deficiency. Available online at http://www.omafra.gov.on.ca/english/crops/hort/news/orchnews/2016/on-0816a2.htm (Accessed 15 August 2021).

Blanusa, T.; Else, M. A.; Atkinson, C. J.; Davies, W. J. The regulation of sweet cherry fruit abscission by polar auxin transport. Plant Growth Regul. 2005, 45(3), 189-198.

Boeing, H.; Bechthold, A.; Bub, A.; Ellinger, S.; Haller, D.; Kroke, A.; Watzl, B. Critical review: vegetables and fruit in the prevention of chronic diseases. Eur. J. Nutr., 2012, 51(6), 637-663.

Bolger, A. M.; Lohse, M.; Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014, 30(15), 2114-2120.

Boliko, M. C. FAO and the situation of food security and nutrition in the world. Journal of nutritional science and vitaminology, 2019, 65(Supplement), S4-S8.

Bonghi, C.; Casadoro, G.; Ramina, A.; Rascio, N. Abscission in leaf and fruit explants of Prunus persica (L.) Batsch. New Phytol. 1993, 123, 555–565.

123

Botton, A.; Ruperti, B. The yes and no of the ethylene involvement in abscission. Plants 2019, 8, 187.

Brown, J.H.; Paliyath, G.; Thompson, J.E. Influence of acyl chain composition on the degradation of phosphatidylcholine by phospholipase D in carnation microsomal membranes. J. Exp. Bot. 1990, 41, 979–986.

Buesa, C.; Dominguez, M.; Vendrell, M. Abscisic acid effects on ethylene production and respiration rate in detached apple fruit at different stages of development. Revista española de ciencia y tecnología de alimentos, 1994, 34(5), 495-506.

Buta, J. G.; Spaulding, D. W. Changes in indole-3-acetic acid and abscisic acid levels during tomato (Lycopersicon esculentum Mill.) fruit development and ripening. J. Plant Growth Regul., 1994, 13(3), 163-166.

Byers, R. E. Effects of aminoethoxyvinylglycine (AVG) on preharvest fruit drop, maturity, and cracking of several apple cultivars. J. Tree Fruit Prod., 1997, 2(1), 77-97.

Cabe, P. R.; Baumgarten, A.; Onan, K.; Luby, J. J.; Bedford, D. S. Using Microsatellite Analysis to Verify Breeding Records: A study of Honeycrisp' and Other Cold-hardy Apple Cultivars. Hort. Sci., 2005, 40(1), 15-17.

Cheema, A.; Padmanabhan, P.; Amer, A.; Parry, M.J.; Lim, L.T.; Subramanian, J.; Paliyath, G. Postharvest hexanal vapor treatment delays ripening and enhances shelf life of greenhouse grown sweet bell pepper (Capsicum annum L.). Postharvest Biol. Technol. 2018, 136, 80–89.

Chen, S. Y.; Kuo, S.R.; Chien, C. T. Roles of gibberellins and abscisic acid in dormancy and germination of red bayberry (Myrica rubra) seeds. Tree Physiol. 2008, 28(9), 1431-1439.

Cheng, L.; Sazo, M. M. Why is ‘Honeycrisp’ so susceptible to bitter pit. Fruit Q, 2018, 26(1), 19-23.

Chiu, G. Z.; Shelp, B. J.; Bowley, S. R.; DeEll, J. R.; Bozzo, G. G. Controlled atmosphere-related injury in ‘Honeycrisp’ apples is associated with γ-aminobutyrate accumulation. Can. J. Plant Sci., 2015, 95(5), 879-886.

Choe, H. T.; Cosgrove, D. J. Expansins as agents in hormone action. In Plant Hormone 2010, pp. 262-28.

Choi, K. Y.; Kim, I. S.; Yun, Y. S.; Choi, E. Y. Determination of Optimal Concentration of LPE (Lysophosphatidylethanolamine) for Postharvest Stability and Quality of Strawberry Fruit. Protected Horticulture and Plant Factory, 2016, 25(3), 153-161.

124

Cliff, M.; Lok, S.; Lu, C.; Toivonen, P. M. Effect of 1-methylcyclopropene on the sensory, visual, and analytical quality of greenhouse tomatoes. Postharvest Bio.Technol., 2009, 53(1-2), 11-15.

Cline, J. A. Multiple season-long sprays of ethephon or NAA combined with calcium chloride on ‘Honeycrisp’ apples: I. Effect on bloom and fruit quality attributes. Can. J. Plant Sci. 2019, 99(4), 444-459.

Cline, J. A.; Gardner, J. Commercial production of Honeycrisp apples in Ontario.

Ontario, Ministry of Agriculture, Food and Rural Affairs, 2005. Available Online at

http://www.omafra.gov.on.ca/english/crops/facts/05-047.htm (accessed 2 May 2021).

Cline, J.A. Commercial Production of Honeycrisp Apples in Ontario. 2009. Available online: http://www.omafra.gov.on.ca/english/crops/facts/05-047.htm (accessed on 20 August 2021).

Cline, J.A. Gala, Honeycrisp, and Ambrosia®—Strong Contenders in the Ontario Apple Market. 2014. Available online: http://www.omafra.gov.on.ca/english/crops/hort/news/orchnews/2014/on-1214a1.htm (accessed on 3 June 2021).

Cline, J.A. Multiple season-long sprays of ethephon or NAA combined with calcium chloride on ‘Honeycrisp’ apples: I. Effect on bloom and fruit quality attributes. Can. J. Plant Sci. 2019, 99, 444–459.

Corbacho, J.; Romojaro, F.; Pech, J. C.; Latché, A.; Gomez-Jimenez, M. C. Transcriptomic events involved in melon mature-fruit abscission comprise the sequential induction of cell-wall degrading genes coupled to a stimulation of endo and exocytosis. PloS One 2013, 8(3), e58363.

Daccord, N.; Celton, J.M.; Linsmith, G.; Becker, C.; Choisne, N.; Schijlen, E.; Bucher, E. High-quality de novo assembly of the apple genome and methylome dynamics of early fruit development. Nat. Genet. 2017, 49, 1099–1106.

Dal Cin, V., Barbaro, E., Danesin, M., Murayama, H., Velasco, R., & Ramina, A. Fruitlet

abscission: a cDNA-AFLP approach to study genes differentially expressed during

shedding of immature fruit reveals the involvement of a putative auxin hydrogen

symporter in apple (Malus domestica L. Borkh). Gene, 2009, 442(1-2), 26-36.

Dandekar, A.M.; Teo, G.; Defilippi, B.G.; Uratsu, S.L.; Passey, A.J.; Kader, A.A.; Stow, J.R.; Colgan, R.J.; James, D.J. Effect of down-regulation of ethylene biosynthesis on fruit flavor complex in apple fruit. Transgenic Res. 2004, 13, 373–384.

125

De Freitas, S. T.; do Amarante, C. V. T.; Mitcham, E. J. Mechanisms regulating apple cultivar susceptibility to bitter pit. Sci. Hortic., 2015, 186, 54-60.

De Freitas, S.T.; do Amarante, C.V.; Labavitch, J.M.; Mitcham, E.J. Cellular approach to understand bitter pit development in apple fruit. Postharvest Biol. Technol. 2010, 57, 6–13.

DeBrouwer, E. J.; Sriskantharajah, K.; El Kayal, W.; Sullivan, J.A.; Paliyath, G.; Subramanian, J. Pre-harvest hexanal spray reduces bitter pit and enhances postharvest quality in 'Honeycrisp’ apples (Malus domestica Borkh.). Sci. Hortic. 2020, 273, 109610.

DeEll, J.R.; Ayres, J.T.; Murr, D.P. 1-Methylcyclopropene concentration and timing of postharvest application alters the ripening of ‘McIntosh’ apples during storage. Hort. Technol., 2008, 18, 624–630.

DeEll, J.R.; Ayres, J.T.; Murr, D.P. 1-Methylcyclopropene influences ‘Empire’ and ‘Delicious’ apple quality during long-term commercial storage. Hort. Technol., 2007, 17, 46–51.

DeEll, J.R.; Ehsani-Moghaddam, B. Preharvest 1-methylcyclopropene treatment reduces soft scald in ‘Honeycrisp’ apples during storage. Hort. Sci., 2010, 45, 414–417.

DeEll, J.R.; Lum, G.B.; Ehsani‐Moghaddam, B. Effects of delayed controlled atmosphere storage on disorder development in ‘Honeycrisp’ apples. Can. J. Plant Sci. 2016, 96, 621–629.

de Freitas, S. T.; Mitcham, E. I. 3 factors involved in fruit calcium deficiency disorders. Horticultural reviews, 2012, 40(1), 107-146.

Dek, M.S.; Padmanabhan, P.; Subramanian, J.; Paliyath, G. Inhibition of tomato fruit ripening by 1-MCP, wortmannin and hexanal is associated with a decrease in transcript levels of phospholipase D and other ripening related genes. Postharvest Biol. Technol. 2018, 140, 50–59.

Delong, J.M.; Prange, R.K.; Schotsmans, W.C.; Nichols, D.S.; Harrison, P. Determination of the optimal pre-storage delayed cooling regime to control disorders and maintain quality in ‘Honeycrisp’TM apples. J. Hortic. Sci. Biotechnol. 2009, 84, 410–414.

Demarty, M.; Morvan, C.; Thellier, M. Calcium and the cell wall. Plant, Cell. Environ., 1984, 7(6), 441-448.

Ding, X.; Zhang, L.; Hao, Y.; Xiao, S.; Wu, Z.; Chen, W.; Li, X.; Zhu, X. Genome-wide identification and expression analyses of the calmodulin and calmodulin-like proteins

126

reveal their involvement in stress response and fruit ripening in papaya. Postharvest Biol. Technol. 2018, 143, 13–27.

Doerflinger, F.C.; Sutanto, G.; Nock, J.F.; Shoffe, Y.A.; Zhang, Y.; Watkins, C.B. Stem-end flesh browning of ‘Gala’ apples is decreased by preharvest 1-MCP (Harvista) and conditioning treatments. Fruit Q. 2017, 25, 9–14.

Dong, Y. H.; Janssen, B. J.; Bieleski, L. R.; Atkinson, R. G.; Morris, B. A.; Gardner, R. C. Isolating and characterizing genes differentially expressed early in apple fruit development. J. Am. Soc. Hortic. Sci., 1997, 122(6), 752-757.

Drazeta, L.; Lang, A.; Morgan, L.; Volz, R.; Jameson, P. E. Bitter pit and vascular function in apples. In IV International Symposium on Mineral Nutrition of Deciduous Fruit Crops, 2000, 564 (pp. 387-392).

Eccher, G.; Begheldo, M.; Boschetti, A.; Ruperti, B.; Botton, A. Roles of ethylene

production and ethylene receptor expression in regulating apple fruitlet abscission. Plant

Physiol., 2015, 169(1), 125-137.

Eccher, G.; Ferrero, S.; Populin, F.; Colombo, L.; Botton, A. Apple (Malus domestica L.

Borkh) as an emerging model for fruit development. Plant Biosystems, 2014, 148(1),

157-168.

El Kayal, W.; Paliyath, G.; Sullivan, J. A.; Subramanian, J. Phospholipase D inhibition by hexanal is associated with calcium signal transduction events in raspberry. Hortic. Res. 2017, 4, 17042.

Elik, A.; Yanik, D. K.; Istanbullu, Y.; Guzelsoy, N. A.; Yavuz, A.; Gogus, F. Strategies to reduce post-harvest losses for fruit and vegetables. Strategies, 2019. 5(3), 29-39.

Embree, C. G.; Myra, M. T.; Nichols, D. S.; Wright, A. H. Effect of blossom density and

crop load on growth, fruit quality, and return bloom in ‘Honeycrisp’

apple. Hort.Sci., 2007, 42(7), 1622-1625.

Erland, L, A.; Shukla, M. R.; Glover, W. B.; Saxena, P. K. A simple and efficient method for analysis of plant growth regulators: a new tool in the chest to combat recalcitrance in plant tissue culture. Plant Cell, Tissue and Organ Cult. 2017, 131(3), 459-470.

Estornell, L. H.; Agustí, J.; Merelo, P.; Talón, M.; Tadeo, F. R. Elucidating mechanisms underlying organ abscission. Plant Sci. 2013, 199, 48-60.

Fan, X.; Blankenship, S. M.; Mattheis, J. P. 1-Methylcyclopropene inhibits apple ripening. J. Am. Soc. Hortic. Sci., 1999, 124(6), 690-695.

127

Fan, X.; Mattheis, J.P.; Blankenship, S. Development of apple superficial scald, soft scald, core flush, and greasiness is reduced by MCP. J. Agric. Food Chem. 1999, 47, 3063–3068.

FAO, 2017. Supply utilization account – crop data. Available online at https://www.fao.org/faostat/en/#data/SCL (accessed on 15 August 2021).

FAO, 2009. How to Feed the World in 2050. Available Online at https://www.fao.org/fileadmin/templates/wsfs/docs/expert_paper/How_to_Feed_the_World_in_2050.pdf (accessed on 15 August 2021). FAO, 2019. The State of Food and Agriculture: Moving Forward on Food Loss and Waste Reduction. Available Online at https://www.fao.org/fileadmin/templates/wsfs/docs/Issues_papers/HLEF2050_Global_Agriculture.pdf (accessed on 18 Aug 2021).

Faust, M., & Shear, C. B. Corking disorders of apples: A physiological and biochemical review. The Bot. Rev., 1968, 34(4), 441.

Foley, J. A.; Ramankutty, N.; Brauman, K, J.; Cassidy, E. S.; Gerber, J. S.; Johnston, M.; Nathaniel D. Mueller et al. Solutions for a cultivated planet. Nature 478, no. 7369, 2011, 337-342.

Farag, K. M.; Palta, J. P. Enhancing ripening and keeping quality of apple and cranberry fruit using lysophosphatidylethanolamine, a natural lipid. Hort. Sci., 1991, 26, 67.

Fukumoto, M.; Nagai, K.; Yoshioka, H.; Aoba, K. Mechanism of the development of a calcium-related disorder (bitter pit) in apple. JARQ 1987, 20, 248–252.

Gallardo R. K.; Hanrahan, I.; Hong, Y. A.; Luby, J. J. Crop load management and the market profitability of ‘Honeycrisp’ apples. Hort Technol., 2015; 25: 575–584.

Gao, Q.; Xiong, T.; Li, X.; Chen, W.; Zhu, X. Calcium and calcium sensors in fruit development and ripening. Sci. Hortic. 2019, 253, 412–421.

Gao, Z.; Chen, Y.F.; Randlett, M.D.; Zhao, X.C.; Findell, J.L.; Kieber, J.J.; Schaller, G.E. Localization of the Raf-like kinase CTR1 to the endoplasmic reticulum of Arabidopsis through participation in ethylene receptor signaling complexes. J. Biol. Chem. 2003, 278, 34725–34732.

Garman, P.; Mathis, W. T. Conn. agrie. exp, Sta. Bull. 1956, 601. 19 pp

Ge, S. X.; Jung, D.; Yao, R. ShinyGO: a graphical gene-set enrichment tool for animals and plants. Bioinformatics 2020, 36(8), 2628-2629.

128

Gill, K. S.; Dhaliwal, H. S.; Mahajan, B. V. C. Paliyath, G.; Boora, R. S. Enhancing postharvest shelf life and quality of guava (Psidium guajava L.) cv. Allahabad Safeda by pre-harvest application of hexanal containing aqueous formulation. Postharvest Biol. Technol., 2016, 112, 224-232.

Gilliham, M.; Dayod, M.; Hocking, B. J.; Xu, B.; Conn, S. J.; Kaiser, B. N.; Tyerman, S. D. Calcium delivery and storage in plant leaves: exploring the link with water flow. J. Exp. Bot., 2011, 62(7), 2233-2250.

Giovannoni, J. Molecular biology of fruit maturation and ripening. Annu. Rev. Plant Biol., 2001, 52(1), 725-749.

Greene, D.W. The development and use of plant bioregulators in tree fruit production. In Proceedings of the XI International Symposium on Plant Bioregulators in Fruit Production, Bologna, Italy, 20–24 September 2009; Volume 884, pp. 31–40.

Greene, D. W.; Krupa, J.; Autio, W. Factors influencing preharvest drop of apples. In XII International Symposium on Plant Bioregulators in Fruit Production. 2013, 1042 (pp. 231-235).

Guinn, G. Fruit age and changes in abscisic acid content, ethylene production, and abscission rate of cotton fruit. Plant Physiol. 1982, 69, 349–352.

Guo, H.; Ecker, J.R. The ethylene signaling pathway: New insights. Curr. Opin. Plant

Biol. 2004, 7, 40–49.

Gustavsson, J.; Cederberg, C.; Sonesson, U.; Van Otterdijk, R.; Meybeck, A. Global food losses and food waste, Food, and agriculture organization of the United Nations. FAO, Rome, 2011.

Hanson, J. B. Impairment of respiration, ion accumulation, and ion retention in root tissue treated with ribonuclease and ethylenediamine tetraacetic acid. Plant Physiol. 1960, 35: 372–379.

Harada, T.; Sunako, T.; Wakasa, Y.; Soejima, J.; Satoh, T.; Niizeki, M. An allele of the 1-aminocyclopropane-1-carboxylate synthase gene (Md-ACS1) accounts for the low level of ethylene production in climacteric fruit of some apple cultivars. Theor. Appl. Genet. 2000, 101, 742–746.

Harb, J.; Gapper, N.E.; Giovannoni, J.J.; Watkins, C.B. Molecular analysis of softening and ethylene synthesis and signaling pathways in a non-softening apple cultivar, ‘Honeycrisp’ and a rapidly softening cultivar, ‘McIntosh’. Postharvest Biol. Technol. 2012, 64, 94–103.

129

Harris, S. A.; Robinson, J. P.; Juniper, B. E. Genetic clues to the origin of the

apple. Trends Genet., 2002, 18(8), 426-430.

Herrick, 2016, Millennials drive premium apple demand. Available online at

https://www.growingproduce.com/fruit/apples-pears/millennials-drive-premium-apple-

demand/ (accessed on 18 Sep 2021).

Hocking, B.; Tyerman, S. D.; Burton, R. A.; Gilliham, M. Fruit calcium: transport and

physiology. Front. Plant Sci., 2016, 7, 569.

Howard, N. P.; Albach, D. C.; Luby, J. J. The identification of apple pedigree information

on a large diverse set of apple germplasm and its application in apple breeding using

new genetic tools. In 18th international conference on organic fruit-growing:

proceedings of the conference, 2018, (pp. 19-21).

Hua, J.; Meyerowitz, E. M. Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana. Cell 1998, 94(2), 261-271.

Ireland, H.S.; Guillen, F.; Bowen, J.H.; Tacken, E.J.; Putterill, J.; Schaffer, R.J.;

Johnston, J.W. Mining the apple genome reveals a family of nine ethylene receptor

genes. Postharvest Biol. Technol. 2012, 72, 42–46.

Irish-Brown, A.; Schwallier, P.; Shane, B.; Tritten, B. Why Does Apple Fruit Drop Prematurely? 2011. Available online: https://www.canr.msu.edu/news/why_does_apple_fruit_drop_ prematurely (accessed on 17 February 2021).

Jemrić, T.; Fruk, I.; Fruk, M.; Radman, S.; Sinkovič, L.; Fruk, G. Bitter pit in apples: Pre-and postharvest factors: A review. Span. J. Agric. Res. 2016, 14, 15.

Ji, Y.; Qu, Y.; Jiang, Z.; Yan, J.; Chu, J.; Xu, M.; Su, X.; Yuan, H.; Wang, A. The mechanism for brassinosteroids suppressing climacteric fruit ripening. Plant Physiol. 2021, 185, 1875–1893.

Ji, Y.; Wang, A. Recent Advances in Phytohormone Regulation of Apple-Fruit Ripening. Plants, 2021, 10(10), 2061.

Jincy, M.; Djanaguiraman, M.; Jeyakumar, P.; Subramanian, K. S. ; Jayasankar, S.; Paliyath, G. Inhibition of phospholipase D enzyme activity through hexanal leads to delayed mango (Mangifera indica L.) fruit ripening through changes in oxidants and antioxidant enzymes activity. Sci. Hortic. 2017, 218, pp:316-325.

Johnston, J.W.; Hewett, E.W.; Hertog, M.L. Postharvest softening of apple (Malus domestica) fruit: A review. N. Z. J. Crop Hortic. Sci. 2002, 30, 145–160.

130

Johnston, J.W.; Hewett, E.W.; Hertog, M.L.; Harker, F.R. Harvest date and fruit size affect postharvest softening of apple fruit. J. Hortic. Sci. 2002, 77, 355–360.

Juniper, B. E.; Watkins, R.; Harris, S. A. The origin of the apple. In Eucarpia Symposium

on Fruit Breeding and Genetics 1996, 484 (pp. 27-34).

Kalcsits, L.; van der Heijden, G.; Reid, M.; Mullin, K. Calcium absorption during fruit development in ‘Honeycrisp’ apple measured using 44Ca as a stable isotope tracer. Hort. Sci., 2017, 52(12), 1804-1809.

Kc, K. B.; Dias, G. M.; Veeramani, A.; Swanton, C. J.; Fraser, D.; Steinke, D; Fraser, E. D. When too much isn’t enough: Does current food production meet global nutritional needs?. PloS one, 2018, 13(10), e0205683.

Kende, H. Ethylene biosynthesis. Annu. Rev. Plant Biol. 1993, 44, 283–307.

Kolarič, J.; Pleško, I. M.; Tojnko, S.; Stopar, M. Apple fruitlet ethylene evolution and MdACO1, MdACS5A, and MdACS5B expression after application of naphthaleneacetic acid, 6-benzyladenine, ethephon, or shading. Hortsci. 2011, 46(10), 1381-1386.

Kondo, S.; Tomiyama, A.; Seto, H. Changes of endogenous jasmonic acid and methyl jasmonate in apples and sweet cherries during fruit development. J. Am. Soc. Hortic. Sci., 2000, 125(3), 282-287.

Kondo, S.; Kittikorn, M.; Kanlayanarat, S. Preharvest antioxidant activities of tropical fruit and the effect of low temperature storage on antioxidants and jasmonates. Postharvest Biol.Technol., 2005, 36(3), 309-318.

Krishna Kumar, S.; El Kayal, W.; Sullivan, J. A.; Paliyath, G.; Subramanian, J. Pre-harvest application of hexanal formulation enhances shelf life and quality of ‘Fantasia’ nectarines by regulating membrane and cell wall catabolism-associated genes. Sci. Hortic. 2018, 229, 117–124.

Kucukural, A.; Yukselen, O.; Ozata, D. M.; Moore, M. J.; Garber, M. DEBrowser: interactive differential expression analysis and visualization tool for count data. BMC Genomics 2019, 20(1), 1-12.

Kumar, R.; Khurana, A.; Sharma, A. K. Role of plant hormones and their interplay in development and ripening of fleshy fruit. J. Exp. Bot. 2013, 65(16), 4561-4575.

Lara, I.; Belge, B.; Goulao, L. F. The fruit cuticle as a modulator of postharvest quality. Postharvest Biol. Technol., 2014, 87, 103-112.

Lara, I.; Heredia, A.; Domínguez, E. Shelf life potential and the fruit cuticle: The unexpected player. Front. Plant. Sci. 2019, 10, 770.

131

Lara, I.; Vendrell, M. Development of ethylene-synthesizing capacity in preclimacteric apples: Interaction between abscisic acid and ethylene. J. Am. Soc. Hortic. Sci. 2000, 125, 505–512.

Lashbrook, C. C.; Giovannoni, J. J.; Hall, B. D.; Fischer, R. L.; Bennett, A. B. Transgenic analysis of tomato endo‐β‐1, 4‐glucanase gene function. Role of cel1 in floral abscission. Plant J. 1998, 13(3), 303-310.

Li, C.; Meng, D.; Zhang, J.; Cheng, L. Genome-wide identification and expression analysis of calmodulin and calmodulin-like genes in apple (Malus× domestica). Plant Physiol. Biochem. 2019, 139, 600–612.

Li, J.; Yuan, R. NAA and ethylene regulate expression of genes related to ethylene biosynthesis, perception, and cell wall degradation during fruit abscission and ripening in ‘Delicious’ apples. J. Plant Growth Regul. 2008, 27, 283–295.

Li, J.; Zhu, H.; Yuan, R. Profiling the expression of genes related to ethylene biosynthesis, ethylene perception, and cell wall degradation during fruit abscission and fruit ripening in apple. J. Am. Soc. Hortic. Sci. 2010, 135, 391–401.

Li, T.; Jiang, Z.; Zhang, L.; Tan, D.; Wei, Y.; Yuan, H.; Li, T.; Wang, A. Apple (Malus domestica) MdERF2 negatively affects ethylene biosynthesis during fruit ripening by suppressing MdACS1 transcription. Plant J. 2016, 88, 735–748.

Li, T.; Xu, Y.; Zhang, L.; Ji, Y.; Tan, D.; Yuan, H.; Wang, A. The Jasmonate-Activated Transcription Factor MdMYC2 Regulates ETHYLENE RESPONSE FACTOR and Ethylene Biosynthetic Genes to Promote Ethylene Biosynthesis during Apple Fruit Ripening. Plant Cell 2017, 29, 1316–1334.

Liao, Y.; Smyth, G. K.; Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30(7), 923-930.

Liu, X.; Hou, X. Antagonistic regulation of ABA and GA in metabolism and signaling pathways. Front. Plant Sci. 2018, 9, 251.

Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25(4), 402-408.

Luby J.; Bedford, D. S. Apple tree: Honeycrisp. Regents of the University of Minnesota, assignee, US patent, US PP7197, 1990.

Luckwill, L. C, 1948. The hormone content of the seed in relation to endosperm development and fruit drop in apple. J. hort. Sci., 1948, (24) pp. 32-43

132

Ludford, P.M. Hormonal changes during postharvest. In Postharvest Physiology and Pathology of Vegetables, 2nd ed.; Bartz, J. A., Brecht, K. B., Eds.; ISBN 9780824706876, CRC press, Boca Raton, Florida, USA,2002; pp. 57–107.

Mailvaganam, S. Apple Crop Estimate for Ontario, as of November 2014. 2015. Available online: http://www.omafra.gov.on.ca/english/stats/hort/applecropestimate.htm (accessed on 3 June 2021).

Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 2011, 17, 10–12.

Masia, A.; Ventura, M.; Gemma, H.; Sansavini, S. Effect of some plant growth regulator treatments on apple fruit ripening. Plant Growth Regul. 1998, 25, 127–134.

Maunders, M. J.; Holdsworth, M. J.; Slater, A.; Knapp, J. E.; Bird, C. R.; Schuch, W.;

Grierson, D. Ethylene stimulates the accumulation of ripening‐related mRNAs in

tomatoes. Plant, Cell & Environ., 1987, 10(2), 177-184.

McAtee, P.; Karim, S.; Schaffer, R. J.; David K. A dynamic interplay between phytohormones is required for fruit development, maturation, and ripening. Front. Plant Sci. 2013, 4, 79.

McCluskey, J. J.; Mittelhammer, R. C.; Marin, A. B.; Wright, K. S. Effect of quality characteristics on consumers' willingness to pay for Gala apples. Can. J. Agric. Econ., 2007, 55(2), 217-231.

McCown, M. Anatomical and chemical aspects of abscission of fruit of the

apple. Botanical Gazette, 1943, 105(2), 212-220.

McManus, M. T. Further examination of abscission zone cells as ethylene target cells in

higher plants. Annals of Botany, 2008, 101(2), 285-292.

Meir, S.; Hunter, D. A.; Chen, J. C.; Halaly, V.; Reid, M. S. Molecular changes occurring during the acquisition of abscission competence following lowering auxin depletion in Mirabilis jalapa. Plant Physiol. 2006, 141:1604–1616.

Merelo, P.; Agustí, J.; Arbona, V.; Costa, M. L.; Estornell, L. H.; Gómez-Cadenas, A., Tadeo, F. R. Cell wall remodeling in abscission zone cells during ethylene-promoted fruit abscission in citrus. Front. Plant Sci., 2017, 8, 126.

Miqueloto, A.; do Amarante, C. V. T.; Steffens, C. A.; dos Santos, A.; Mitcham, E. Relationship between xylem functionality, calcium content and the incidence of bitter pit in apple fruit. Sci. Hortic., 2014, 165, 319-323.

133

Montanaro, G.; Dichio, B.; Xiloyannis, C.; Celano, G. Light influences transpiration and calcium accumulation in fruit of kiwifruit plants (Actinidia deliciosa var. deliciosa). Plant Sci., 2006, 170(3), 520-527.

Mou, W.; Li, D.; Bu, J.; Jiang, Y.; Khan, Z.U.; Luo, Z.; Ying, T. Comprehensive analysis of ABA effects on ethylene biosynthesis and signaling during tomato fruit ripening. PLoS ONE 2016, 11, e0154072.

Nakano, T., Kimbara, J., Fujisawa, M., Kitagawa, M., Ihashi, N., Maeda, H., ... & Ito, Y.

MACROCALYX and JOINTLESS interact in the transcriptional regulation of tomato fruit

abscission zone development. Plant physiology, 2012, 158(1), 439-450.

Nock, J.F.; Watkins, C.B.; James, H.; Reed, N.; Oakes, R.L. Preharvest application of 1-methylcyclopropene (1-MCP) to control fruit drop of apples, and its effects on postharvest quality. In Proceedings of the VI International Postharvest Symposium, Antalya, Turkey, 8–12 April 2009; Volume 877, pp. 365–374.

OAG, 2020, Annual report. Available online at https://onapples.com/mobile/annual-report (accessed 3 May 2021).

Ogawa, M.; Kay, P.; Wilson, S.; Swain, S. M. Arabidopsis dehiscence zone polygalacturonase1 (ADPG1), ADPG2, and QUARTET2 are polygalacturonases required for cell separation during reproductive development in Arabidopsis. The Plant Cell 2009, 21(1), 216-233.

OMAFRA, 2005, Commercial production of ‘Honeycrisp’ apples in Ontario. Available online at http://www.omafra.gov.on.ca/english/crops/facts/05-047.htm accessed August 2021.

Onik, J.C.; Hu, X.; Lin, Q.; Wang, Z. Comparative Transcriptomic Profiling to Understand Pre- and Post-Ripening Hormonal Regulations and Anthocyanin Biosynthesis in Early Ripening Apple Fruit. Molecules 2018, 23, 1908.

Osborne, D. J. Abscission. Crit Rev Plant Sci. 1989, 8:103–129.

Osborne, D. J.; Sargent, J. A. The positional differentiation of ethylene-responsive cells in rachis abscission zones in leaves of Sambucus nigra and their growth and ultrastructural changes at senescence and separation. Planta 1976, 130(2), 203-210.

Osorio, S., Scossa, F., & Fernie, A. Molecular regulation of fruit ripening. Frontiers in

plant science, 2013, 4, 198.

134

Palego, L.; Betti, L.; Rossi, A.; Giannaccini, G. Tryptophan biochemistry: Structural, nutritional, metabolic, and medical aspects in humans. J. Amino Acids 2016, 2016, doi:10.1155/2016/8952520.

Paliyath, G.; Droillard, M. J. The mechanisms of membrane deterioration and

disassembly during senescence. Plant Physiol. Biochem., 1992, 30(6), 789-812.

Paliyath, G.; Lynch, D.V.; Thompson, J.E. Regulation of membrane phospholipid catabolism in senescing carnation flowers. Physiol. Plant. 1987, 71, 503–511.

Paliyath, G.; Murr, D.P. Compositions for the Preservation of Fruit and Vegetables. U.S. Patent 6,514,914, 3 April 2007.

Paliyath, G.; Subramanian, J. Phospholipase D inhibition technology for enhancing shelf life and quality. In Post-Harvest Biology and Technology of Fruit, Vegetables, and Flowers, 1st ed.; Paliyath, G., Murr, D.P., Handa, A.K., Lurie, S., Gill, K.S., Eds.; Wiley-Blackwell: Iowa 50014-8300, USA, 2008; Chapter 8, pp. 240–245.

Paliyath, G.; Thompson, J.E. Calcium-and calmodulin-regulated breakdown of phospholipid by microsomal membranes from bean cotyledons. Plant Physiol. 1987, 83, 63–68.

Paliyath, G.; Tiwari, K.; Yuan, H.; Whitaker, B.D. Structural deterioration in produce: Phospholipase D, membrane deterioration, and senescence. In Post-Harvest Biology and Technology of Fruit, Vegetables, and Flowers, 1st ed.; Paliyath, G., Murr, D.P., Handa, A.K., Lurie, S., Gill, K.S., Eds.; Wiley-Blackwell: Hoboken, NJ, USA, 2008; Chapter 9; pp. 195–239.

Paliyath, G.; Yada, R.; Murr, D. P.; Pinhero, R. G. Inhibition of Phospholipase D. US patent # 6, 514, 914. 2003, 298, 249.

Poovaiah, B.W.; Du, L.; Wang, H.; Yang, T. Recent advances in calcium/calmodulin-mediated signaling with an emphasis on plant-microbe interactions. Plant Physiol. 2013, 163, 531–542.

Prange, R., Dejong, J., Nichols, D., and Harrison, P. 2011. Effect of fruit maturity on the incidence of bitter pit, senescent breakdown, and other poat-harvest disorders in ‘Honeycrisp’TM apple. J. Hortic. Sci. 86: 245-248.

Ranty, B.; Aldon, D.; Galaud, J.P. Plant calmodulins and calmodulin-related proteins: Multifaceted relays to decode calcium signals. Plant Signal. Behav. 2006, 1, 96–104.

Rasori, A.; Ruperti, B.; Bonghi, C.; Tonutti, P.; Ramina, A. Characterization of two putative ethylene receptor genes expressed during peach fruit development and abscission. J. Exp. Bot. 2002, 53, 2333–2339.

135

Robinson, M. D.; McCarthy, D. J.; Smyth, G. K. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26(1), 139-140.

Robinson, T. The Physiology of Apple Pre-Harvest Fruit Drop. 2011. Available online: http://www.hort.cornell.edu/expo/proceedings/2011/Management%20of%20Pre-Harvest%20Fruit%20Drop/Physiology%20of%20fruit%20drop.pdf (accessed on 2 March 2021).

Robinson, T.; Lopez, S. Crop load affects 'Honeycrisp' fruit quality more than nitrogen,

potassium, or irrigation. In XXVIII International Horticultural Congress on Science and

Horticulture for People (IHC2010): International Symposium on the 2010, 940, pp. 529-

537.

Robinson, T.L.; Lakso, A.N.; Hoying, S.A. Advances in predicting chemical thinner response of apple using a MaluSim carbon balance model. In Proceedings of the XXVIII International Horticultural Congress on Science and Horticulture for People (IHC2010): International Symposium on Plant, Lisbon, Portugal, 22–27 August 2010; Volume 932, pp. 223–229.

Rosenberger, D. A.; Schupp, J. R.; Hoying, S. A.; Cheng, L.; Watkins, C. B. Controlling bitter pit in ‘Honeycrisp’ apples. Hort. Technol., 2004, 14(3), 342-349.

Rudell, D.R.; Fellman, J.K.; Mattheis, J.P. Preharvest application of methyl jasmonate to'Fuji'apples enhances red coloration and affects fruit size, splitting, and bitter pit incidence. HortScience 2005, 40, 1760–1762.

Sakaldas, M.; Gundogdu, M.A. The effects of preharvest 1‐methylcyclopropene (Harvista) treatments on harvest maturity of ‘Golden Delicious’ apple cultivar. In Proceedings of the III Balkan Symposium on Fruit Growing, Belgrade, Serbia, 16–18 September 2015; Volume 1139, pp. 601–608.

Samwel, J.; Msogoya, T.; Tryphone, G.; Mtui, H.D.; Baltazari, A.; Sullivan, J.A.; Mwatawala, M.W. Effects pre-harvest hexanal application on fruit market attributes of orange varieties grown in Eastern zone of Tanzania. J. Hortic. Sci. Biotechnol. 2021, 96, 364–371.

Sato-Nara, K.; Yuhashi, K. I.; Higashi, K.; Hosoya, K.; Kubota, M.; Ezura, H. Stage-and tissue-specific expression of ethylene receptor homolog genes during fruit development in muskmelon. Plant Physiol. 1999, 120(1), 321-330.

Saure, M. C. Calcium translocation to fleshy fruit: its mechanism and endogenous control. Scientia Horticulturae, 2005, 105(1), 65-89.

136

Saure, M.C. Reassessment of the role of calcium in development of bitter pit in apple. Funct. Plant Biol. 1996, 23, 237–243.

Schupp, J. R.; Fallahi, E.; Chun, I. J. Effect of particle film on fruit sunburn, maturity, and

quality of ‘Fuji' and ‘Honeycrisp' apples. Hort. Technol., 2002, 12(1), 87-90.

Schupp, J. R.; Greene, D. W. Effect of Aminoethoxyvinylglycine (AVG) on Preharvest Drop, Fruit Quality, and Maturation of ‘McIntosh' Apples. Concentration and Timing of Dilute Applications of AVG. Hort. Sci., 2004, 39(5), 1030-1035.

Schwartz, S. H., & Zeevaart, J. A. (2010). Abscisic acid biosynthesis and metabolism.

In Plant hormones (pp. 137-155). Springer, Dordrecht.

Seymour, G. B.; Østergaard, L.; Chapman, N. H.; Knapp, S.; Martin, C. Fruit development and ripening. Annu. Rev. Plant Biol., 2013, 64, 219-241.

Sharma, M.; Jacob, J.K.; Subramanian, J.; Paliyath, G. Hexanal and 1‐MCP treatments

for enhancing the shelf life and quality of sweet cherry (Prunus avium L.). Sci. Hortic.

2010, 125, 239–247.

Spaventa, 2020. A brief history of apples. Available online at

https://farmtogether.com/learn/blog/a-brief-history-of-apples (accessed 3 August 2021).

Sriskantharajah, K.; El Kayal, W.; Torkamaneh, D.; Ayyanath, M.M.; Saxena, P.K.; Sullivan, A.J.; Paliyath, G.; Subramanian, J. Transcriptomics of improved fruit retention by hexanal in ‘Honeycrisp’ reveals hormonal crosstalk and reduced cell wall degradation in the fruit abscission zone. Int. J. Mol. Sci. 2021, 22, 8830.

Statista, 2018. Share of apple production in 2018 in Canada, by province. Available online at https://www.statista.com/statistics/1073997/share-of-apple-production-in-canada-by-province/ (accessed 10 March 2021).

Statista, 2021. Global fruit production in 2019, by selected variety. Available online at https://www.statista.com/statistics/264001/worldwide-production-of-fruit-by-variety/ (Accessed 5 March 2021).

Statista, Global Fruit Production in 2019, by Selected Variety (in Million Metric Tons)*. 2021. Available online: https://www.statista.com/statistics/264001/worldwide-production-of-fruit-by-variety/ (accessed on 20 July 2021).

Sun, L.; Zhang, M.; Ren, J.; Qi, J.; Zhang, G.; Leng, P. Reciprocity between abscisic acid and ethylene at the onset of berry ripening and after harvest. BMC Plant Biol., 2010, 10(1), 1-11.

137

Sunako, T.; Sakuraba, W.; Senda, M.; Akada, S.; Ishikawa, R.; Niizeki, M.; Harada, T. An allele of the ripening-specific 1- aminocyclopropane-1-carboxylic acid synthase gene (ACS1) in apple fruit with a long storage life. Plant Physiol. 1999, 119, 1297–1304.

Taheri-Garavand, A.; Mumivand, H.; Fanourakis, D.; Fatahi, S.; Taghipour, S. An artificial neural network approach for non-invasive estimation of essential oil content and composition through considering drying processing factors: A case study in Mentha aquatica. Ind. Crop. Prod. 2021, 171, 113985.

Tan, D.; Li, T.; Wang, A. Apple 1-aminocyclopropane-1-carboxylic acid synthase genes, MdACS1 and MdACS3a, are expressed in different systems of ethylene biosynthesis. Plant Mol. Biol. Rep. Technol. 2013, 31, 204–209.

Taylor, J. E.; Whitelaw, C. A. Signals in abscission. New Phytol. 2001, 151(2), 323-340.

Thompson, D. S.; Osborne, D. JA role for the stele in intertissue signaling in the

initiation of abscission in bean leaves (Phaseolus vulgaris L.). 1999, Plant

Physiol., 105(1), 341-347.

Tieman, D. M.; Ciardi, J. A.; Taylor, M. G.; Klee, H. J. Members of the tomato LeEIL (EIN3‐like) gene family are functionally redundant and regulate ethylene responses throughout plant development. Plant J. 2001, 26(1), 47-58.

Tiwari, K.; Paliyath, G. Microarray analysis of ripening-regulated gene expression and its modulation by 1-MCP and hexanal. Plant Physiol. Biochem. 2011, 49, 329–340.

Tong, C.; Krueger, D.; Vickers, Z.; Bedford, D.; Luby, J.; El-Shiekh, A.; Shackel, K.; Ahmadi, H. Comparison of Softening-related Changes during Storage of Honeycrisp apple, its Parents, and Delicious. J. Am. Soc. Hortic. Sci. 1999, 124, 407–415.

Tonutti, P.; Cass, L. G.; Christoffersen, R. E. The expression of cellulase gene family members during induced avocado fruit abscission and ripening. Plant Cell Environ. 1995, 18(6), 709-713.

Tsuchiya, M.; Satoh, S.; Iwai, H. Distribution of XTH, expansin, and secondary-wall-related CesA in floral and fruit abscission zones during fruit development in tomato (Solanum lycopersicum). Front. Plant Sci. 2015, 6, 323.

UN environment, 2021. Stop Food Loss and Waste, for the people, for the planet. Available online at https://www.un.org/en/observances/end-food-waste-day (Accessed August 2021).

Van de Poel, B.; Bulens, I.; Markoula, A.; Hertog, M. L.; Dreesen, R.; Wirtz, M.;

Geeraerd, A. H. Targeted systems biology profiling of tomato fruit reveals coordination

138

of the Yang cycle and a distinct regulation of ethylene biosynthesis during post

climacteric ripening. Plant Physiol., 2012, 160(3), 1498-1514.

Vendrell, M.; Buesa, C. Relationship between abscisic acid content and ripening of apples. In Proceedings of the InInternational Symposium on Postharvest Handling of Fruit and Vegetables, Leuven, Belgium, 29 August–2 September 1988; Volume 258; pp. 389–396.

Vriezen, W. H., Feron, R., Maretto, F., Keijman, J., & Mariani, C. Changes in tomato

ovary transcriptome demonstrate complex hormonal regulation of fruit set. New

Phytologist, 2008, 177(1), 60-76.

Watkins, C.; Al Shoffe, Y.; Nock, J.F.; Zhang, Y. Harvista Treatment Effects on Quality and Storage Disorders of ‘Honeycrisp’ Apples. In Proceedings of the 2019 ASHS Annual Conference, Las Vegas, NV, USA, 21–25 July 2019.

Watkins, C.B.; Nock, J.F.; Kang, I.K.; Ma, Y.; Cheng, Y.; Fargione, M.F. ReTain and Harvista Effects on Maturity and Interactions with SmartFresh on Storage Quality of ‘Honeycrisp’ Apples from Three New York Growing Regions. In Hort. Sci., American Society for Horticultural Science: Alexandria, VA, USA, 2012; Volume 47, p. S233.

Watkins, C.B.; Nock, J.F.; Weis, S.A.; Jayanty, S.; Beaudry, R.M. Storage temperature, diphenylamine, and pre-storage delay effects on soft scald, soggy breakdown and bitter pit of ‘Honeycrisp’ apples. Postharvest Biol. Technol. 2004, 32, 213–221.

Watkins, C. B.; Erkan, M.; Nock, J. F.; Iungerman, K. A.; Beaudry, R. M.; Moran, R. E. Harvest Date Effects on Maturity, Quality, and Storage Disorders of ‘Honeycrisp' Apples. Hort. Sci., 2005, 40(1), 164-169.

White, P. J. Recent advances in fruit development and ripening: an overview. Journal of Experimental Botany, 2002, 53(377), 1995-2000.

Willett, W.; Rockström, J.; Loken, B.; Springmann, M.; Lang, T.; Vermeulen, S.; Murray, C. J. Food in the Anthropocene: the EAT–Lancet Commission on healthy diets from sustainable food systems. The Lancet, 2019, 393(10170), 447-492.

Wilmowicz, E.; Frankowski, K.; Kućko, A.; Świdziński, M.; de Dios Alché, J.; Nowakowska, A.; Kopcewicz, J. The influence of abscisic acid on the ethylene biosynthesis pathway in the functioning of the flower abscission zone in Lupinus luteus. J. Plant Physiol. 2016, 206, 49–58.

Wu, Z.; Burns, J. K. A β-galactosidase gene is expressed during mature fruit abscission of ‘Valencia’ orange (Citrus sinensis). J. Exp. Bot., 2004, 55(402), 1483-1490.

139

Yang, T.; Peng, H.; Bauchan, G.R. Functional analysis of tomato calmodulin gene family during fruit development and ripening. Hortic. Res. 2016, 1, 1–9.

Yang, T.; Poovaiah, B.W. Calcium/calmodulin-mediated signal network in plants. Trends Plant Sci. 2003, 8, 505–512.

Yuan, R. Effects of temperature on fruit thinning with ethephon in ‘Golden Delicious’ apples. Sci. Hortic. 2007, 113, 8–12.

Yuan, R.; Carbaugh, D. H. Effects of NAA, AVG, and 1-MCP on ethylene biosynthesis, pre-harvest fruit drop, fruit maturity, and quality of 'Golden Supreme’ and' Golden Delicious' apples. Hortic. Sci. 2007, 42(1), 101-105.

Yuan, R.; Li, J. Effect of sprayable 1-MCP, AVG, and NAA on ethylene biosynthesis, pre-harvest fruit drop, fruit maturity, and quality of ‘Delicious’ apples. Hortic. Sci. 2008, 43, 1454–1460.

Yue, P.; Lu, Q.; Liu, Z.; Lv, T.; Li, X.; Bu, H.; Liu, W.; Xu, Y.; Yuan, H.; Wang, A. Auxin-activated MdARF5 induces the expression of ethylene biosynthetic genes to initiate apple fruit ripening. New Phytol. 2020, 226, 1781–1795.

Yumbya, P.M.; Hutchinson, M.J.; Ambuko, J.; Owino, W.O.; Sullivan, A.; Paliyath, G.; Subramanian, J. Efficacy of hexanal application on the postharvest shelf life and quality of banana fruit (Musa acuminata) in Kenya. J. Trop. Agric. 2018, 95 (1), 14-35.

Zhang, M.; Yuan, B.; Leng, P. The role of ABA in triggering ethylene biosynthesis and ripening of tomato fruit. J. Exp. Bot., 2009, 60(6), 1579-158

140

Appendix A1: Preparation of hexanal formulation

To prepare 1 l of hexanal formulation, following components were added based on the

previous studies by El Kayal et al., 2017 and Kumar et al., 2018.

- 10 ml of 1% (v/v) hexanal

- 10 ml of 1% (v/v) geraniol

- 10 ml of 1% (w/v) α-tocopherol

- 1 ml of 10% (v/v) Tween 20

- 100 ml of 10% (v/v) ethanol

- 869 ml of milliQ water.

The 1 l formulation was diluted to 50 l using tap water and it was sprayed to the trees at

a rate of 1 l per tree

141

Appendix A2: Forward and reverse primer details of the selected genes in the ethylene biosynthesis and signalling pathway and cell-wall re-modelling.

No Gene Gene ID (Malus domestica)

Forward primer Reverse Primer

1 SAM2 MD13G1141700 TCAACCCAGCACGATGAGAC TGAGCACCCCATCCTCCATA

2 ACO3 MD09G1114800 GCTGCTGGACTTGTTGTGTG TGGAAGAGCAAGATGAGGCC

3 ETR2 MD13G1209700 AGCATGGCACTTGTTCTTCG CTCGAGCATTTTCCGCATCA

4 ERF17 MD15G1221100 GAAGCAGACGATTGGGAAGC TCGGGGAAATTAAACTTGGCA

5 EXPA6 MD03G1090700 GTGAGAGTGTTTGAGGGGCA TGGTGCGGGCTACAAATTCT

6 EXPA8 MD07G1233100 GCTGCGGGTCTTGTTATGAG CTGAAGGAGACGGGGACAAT

7 EG19-like MD06G1105900 TAGCTGATAAACCACCGCAC CAAGTGACTCTCTGGTTGGG

8 1,4-β-EG3 MD10G1003400 GAGGCCCGAAGATATGGACA ATCACTGTATGCACCTCGGT

9 MdAct XM_008362405.3 GTGGATTGCAAAGGCAGAGT CATAATTTGCTCGCCTCCAT

10 MdHis3 AY347801.1 TGGAACTGTTGCTCTTCGTG CTCAAACAACCCGACAAGGT

Sequencing details to the gene set 1-8 were obtained from Genomic Database for Rosaceae and 9-10 from NCBI data base.

142

Appendix A3: Summary results of the RNA-Seq run

Data Control_rep1 Control_rep2 Hexanal_rep1 Hexanal_rep2

RNA concentration (ng/μL) 428 466 381 409 Read length (bp) 150 150 150 150 Number of raw reads 25,615,611 20,059,664 19,717,528 33,233,141 Failed reads during quality and clipping 125,947 95,215 85,558 154,401 Reads passed initial quality 25,489,664 19,964,449 19,631,970 33,078,740 Shorts reads 111,506 83,888 74,314 135,340 rRNA 406,755 194,188 450,722 1,058,587 Total mappable reads 25,239,628 19,846,108 19,360,138 32,444,090 Reads mapped to genome 24,133,526 19,084,392 18,796,051 30,977,816 Not mapped to genome 1,338,387 967,217 754,635 1,779,053 % of reads mapped to genome 95.62 96.16 97.08 95.48 Gene sense count 20,763,558 16,585,294 16,152,345 26,269,328 Number of detected genes at >1 raw read 35,046 34,394 34,845 35,042

rep1 represents the RNA extracted from the fruit-AZ harvested from commercial orchard located in Site A, whereas rep2 from commercial orchard located in Site B.

143

Appendix A4: List of Differentially expressed genes between hexanal and control FAZ at commercial maturity of ‘Honeycrisp’ apples

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD13G1175300 4.342 0.011 peroxidase (E1.11.1.7) 1638 Chr13 14485822 14487459

MD04G1180900 4.333 0.001 F-box-like family protein 1461 Chr04 27157821 27159281

MD00G1113500 4.252 0.001 zinc finger protein 2 342 Chr00 24055637 24055978

MD10G1111400 3.969 0.043 Protein of unknown function 892 Chr10 18292332 18293223

MD05G1046500 3.968 0.037 Tetratricopeptide repeat (TPR)-like superfamily protein 1206 Chr05 7869704 7870909

MD06G1152100 3.893 0.011 Histone acetyltransferase 203 Chr06 29587919 29588121

MD00G1133400 3.793 0.015 Endoglucanase 589 Chr00 28968480 28969068

MD04G1066200 3.687 0.026 Protein of unknown function 1122 Chr04 8832781 8833902

MD01G1226700 3.429 0.037 F-box/RNI-like superfamily protein 639 Chr01 31686739 31687377

MD15G1362500 3.234 0.030 agamous-like MADS-box protein AGL104 5215 Chr15 43737493 43742707

MD02G1198000 3.170 0.015 gibberellin 20 oxidase 1-like 1753 Chr02 19262856 19264608

MD15G1171100 3.129 0.044 YABBY domain class transcription factor 4399 Chr15 13285307 13289705

MD06G1122900 3.096 0.001 RING-H2 FINGER PROTEIN ATL60 555 Chr06 26438488 26439042

MD04G1097800 2.807 0.031 Protein of unknown function 537 Chr04 18166603 18167139

MD12G1082100 2.689 0.002 putative CCR4-associated factor 1 homolog 8 1035 Chr12 10002163 10003197

MD12G1034200 2.630 0.003 transcription repressor OFP13-like 876 Chr12 3751599 3752474

MD10G1015700 2.582 0.042 PPR repeat (PPR) // PPR repeat family (PPR_2) 870 Chr10 2075461 2076330

MD15G1182200 2.582 0.042 RHO GUANINE NUCLEOTIDE EXCHANGE FACTOR 8-like 2818 Chr15 14446832 14449649

144

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD02G1302600 2.559 0.027

Leucine Rich Repeat (LRR_1) // Leucine rich repeat N-terminal domain (LRRNT_2) // Leucine rich repeat (LRR_8) 2110 Chr02 35676119 35678228

MD10G1268500 2.555 0.010 OXIDOREDUCTASE, 2OG-FE II OXYGENASE FAMILY PROTEIN 3862 Chr10 36139905 36143766

MD17G1137500 2.555 0.010 protein DETOXIFICATION 56 1452 Chr17 12328143 12329594

MD15G1131700 2.531 0.013 BIS3 biphenyl synthase 1962 Chr15 9556180 9558141

MD16G1004500 2.507 0.003 STI2 PROTEIN-RELATED 1222 Chr16 344135 345356

MD13G1023300 2.495 0.014 MLP-like protein 28 3799 Chr13 1675296 1679094

MD07G1286100 2.495 0.014 TREHALOSE-6-PHOSPHATE SYNTHASE 2646 Chr07 34815809 34818454

MD13G1155200 2.495 0.014 uncharecterized protein 1215 Chr13 12098634 12099848

MD05G1072300 2.494 0.003 EPIDIDYMAL MEMBRANE PROTEIN E9-like 614 Chr05 15256285 15256898

MD13G1126900 2.447 0.004 NADH-ubiquinone oxidoreductase chain 5 (ND5) 345 Chr13 9501534 9501878

MD07G1304200 2.447 0.004 Auxin canalisation (Auxin_canalis) 1774 Chr07 36173372 36175145

MD06G1051900 2.438 0.016 ethylene-responsive transcription factor 5-like 999 Chr06 7252563 7253561

MD12G1223000 2.381 0.00 transcription factor bHLH94-like 1679 Chr12 29989936 29991614

MD03G1121300 2.354 0.012 Protein of unknown function 2263 Chr03 11292226 11294488

MD15G1313200 2.354 0.015 MADS-box protein JOINTLESS-like 4779 Chr15 31619578 31624356

MD01G1162600 2.347 0.020 protein NRT1/ PTR FAMILY 5.1-like 1213 Chr01 26747076 26748288

MD12G1009200 2.312 0.000 plant cysteine oxidase 2-like 4572 Chr12 966983 971554

MD17G1064400 2.302 0.024 B12D PROTEIN 945 Chr17 5220009 5220953

MD00G1015700 2.283 0.010 Formamidase-like isoform X1 / Formamide amidohydrolase (EC 3.5.1.49) 1906 Chr00 2247381 2249286

MD14G1125500 2.250 0.000 Protein of unknown function 777 Chr14 20052087 20052863

MD15G1167500 2.249 0.005 2',3'-CYCLIC-NUCLEOTIDE 3'-PHOSPHODIESTERASE 832 Chr15 12675043 12675874

MD02G1163400 2.245 0.015 Protein of unknown function 718 Chr02 13934914 13935631

145

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD08G1113200 2.245 0.015 GATA transcription factor 12-like 1697 Chr08 10042163 10043859

MD13G1092700 2.218 0.002 Protein of unknown function 891 Chr13 6542902 6543792

MD15G1285100 2.200 0.000 mitogen-activated protein kinase kinase kinase 3-like 1053 Chr15 25929489 25930541

MD05G1336700 2.159 0.000 SULFITE EXPORTER TAUE 2016 Chr05 45858154 45860169

MD00G1093500 2.145 0.024 Protein of unknown function 1317 Chr00 19620874 19622190

MD11G1068500 2.145 0.000 photosystem I P700 chlorophyll a apoprotein A2 (psaB) 974 Chr11 5895570 5896543

MD09G1131100 2.125 0.007 RECEPTOR LIKE PROTEIN 12 2979 Chr09 10090820 10093798

MD09G1102800 2.105 0.000 BTB/POZ domain-containing protein 3235 Chr09 7518344 7521578

MD02G1057300 2.102 0.037 GLYSO UPF0378 protein KIAA0100-like protein 1327 Chr02 4634907 4636233

MD16G1250200 2.093 0.025 protein COFACTOR ASSEMBLY OF COMPLEX C SUBUNIT B CCB2, chloroplastic 8925 Chr16 28031372 28040296

MD05G1278200 2.085 0.000 phospholipase A1-Igamma1, chloroplastic-like 1557 Chr05 41267524 41269080

MD14G1056300 2.069 0.015 HOMEOBOX-LEUCINE ZIPPER PROTEIN HAT1-like 1294 Chr14 5813824 5815117

MD06G1098200 2.062 0.001 Protein of unknown function 191 Chr06 23406552 23406742

MD17G1010900 2.055 0.023 EXOCYST COMPLEX PROTEIN EXO70B1-like 2448 Chr17 674265 676712

MD09G1041900 2.034 0.023 ABC TRANSPORTER B FAMILY MEMBER 15-like 10123 Chr09 2715671 2725793

MD03G1036900 2.033 0.001 LRR receptor-like serine/threonine-protein kinase 3967 Chr03 2939125 2943091

MD02G1253700 2.006 0.000 Protein of unknown function 2163 Chr02 30525143 30527305

MD07G1290600 2.004 0.030 Wall-associated receptor kinase galacturonan-binding (GUB_WAK_bind) 2461 Chr07 35126417 35128877

MD04G1058200 1.996 0.000 ethylene-responsive transcription factor 5-like 7541 Chr04 7283821 7291361

MD15G1391900 1.987 0.007 Uncharecterized protein 730 Chr15 48834024 48834753

MD04G1175400 1.981 0.000 Protein of unknown function 1345 Chr04 26644516 26645860

MD15G1354700 1.979 0.009 Protein of unknown function 406 Chr15 42604359 42604764

MD17G1262600 1.971 0.000 U-box domain-containing protein 21-like 1469 Chr17 32311974 32313442

146

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD07G1153300 1.958 0.018 dof zinc finger protein DOF2.5-like 1303 Chr07 22366665 22367967

MD08G1112700 1.956 0.000 leucine-rich repeat receptor-like protein kinase 3872 Chr08 9996190 10000061

MD11G1274000 1.952 0.038 CYTOCHROME P450 CYP72A219-like 3502 Chr11 39047528 39051029

MD15G1354000 1.943 0.000 Protein of unknown function 896 Chr15 42454978 42455873

MD02G1240900 1.917 0.000 Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase 5538 Chr02 28926577 28932114

MD16G1093500 1.909 0.000 Protein of unknown function 915 Chr16 6463509 6464423

MD15G1326800 1.906 0.007 ethylene-responsive transcription factor ERF060 1698 Chr15 35297146 35298843

MD15G1158100 1.905 0.000 Protein of unknown function 624 Chr15 11742831 11743454

MD02G1049600 1.899 0.000 ribulose-bisphosphate carboxylase large chain (rbcL) 1395 Chr02 3871079 3872473

MD03G1282900 1.892 0.000 GLUTATHIONE S-TRANSFERASE F14-like 1967 Chr03 36322193 36324159

MD03G1255500 1.883 0.001 Protein of unknown function 570 Chr03 34288101 34288670

MD04G1005900 1.872 0.000 anthranilate N-benzoyltransferase protein 1 1377 Chr04 699064 700440

MD01G1051800 1.853 0.046 S-adenosyl-L-methionine-dependent methyltransferases 2445 Chr01 15606210 15608654

MD11G1004600 1.853 0.003 PHOSPHOLIPASE A1-IIDELTA 1319 Chr11 429304 430622

MD13G1012600 1.846 0.000 TRANSCRIPTION FACTOR BHLH110-like 3017 Chr13 753937 756953

MD11G1236600 1.843 0.000 (-)-alpha-pinene synthase like 2119 Chr11 34412423 34414541

MD10G1071000 1.840 0.019 Salicylate carboxymethyltransferase / Salicylate O-methyltransferase 1031 Chr10 9837892 9838922

MD04G1047900 1.834 0.009 serine/threonine-protein kinase roco10 957 Chr04 5596530 5597486

MD13G1210200 1.834 0.000 Protein of unknown function 336 Chr13 19579571 19579906

MD15G1321200 1.812 0.002 PEROXIDASE 17 1304 Chr15 33504699 33506002

MD15G1025600 1.806 0.000 protein RADIALIS-like 6 2104 Chr15 1497521 1499624

MD06G1177100 1.772 0.000 U-BOX DOMAIN-CONTAINING PROTEIN 18-like 2064 Chr06 31692100 31694163

MD06G1117900 1.770 0.000 Protein of unknown function 756 Chr06 25670105 25670860

MD10G1303500 1.765 0.006 Protein of unknown function 897 Chr10 38996349 38997245

147

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD15G1292600 1.761 0.023 probable membrane-associated kinase regulator 1 1188 Chr15 27103197 27104384

MD11G1236200 1.754 0.000 - (-)-alpha-pinene synthase like 2497 Chr11 34346632 34349128

MD05G1000900 1.747 0.015 protein NRT1/ PTR FAMILY 4.4-like 4710 Chr05 293868 298577

MD02G1030000 1.743 0.009 F18B13.21 PROTEIN-like 1428 Chr02 2318181 2319608

MD14G1144100 1.742 0.002 AQUAPORIN NIP5-1-like 9724 Chr14 23697369 23707092

MD17G1076900 1.737 0.010 Protein of unknown function 1351 Chr17 6369884 6371234

MD07G1076200 1.725 0.028 N-acetylglucosaminylproteoglycan beta-1,4-glucuronyltransferase 5732 Chr07 7276507 7282238

MD16G1140500 1.722 0.031 Polygalacturonase / Pectinase 5819 Chr16 10800275 10806093

MD16G1012100 1.712 0.000 SERINE/THREONINE-PROTEIN KINASE BRI1-LIKE 2 1386 Chr16 937398 938783

MD03G1268000 1.704 0.003 Protein of unknown function 3581 Chr03 35288199 35291779

MD10G1328400 1.700 0.043 Tyrosine phosphatase (Y_phosphatase3) 5469 Chr10 40761656 40767124

MD11G1295000 1.685 0.000 ribulose-bisphosphate carboxylase large chain (rbcL) 748 Chr11 41344535 41345282

MD10G1090600 1.683 0.000 Protein of unknown function 1191 Chr10 13574596 13575786

MD10G1300000 1.679 0.000 SERINE CARBOXYPEPTIDASE-LIKE 31-like 4142 Chr10 38733949 38738090

MD10G1242100 1.678 0.011 PPR repeat (PPR) // Pentatricopeptide repeat domain (PPR_3) 3388 Chr10 33702994 33706381

MD15G1234100 1.674 0.000 Acyl-activating enzyme 1 5332 Chr15 19174412 19179743

MD07G1172200 1.670 0.028 lysM domain receptor-like kinase 3 1194 Chr07 24925341 24926534

MD15G1276300 1.663 0.008 dof zinc finger protein DOF2.4-like transcription factor 1594 Chr15 24268103 24269696

MD11G1267200 1.661 0.000 BES1/BZR1 HOMOLOG PROTEIN 3 like 4087 Chr11 38214764 38218850

MD07G1220900 1.654 0.013 NUCLEAR PORE COMPLEX PROTEIN NUP88 1440 Chr07 29837934 29839373

MD17G1048300 1.652 0.029 plant cysteine oxidase 2-like 2689 Chr17 3514629 3517317

MD13G1129300 1.646 0.005 NEOXANTHIN-DEFICIENT 1-like 3210 Chr13 9771582 9774791

MD12G1144900 1.634 0.000 probable E3 ubiquitin-protein ligase RHC2A 1074 Chr12 22395846 22396919

148

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD13G1066100 1.629 0.042 Protein of unknown function 1912 Chr13 4570062 4571973

MD07G1269100 1.628 0.008 Protein of unknown function 1441 Chr07 33676626 33678066

MD10G1276400 1.626 0.000 Protein of unknown function 714 Chr10 36744204 36744917

MD08G1074700 1.626 0.000 transcription factor MYB36-like 1123 Chr08 6031793 6032915

MD13G1163400 1.621 0.000 Protein of unknown function 1169 Chr13 12841778 12842946

MD15G1005100 1.620 0.001 Protein of unknown function 1049 Chr15 313514 314562

MD13G1139100 1.618 0.001 ABC transporter B family member 4-like 5435 Chr13 10713103 10718537

MD07G1004600 1.617 0.031 LIPOXYGENASE 4935 Chr07 492749 497683

MD02G1086600 1.601 0.046 protein BIG GRAIN 1-like C 1197 Chr02 6787043 6788239

MD04G1103900 1.601 0.028 Protein of unknown function 3416 Chr04 19111765 19115180

MD14G1176300 1.598 0.000 plant UBX domain-containing protein 10-like 2146 Chr14 26941258 26943403

MD15G1317100 1.593 0.029 Protein of unknown function 789 Chr15 32700193 32700981

MD08G1022400 1.590 0.012 PROTEIN WALLS ARE THIN 1 3631 Chr08 1637009 1640639

MD10G1117100 1.579 0.002 Protein of unknown function 6066 Chr10 19472607 19478672

MD15G1106400 1.572 0.005 Sarcosine oxidase 1206 Chr15 7438426 7439631

MD07G1038800 1.565 0.046 PROTEIN NRT1/ PTR FAMILY 5.4 10110 Chr07 3237655 3247764

MD14G1176000 1.561 0.017 Protein of unknown function 3847 Chr14 26925664 26929510

MD02G1178100 1.560 0.000 F-box protein SKIP2-like 1623 Chr02 15733658 15735280

MD05G1199900 1.549 0.008 RNA-directed DNA polymerase 2670 Chr05 32748279 32750948

MD16G1101300 1.549 0.038 Protein of unknown function 258 Chr16 7026843 7027100

MD09G1225800 1.540 0.031 CHAPERONE PROTEIN DNAJ 2156 Chr09 27854652 27856807

MD07G1237700 1.538 0.014 Protein of unknown function 1456 Chr07 31008128 31009583

MD15G1036300 1.538 0.007 Aspartate transaminase 1827 Chr15 2538902 2540728

MD02G1075500 1.529 0.043 EFFECTOR OF TRANSCRIPTION2-like 8628 Chr02 5999914 6008541

MD13G1137900 1.529 0.041 Protein of unknown function 2154 Chr13 10621540 10623693

149

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD06G1024300 1.524 0.000 disease resistance protein RPM1-like 3308 Chr06 2982030 2985337

MD07G1139300 1.515 0.008 Leucine rich repeat N-terminal domain (LRRNT_2) 3190 Chr07 20189797 20192986

MD10G1128300 1.515 0.000 Protein of unknown function 528 Chr10 20902181 20902708

MD14G1144900 1.506 0.012 Protein of unknown function 743 Chr14 23801140 23801882

MD16G1069100 1.503 0.042 mitochondrial uncoupling protein 3-like 1409 Chr16 4877302 4878710

MD00G1018400 1.503 0.046 Thioredoxin // cysteine/histidine-rich c1 domain family protein 732 Chr00 3060895 3061626

MD03G1286900 1.502 0.013 E3 UBIQUITIN-PROTEIN LIGASE BAH1 2834 Chr03 36601690 36604523

MD10G1334500 1.499 0.013 Probable LRR receptor-like serine/threonine-protein kinase 3211 Chr10 41190594 41193804

MD14G1110200 1.497 0.015 Protein of unknown function 3526 Chr14 17500983 17504508

MD01G1105700 1.492 0.004 interleukin-1 receptor-associated kinase 4 (IRAK4) 1248 Chr01 21904906 21906153

MD06G1125700 1.488 0.017 dehydration-responsive element-binding protein 1E-like 870 Chr06 26773748 26774617

MD03G1231800 1.486 0.000 AP2/ERF-transcription factor05 693 Chr03 31718140 31718832

MD04G1233500 1.485 0.044 AMMONIUM TRANSPORTER 1 MEMBER 2 2246 Chr04 31258512 31260757

MD10G1303800 1.482 0.033 DYNEIN LIGHT CHAIN TYPE 1 FAMILY PROTEIN 1362 Chr10 39011941 39013302

MD00G1133500 1.482 0.015 Protein Plant Cadmiun Resistant 2-like 1666 Chr00 28970411 28972076

MD05G1058600 1.481 0.049 Protein of unknown function 564 Chr05 10141044 10141607

MD00G1004300 1.481 0.036 Phosphatidylinositol n-acetylglucosaminyltransferase subunit p 3688 Chr00 671392 675079

MD13G1209700 1.478 0.024 ethylene receptor 2-like (ETR2) 4595 Chr13 19432876 19437470

MD15G1146700 1.476 0.000 GLUCOSYL/GLUCURONOSYL TRANSFERASES 2307 Chr15 10907733 10910039

MD10G1009000 1.476 0.000 F-box/RNI-like superfamily protein 1319 Chr10 1315923 1317241

MD10G1302100 1.473 0.000 T28P6.11 PROTEIN 1892 Chr10 38903045 38904936

MD16G1192600 1.471 0.002 HEAT SHOCK 70 KDA PROTEIN 8 2673 Chr16 17025352 17028024

MD02G1012300 1.469 0.000 Protein of unknown function 624 Chr02 775712 776335

150

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD15G1221100 1.462 0.000 AP2/ ETHYLENE-RESPONSIVE TRANSCRIPTION FACTOR ERF017 714 Chr15 17887545 17888258

MD12G1253300 1.454 0.003 U-box domain-containing protein 9-like 2718 Chr12 32215439 32218156

MD06G1123400 1.451 0.002 E3 UBIQUITIN-PROTEIN LIGASE RHA2B-like 558 Chr06 26490443 26491000

MD16G1091300 1.451 0.011 U-box domain-containing protein 19-like 2061 Chr16 6340752 6342812

MD05G1068500 1.450 0.031 Protein of unknown function 4901 Chr05 13086911 13091811

MD11G1172400 1.448 0.006 CCR4-ASSOCIATED FACTOR 1 HOMOLOG 11-like 852 Chr11 19108256 19109107

MD14G1126900 1.443 0.002 transcription factor MYC2-like 2463 Chr14 20181581 20184043

MD14G1154200 1.442 0.029 COPPER TRANSPORT PROTEIN ATOX1-like 2337 Chr14 24868280 24870616

MD01G1153400 1.439 0.000

DOUBLE CLP-N MOTIF-CONTAINING P-LOOP NUCLEOSIDE TRIPHOSPHATE HYDROLASES SUPERFAMILY PROTEIN (SMAX1-LIKE 7-like) 4214 Chr01 26178579 26182792

MD07G1189600 1.436 0.005 Protein of unknown function 1746 Chr07 26986137 26987882

MD16G1025000 1.435 0.012 MLP-LIKE PROTEIN 43 515 Chr16 1802244 1802758

MD08G1190800 1.430 0.000 CLATHRIN ASSEMBLY PROTEIN 1050 Chr08 24173736 24174785

MD11G1096200 1.428 0.002 E3 ubiquitin-protein ligase RDUF1-like 1139 Chr11 8005944 8007082

MD17G1085200 1.427 0.030 Wound-induced protein (DUF3774) 2073 Chr17 7006397 7008469

MD02G1096500 1.426 0.000 AP2/ETHYLENE-RESPONSIVE TRANSCRIPTION FACTOR ERF017 708 Chr02 7623930 7624637

MD12G1011500 1.423 0.003 Cation/CALCIUM EXCHANGER 1 1746 Chr12 1189557 1191302

MD10G1057100 1.422 0.012 Cysteine-rich TM module stress tolerance (CYSTM) 1401 Chr10 7772091 7773491

MD09G1233500 1.420 0.026 Protein of unknown function 1028 Chr09 29342965 29343992

MD05G1110100 1.420 0.000 CYSTEINE-RICH SECRETORY PROTEIN-like [CRISP1] 495 Chr05 22634941 22635435

MD12G1053700 1.420 0.030 Protein of unknown function 9140 Chr12 5990282 5999421

MD15G1378100 1.416 0.001 CLATHRIN ASSEMBLY PROTEIN 1090 Chr15 46351734 46352823

MD02G1208300 1.408 0.000 IRK-interacting protein-like 1491 Chr02 21276733 21278223

151

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD16G1198700 1.406 0.000 Protein of unknown function 3724 Chr16 17924268 17927991

MD03G1227500 1.403 0.000 metallothionein type 3 1408 Chr03 31313899 31315306

MD02G1161600 1.402 0.003 salicylic acid-binding protein 2-like 1268 Chr02 13577283 13578550

MD06G1211100 1.399 0.001 TRANSCRIPTION FACTOR TCP18 2844 Chr06 34380518 34383361

MD07G1248600 1.394 0.000 AP2/ethylene-responsive transcription factor ERF105 945 Chr07 31793773 31794717

MD15G1142100 1.387 0.000 ARGOS-LIKE PROTEIN-like 1741 Chr15 10508152 10509892

MD13G1226700 1.386 0.006 Protein of unknown function 1747 Chr13 22141256 22143002

MD10G1333200 1.384 0.030 Leucine Rich Repeat (LRR_1) 6585 Chr10 41054675 41061259

MD02G1202000 1.384 0.002 CALCIUM-BINDING PROTEIN CML18-like 618 Chr02 20017159 20017776

MD08G1133200 1.384 0.011 Protein of unknown function 3081 Chr08 12636004 12639084

MD05G1134000 1.381 0.040 Protein of unknown function 2025 Chr05 26252689 26254713

MD16G1215600 1.375 0.000 Protein of unknown function 161 Chr16 20998750 20998910

MD00G1203000 1.371 0.000 Protein of unknown function 3465 Chr00 48602821 48606285

MD16G1283000 1.371 0.000 Protein of unknown function 6115 Chr16 38914228 38920342

MD15G1295700 1.371 0.025 Protein of unknown function 581 Chr15 27758355 27758935

MD15G1346300 1.368 0.000 Protein of unknown function 197 Chr15 40749312 40749508

MD16G1056800 1.366 0.002 11-oxo-beta-amyrin 30-oxidase / CYP72A154 1283 Chr16 4086947 4088229

MD12G1222600 1.365 0.000 E3 ubiquitin-protein ligase ATL6-like [EC:6.3.2.19] 1137 Chr12 29956094 29957230

MD08G1070200 1.353 0.000 thermospermine synthase (ACL5) 3831 Chr08 5549132 5552962

MD12G1146500 1.347 0.026 L-type lectin-domain containing receptor kinase IV.1-like 828 Chr12 22517221 22518048

MD05G1069800 1.341 0.001 Protein of unknown function 2041 Chr05 13499591 13501631

MD02G1035800 1.341 0.002 RNA-binding protein C17H9.04c-like 2040 Chr02 2720860 2722899

MD16G1008400 1.340 0.000 PPR repeat (PPR_1) 1827 Chr16 628820 630646

MD00G1191200 1.335 0.000 Protein of unknown function 773 Chr00 46325934 46326706

152

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD00G1192500 1.334 0.046 Amidase 1- related / Acylase 890 Chr00 46612412 46613301

MD09G1106400 1.328 0.012 Protein of unknown function 908 Chr09 7706937 7707844

MD15G1038300 1.314 0.040 U-box domain-containing protein 4 2693 Chr15 2672283 2674975

MD11G1294900 1.314 0.004 ribulose-bisphosphate carboxylase large chain (rbcL) 1534 Chr11 41342953 41344486

MD15G1201300 1.308 0.006 CCCH-type Zn-finger protein 1194 Chr15 16027003 16028196

MD05G1265200 1.307 0.050 WRKY transcription factor 14 4562 Chr05 40011060 40015621

MD06G1141500 1.306 0.001 protein SHOOT GRAVITROPISM 5-like 513 Chr06 28510518 28511030

MD17G1012500 1.304 0.003 F-box/kelch-repeat protein 2110 Chr17 1102994 1105103

MD06G1086200 1.303 0.005 PROTEIN VM106R.1 1419 Chr06 21296797 21298215

MD03G1097900 1.298 0.050 ACTIN-DEPOLYMERIZING FACTOR 10-like 679 Chr03 8402674 8403352

MD11G1060700 1.298 0.040 transcription regulators 1647 Chr11 5291041 5292687

MD04G1113500 1.294 0.001 Protein of unknown function 197 Chr04 19953064 19953260

MD13G1091300 1.293 0.026 Protein of unknown function 750 Chr13 6457285 6458034

MD10G1274600 1.293 0.000 U-BOX DOMAIN-CONTAINING PROTEIN 17 2772 Chr10 36604548 36607319

MD01G1157100 1.290 0.048 serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit B-like 1944 Chr01 26439095 26441038

MD00G1202200 1.290 0.001 Protein of unknown function 1002 Chr00 48263538 48264539

MD03G1184400 1.289 0.007 MEIOTIC RECOMBINATION PROTEIN SPO11 1118 Chr03 25133185 25134302

MD04G1201300 1.288 0.025 COPPER TRANSPORT PROTEIN ATOX1-like 2449 Chr04 28750384 28752832

MD08G1082700 1.288 0.022 COMPONENT OF GEMS PROTEIN 5 3328 Chr08 6861226 6864553

MD09G1096600 1.287 0.009 Wound-induced protein (DUF3774) 255 Chr09 7014760 7015014

MD17G1176600 1.282 0.001 Protein of unknown function 8898 Chr17 20004497 20013394

MD07G1302600 1.281 0.036 Protein of unknown function 363 Chr07 36080310 36080672

MD02G1113400 1.278 0.002 RING-H2 finger protein ATL80-like 648 Chr02 9206058 9206705

MD15G1034400 1.273 0.003 ent-kaurene oxidase, chloroplastic-like 3755 Chr15 2429545 2433299

153

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD13G1123000 1.272 0.037 ACT domain-containing protein ACR4-like 3304 Chr13 9122112 9125415

MD08G1030400 1.269 0.016 PROTEIN DNJ-23-like 2628 Chr08 2186847 2189474

MD03G1152100 1.264 0.009 CCR4-ASSOCIATED FACTOR 1 HOMOLOG 11-like 852 Chr03 17271202 17272053

MD03G1236100 1.264 0.046 CHLOROPLAST PROTEIN HCF243 2217 Chr03 32174648 32176864

MD01G1201200 1.262 0.000 COPPER TRANSPORT PROTEIN ATOX1-like 1020 Chr01 29758079 29759098

MD16G1095400 1.261 0.000 Polygalacturonase/PECTIN LYASE-LIKE PROTEIN 4278 Chr16 6593888 6598165

MD02G1317800 1.260 0.015 lipoxygenase (LOX2S) 7877 Chr02 37219640 37227516

MD15G1168000 1.260 0.000 Protein of unknown function 138 Chr15 12897094 12897231

MD14G1087100 1.258 0.001 Protein of unknown function 742 Chr14 10817820 10818561

MD00G1015800 1.258 0.037 LOB domain-containing protein 37-like 1695 Chr00 2268408 2270102

MD05G1352700 1.250 0.009 translation initiation factor IF-2 1050 Chr05 46918268 46919317

MD06G1113700 1.245 0.023 NAD(P)-BINDING ROSSMANN-FOLD SUPERFAMILY PROTEIN 3317 Chr06 25186122 25189438

MD17G1226100 1.244 0.025 HEAT SHOCK 70 KDA PROTEIN 5 1971 Chr17 27430901 27432871

MD17G1111700 1.243 0.012 N-ACETYLTRANSFERASE 9 // N-ACETYLTRANSFERASE 9 1082 Chr17 9574764 9575845

MD02G1317100 1.240 0.002 Protein of unknown function 959 Chr02 37143633 37144591

MD15G1140500 1.238 0.001 ferric reduction oxidase 7, chloroplastic-like 4023 Chr15 10377869 10381891

MD08G1117200 1.235 0.007 TETRASPANIN 2056 Chr08 10729843 10731898

MD10G1135200 1.234 0.034 Protein of unknown function 427 Chr10 21802119 21802545

MD04G1038200 1.231 0.049 protein EMBRYO DEFECTIVE 1674-like 9678 Chr04 4237943 4247620

MD16G1164700 1.228 0.001 E3 UBIQUITIN-PROTEIN LIGASE ATL41-like 948 Chr16 13650888 13651835

MD00G1191600 1.220 0.011 PHOSPHOLIPASE A1-IIDELTA 1035 Chr00 46484170 46485204

MD13G1124300 1.219 0.042 BIDIRECTIONAL SUGAR TRANSPORTER SWEET15 2584 Chr13 9229495 9232078

MD14G1125900 1.218 0.001 METAL-NICOTIANAMINE TRANSPORTER YSL3 3122 Chr14 20079382 20082503

MD04G1176900 1.216 0.037 acid phosphatase 1-like 3265 Chr04 26830626 26833890

154

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD05G1160300 1.211 0.015 Protein of unknown function 1391 Chr05 28870383 28871773

MD03G1230400 1.204 0.042 Protein of unknown function 1837 Chr03 31551529 31553365

MD16G1094500 1.203 0.037 nucleoredoxin [EC:1.8.1.8] (NXN) 1863 Chr16 6547479 6549341

MD06G1112200 1.202 0.013 Protein of unknown function 931 Chr06 25079522 25080452

MD07G1282800 1.202 0.002 Chitinase 18/ Poly-beta-glucosaminidase 903 Chr07 34583669 34584571

MD05G1296700 1.200 0.004 cellulose synthase A catalytic subunit 8 [UDP-forming]-like 7904 Chr05 43097238 43105141

MD00G1176400 1.199 0.037 Riboflavin kinase/FMN ADENYLYLTRANSFERASE 2966 Chr00 40813519 40816484

MD07G1142400 1.197 0.035 Protein of unknown function 729 Chr07 20645197 20645925

MD08G1041600 1.195 0.019 serpin B (SERPINB) 4569 Chr08 3063406 3067974

MD16G1056900 1.195 0.003 CYTOCHROME P450 CYP749A22-like 856 Chr16 4088231 4089086

MD09G1207400 1.194 0.012 AQUAPORIN TIP2-1 2132 Chr09 19865896 19868027

MD04G1064700 1.188 0.030 HEAT STRESS TRANSCRIPTION FACTOR B-2B 1843 Chr04 8697125 8698967

MD07G1022600 1.182 0.001 Protein of unknown function 1024 Chr07 1881522 1882545

MD03G1053500 1.177 0.001 serine/threonine-protein kinase WNK4 isoform X1 5485 Chr03 4266286 4271770

MD09G1102600 1.176 0.001

XYLOGLUCAN ENDOTRANSGLUCOSYLASE/HYDROLASE PROTEIN 9 3187 Chr09 7492197 7495383

MD15G1443100 1.176 0.019 PROTEIN NRT1/ PTR FAMILY 4.3-like 2153 Chr15 54322869 54325021

MD14G1187200 1.176 0.011 Protein of unknown function 252 Chr14 27949418 27949669

MD00G1036100 1.175 0.037 Cytochrome P450 78A6-like 2089 Chr00 6401546 6403634

MD17G1014100 1.174 0.005 PROTEIN LYK2-like 2339 Chr17 1181630 1183968

MD16G1047700 1.174 0.022 AP2/ERF and B3 domain-containing transcription factor RAV1 1209 Chr16 3329564 3330772

MD15G1032500 1.172 0.018 calcium uniporter protein 4, mitochondrial 1525 Chr15 2016403 2017927

MD17G1035400 1.171 0.034 homeobox-leucine zipper protein HAT5 3816 Chr17 2533728 2537543

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome

Gene > Chromosome

Gene > Chromosome

155

Primary Identifier

Location. Start

Location. End

MD04G1061200 1.169 0.012 HOMEOBOX-LEUCINE ZIPPER PROTEIN HAT1-like 2116 Chr04 8078422 8080537

MD05G1355100 1.168 0.016 Myo-inositol-1-phosphatase 3678 Chr05 47158811 47162488

MD04G1040300 1.168 0.001 TETRAPYRROLE-BINDING PROTEIN, CHLOROPLASTIC 792 Chr04 4710689 4711480

MD12G1262600 1.167 0.025 U-box domain-containing protein 9-like 2718 Chr12 32215439 32218156

MD01G1092900 1.166 0.006 No apical meristem (NAM) protein 83-like 3108 Chr01 20770920 20774027

MD07G1202300 1.164 0.016 Protein of unknown function 2723 Chr07 28025627 28028349

MD12G1113300 1.164 0.002 uncharacterized protein 1598 Chr12 18033876 18035473

MD10G1248100 1.163 0.028 ETHYLENE-REGULATED NUCLEAR PROTEIN ERT2-LIKE PROTEIN-like 1500 Chr10 34097658 34099157

MD08G1043300 1.163 0.014 histone deacetylase 11 (HDAC11) 3591 Chr08 3272752 3276342

MD13G1095900 1.159 0.037 S-ADENOSYLMETHIONINE-DEPENDENT METHYLTRANSFERASE CRG1-like 2224 Chr13 6769503 6771726

MD17G1281200 1.156 0.024 WD40-like Beta Propeller Repeat (PD40) 2051 Chr17 34087607 34089657

MD10G1026000 1.155 0.040 Protein of unknown function 1325 Chr10 3230663 3231987

MD05G1296400 1.154 0.030 Protein of unknown function 708 Chr05 43078863 43079570

MD08G1157400 1.153 0.014 RNA-directed DNA polymerase / Revertase 2591 Chr08 17507819 17510409

MD15G1335800 1.153 0.024 Protein of unknown function 862 Chr15 37601453 37602314

MD09G1141300 1.152 0.005 UDP-GLYCOSYLTRANSFERASE 71B2-like 6616 Chr09 11051530 11058145

MD15G1176000 1.149 0.038 RNA-binding protein C17H9.04c 1676 Chr15 13751418 13753093

MD14G1157000 1.145 0.002 PCDC2 PROGRAMMED CELL DEATH PROTEIN 2 -like 1539 Chr14 25115806 25117344

MD15G1131000 1.143 0.010 PPR repeat (PPR) 2408 Chr15 9465121 9467528

MD12G1169500 1.138 0.024 Phosphatidylinositol-3,4-bisphosphate 4-phosphatase 830 Chr12 25067247 25068076

MD14G1221800 1.137 0.009 TRANSCRIPTION FACTOR TCP18 2563 Chr14 30342865 30345427

MD12G1024700 1.136 0.002 Calcium/calmodulin-dependent protein kinase 2 882 Chr12 2653080 2653961

156

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD08G1009200 1.131 0.010 cinnamyl alcohol dehydrogenase 6 5588 Chr08 678733 684320

MD16G1156900 1.129 0.015 cytokinin riboside 5'-monophosphate phosphoribohydrolase LOG8 1391 Chr16 12543472 12544862

MD17G1281300 1.126 0.032 WD REPEAT PROTEIN 2313 Chr17 34091696 34094008

MD03G1273300 1.126 0.009 GIBBERELLIN RECEPTOR GID1B 2486 Chr03 35659607 35662092

MD05G1163700 1.125 0.050 Protein of unknown function 4770 Chr05 29272290 29277059

MD13G1094100 1.125 0.010 Pectin lyase-like superfamily protein 4246 Chr13 6625969 6630214

MD07G1173100 1.119 0.001 CALCIUM-ACTIVATED CHLORIDE CHANNEL REGULATOR 4331 Chr07 25074959 25079289

MD01G1025300 1.119 0.031 F28K19.24-like 1398 Chr01 9601689 9603086

MD14G1074900 1.117 0.010 Protein of unknown function 4997 Chr14 8518457 8523453

MD15G1096500 1.117 0.034 4-amino-4-deoxychorismate lyase (ADCL) 2798 Chr15 6742191 6744988

MD16G1260200 1.117 0.005 UDP-glucuronate 4-epimerase 1 1299 Chr16 32030303 32031601

MD10G1293900 1.116 0.015 Protein of unknown function 447 Chr10 38211878 38212324

MD02G1037700 1.115 0.005 Protein of unknown function 366 Chr02 2848566 2848931

MD06G1096000 1.115 0.007 aluminum-activated malate transporter 9-like 3905 Chr06 23018794 23022698

MD07G1214900 1.112 0.040 Protein of unknown function 750 Chr07 29227255 29228004

MD05G1005200 1.110 0.010 Protein of unknown function 3663 Chr05 1386060 1389722

MD02G1175500 1.108 0.001

ANTHRANILATE N-HYDROXYCINNAMOYL/BENZOYLTRANSFERASE-LIKE PROTEIN-like 1353 Chr02 15412331 15413683

MD16G1113400 1.106 0.014 Protein of unknown function 828 Chr16 7945426 7946253

MD06G1073200 1.104 0.003 F-BOX PROTEIN PP2-A11-like 2817 Chr06 18192935 18195751

MD09G1087500 1.099 0.031 CELL DIVISION CYCLE PROTEIN 123 1003 Chr09 6267385 6268387

MD10G1094100 1.098 0.022 calmodulin-like protein 1 846 Chr10 14668494 14669339

MD15G1293900 1.092 0.026 Protein of unknown function 2858 Chr15 27338830 27341687

MD02G1208000 1.090 0.021 fructokinase-7 3253 Chr02 21065085 21068337

157

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD03G1059100 1.089 0.008 BIOGENESIS OF LYSOSOME-RELATED ORGANELLES COMPLEX 1 SUBUNIT 1 854 Chr03 4761035 4761888

MD03G1292200 1.087 0.029 ethylene response sensor 1 3380 Chr03 36926692 36930071

MD05G1313600 1.086 0.034 E3 ubiquitin-protein ligase RMA1H1-like 2392 Chr05 44408001 44410392

MD08G1184000 1.084 0.011 14-3-3 protein epsilon (YWHAE) 15720 Chr08 22921142 22936861

MD02G1220200 1.082 0.015 RNA-BINDING PROTEIN 28 573 Chr02 25560024 25560596

MD11G1011600 1.080 0.007 MANNOSYLTRANSFERASE 2 4462 Chr11 849683 854144

MD15G1053800 1.077 0.002 17.1 kDa class II heat shock protein-like 652 Chr15 3675367 3676018

MD13G1097000 1.073 0.011 CARBOXYL-TERMINAL PEPTIDASE-like 6052 Chr13 6871524 6877575

MD08G1192500 1.068 0.010 Protein of unknown function 1606 Chr08 24795209 24796814

MD05G1023900 1.061 0.008 FRUCTOSE-1,6-BISPHOSPHATASE-like 3502 Chr05 3934787 3938288

MD16G1031400 1.060 0.009 Protein of unknown function 570 Chr16 2229450 2230019

MD16G1105400 1.058 0.006 F-BOX AND WD40 DOMAIN PROTEIN // F21J9.19 1314 Chr16 7381199 7382512

MD12G1161100 1.054 0.002 transcription factor DIVARICATA-like 2350 Chr12 24109690 24112039

MD12G1125300 1.054 0.026 putative dynamin-related protein 4A 6875 Chr12 20068224 20075098

MD02G1173600 1.052 0.006 MITOGEN-ACTIVATED PROTEIN KINASE KINASE KINASE 3 1053 Chr02 15253056 15254108

MD12G1185400 1.051 0.034 Ca/CAM-dependent serine/threonine-protein kinase 14 1516 Chr12 26664330 26665845

MD16G1007000 1.045 0.045 Protein of unknown function 3553 Chr16 532902 536454

MD11G1136500 1.042 0.004 EMB|CAB72159.1 510 Chr11 12541602 12542111

MD02G1146300 1.040 0.003 ZINC-FINGER HOMEODOMAIN PROTEIN 6 963 Chr02 12084535 12085497

MD11G1255800 1.037 0.036 E3 SUMO-PROTEIN LIGASE MMS21 3193 Chr11 36870235 36873427

MD00G1004600 1.036 0.017 SOC1-like MADS-box protein 1347 Chr00 713271 714617

MD09G1079400 1.035 0.002 PROTEIN NSP-INTERACTING KINASE 1 3626 Chr09 5569564 5573189

MD03G1125400 1.029 0.040 CHAPERONE-ACTIVITY OF BC1 COMPLEX CABC1 -like 1105 Chr03 11834061 11835165

158

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD09G1123100 1.028 0.018 vacuolar protein sorting 11 1456 Chr09 9477542 9478997

MD04G1031800 1.027 0.037 Protein of unknown function 2155 Chr04 3610223 3612377

MD15G1033400 1.025 0.013 cytochrome P450 CYP82D47-like 2065 Chr15 2342858 2344922

MD13G1046500 1.023 0.008 DVL FAMILY PROTEIN-like 153 Chr13 3222841 3222993

MD10G1297900 1.019 0.017 dof zinc finger protein DOF1.4-like 879 Chr10 38515004 38515882

MD12G1133800 1.014 0.024 COPPER TRANSPORT PROTEIN ATOX1-like 1998 Chr12 20921112 20923109

MD04G1167500 1.014 0.005 S-adenosyl-L-methionine-dependent methyltransferases 1693 Chr04 25775112 25776804

MD15G1383700 1.010 0.032 ASPARTYL PROTEASE-LIKE PROTEIN 1329 Chr15 47251761 47253089

MD05G1100900 1.009 0.022 1,4-BETA-XYLAN ENDOHYDROLASE-like 3178 Chr05 20910860 20914037

MD13G1198800 1.009 0.038 chlorophyllase (E3.1.1.14) 3349 Chr13 17629714 17633062

MD10G1313600 1.000 0.012 Protein tyrosine kinase (Pkinase_Tyr) 3080 Chr10 39814066 39817145

159

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD13G1208700 -5.079 0.015 Potato inhibitor type I family protein (potato_inhibit) 616 Chr13 19181469 19182084

MD15G1327700 -5.079 0.015 ALLERGEN-LIKE PROTEIN BRSN20-like 977 Chr15 35443531 35444507

MD05G1018200 -4.588 0.004 dof zinc finger protein DOF3.5 912 Chr05 3198536 3199447

MD03G1013200 -4.441 0.000 PEROXIDASE A2-like 1968 Chr03 1039521 1041488

MD17G1285300 -4.372 0.010 PROTEIN S-ACYLTRANSFERASE 18 2745 Chr17 34433080 34435824

MD06G1190200 -4.372 0.009 STEROL REGULATORY ELEMENT-BINDING PROTEIN // PROTEIN BANQUO 3 1321 Chr06 32652286 32653606

MD00G1125400 -3.985 0.009 Expansin-A10-like /allergen_DPBB_dom 2029 Chr00 26716957 26718985

MD16G1191900 -3.929 0.000 AMINE OXIDASE-RELATED 13790 Chr16 16955726 16969515

MD16G1160400 -3.857 0.000 major allergen Mal d 1-like 1142 Chr16 13059984 13061125

MD09G1285900 -3.728 0.001 GLYCEROL-3-PHOSPHATE ACYLTRANSFERASE 2-like 2027 Chr09 36441296 36443322

MD07G1034400 -3.518 0.003 proline-rich protein 4-like 1344 Chr07 2818980 2820323

MD10G1132900 -3.489 0.038 lysine histidine transporter-like 8 3153 Chr10 21424552 21427704

MD08G1147800 -3.412 0.011 Endoglucanase 45-like domain containing protein isoform X1 700 Chr08 14887927 14888626

MD11G1054500 -3.309 0.008 expansin 1 1869 Chr11 4644688 4646556

MD16G1149300 -3.186 0.000 Protein of unknown function 1895 Chr16 11755682 11757576

MD16G1044500 -3.113 0.020 COPPER TRANSPORT PROTEIN ATOX1-like 583 Chr16 3150114 3150696

MD11G1159100 -3.098 0.000 Iron-chelate-transporting ATPase 6991 Chr11 15487893 15494883

MD00G1068800 -3.056 0.005 Transcription factor BHLH18-like 2349 Chr00 13493469 13495817

MD07G1307400 -3.032 0.002 MULTI-COPPER OXIDASE // LACCASE-15 2855 Chr07 36348300 36351154

MD16G1217400 -3.029 0.003 probable inorganic phosphate transporter 1-7 3915 Chr16 21484149 21488063

MD17G1009700 -3.002 0.014

UNCHARACTERIZED // ENDOSOMAL TARGETING BRO1-LIKE DOMAIN-CONTAINING PROTEIN 3014 Chr17 602091 605104

160

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD04G1236900 -2.987 0.000 PROPROTEIN CONVERTASE SUBTILISIN/KEXIN 2295 Chr04 31554468 31556762

MD16G1160500 -2.968 0.000 major allergen Mal d 1.06A 861 Chr16 13069155 13070015

MD05G1110300 -2.902 0.000 pathogenesis-related protein 1 (PR1) 507 Chr05 22688873 22689379

MD07G1308000 -2.772 0.030 MULTI-COPPER OXIDASE // LACCASE-15 4108 Chr07 36397640 36401747

MD17G1261000 -2.743 0.000 TRANSCRIPTION FACTOR MYB114-like 2991 Chr17 32150472 32153462

MD05G1267800 -2.680 0.034 Tetrahydroberberine oxidase 942 Chr05 40292424 40293365

MD12G1028500 -2.600 0.046 1-aminocyclopropane-1-carboxylate oxidase homolog 4-like 2133 Chr12 3174831 3176963

MD03G1067900 -2.579 0.000 omega-3 fatty acid desaturase (delta-15 desaturase) (FAD8, desB) 2628 Chr03 5387150 5389777

MD05G1356900 -2.517 0.000 Protein of unknown function 1112 Chr05 47240551 47241662

MD02G1095100 -2.465 0.020 inter-alpha-trypsin inhibitor heavy chain H3 5346 Chr02 7513757 7519102

MD13G1138000 -2.462 0.001 guanine deaminase-like isoform X2 763 Chr13 10625986 10626748

MD13G1256400 -2.455 0.005 hydroxyproline O-galactosyltransferase GALT3 957 Chr13 28134017 28134973

MD16G1109500 -2.448 0.000 Xenobiotic-transporting ATPase / Steroid-transporting ATPase 5991 Chr16 7681200 7687190

MD10G1153400 -2.443 0.004 CYSTEINE-RICH REPEAT SECRETORY PROTEIN 55 801 Chr10 24084425 24085225

MD10G1256000 -2.425 0.050 MYOSIN HEAVY CHAIN-LIKE PROTEIN 1876 Chr10 35051249 35053124

MD05G1305900 -2.416 0.015 glutamate receptor 2.7-like 3440 Chr05 43825578 43829017

MD16G1274700 -2.412 0.037

MITOCHONDRIAL CARNITINE/ACYLCARNITINE CARRIER-LIKE PROTEIN 3466 Chr16 36716292 36719757

MD17G1020700 -2.412 0.037

GLYCEROL-3-PHOSPHATE DEHYDROGENASE [NAD(+)], CYTOPLASMIC 2652 Chr17 1560237 1562888

MD04G1036100 -2.412 0.034 TMV resistance protein N 3040 Chr04 4040859 4043898

MD01G1168100 -2.379 0.007 TWO-COMPONENT RESPONSE REGULATOR ARR17-RELATED 1130 Chr01 27253523 27254652

161

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD13G1145600 -2.315 0.000 BTB/POZ and MATH domain-containing protein 3-like 2299 Chr13 11299324 11301622

MD05G1064700 -2.271 0.029 SYNTAXIN-112 1848 Chr05 11519795 11521642

MD08G1008500 -2.271 0.029 Protein of unknown function 1045 Chr08 651182 652226

MD05G1130400 -2.263 0.010

CYTOKININ RIBOSIDE 5'-MONOPHOSPHATE PHOSPHORIBOHYDROLASE LOG5 1963 Chr05 25510544 25512506

MD10G1052800 -2.252 0.000 protein DMR6-LIKE OXYGENASE 2-like 1487 Chr10 7012367 7013853

MD13G1089700 -2.229 0.001 potassium transporter 6-like 4259 Chr13 6314310 6318568

MD17G1212000 -2.208 0.038 palmitoyl-monogalactosyldiacylglycerol delta-7 desaturase, chloroplastic 2625 Chr17 25919173 25921797

MD11G1138800 -2.206 0.024 GLYCOSYLTRANSFERASE FAMILY PROTEIN 2 4813 Chr11 12775131 12779943

MD09G1023600 -2.204 0.016 F4P13.14 PROTEIN-like 3456 Chr09 1412641 1416096

MD05G1331000 -2.177 0.016 G-type lectin S-receptor-like serine/threonine-protein kinase 3149 Chr05 45507271 45510419

MD01G1201900 -2.175 0.000 PAR1 PROTEIN 1094 Chr01 29791492 29792585

MD10G1298700 -2.156 0.016 polyphenol oxidase, chloroplastic-like 1833 Chr10 38594920 38596752

MD16G1085100 -2.137 0.025 Microtubule binding protein YTM1 (contains WD40 repeats) 1308 Chr16 5959132 5960439

MD11G1117000 -2.137 0.015 Vinorine synthase 1386 Chr11 10598865 10600250

MD16G1043200 -2.135 0.005 homocysteine S-methyltransferase 1 (mmuM) 2061 Chr16 3041614 3043674

MD15G1110200 -2.124 0.006 CRYPTOCHROME DASH 3902 Chr15 7702158 7706059

MD06G1058200 -2.118 0.000 putative glucuronosyltransferase PGSIP8 4954 Chr06 9023530 9028483

MD07G1151700 -2.094 0.046 AP2 domain/ETHYLENE-RESPONSIVE TRANSCRIPTION FACTOR ERF023 567 Chr07 22122629 22123195

MD03G1090700 -2.091 0.000 EXPANSIN-A6 3648 Chr03 7513108 7516755

MD16G1196700 -2.079 0.000 SEED STORAGE 2S ALBUMIN SUPERFAMILY PROTEIN-like 1111 Chr16 17490041 17491151

MD01G1055200 -2.067 0.000 O-glucosyltransferase rumi homolog 2818 Chr01 15978768 15981585

162

Gene ID log2FoldChange

padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD15G1048500 -2.062 0.000 Non-specific serine/threonine protein kinase 1946 Chr15 3307912 3309857

MD01G1000200 -2.058 0.002 amino-acid permease BAT1 homolog 3417 Chr01 19860 23276

MD10G1035800 -2.054 0.000 tryptophan aminotransferase-related protein 4 3061 Chr10 4643726 4646786

MD06G1184200 -2.052 0.042 coatomer, subunit beta' (COPB2, SEC27) 2468 Chr06 32241189 32243656

MD10G1306800 -2.045 0.001 G-type lectin S-receptor-like serine/threonine-protein kinase 3332 Chr10 39241434 39244765

MD17G1141200 -2.043 0.002 GALACTURONOSYLTRANSFERASE 15-like 11498 Chr17 12677552 12689049

MD14G1124500 -2.036 0.026 mavicyanin-like 1153 Chr14 20010553 20011705

MD07G1233100 -2.021 0.000 EXPANSIN-A8 2056 Chr07 30701846 30703901

MD10G1298500 -2.005 0.000 polyphenol oxidase (E1.10.3.1) 1833 Chr10 38562790 38564622

MD11G1114400 -2.003 0.003 Protein of unknown function 2316 Chr11 10361048 10363363

MD00G1156100 -1.991 0.015 C2H2-type zinc finger protein 43-Related (zf-C2H2_6) 1620 Chr00 34410633 34412252

MD13G1200600 -1.976 0.029 EARLY LIGHT-INDUCED PROTEIN 1, CHLOROPLASTIC-RELATED 1010 Chr13 17842766 17843775

MD00G1087900 -1.976 0.002 Polygalacturonase 1 2345 Chr00 17831826 17834170

MD06G1195100 -1.970 0.000 expansin-A1-like 1417 Chr06 32954957 32956373

MD16G1097400 -1.963 0.000 CYSTEINE-RICH RECEPTOR-LIKE PROTEIN KINASE 2 2666 Chr16 6793420 6796085

MD06G1233500 -1.956 0.035 Calcineurin-like_purple acid phosphatase 17 like 2135 Chr06 36463094 36465228

MD03G1172200 -1.953 0.000 ABC transporter G family member 15-like 4652 Chr03 23451216 23455867

MD16G1201400 -1.942 0.000 ATP sulfurylase 1, chloroplastic 4866 Chr16 18313416 18318281

MD00G1123300 -1.941 0.001 Sugar-terminal-phosphatase (EC 3.1.3.58)/ Xylitol-5-phosphatase 732 Chr00 26431815 26432546

MD10G1299100 -1.930 0.000 MALDO Polyphenol oxidase V 1716 Chr10 38631151 38632866

MD12G1050900 -1.930 0.044 APYRASE 3-RELATED 1660 Chr12 5756463 5758122

MD10G1003400 -1.929 0.030 ENDO-1,4-BETA-GLUCANASE 3741 Chr10 649524 653264

MD15G1330100 -1.926 0.000 acetyl-CoA carboxylase, biotin carboxylase subunit (accC) 6354 Chr15 36348360 36354713

163

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD10G1303600 -1.917 0.000 external alternative NAD(P)H-ubiquinone oxidoreductase B2, mitochondrial 4879 Chr10 39002198 39007076

MD17G1098300 -1.904 0.011 L-ascorbate oxidase 3711 Chr17 8355194 8358904

MD15G1021500 -1.901 0.000 CYTOKININ DEHYDROGENASE 5 6378 Chr15 1244122 1250499

MD04G1067800 -1.899 0.005 DEHYDRATION-RESPONSIVE ELEMENT-BINDING 1B transcription factor 954 Chr04 9200318 9201271

MD17G1160500 -1.893 0.000 beta-amyrin synthase-like 5755 Chr17 15694687 15700441

MD06G1226700 -1.883 0.000 phosphoethanolamine N-methyltransferase (E2.1.1.103, NMT) 3691 Chr06 35723414 35727104

MD07G1306900 -1.882 0.008 UDP-GLYCOSYLTRANSFERASE 78D1-like 2082 Chr07 36326910 36328991

MD05G1211000 -1.879 0.000 GLUTATHIONE S-TRANSFERASE U21-like 1436 Chr05 34224366 34225801

MD10G1299400 -1.850 0.000 Polyphenol oxidase, chloroplastic 1782 Chr10 38683770 38685551

MD03G1221700 -1.844 0.004 PAP-SPECIFIC PHOSPHATASE HAL2-LIKE 4432 Chr03 30565058 30569489

MD17G1044000 -1.843 0.000 CLAVATA3/ESR (CLE)-related protein 25-like 1942 Chr17 3217476 3219417

MD04G1013500 -1.840 0.012 SUCROSE-PHOSPHATE SYNTHASE 3-like 5461 Chr04 1538915 1544375

MD11G1179700 -1.839 0.000 NON-SPECIFIC LIPID TRANSFER PROTEIN GPI-ANCHORED 2-like 3503 Chr11 21803421 21806923

MD03G1263700 -1.835 0.000 FATTY-ACID-BINDING PROTEIN 1 2687 Chr03 34934945 34937631

MD13G1057000 -1.823 0.025 cytochrome P450 CYP749A22-like 2536 Chr13 3990668 3993203

MD05G1350300 -1.822 0.001 stigma-specific STIG1-like protein 3 348 Chr05 46790064 46790411

MD17G1261100 -1.811 0.026 TRANSCRIPTION FACTOR MYB110b-like 6429 Chr17 32191281 32197709

MD16G1160100 -1.806 0.011 major allergen Mal d 1.03G 480 Chr16 12988861 12989340

MD10G1053000 -1.787 0.007 protein DMR6-LIKE OXYGENASE 2-like 1289 Chr10 7070214 7071502

MD15G1084200 -1.780 0.001 probable protein phosphatase 2C 12 5207 Chr15 5823427 5828633

MD01G1136800 -1.780 0.028 GLYCEROL-3-PHOSPHATE ACYLTRANSFERASE 5-like 1837 Chr01 24603606 24605442

MD08G1012300 -1.774 0.041 Protein of unknown function 4227 Chr08 936324 940550

MD13G1048700 -1.770 0.042 protein MIZU-KUSSEI 1-like 798 Chr13 3421693 3422490

MD09G1263900 -1.769 0.000 GIBBERELLIN-REGULATED PROTEIN 12-like 1142 Chr09 33699541 33700682

MD14G1209700 -1.757 0.023 UDP-glucose 6-dehydrogenase 4-like 1823 Chr14 29565178 29567000

164

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD17G1038900 -1.754 0.002 xyloglucan glycosyltransferase 4-like 2522 Chr17 2839125 2841646

MD12G1002300 -1.752 0.012 GLUCAN ENDO-1,3-BETA-GLUCOSIDASE 8-like 2708 Chr12 393281 395988

MD11G1135900 -1.751 0.003 protein kinase APK1A, chloroplastic-like isoform X1 5276 Chr11 12464807 12470082

MD03G1004000 -1.746 0.000 arabinogalactan protein 14 563 Chr03 284747 285309

MD11G1156200 -1.745 0.000 GLUCOMANNAN 4-BETA-MANNOSYLTRANSFERASE 2 5646 Chr11 15012290 15017935

MD09G1192100 -1.738 0.009 cell wall invertase 1 4256 Chr09 17088602 17092857

MD07G1191700 -1.730 0.027 Plant transposon protein (Plant_tran) 4104 Chr07 27153671 27157774

MD08G1037500 -1.728 0.002 protein DETOXIFICATION 33-like 1180 Chr08 2756748 2757927

MD01G1032700 -1.728 0.029 ARABINOGALACTAN PROTEIN 3-like 438 Chr01 11379739 11380176

MD07G1219100 -1.727 0.000 probable LRR receptor-like serine/threonine-protein kinase 3226 Chr07 29648394 29651619

MD01G1148700 -1.718 0.000 UDP-glycosyltransferase 76F1 2046 Chr01 25741958 25744003

MD03G1034900 -1.717 0.000 farnesyl diphosphate synthase (FDPS) 5646 Chr03 2803953 2809598

MD02G1303900 -1.709 0.007 cinnamoyl-CoA reductase 1-like 1748 Chr02 35748230 35749977

MD12G1028800 -1.708 0.031 gamma-glutamyltranspeptidase 1-like 3310 Chr12 3205502 3208811

MD14G1078100 -1.701 0.033 ALPHA CARBONIC ANHYDRASE 4-like 4339 Chr14 8924662 8929000

MD17G1284100 -1.686 0.000 Protein of unknown function 3738 Chr17 34307774 34311511

MD14G1228000 -1.679 0.047 Protein of unknown function 780 Chr14 30906536 30907315

MD03G1013600 -1.679 0.046 PEROXIDASE A2-like 2234 Chr03 1071235 1073468

MD03G1020000 -1.676 0.000 G-type lectin S-receptor-like serine/threonine-protein kinase LECRK3 810 Chr03 1555813 1556622

MD02G1003300 -1.676 0.003 UDP-glycosyltransferase 74F2-like 2427 Chr02 244303 246729

MD02G1089800 -1.667 0.001 auxin-binding protein ABP19a-like 633 Chr02 7131941 7132573

MD10G1254300 -1.663 0.000 CATIONIC AMINO ACID TRANSPORTER 1 4509 Chr10 34670651 34675159

MD01G1161300 -1.661 0.000 probable sodium-coupled neutral amino acid transporter 6 2921 Chr01 26661965 26664885

MD14G1116800 -1.660 0.000 disease resistance response protein 206-like 670 Chr14 18978802 18979471

165

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD05G1176500 -1.658 0.000 desumoylating isopeptidase 1 2343 Chr05 30402686 30405028

MD01G1163900 -1.655 0.001 ADENINE/GUANINE PERMEASE AZG1 1731 Chr01 26862823 26864553

MD14G1080200 -1.654 0.005 INACTIVE PURPLE ACID PHOSPHATASE 16-like 7086 Chr14 9159744 9166829

MD07G1150600 -1.650 0.001 ASPARTYL PROTEASE-like 1464 Chr07 21887777 21889240

MD13G1004500 -1.643 0.002 SERINE CARBOXYPEPTIDASE-LIKE 35 6278 Chr13 273991 280268

MD05G1065500 -1.642 0.000 transcription factor RADIALIS-like 1016 Chr05 12019271 12020286

MD01G1032400 -1.638 0.000 lipase 3-like 2939 Chr01 11301276 11304214

MD01G1052700 -1.632 0.000 (+)-neomenthol dehydrogenase-like (E1.1.1.208) 2194 Chr01 15793894 15796087

MD12G1149000 -1.626 0.007 Tropinone reductase 1 (TR1) 1732 Chr12 22901460 22903191

MD03G1209200 -1.626 0.003 Protein of unknown function 1235 Chr03 28869191 28870425

MD04G1112000 -1.626 0.003 GLUTATHIONE S-TRANSFERASE L1-like 2612 Chr04 19786012 19788623

MD02G1099300 -1.626 0.029 Protein of unknown function 573 Chr02 7873920 7874492

MD05G1178100 -1.619 0.000 protein SULFUR DEFICIENCY-INDUCED 1 2911 Chr05 30476390 30479300

MD00G1073200 -1.615 0.038 Hypothetical protein PRUPE_6G129600 [Prunus persica] 270 Chr00 14599354 14599623

MD17G1039700 -1.614 0.001 SENESCENCE-ASSOCIATED CARBOXYLESTERASE 101-like 3643 Chr17 2909911 2913553

MD17G1092000 -1.614 0.000 FRINGE-RELATED protein 1819 Chr17 7711238 7713056

MD05G1056900 -1.606 0.000 ENHANCED DISEASE SUSCEPTIBILITY 5-like 7480 Chr05 9972974 9980453

MD11G1125200 -1.597 0.002 LOB DOMAIN-CONTAINING PROTEIN 1-like 1802 Chr11 11533473 11535274

MD15G1268500 -1.597 0.028 Protein of unknown function 2922 Chr15 23231584 23234505

MD01G1101300 -1.593 0.000 Monocarboxylate transporter 2922 Chr01 21423249 21426170

MD06G1120700 -1.592 0.013 ENDO-1,4-BETA-GLUCANASE 2827 Chr06 26121728 26124554

MD05G1219400 -1.592 0.006 CAMTA domain class transcription factor 1329 Chr05 34981751 34983079

MD02G1078500 -1.584 0.024 Protein of unknown function 3160 Chr02 6203494 6206653

MD07G1210900 -1.581 0.012 Protein of unknown function 413 Chr07 28972627 28973039

166

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD05G1031700 -1.580 0.022 interleukin-1 receptor-associated kinase 4 (IRAK4) 3164 Chr05 5161143 5164306

MD05G1129600 -1.579 0.000 lysine histidine transporter-like 8 5087 Chr05 25370086 25375172

MD03G1143800 -1.572 0.000 Protein of unknown function 414 Chr03 15460561 15460974

MD11G1110100 -1.569 0.011 EPSIN/ENT-RELATED // ENTH/VHS FAMILY PROTEIN 1858 Chr11 9728932 9730789

MD04G1204000 -1.566 0.000 linoleate 9S-lipoxygenase (LOX1_5) 3958 Chr04 29011559 29015516

MD16G1160300 -1.564 0.029 major allergen Mal d 1.0501 835 Chr16 13047363 13048197

MD03G1224600 -1.560 0.000 MLO-LIKE PROTEIN 11-like 7258 Chr03 31033175 31040432

MD13G1042700 -1.557 0.000 Alpha-xylosidase 1 5465 Chr13 2971349 2976813

MD05G1218000 -1.546 0.002 CYSTEINE-RICH RECEPTOR-LIKE PROTEIN KINASE 27-like 3518 Chr05 34869842 34873359

MD11G1134600 -1.546 0.000 probable E3 ubiquitin-protein ligase LUL2 3364 Chr11 12390251 12393614

MD03G1020200 -1.543 0.000 G-type lectin S-receptor-like serine/threonine-protein kinase RLK1 1064 Chr03 1558966 1560029

MD09G1168300 -1.533 0.000 Beta-amyrin synthase 7421 Chr09 13934972 13942392

MD02G1013000 -1.528 0.002

SERINE-THREONINE PROTEIN KINASE // OCTICOSAPEPTIDE/PHOX/BEM1P DOMAIN-CONTAINING PROTEIN KINASE 6426 Chr02 826828 833253

MD02G1244000 -1.525 0.025 PYRUVATE KINASE 1 cytosolic-like 8883 Chr02 29398666 29407548

MD14G1207600 -1.524 0.022 protein DMR6-LIKE OXYGENASE 2-like 1407 Chr14 29464497 29465903

MD03G1012700 -1.520 0.011 PEROXIDASE A2-like 1930 Chr03 966462 968391

MD16G1050000 -1.515 0.015 protein MIZU-KUSSEI 1 798 Chr16 3527351 3528148

MD16G1029200 -1.512 0.015 Protein of unknown function 2249 Chr16 2082095 2084343

MD06G1134100 -1.511 0.022 EARLY LIGHT-INDUCED PROTEIN 1, CHLOROPLASTIC-like 1245 Chr06 27838905 27840149

MD05G1074200 -1.507 0.031 protein DMR6-LIKE OXYGENASE 2-like 5907 Chr05 15601515 15607421

MD02G1302900 -1.506 0.001 cinnamoyl-CoA reductase 1-like 4285 Chr02 35689520 35693804

MD10G1042600 -1.502 0.045 MULTI-COPPER OXIDASE // LACCASE-15 1632 Chr10 5539164 5540795

MD08G1242900 -1.500 0.001 coumaroyl quinate(coumaroylshikimate) 3'-monooxygenase (CYP98A3, C3'H) 4622 Chr08 30838332 30842953

167

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD13G1141700 -1.495 0.000 S-adenosylmethionine synthase 2 (SAM2) 2308 Chr13 10985244 10987551

MD14G1124200 -1.485 0.001 oligopeptide transporter 7 4810 Chr14 19991908 19996717

MD04G1027800 -1.485 0.000 vacuolar amino acid transporter 1 2606 Chr04 3178806 3181411

MD11G1188700 -1.478 0.021 Heat shock protein DnaJ with tetratricopeptide repeat 1148 Chr11 26597327 26598474

MD02G1226500 -1.477 0.005 DYNAMIN-RELATED PROTEIN 1C 10139 Chr02 26646662 26656800

MD16G1231500 -1.475 0.000 beta-amylase 1 (E3.2.1.2) 4006 Chr16 23732829 23736834

MD15G1262300 -1.474 0.000 RETINALDEHYDE BINDING PROTEIN-like 3188 Chr15 22402487 22405674

MD04G1009700 -1.473 0.000 phytate 6-phosphatase 3305 Chr04 1101652 1104956

MD01G1100600 -1.471 0.000 PECTIN LYASE-LIKE SUPERFAMILY PROTEIN-like 5815 Chr01 21371586 21377400

MD07G1282000 -1.465 0.000 AAA ATPASE 5486 Chr07 34501590 34507075

MD10G1029100 -1.454 0.003 ABA/WDS induced protein (ABA_WDS) 961 Chr10 3806737 3807697

MD09G1114800 -1.452 0.000 1-AMINOCYCLOPROPANE-1-CARBOXYLATE OXIDASE 1756 Chr09 8745866 8747621

MD05G1129900 -1.445 0.000 lysine histidine transporter-like 8 3630 Chr05 25422385 25426014

MD14G1205300 -1.437 0.016 ZINC FINGER (C3HC4-TYPE RING FINGER) FAMILY PROTEIN 5446 Chr14 29275419 29280864

MD03G1019900 -1.429 0.003 G-type lectin S-receptor-like serine/threonine-protein kinase LECRK3 854 Chr03 1554957 1555810

MD06G1162100 -1.419 0.022 proline transporter 2-like 4613 Chr06 30282963 30287575

MD02G1133600 -1.418 0.001 palmitoyl-monogalactosyldiacylglycerol delta-7 desaturase, chloroplastic-like 1869 Chr02 10797592 10799460

MD13G1025500 -1.417 0.033 classical arabinogalactan protein 9-like 1454 Chr13 1828706 1830159

MD03G1105800 -1.417 0.044 KINESIN MOTOR PROTEIN-RELATED PROTEIN-like 4118 Chr03 9086560 9090677

MD02G1093200 -1.412 0.000 Flavonoid 3'-monooxygenase 2018 Chr02 7409843 7411860

MD12G1059500 -1.409 0.000 ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE [NADH], CHLOROPLASTIC 2874 Chr12 6925201 6928074

MD09G1168200 -1.405 0.000 beta-amyrin synthase (LUP4) 6917 Chr09 13869658 13876574

168

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD13G1217400 -1.403 0.001 peroxisomal membrane protein 2 (PXMP2, PMP22) 3409 Chr13 20819562 20822970

MD03G1095100 -1.402 0.000 EPSIN 3-like 2076 Chr03 8067586 8069661

MD09G1211700 -1.393 0.032 mitochondrial arginine transporter BAC2 729 Chr09 20665714 20666442

MD12G1059400 -1.392 0.000 NADH-specific enoyl-ACP reductase 1321 Chr12 6923816 6925136

MD09G1049600 -1.391 0.037 Protein of unknown function 1313 Chr09 3308506 3309818

MD07G1240300 -1.384 0.004 DUF724 domain-containing protein 3-like isoform X3 5008 Chr07 31171262 31176269

MD16G1160000 -1.383 0.000 Major allergen Mal d 1 2763 Chr16 12969494 12972256

MD10G1301300 -1.377 0.000 internal alternative NAD(P)H-ubiquinone oxidoreductase A1, mitochondrial-like 2824 Chr10 38853804 38856627

MD03G1290200 -1.375 0.035 F22D16.19 PROTEIN 548 Chr03 36801217 36801764

MD11G1203600 -1.372 0.011 ABC transporter C family member 3-like 5923 Chr11 29729364 29735286

MD01G1211100 -1.370 0.029 RETICULON-LIKE PROTEIN B4 2204 Chr01 30480322 30482525

MD10G1038100 -1.369 0.000 Protein of unknown function 6528 Chr10 4993819 5000346

MD06G1213800 -1.368 0.027 Cytochrome P450 (p450) 3791 Chr06 34642020 34645810

MD04G1183100 -1.364 0.000 LEUCINE-RICH REPEAT RECEPTOR-LIKE PROTEIN KINASE 5682 Chr04 27441450 27447131

MD13G1041700 -1.360 0.000 Protein of unknown function 396 Chr13 2861639 2862034

MD03G1188200 -1.358 0.000 ABC transporter C family member 3-like 6038 Chr03 25725849 25731886

MD06G1105900 -1.354 0.034 ENDOGLUCANASE 6-like 4470 Chr06 24470237 24474706

MD01G1135600 -1.353 0.000 EXPANSIN-A4-like 1643 Chr01 24472213 24473855

MD09G1057600 -1.352 0.000 LAMIN-LIKE PROTEIN 1243 Chr09 3810911 3812153

MD03G1082800 -1.348 0.000 Universal stress protein PHOS32-like 1406 Chr03 6725529 6726934

MD14G1210700 -1.347 0.000 flavonoid 3'-monooxygenase (E1.14.13.21) 4031 Chr14 29630776 29634806

MD06G1128600 -1.344 0.030 Protein of unknown function 4768 Chr06 27094698 27099465

MD15G1415700 -1.339 0.000 NAC domain-class transcrition factor protein 104-like 1697 Chr15 51689615 51691311

MD11G1258400 -1.334 0.030 EF-HAND CALCIUM-BINDING DOMAIN CONTAINING PROTEIN 5280 Chr11 37186082 37191361

169

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD14G1038200 -1.329 0.048 exocyst complex component EXO70A1-like 6361 Chr14 3486221 3492581

MD13G1056800 -1.328 0.021 ACT domain-containing protein ACR4-like 3284 Chr13 3975036 3978319

MD04G1134300 -1.327 0.002 FRINGE-RELATED DUF604 3403 Chr04 22106690 22110092

MD06G1203900 -1.326 0.001 alpha-1,4-glucan-protein synthase [UDP-forming] 2 2462 Chr06 33853359 33855820

MD09G1019900 -1.325 0.000 PECTATE LYASE 11-like 2118 Chr09 1204419 1206536

MD10G1299300 -1.324 0.023 MALDO Polyphenol oxidase 1833 Chr10 38661973 38663805

MD07G1221400 -1.321 0.020 CHAPERONE-ACTIVITY OF BC1 COMPLEX CABC1 -like 4563 Chr07 29857713 29862275

MD03G1111000 -1.320 0.001 PHOSPHATIDYLINOSITOL TRANSFER PROTEIN -1 like 4545 Chr03 9687269 9691813

MD05G1310400 -1.314 0.015 EXPRESSED PROTEIN 6-like 1496 Chr05 44108474 44109969

MD07G1143800 -1.313 0.000 CAMP-RESPONSE ELEMENT BINDING PROTEIN-like 4648 Chr07 20959304 20963951

MD07G1247200 -1.311 0.024 UCLACYANIN I-like 950 Chr07 31667737 31668686

MD10G1148400 -1.309 0.001 Protein of unknown function 3351 Chr10 23589944 23593294

MD16G1139300 -1.308 0.016 PHRAGMOPLAST ORIENTING KINESIN-1 12286 Chr16 10723556 10735841

MD11G1206900 -1.303 0.000 pirin-like protein 2722 Chr11 30147530 30150251

MD15G1024000 -1.301 0.026 mannan endo-1,4-beta-mannosidase (MAN) 3035 Chr15 1425922 1428956

MD06G1164800 -1.299 0.001 Quinolinate synthase / Quinolinate synthetase 4423 Chr06 30512243 30516665

MD12G1003900 -1.298 0.001 ADENYLYL-SULFATE KINASE 3 3094 Chr12 555377 558470

MD03G1218200 -1.295 0.021 Protein of unknown function 4036 Chr03 30259532 30263567

MD17G1013800 -1.280 0.000 triacylglycerol lipase 2-like 5983 Chr17 1152448 1158430

MD13G1001800 -1.279 0.007 DNA-damage-repair/toleration protein DRT100 1845 Chr13 117170 119014

MD12G1038700 -1.274 0.000

LATE EMBRYOGENESIS ABUNDANT HYDROXYPROLINE-RICH GLYCOPROTEIN-like 633 Chr12 4175234 4175866

MD14G1128000 -1.273 0.011 endoglucanase 6 4991 Chr14 20435456 20440446

MD17G1106300 -1.271 0.006 1-aminocyclopropane-1-carboxylate oxidase 4 1725 Chr17 9066736 9068460

170

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD10G1195800 -1.270 0.007 probable sugar phosphate/phosphate translocator 4958 Chr10 29411908 29416865

MD02G1028700 -1.263 0.001 blue copper protein-like isoform X2 1645 Chr02 2200895 2202539

MD17G1226700 -1.258 0.017 AP2-like ethylene-responsive transcription 3004 Chr17 27479377 27482380

MD13G1009400 -1.257 0.002 PHYTOSULFOKINE RECEPTOR 1 3063 Chr13 606006 609068

MD11G1207500 -1.256 0.049 FIMBRIN-1-like 6823 Chr11 30214410 30221232

MD05G1359500 -1.252 0.001 AUXIN-INDUCED IN ROOT CULTURES PROTEIN 12 3102 Chr05 47425501 47428602

MD05G1174000 -1.250 0.000 purple acid phosphatase 15-like 3774 Chr05 30226979 30230752

MD01G1162900 -1.248 0.025 LOB DOMAIN-CONTAINING PROTEIN 15 1710 Chr01 26802391 26804100

MD17G1264900 -1.245 0.003 aspartate aminotransferase, mitochondrial (GOT2) 6233 Chr17 32540122 32546354

MD11G1019800 -1.243 0.042 disease resistance protein RPS2 (RPS2) 3997 Chr11 1687459 1691455

MD01G1103300 -1.241 0.029 glycerol-3-phosphate dehydrogenase SDP6, mitochondrial isoform X2 3984 Chr01 21543619 21547602

MD05G1170300 -1.240 0.000 NINJA-FAMILY PROTEIN AFP1-like 1493 Chr05 29987233 29988725

MD05G1251900 -1.240 0.046 putative glutathione S-transferase (ECM4) 3078 Chr05 38360270 38363347

MD07G1309000 -1.237 0.001 4-COUMARATE--COA LIGASE 2 5496 Chr07 36439419 36444914

MD07G1219600 -1.237 0.011 Protein tyrosine kinase (Pkinase_Tyr) 3247 Chr07 29711890 29715136

MD17G1193800 -1.234 0.010 kinesin-13A-like 5610 Chr17 23253051 23258660

MD06G1006900 -1.225 0.026 Glucan endo-1,3-beta-D-glucosidase / Laminarinase 2134 Chr06 714149 716282

MD16G1239900 -1.220 0.001 MEDIATOR OF RNA POLYMERASE II TRANSCRIPTION SUBUNIT 37E-like 792 Chr16 25490242 25491033

MD02G1142200 -1.215 0.003 AAA-ATPase At2g18193-like 1512 Chr02 11819806 11821317

MD11G1097600 -1.210 0.004 HALOACID DEHALOGENASE-LIKE HYDROLASE 2527 Chr11 8095356 8097882

MD17G1215600 -1.208 0.000 glycerol kinase (glpK, GK) 3835 Chr17 26258132 26261966

MD17G1011500 -1.201 0.008 omega-hydroxypalmitate O-feruloyl transferase 1870 Chr17 722382 724251

MD09G1110300 -1.200 0.000 5'-adenylylsulfate reductase 1 2215 Chr09 8191941 8194155

MD05G1117500 -1.199 0.007 DIRIGENT PROTEIN 23 579 Chr05 23850371 23850949

171

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD01G1231600 -1.198 0.002 IgA-specific serine endopeptidase / Immunoglobulin A1 protease 327 Chr01 32041962 32042288

MD17G1194200 -1.197 0.005 Protein of unknown function 3002 Chr17 23290243 23293244

MD03G1111600 -1.187 0.004 LOB DOMAIN-CONTAINING PROTEIN 1-like 2027 Chr03 9716836 9718862

MD10G1033300 -1.187 0.046 PEROXIDASE 12 3818 Chr10 4311879 4315696

MD10G1184700 -1.186 0.003 MAJOR FACILITATOR PROTEIN-like 3399 Chr10 27758965 27762363

MD05G1286400 -1.184 0.016 FLAVIN REDUCTASE-like 2610 Chr05 41931756 41934365

MD16G1096300 -1.181 0.008 ATP-citrate synthase alpha chain protein 1 3778 Chr16 6695050 6698827

MD06G1211400 -1.181 0.002 Leucoanthocyanidin reductase / Leucocyanidin reductase 4202 Chr06 34408574 34412775

MD14G1213800 -1.178 0.022 protein SPIRAL1-like 3 (SPR1) 1744 Chr14 29816645 29818388

MD16G1217500 -1.177 0.001 calcium/calmodulin-dependent protein kinase (CaM kinase) II (CAMK2) 1404 Chr16 21495466 21496869

MD07G1291000 -1.176 0.015 PROTEIN PHOSPHATASE 2C 2397 Chr07 35175364 35177760

MD06G1237600 -1.173 0.001

NUCLEOTIDE-DIPHOSPHO-SUGAR TRANSFERASE DOMAIN-CONTAINING PROTEIN-like 4577 Chr06 36877463 36882039

MD12G1233500 -1.173 0.001 2-acylglycerol O-acyltransferase 5801 Chr12 30925175 30930975

MD05G1296600 -1.172 0.035 CELLULOSE SYNTHASE A CATALYTIC SUBUNIT 8 [UDP-FORMING] 5394 Chr05 43091799 43097192

MD07G1214500 -1.170 0.008 3-deoxy-7-phosphoheptulonate synthase (E2.5.1.54, aroF, aroG, aroH) 932 Chr07 29187970 29188901

MD03G1140300 -1.165 0.004 Flavanone 3-dioxygenase 1716 Chr03 14633796 14635511

MD09G1190300 -1.160 0.011 ZETA-COAT PROTEIN 2708 Chr09 16639568 16642275

MD13G1062800 -1.157 0.001 Wall-associated receptor kinase galacturonan-binding (GUB_WAK_bind) 1939 Chr13 4367180 4369118

MD15G1106000 -1.154 0.003 CYCLIC NUCLEOTIDE-GATED ION CHANNEL 14-like 3301 Chr15 7401220 7404520

MD09G1019600 -1.154 0.002 UBIQUITIN 2 1251 Chr09 1190928 1192178

MD02G1121300 -1.153 0.001 REGULATOR OF VPS4 ACTIVITY IN THE MVB PATHWAY PROTEIN 7196 Chr02 9894503 9901698

172

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD07G1279000 -1.150 0.000 ENDO-POLYGALACTURONASE-LIKE PROTEIN-like 2737 Chr07 34347336 34350072

MD13G1090800 -1.147 0.043 aldehyde dehydrogenase family 2 member B7, mitochondrial-like 5167 Chr13 6436603 6441769

MD01G1073000 -1.146 0.021 Delta(8)-fatty-acid desaturase 1- like / SLD 1344 Chr01 17814505 17815848

MD09G1241900 -1.145 0.016 protein E6 888 Chr09 30934103 30934990

MD04G1245100 -1.144 0.001 isopentenyl-diphosphate delta-isomerase (idi, IDI) 2796 Chr04 32086167 32088962

MD01G1222200 -1.135 0.006 GAG-POL-RELATED RETROTRANSPOSON 1632 Chr01 31464369 31466000

MD03G1085400 -1.135 0.032 PROTEIN PHOSPHATASE 2C 24 2086 Chr03 6898086 6900171

MD17G1062700 -1.132 0.019 Protein of unknown function 4270 Chr17 5089218 5093487

MD13G1101200 -1.131 0.011 ALDO/KETO REDUCTASE-like 11067 Chr13 7185510 7196576

MD13G1285100 -1.130 0.015 chalcone synthase 2603 Chr13 43203447 43206049

MD10G1012200 -1.126 0.046 BIDIRECTIONAL SUGAR TRANSPORTER SWEET1 2147 Chr10 1678542 1680688

MD01G1072100 -1.126 0.031 LATE EMBRYOGENESIS ABUNDANT HYDROXYPROLINE-RICH GLYCOPROTEIN 663 Chr01 17753444 17754106

MD02G1028100 -1.123 0.002 WD repeat-containing protein 11-like 7897 Chr02 2151547 2159443

MD05G1194500 -1.123 0.001 ABC transporter I family member 19-like 2554 Chr05 32208086 32210639

MD11G1072500 -1.120 0.044 Fatty acid desaturase (FA_desaturase) 1111 Chr11 6158960 6160070

MD13G1182400 -1.115 0.007 uncharecterized protein 2895 Chr13 15249089 15251983

MD15G1401300 -1.115 0.049 NADH OXIDOREDUCTASE-like 3865 Chr15 50230981 50234845

MD09G1007400 -1.114 0.009 GLUTAREDOXIN-C7-like 381 Chr09 524570 524950

MD11G1110600 -1.111 0.006 E3 UBIQUITIN-PROTEIN LIGASE XBAT31-like 3502 Chr11 9781190 9784691

MD15G1373400 -1.103 0.004 14-3-3 PROTEIN 1733 Chr15 45588403 45590135

MD05G1112000 -1.103 0.012 Squalene monooxygenase 3197 Chr05 22908492 22911688

MD11G1305700 -1.103 0.022 thiamine pyrophosphokinase 1-like (thiN, TPK1, THI80) 2435 Chr11 42043639 42046073

MD06G1197800 -1.100 0.034 LON peptidase N-terminal domain and RING finger protein 2-like 5929 Chr06 33154855 33160783

173

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD17G1051900 -1.098 0.005 cystathionine gamma-synthase 1, chloroplastic-like 3777 Chr17 4084497 4088273

MD16G1081100 -1.096 0.002 glutathione S-transferase U17-like 1629 Chr16 5706295 5707923

MD02G1207400 -1.094 0.010 3-phosphoshikimate 1-carboxyvinyltransferase / EPSP synthase 4101 Chr02 20942381 20946481

MD17G1039000 -1.093 0.016

POLYNUCLEOTIDYL TRANSFERASE, RIBONUCLEASE H-LIKE SUPERFAMILY PROTEIN 2436 Chr17 2853017 2855452

MD01G1106200 -1.092 0.005 adenosine kinase 2 (E2.7.1.20, ADK) 3618 Chr01 21935183 21938800

MD08G1032100 -1.092 0.004 RETINALDEHYDE BINDING PROTEIN-like 2816 Chr08 2300218 2303033

MD09G1007300 -1.090 0.004 membrane-anchored ubiquitin-fold protein 4 3425 Chr09 514577 518001

MD05G1348200 -1.089 0.005 adenylyl-sulfate reductase (glutathione) (APR) 2760 Chr05 46671614 46674373

MD13G1046900 -1.084 0.003 Leucoanthocyanidin reductase 4333 Chr13 3255682 3260014

MD05G1195500 -1.082 0.011 Arabinose-5-phosphate isomerase 1597 Chr05 32294015 32295611

MD03G1058400 -1.079 0.027 NUCLEAR FUSION DEFECTIVE 4-like 2132 Chr03 4706855 4708986

MD15G1203800 -1.073 0.003 protein arginine N-methyltransferase 1 (PRMT1) 3135 Chr15 16210542 16213676

MD00G1037100 -1.070 0.003

Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplastic-like (E2.5.1.54, aroF, aroG, aroH) 3405 Chr00 6582906 6586310

MD08G1181400 -1.068 0.038 MAJOR FACILITATOR PROTEIN 1 3097 Chr08 22497810 22500906

MD09G1222300 -1.068 0.002 glycerol kinase (glpK, GK) 3848 Chr09 25904341 25908188

MD17G1248100 -1.063 0.040 interleukin-1 receptor-associated kinase 1 (IRAK1) 1947 Chr17 29694118 29696064

MD07G1239500 -1.063 0.016 Probable lipid transfer (LTP_2) 762 Chr07 31087795 31088556

MD17G1263400 -1.062 0.005 peroxisomal membrane protein 2-like 2958 Chr17 32441045 32444002

MD03G1078200 -1.062 0.006 MITOCHONDRIAL UNCOUPLING PROTEIN 2 3125 Chr03 6341244 6344368

MD09G1155800 -1.062 0.001 serine/threonine-protein kinase TNNI3K 4834 Chr09 12415933 12420766

174

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD10G1307800 -1.056 0.007

G-TYPE LECTIN S-RECEPTOR-LIKE SERINE/THREONINE-PROTEIN KINASE RKS1 3110 Chr10 39297620 39300729

MD06G1209100 -1.048 0.024 phospholipid-translocating ATPase (E3.6.3.1) 5816 Chr06 34256443 34262258

MD16G1070600 -1.047 0.013 expansin-A1-like 1857 Chr16 4956658 4958514

MD00G1123600 -1.046 0.024 2-Deoxyglucose-6-Phosphate Phosphatase 2 (EC 3.1.3.68) 2920 Chr00 26497882 26500801

MD17G1019200 -1.046 0.011 cystinosin (CTNS) 3038 Chr17 1493302 1496339

MD09G1092100 -1.043 0.002 PROTEIN ULTRAPETALA 1-like 3608 Chr09 6730076 6733683

MD14G1156200 -1.042 0.002 protein NUCLEAR FUSION DEFECTIVE 4-like 5677 Chr14 25063832 25069508

MD16G1183100 -1.040 0.013 ANCIENT CONSERVED DOMAIN PROTEIN-like 4276 Chr16 15729283 15733558

MD15G1423100 -1.040 0.003 maternal effect embryo arrest 9 444 Chr15 52454341 52454784

MD10G1145600 -1.038 0.008 UDP-galactose transporter 2-like 2420 Chr10 23211047 23213466

MD07G1140300 -1.038 0.010 remorin-like 2127 Chr07 20364118 20366244

MD09G1079600 -1.037 0.016 ABA-INDUCIBLE PROTEIN-KINI-like 755 Chr09 5595448 5596202

MD03G1138500 -1.035 0.037 LRR receptor-like serine/threonine-protein kinase FLS2 (FLS2) 4191 Chr03 14218954 14223144

MD12G1066100 -1.033 0.015 carboxyl-terminal-processing peptidase 3, chloroplastic-like 14865 Chr12 7730358 7745222

MD06G1025400 -1.029 0.023 Protein of unknown function 2372 Chr06 3078722 3081093

MD17G1209300 -1.021 0.009 Protein of unknown function 854 Chr17 25412067 25412920

MD04G1197100 -1.020 0.007 PROTEIN PHOSPHATASE 2C 34-like 3833 Chr04 28527023 28530855

MD12G1212200 -1.018 0.008 Hypoxia induced protein conserved region (HIG_1_N) 2529 Chr12 29106339 29108867

MD12G1207600 -1.018 0.005

PHOSPHATIDYLINOSITOL N-ACETYLGLUCOSAMINYLTRANSFERASE SUBUNIT P 5221 Chr12 28742221 28747441

MD09G1054500 -1.017 0.026 transmembrane emp24 domain-containing protein p24delta7-like 2545 Chr09 3623821 3626365

MD04G1081000 -1.016 0.032 Probable lipid transfer (LTP2) 2340 Chr04 11187357 11189696

175

A total of 726 identified DEGs were up (353) and down-regulated (373) based on p < 0.05 and fold expression change ≥2. Up regulated genes are with orange code, whereas the down-regulated ones are with blue code.

Gene ID log2FoldChange padj Gene > Defline Gene > Length

Chromosome Primary Identifier

Gene > Chromosome Location. Start

Gene > Chromosome Location. End

MD16G1116200 -1.016 0.012 Geraniol 8-hydroxylase 2789 Chr16 8244689 8247477

MD17G1125000 -1.016 0.010 7-deoxyloganetin glucosyltransferase / UGT85A24 2169 Chr17 10875148 10877316

MD13G1120300 -1.011 0.003 SQUAMOSA PROMOTER-BINDING-LIKE PROTEIN 2-like 4775 Chr13 8837397 8842171

MD05G1321000 -1.009 0.045 COP1-INTERACTING PROTEIN-like 3918 Chr05 44827219 44831136

MD12G1186600 -1.009 0.036 PPR repeat (PPR) 1460 Chr12 26877240 26878699

MD01G1211300 -1.009 0.006

P-LOOP CONTAINING NUCLEOSIDE TRIPHOSPHATE HYDROLASES/AAA ATPASE 5034 Chr01 30486311 30491344

MD10G1073500 -1.006 0.011 2'-hydroxyisoflavone reductase 2386 Chr10 10267777 10270162

MD08G1061500 -1.005 0.007 Glycine dehydrogenase (aminomethyl-transferring) 4902 Chr08 4857619 4862520

MD08G1007400 -1.003 0.012 24-methylenesterol C-methyltransferase 1341 Chr08 580729 582069

MD06G1012300 -1.002 0.019 ROP GUANINE NUCLEOTIDE EXCHANGE FACTOR 14 2699 Chr06 1534669 1537367

MD03G1021000 -1.001 0.018

Calcium-dependent lipid-binding (CaLB domain) ANTHRANILATE PHOSPHORIBOSYLTRANSFERASE-LIKE PROTEIN 3478 Chr03 1622207 1625684

MD02G1226200 -1.001 0.024 2-DEOXYGLUCOSE-6-PHOSPHATE PHOSPHATASE 2 2735 Chr02 26548043 26550777

MD07G1019800 -1.001 0.038 LEUCINE-RICH REPEAT-CONTAINING PROTEIN 1347 Chr07 1675183 1676529

176

Appendix A5: Detail information of enriched biological processes (BP), cellular components (CC) and molecular functions (MF)

Process Genes in list Total genes

Functional Category AT Genes

BP 121 3648 Response to stress

AT1G05010 AT1G07460 AT1G11280 AT1G14140 AT1G22130 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G77980 AT2G32120 AT3G50310 AT4G11660 AT4G36950 AT5G12020 AT5G12030 AT5G67080 AT1G02920 AT1G02930 AT1G51500 AT3G16720 AT4G39640 AT1G14930 AT1G14940 AT1G14950 AT1G14960 AT1G20823 AT1G26700 AT1G30990 AT1G64760 AT1G71695 AT1G75500 AT1G80460 AT2G01520 AT2G01530 AT2G22420 AT2G23620 AT2G39040 AT3G05200 AT3G11660 AT3G15150 AT3G15210 AT3G26450 AT3G26460 AT4G02520 AT4G14060 AT4G17490 AT4G23670 AT4G23680 AT5G06720 AT5G06730 AT5G14930 AT5G16000 AT5G20480 AT5G24660 AT5G24850 AT5G27420 AT5G47230 AT5G53760 AT5G67160 AT1G02500 AT1G09750 AT1G22160 AT1G56650 AT1G59960 AT1G66950 AT1G70520 AT1G74930 AT1G76680 AT1G76690 AT1G78020 AT2G18190 AT2G18260 AT3G01470 AT3G05640 AT3G13790 AT3G17790 AT3G21780 AT3G22840 AT3G23920 AT3G44260 AT3G45140 AT3G49580 AT4G14680 AT4G14690 AT5G01820 AT5G13930 AT5G20630 AT5G22250 AT5G24090 AT5G48850 AT5G59220 AT2G02220 AT4G30440 AT1G10370 AT1G16060 AT1G29340 AT1G53210 AT2G19810 AT2G46210 AT2G46590 AT3G02885 AT3G23170 AT3G28455 AT3G46620 AT3G61580 AT4G18780 AT5G04500 AT5G13170 AT5G14180 AT5G27930 AT5G39890 AT5G59550

BP 119 3194 Response to chemical

AT1G05010 AT2G32120 AT3G22810 AT3G63010 AT4G14740 AT4G21120 AT4G22790 AT4G24120 AT5G12020 AT5G12030 AT5G46800 AT5G59220 AT1G51500 AT2G01530 AT2G38940 AT3G22890 AT3G26450 AT4G10380 AT5G20630 AT5G67160 AT1G01250 AT1G02920 AT1G02930 AT1G10360 AT1G10370 AT1G10560 AT1G16060 AT1G19210 AT1G25560 AT1G53170 AT1G68840 AT1G71695 AT1G74500 AT1G74930 AT1G75500 AT1G78700 AT1G79700 AT2G02930 AT2G21340 AT2G22420 AT2G39040 AT2G40670 AT2G40940 AT3G02885 AT3G15150 AT3G15210 AT3G17790 AT3G23150 AT3G42800 AT3G46620 AT3G49570 AT3G49580 AT3G56380 AT4G02520 AT4G17490 AT5G02780 AT5G02790 AT5G06720 AT5G06730 AT5G24655 AT5G24660 AT5G47230 AT5G51190 AT5G59550 AT1G02500 AT1G20823 AT1G22160 AT1G31670 AT1G56650 AT1G66160 AT1G66370 AT1G66380 AT1G66950 AT1G68560 AT1G69040 AT1G70520 AT1G76680 AT1G80460

177

AT2G01520 AT2G30970 AT2G46270 AT2G46590 AT3G05200 AT3G05640 AT3G09820 AT3G16720 AT3G21780 AT3G23920 AT3G45140 AT3G50310 AT4G09000 AT4G11660 AT4G16780 AT4G19880 AT4G23670 AT4G25420 AT4G33010 AT4G39230 AT4G39795 AT5G01820 AT5G07990 AT5G13170 AT5G13930 AT5G24090 AT5G27420 AT5G37490 AT5G48100 AT5G51810 AT1G07200 AT1G43670 AT1G61380 AT3G18000 AT3G28455 AT4G18780 AT5G04500 AT5G27930 AT5G39890 AT1G78300 AT5G25900

BP 88 3037 Multicellular organismal process

AT1G05010 AT1G22130 AT1G77980 AT2G22540 AT3G02000 AT3G18550 AT3G22810 AT3G63010 AT4G14740 AT4G24120 AT4G25420 AT5G14070 AT5G51810 AT1G11280 AT1G11300 AT1G31670 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61460 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G66370 AT1G66380 AT2G26580 AT2G46660 AT3G01470 AT3G28455 AT3G61880 AT4G16780 AT4G28190 AT5G13170 AT5G25830 AT3G50310 AT5G04500 AT1G10560 AT1G31650 AT1G60190 AT4G26540 AT5G43270 AT5G56040 AT1G10370 AT1G10670 AT1G13245 AT1G16060 AT1G20330 AT1G20823 AT1G21070 AT1G25560 AT1G30370 AT1G60870 AT1G65060 AT1G74500 AT1G78020 AT2G01520 AT2G21650 AT2G22420 AT2G30330 AT2G34830 AT2G43820 AT2G46590 AT3G02780 AT3G07130 AT3G15150 AT3G18000 AT3G22840 AT3G43720 AT4G05440 AT4G14690 AT5G02600 AT5G06720 AT5G13990 AT5G14930 AT5G16000 AT5G22740 AT5G24655 AT5G56540 AT5G57520 AT5G59220 AT5G64530 AT5G67420

BP 78 2150 Response to abiotic stimulus

AT1G05010 AT1G14140 AT1G22130 AT1G77980 AT2G32120 AT3G48550 AT4G11660 AT5G12020 AT5G12030 AT1G51500 AT3G60680 AT4G16780 AT1G01300 AT1G02500 AT1G02920 AT1G02930 AT1G10370 AT1G30530 AT1G56650 AT1G59960 AT1G66390 AT1G70420 AT1G80460 AT1G80920 AT2G18190 AT2G18260 AT2G42690 AT2G46590 AT3G01470 AT3G05640 AT3G13790 AT3G21090 AT3G21780 AT3G22840 AT3G23920 AT3G49580 AT3G50310 AT4G02520 AT4G14690 AT4G23670 AT4G24110 AT4G25420 AT5G01820 AT5G17050 AT5G20630 AT5G24090 AT5G24660 AT5G25830 AT5G44110 AT5G47230 AT5G48540 AT5G49730 AT5G51810 AT5G59220 AT1G10670 AT1G16060 AT1G20823 AT1G25560 AT1G53210 AT1G65420 AT2G21650 AT2G22540 AT2G46210 AT3G02885 AT3G15850 AT3G28455 AT3G46620 AT3G61580 AT3G61850 AT4G17490 AT4G18780 AT5G04500 AT5G13170 AT5G13930 AT5G24655 AT5G27930 AT5G39890 AT5G59550

BP 76 2194 Response to organic substance

AT1G05010 AT2G32120 AT3G22810 AT3G63010 AT4G14740 AT5G59220 AT1G51500 AT2G01530 AT2G38940 AT3G22890 AT3G26450 AT5G20630 AT5G67160 AT1G01250 AT1G10560 AT1G16060 AT1G19210 AT1G25560 AT1G53170 AT1G68840 AT1G74500 AT1G74930 AT1G75500 AT1G78700 AT1G79700 AT2G40670 AT2G40940 AT3G02885 AT3G15150 AT3G15210 AT3G23150 AT3G42800 AT3G46620 AT3G56380 AT4G02520 AT4G17490

178

AT5G47230 AT5G51190 AT5G59550 AT1G10370 AT1G20823 AT1G22160 AT1G31670 AT1G56650 AT1G66160 AT1G66370 AT1G66380 AT1G69040 AT1G76680 AT1G80460 AT2G01520 AT2G46270 AT3G05200 AT3G09820 AT3G16720 AT3G21780 AT3G45140 AT4G11660 AT4G16780 AT4G25420 AT4G39795 AT5G01820 AT5G07990 AT5G13170 AT5G13930 AT5G27420 AT5G37490 AT5G51810 AT1G07200 AT1G43670 AT1G61380 AT3G50310 AT4G22790 AT5G04500 AT1G78300 AT5G25900

BP 73 2538 Phosphorus metabolic process

AT1G02880 AT1G10670 AT1G11280 AT1G11300 AT1G43670 AT1G60810 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G70520 AT1G80460 AT2G25790 AT2G44750 AT3G02780 AT3G08900 AT3G10370 AT3G50310 AT4G26540 AT4G36950 AT5G16000 AT5G16440 AT5G20480 AT5G23400 AT5G40610 AT5G50210 AT5G54390 AT5G58350 AT5G67080 AT1G48600 AT1G79620 AT3G05640 AT1G02390 AT1G47380 AT1G61460 AT1G70250 AT2G02220 AT2G38600 AT2G40940 AT2G47010 AT3G01120 AT3G01840 AT3G03900 AT3G07130 AT3G09820 AT3G10150 AT3G11430 AT3G15095 AT3G17790 AT3G18000 AT3G22890 AT3G23150 AT3G46920 AT3G47110 AT4G01950 AT4G14680 AT4G18250 AT5G01820 AT5G03300 AT5G06090 AT5G27930 AT5G35360 AT5G38280 AT5G56040 AT5G59220

BP 72 2324 Cell communication

AT3G22810 AT3G50310 AT3G59400 AT3G63010 AT4G14740 AT4G36950 AT5G58350 AT5G59220 AT5G67080 AT1G01250 AT1G07460 AT1G10560 AT1G11280 AT1G11300 AT1G16060 AT1G19210 AT1G25560 AT1G31670 AT1G53170 AT1G61100 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61460 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G68840 AT1G74500 AT1G74930 AT1G75500 AT1G78700 AT1G79700 AT2G40670 AT2G40940 AT3G01120 AT3G02885 AT3G15150 AT3G15210 AT3G23150 AT3G28455 AT3G42800 AT3G46620 AT3G56380 AT4G02520 AT4G16780 AT4G17490 AT5G01820 AT5G16000 AT5G38280 AT5G47230 AT5G51190 AT5G59550 AT3G49580 AT4G10380 AT4G14680 AT5G24090 AT5G24660 AT5G48850 AT1G56650 AT2G46590 AT5G20480 AT5G27420 AT1G78300 AT4G25420 AT5G25900

BP 72 2496 Phosphate-containing compound metabolic process

AT1G02880 AT1G10670 AT1G11280 AT1G11300 AT1G43670 AT1G60810 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G70520 AT1G80460 AT2G25790 AT2G44750 AT3G02780 AT3G10370 AT3G50310 AT4G26540 AT4G36950 AT5G16000 AT5G16440 AT5G20480 AT5G23400 AT5G40610 AT5G50210 AT5G54390 AT5G58350 AT5G67080 AT1G48600 AT1G79620 AT3G05640 AT1G02390 AT1G47380 AT1G61460 AT1G70250 AT2G02220 AT2G38600 AT2G40940 AT2G47010 AT3G01120 AT3G01840 AT3G03900 AT3G07130 AT3G09820 AT3G10150 AT3G11430

179

AT3G15095 AT3G17790 AT3G18000 AT3G22890 AT3G23150 AT3G46920 AT3G47110 AT4G01950 AT4G14680 AT4G18250 AT5G01820 AT5G03300 AT5G06090 AT5G27930 AT5G35360 AT5G38280 AT5G56040 AT5G59220

BP 66 1846 Multi-organism process

AT1G07460 AT1G02920 AT5G20480 AT5G67160 AT1G11280 AT1G11300 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61460 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT3G09820 AT5G03300 AT5G16000 AT1G02930 AT1G05010 AT1G09750 AT1G56650 AT1G59740 AT1G64780 AT1G74930 AT1G76670 AT1G80460 AT2G01340 AT2G02930 AT3G05200 AT3G11660 AT3G13790 AT3G44260 AT3G45140 AT3G50310 AT4G02520 AT4G17490 AT4G23670 AT5G22250 AT5G23960 AT5G24090 AT5G27420 AT1G31650 AT2G23620 AT3G63010 AT4G30440 AT1G22130 AT1G29340 AT1G77980 AT1G78130 AT3G07130 AT3G15210 AT3G18000 AT3G23170 AT3G27400 AT4G18780 AT5G06720 AT5G13990 AT5G14180 AT5G14930 AT5G24660 AT5G38280

BP 64 1835 Oxidation-reduction process

AT5G25900 AT5G40610 AT5G49730 AT5G49740 AT3G45140 AT4G04610 AT5G39890 AT1G05010 AT1G23800 AT1G31490 AT1G31670 AT1G31690 AT1G31710 AT1G33720 AT1G33730 AT1G59950 AT1G59960 AT1G64640 AT1G71695 AT1G75450 AT1G76680 AT1G76690 AT2G22420 AT2G24580 AT2G26080 AT2G39040 AT2G40890 AT2G45550 AT2G45560 AT2G45570 AT2G45580 AT2G46210 AT2G46660 AT3G01070 AT3G02000 AT3G10370 AT3G15850 AT3G17790 AT3G53330 AT3G61040 AT3G61580 AT3G61880 AT4G01380 AT4G02520 AT4G05020 AT4G12880 AT4G17280 AT4G21490 AT4G21990 AT4G25420 AT4G33010 AT4G39230 AT5G06720 AT5G06730 AT5G07475 AT5G07990 AT5G14070 AT5G15350 AT5G20630 AT5G47530 AT5G48100 AT5G51810 AT2G36220 AT5G50210

BP 63 1779 Response to oxygen-containing compound

AT1G05010 AT3G63010 AT5G12020 AT5G12030 AT5G59220 AT1G51500 AT2G38940 AT5G67160 AT1G10560 AT1G74500 AT1G78700 AT3G02885 AT3G46620 AT5G59550 AT1G02930 AT1G10370 AT1G20823 AT1G22160 AT1G31670 AT1G56650 AT1G66160 AT1G66370 AT1G66380 AT1G66950 AT1G70520 AT1G76680 AT2G32120 AT2G46270 AT2G46590 AT3G05200 AT3G05640 AT3G09820 AT3G15210 AT3G16720 AT3G17790 AT3G21780 AT3G23920 AT3G45140 AT3G50310 AT4G11660 AT4G17490 AT4G25420 AT4G39795 AT5G01820 AT5G13170 AT5G13930 AT5G24090 AT5G27420 AT5G37490 AT5G47230 AT5G51190 AT5G51810 AT1G07200 AT1G16060 AT1G43670 AT1G61380 AT3G28455 AT4G18780 AT4G22790 AT5G04500 AT5G27930 AT1G78300 AT5G25900

BP 62 1514 Defense response

AT1G07460 AT1G11280 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G02920 AT3G16720 AT1G02930 AT1G05010 AT1G14930 AT1G14940 AT1G14950 AT1G14960 AT1G20823 AT1G26700 AT1G30990 AT1G64760 AT1G75500 AT1G80460 AT2G01520 AT2G01530

180

AT2G23620 AT3G05200 AT3G11660 AT3G15210 AT3G26450 AT3G26460 AT4G02520 AT4G14060 AT4G17490 AT4G23670 AT4G23680 AT5G14930 AT5G16000 AT5G20480 AT5G24660 AT5G27420 AT5G47230 AT5G53760 AT5G67160 AT1G09750 AT1G74930 AT3G13790 AT3G44260 AT5G22250 AT5G24090 AT2G02220 AT4G30440 AT1G29340 AT3G23170 AT4G18780 AT5G06720 AT5G14180

BP 62 1853 Response to hormone

AT1G05010 AT3G22810 AT3G63010 AT4G14740 AT5G59220 AT1G51500 AT2G01530 AT2G38940 AT3G22890 AT3G26450 AT5G20630 AT5G67160 AT1G01250 AT1G10560 AT1G16060 AT1G19210 AT1G25560 AT1G53170 AT1G68840 AT1G74500 AT1G74930 AT1G75500 AT1G78700 AT1G79700 AT2G40670 AT2G40940 AT3G02885 AT3G15150 AT3G15210 AT3G23150 AT3G42800 AT3G46620 AT3G56380 AT4G02520 AT4G17490 AT5G47230 AT5G51190 AT5G59550 AT1G10370 AT1G31670 AT1G56650 AT1G66370 AT1G66380 AT1G69040 AT1G76680 AT2G46270 AT3G21780 AT3G45140 AT4G16780 AT4G25420 AT5G01820 AT5G07990 AT5G13170 AT5G13930 AT5G27420 AT5G51810 AT1G07200 AT1G43670 AT3G50310 AT5G04500 AT1G78300 AT5G25900

BP 62 1888 Response to endogenous stimulus

AT1G05010 AT3G22810 AT3G63010 AT4G14740 AT5G59220 AT1G51500 AT2G01530 AT2G38940 AT3G22890 AT3G26450 AT5G20630 AT5G67160 AT1G01250 AT1G10560 AT1G16060 AT1G19210 AT1G25560 AT1G53170 AT1G68840 AT1G74500 AT1G74930 AT1G75500 AT1G78700 AT1G79700 AT2G40670 AT2G40940 AT3G02885 AT3G15150 AT3G15210 AT3G23150 AT3G42800 AT3G46620 AT3G56380 AT4G02520 AT4G17490 AT5G47230 AT5G51190 AT5G59550 AT1G10370 AT1G31670 AT1G56650 AT1G66370 AT1G66380 AT1G69040 AT1G76680 AT2G46270 AT3G21780 AT3G45140 AT4G16780 AT4G25420 AT5G01820 AT5G07990 AT5G13170 AT5G13930 AT5G27420 AT5G51810 AT1G07200 AT1G43670 AT3G50310 AT5G04500 AT1G78300 AT5G25900

BP 53 1512 Cellular response to chemical stimulus

AT1G05010 AT2G32120 AT3G22810 AT3G63010 AT4G14740 AT5G59220 AT1G01250 AT1G10560 AT1G16060 AT1G19210 AT1G25560 AT1G53170 AT1G68840 AT1G71695 AT1G74500 AT1G74930 AT1G75500 AT1G78700 AT1G79700 AT2G22420 AT2G39040 AT2G40670 AT2G40940 AT3G02885 AT3G15150 AT3G15210 AT3G17790 AT3G23150 AT3G42800 AT3G46620 AT3G49570 AT3G49580 AT3G56380 AT4G02520 AT4G17490 AT5G06720 AT5G06730 AT5G24655 AT5G24660 AT5G47230 AT5G51190 AT5G59550 AT1G02500 AT2G46590 AT4G10380 AT5G13170 AT5G24090 AT1G56650 AT1G61380 AT4G22790 AT1G78300 AT4G25420 AT5G25900

BP 53 1702 Response to external stimulus

AT1G07460 AT3G48550 AT1G02920 AT5G20480 AT5G67160 AT3G60680 AT4G16780 AT1G02930 AT1G05010 AT1G09750 AT1G22160 AT1G56650 AT1G59740 AT1G64780 AT1G74930 AT1G76670 AT1G78020 AT1G80460 AT2G01340 AT2G02930 AT3G05200 AT3G11660 AT3G13790 AT3G44260

181

AT3G45140 AT3G49580 AT4G02520 AT4G10380 AT4G14680 AT4G17490 AT4G23670 AT5G22250 AT5G23960 AT5G24090 AT5G24660 AT5G27420 AT5G48850 AT2G23620 AT4G30440 AT1G10670 AT1G29340 AT1G61380 AT2G21650 AT3G15210 AT3G18000 AT3G23170 AT3G27400 AT4G18780 AT5G06720 AT5G14180 AT5G14930 AT5G16000 AT5G38280

BP 43 1284 Response to biotic stimulus

AT1G07460 AT1G02920 AT5G20480 AT5G67160 AT1G26700 AT5G53760 AT1G02930 AT1G05010 AT1G09750 AT1G56650 AT1G59740 AT1G64780 AT1G74930 AT1G76670 AT1G80460 AT2G01340 AT2G02930 AT3G05200 AT3G11660 AT3G13790 AT3G44260 AT3G45140 AT4G02520 AT4G17490 AT4G23670 AT5G22250 AT5G23960 AT5G24090 AT5G27420 AT2G23620 AT4G30440 AT1G29340 AT1G61380 AT3G15210 AT3G23170 AT3G27400 AT4G18780 AT5G06720 AT5G14180 AT5G14930 AT5G16000 AT5G24660 AT5G38280

BP 41 1138 Lipid metabolic process

AT1G10670 AT1G60810 AT1G78950 AT1G78955 AT1G80460 AT3G02780 AT3G15850 AT3G63170 AT4G25420 AT5G14180 AT5G16440 AT5G25900 AT5G51810 AT1G20330 AT1G48600 AT1G54570 AT1G76680 AT3G45140 AT3G61580 AT5G23960 AT5G35360 AT1G02390 AT1G30370 AT1G76690 AT2G42690 AT2G46210 AT3G11430 AT3G18000 AT4G01950 AT4G36950 AT5G06090 AT5G14930 AT5G40610 AT5G54390 AT1G16060 AT1G79700 AT3G28455 AT1G28100 AT2G46590 AT5G04500 AT3G21780

BP 41 1271 Response to external biotic stimulus

AT1G07460 AT1G02920 AT5G20480 AT5G67160 AT1G02930 AT1G05010 AT1G09750 AT1G56650 AT1G59740 AT1G64780 AT1G74930 AT1G76670 AT1G80460 AT2G01340 AT2G02930 AT3G05200 AT3G11660 AT3G13790 AT3G44260 AT3G45140 AT4G02520 AT4G17490 AT4G23670 AT5G22250 AT5G23960 AT5G24090 AT5G27420 AT2G23620 AT4G30440 AT1G29340 AT1G61380 AT3G15210 AT3G23170 AT3G27400 AT4G18780 AT5G06720 AT5G14180 AT5G14930 AT5G16000 AT5G24660 AT5G38280

BP 41 1271 Response to other organism

AT1G07460 AT1G02920 AT5G20480 AT5G67160 AT1G02930 AT1G05010 AT1G09750 AT1G56650 AT1G59740 AT1G64780 AT1G74930 AT1G76670 AT1G80460 AT2G01340 AT2G02930 AT3G05200 AT3G11660 AT3G13790 AT3G44260 AT3G45140 AT4G02520 AT4G17490 AT4G23670 AT5G22250 AT5G23960 AT5G24090 AT5G27420 AT2G23620 AT4G30440 AT1G29340 AT1G61380 AT3G15210 AT3G23170 AT3G27400 AT4G18780 AT5G06720 AT5G14180 AT5G14930 AT5G16000 AT5G24660 AT5G38280

BP 41 1302 Organic acid metabolic process

AT1G10670 AT1G60810 AT2G23590 AT2G23600 AT2G23610 AT2G23620 AT2G26080 AT3G15850 AT3G25900 AT3G63170 AT4G25420 AT4G33010 AT4G39640 AT4G39650 AT5G25900 AT5G50210 AT5G51810 AT1G76680 AT1G76690 AT2G43820 AT2G43840 AT5G35360 AT5G57850 AT1G75500 AT1G80460 AT2G24580 AT2G30970 AT3G01120 AT3G03900 AT3G45140 AT4G04610 AT4G21990 AT1G16060 AT1G79700 AT3G28455 AT4G30440 AT5G48850 AT2G46590 AT5G67160 AT1G69040 AT3G21780

182

BP 41 1299 Oxoacid metabolic process

AT1G10670 AT1G60810 AT2G23590 AT2G23600 AT2G23610 AT2G23620 AT2G26080 AT3G15850 AT3G25900 AT3G63170 AT4G25420 AT4G33010 AT4G39640 AT4G39650 AT5G25900 AT5G50210 AT5G51810 AT1G76680 AT1G76690 AT2G43820 AT2G43840 AT5G35360 AT5G57850 AT1G75500 AT1G80460 AT2G24580 AT2G30970 AT3G01120 AT3G03900 AT3G45140 AT4G04610 AT4G21990 AT1G16060 AT1G79700 AT3G28455 AT4G30440 AT5G48850 AT2G46590 AT5G67160 AT1G69040 AT3G21780

BP 40 995 Response to inorganic substance

AT1G05010 AT4G24120 AT5G12020 AT5G12030 AT1G02500 AT1G02920 AT1G02930 AT1G68560 AT1G70520 AT1G76680 AT2G01520 AT2G30970 AT2G32120 AT2G46590 AT3G05640 AT3G09820 AT3G17790 AT3G22890 AT3G23920 AT4G02520 AT4G09000 AT4G19880 AT4G23670 AT4G33010 AT4G39230 AT5G01820 AT5G02790 AT5G24090 AT5G48100 AT5G59220 AT1G10370 AT1G16060 AT1G56650 AT3G28455 AT3G46620 AT3G50310 AT4G18780 AT4G22790 AT5G27930 AT5G59550

BP 40 1133 Carboxylic acid metabolic process

AT1G10670 AT1G60810 AT2G23590 AT2G23600 AT2G23610 AT2G23620 AT2G26080 AT3G15850 AT3G25900 AT3G63170 AT4G25420 AT4G33010 AT4G39640 AT4G39650 AT5G25900 AT5G50210 AT5G51810 AT1G76680 AT1G76690 AT2G43820 AT2G43840 AT5G35360 AT5G57850 AT1G75500 AT1G80460 AT2G24580 AT2G30970 AT3G01120 AT3G03900 AT3G45140 AT4G04610 AT4G21990 AT1G16060 AT1G79700 AT3G28455 AT4G30440 AT2G46590 AT5G67160 AT1G69040 AT3G21780

BP 38 1186 Cellular response to organic substance

AT2G32120 AT3G22810 AT3G63010 AT4G14740 AT5G59220 AT1G01250 AT1G10560 AT1G16060 AT1G19210 AT1G25560 AT1G53170 AT1G68840 AT1G74500 AT1G74930 AT1G75500 AT1G78700 AT1G79700 AT2G40670 AT2G40940 AT3G02885 AT3G15150 AT3G15210 AT3G23150 AT3G42800 AT3G46620 AT3G56380 AT4G02520 AT4G17490 AT5G47230 AT5G51190 AT5G59550 AT1G05010 AT5G13170 AT1G56650 AT1G61380 AT1G78300 AT4G25420 AT5G25900

BP 36 826 Cellular lipid metabolic process

AT1G10670 AT1G60810 AT1G78950 AT1G78955 AT1G80460 AT3G02780 AT3G15850 AT3G63170 AT4G25420 AT5G14180 AT5G16440 AT5G25900 AT5G51810 AT1G48600 AT1G54570 AT1G76680 AT3G45140 AT5G23960 AT5G35360 AT1G02390 AT1G76690 AT2G46210 AT3G11430 AT3G18000 AT3G61580 AT4G01950 AT5G06090 AT5G40610 AT5G54390 AT1G16060 AT1G79700 AT3G28455 AT1G28100 AT2G46590 AT5G04500 AT3G21780

BP 35 1048 Cellular response to hormone stimulus

AT3G22810 AT3G63010 AT4G14740 AT5G59220 AT1G01250 AT1G10560 AT1G16060 AT1G19210 AT1G25560 AT1G53170 AT1G68840 AT1G74500 AT1G74930 AT1G75500 AT1G78700 AT1G79700 AT2G40670 AT2G40940 AT3G02885 AT3G15150 AT3G15210 AT3G23150 AT3G42800 AT3G46620 AT3G56380 AT4G02520 AT4G17490 AT5G47230 AT5G51190 AT5G59550 AT5G13170 AT1G56650 AT1G78300 AT4G25420 AT5G25900

183

BP 35 1084 Cellular response to endogenous stimulus

AT3G22810 AT3G63010 AT4G14740 AT5G59220 AT1G01250 AT1G10560 AT1G16060 AT1G19210 AT1G25560 AT1G53170 AT1G68840 AT1G74500 AT1G74930 AT1G75500 AT1G78700 AT1G79700 AT2G40670 AT2G40940 AT3G02885 AT3G15150 AT3G15210 AT3G23150 AT3G42800 AT3G46620 AT3G56380 AT4G02520 AT4G17490 AT5G47230 AT5G51190 AT5G59550 AT5G13170 AT1G56650 AT1G78300 AT4G25420 AT5G25900

BP 34 922 Hormone-mediated signaling pathway

AT3G22810 AT3G63010 AT4G14740 AT5G59220 AT1G01250 AT1G10560 AT1G16060 AT1G19210 AT1G25560 AT1G53170 AT1G68840 AT1G74500 AT1G74930 AT1G75500 AT1G78700 AT1G79700 AT2G40670 AT2G40940 AT3G02885 AT3G15150 AT3G15210 AT3G23150 AT3G42800 AT3G46620 AT3G56380 AT4G02520 AT4G17490 AT5G47230 AT5G51190 AT5G59550 AT1G56650 AT1G78300 AT4G25420 AT5G25900

BP 32 641 Cofactor metabolic process

AT1G02880 AT1G02920 AT1G02930 AT1G10360 AT1G10370 AT1G10670 AT1G60810 AT2G02930 AT2G44750 AT4G02520 AT4G39640 AT4G39650 AT5G40610 AT5G43860 AT5G50210 AT1G02500 AT1G23360 AT1G71695 AT2G22420 AT2G24580 AT2G39040 AT3G02780 AT3G59400 AT5G06720 AT5G06730 AT5G16440 AT5G35360 AT5G57850 AT3G10370 AT4G14690 AT2G30970 AT3G22840

BP 31 611 Lipid biosynthetic process

AT1G10670 AT1G60810 AT1G78950 AT1G78955 AT3G02780 AT3G15850 AT4G25420 AT5G16440 AT5G25900 AT5G51810 AT1G20330 AT1G48600 AT5G23960 AT5G35360 AT1G02390 AT1G76680 AT1G76690 AT3G11430 AT3G18000 AT3G45140 AT4G01950 AT5G06090 AT5G40610 AT1G16060 AT1G54570 AT1G79700 AT3G28455 AT1G28100 AT2G46210 AT2G46590 AT3G61580

BP 31 829 Drug metabolic process

AT2G23590 AT2G23600 AT2G23610 AT2G23620 AT2G26080 AT4G33010 AT1G54570 AT2G43820 AT2G43840 AT1G02500 AT1G02880 AT1G11925 AT1G71695 AT2G22420 AT2G39040 AT2G44750 AT3G03900 AT3G09820 AT3G22890 AT3G27400 AT3G58790 AT4G14680 AT5G03300 AT5G04310 AT5G06720 AT5G06730 AT5G24090 AT5G50210 AT5G41040 AT5G48100 AT5G67160

BP 30 825 Small molecule biosynthetic process

AT1G10670 AT1G43670 AT1G60810 AT3G15850 AT3G25900 AT4G25420 AT4G39640 AT4G39650 AT5G25900 AT5G51810 AT1G76690 AT5G35360 AT5G57850 AT1G23360 AT1G75500 AT1G76680 AT3G01120 AT3G03900 AT3G09820 AT3G45140 AT4G04610 AT4G21990 AT5G03300 AT5G50210 AT1G16060 AT1G79700 AT3G28455 AT4G30440 AT2G46590 AT5G67160

BP 29 740 Regulation of developmental process

AT1G05010 AT1G22130 AT1G77980 AT3G18550 AT1G10560 AT1G31650 AT1G60190 AT4G26540 AT5G56040 AT1G10670 AT1G16060 AT1G20823 AT1G79620 AT2G22540 AT2G26580 AT2G43820 AT2G46590 AT3G15150 AT3G22840 AT3G50310 AT4G14690 AT4G28190 AT5G13990 AT5G14930 AT5G16000 AT5G24655 AT5G43270 AT5G57520 AT1G31670

184

BP 29 765 Cell wall organization or biogenesis

AT3G08900 AT4G18780 AT1G68560 AT1G10640 AT1G22880 AT1G26770 AT1G48100 AT1G60590 AT1G64390 AT1G64760 AT1G71380 AT1G75500 AT2G03090 AT2G23900 AT2G28950 AT2G40610 AT2G43870 AT3G01120 AT3G28180 AT3G48950 AT3G58790 AT3G59850 AT4G03210 AT5G22740 AT5G25830 AT5G41040 AT1G76670 AT1G79620 AT3G16060

BP 28 652 Response to drug

AT1G05010 AT4G21120 AT4G22790 AT5G12020 AT5G12030 AT5G46800 AT4G10380 AT2G21340 AT1G20823 AT1G66160 AT1G70520 AT1G76680 AT2G32120 AT3G05200 AT3G15210 AT3G16720 AT3G17790 AT3G46620 AT4G11660 AT4G17490 AT5G13170 AT5G27420 AT5G37490 AT5G47230 AT5G51190 AT5G59550 AT1G66950 AT3G02885

BP 28 665 Growth

AT4G25420 AT5G51810 AT1G10370 AT1G11420 AT1G26540 AT1G74500 AT2G46660 AT3G61880 AT1G31650 AT4G26540 AT5G56040 AT1G16060 AT1G20330 AT1G22130 AT1G48100 AT1G75500 AT1G77980 AT1G79620 AT3G05640 AT3G15150 AT3G18000 AT3G50310 AT4G16780 AT4G28190 AT5G13990 AT5G16000 AT5G27930 AT5G56540

BP 27 430 Immune system process

AT1G11280 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G02920 AT2G23620 AT1G09750 AT3G05200 AT3G11660 AT5G24090 AT5G27420 AT1G29340 AT2G02220 AT3G15210 AT3G23170 AT5G14930 AT5G16000 AT5G20480

BP 27 584 Regulation of multicellular organismal process

AT1G05010 AT1G22130 AT1G77980 AT3G18550 AT1G10560 AT1G31650 AT1G60190 AT4G26540 AT5G56040 AT1G10670 AT1G16060 AT1G20823 AT2G22540 AT2G26580 AT2G43820 AT2G46590 AT3G15150 AT3G22840 AT3G50310 AT4G14690 AT4G28190 AT5G13990 AT5G14930 AT5G16000 AT5G24655 AT5G57520 AT1G31670

BP 27 633 External encapsulating structure organization

AT1G10640 AT1G22880 AT1G26770 AT1G48100 AT1G60590 AT1G64390 AT1G64760 AT1G68560 AT1G71380 AT1G75500 AT2G03090 AT2G23900 AT2G28950 AT2G40610 AT2G43870 AT3G01120 AT3G08900 AT3G28180 AT3G48950 AT3G58790 AT3G59850 AT4G03210 AT4G18780 AT5G22740 AT5G25830 AT5G41040 AT1G65060

BP 26 596 Cell wall organization

AT1G10640 AT1G22880 AT1G26770 AT1G48100 AT1G60590 AT1G64390 AT1G64760 AT1G68560 AT1G71380 AT1G75500 AT2G03090 AT2G23900 AT2G28950 AT2G40610 AT2G43870 AT3G01120 AT3G08900 AT3G28180 AT3G48950 AT3G58790 AT3G59850 AT4G03210 AT4G18780 AT5G22740 AT5G25830 AT5G41040

BP 26 638 Organic acid biosynthetic process

AT1G10670 AT1G60810 AT3G15850 AT3G25900 AT4G25420 AT4G39640 AT4G39650 AT5G25900 AT5G51810 AT1G76690 AT5G35360 AT5G57850 AT1G75500 AT1G76680 AT3G01120 AT3G03900 AT3G45140 AT4G04610 AT4G21990 AT5G50210 AT1G16060 AT1G79700 AT3G28455 AT4G30440 AT2G46590 AT5G67160

185

BP 26 638 Carboxylic acid biosynthetic process

AT1G10670 AT1G60810 AT3G15850 AT3G25900 AT4G25420 AT4G39640 AT4G39650 AT5G25900 AT5G51810 AT1G76690 AT5G35360 AT5G57850 AT1G75500 AT1G76680 AT3G01120 AT3G03900 AT3G45140 AT4G04610 AT4G21990 AT5G50210 AT1G16060 AT1G79700 AT3G28455 AT4G30440 AT2G46590 AT5G67160

BP 25 682 Response to osmotic stress

AT1G05010 AT5G12020 AT5G12030 AT1G51500 AT1G02500 AT1G02920 AT1G02930 AT1G56650 AT1G59960 AT2G18190 AT3G01470 AT3G21780 AT3G49580 AT4G02520 AT4G23670 AT5G01820 AT5G24090 AT5G24660 AT1G10370 AT1G16060 AT1G53210 AT3G50310 AT4G18780 AT5G04500 AT5G13170

BP 24 385 Innate immune response

AT1G11280 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G02920 AT2G23620 AT1G09750 AT3G05200 AT5G24090 AT5G27420 AT1G29340 AT2G02220 AT3G15210 AT3G23170 AT5G20480

BP 24 393 Immune response

AT1G11280 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G02920 AT2G23620 AT1G09750 AT3G05200 AT5G24090 AT5G27420 AT1G29340 AT2G02220 AT3G15210 AT3G23170 AT5G20480

BP 24 418 Sulfur compound metabolic process

AT1G02880 AT1G02920 AT1G02930 AT1G10360 AT1G10370 AT1G10670 AT1G60810 AT2G02930 AT2G44750 AT3G03900 AT3G22890 AT3G25900 AT4G02520 AT4G14680 AT4G39640 AT4G39650 AT5G50210 AT4G04610 AT4G21990 AT1G02500 AT3G01120 AT5G35360 AT5G54390 AT5G48850

BP 24 536 Regulation of multicellular organismal development

AT1G05010 AT1G22130 AT1G77980 AT3G18550 AT1G10560 AT1G60190 AT4G26540 AT5G56040 AT1G10670 AT1G16060 AT1G20823 AT2G22540 AT2G26580 AT2G43820 AT2G46590 AT3G15150 AT3G22840 AT3G50310 AT4G14690 AT4G28190 AT5G14930 AT5G24655 AT5G57520 AT1G31670

BP 23 368 Response to toxic substance

AT5G12020 AT5G12030 AT1G02920 AT1G02930 AT1G10360 AT1G10370 AT1G71695 AT2G02930 AT2G22420 AT2G39040 AT3G17790 AT3G49570 AT3G49580 AT4G02520 AT5G02780 AT5G02790 AT5G06720 AT5G06730 AT5G24655 AT5G24660 AT1G80460 AT2G32120 AT1G56650

BP 23 606 Response to salt stress

AT1G05010 AT5G12020 AT5G12030 AT1G51500 AT1G02500 AT1G02920 AT1G02930 AT1G56650 AT1G59960 AT2G18190 AT3G01470 AT3G21780 AT3G49580 AT4G02520 AT4G23670 AT5G01820 AT5G24090 AT5G24660 AT1G10370 AT1G16060 AT1G53210 AT3G50310 AT5G04500

BP 22 548 Monocarboxylic acid metabolic process

AT1G10670 AT1G60810 AT2G23590 AT2G23600 AT2G23610 AT2G23620 AT3G15850 AT3G63170 AT1G76680 AT1G76690 AT2G43820 AT2G43840 AT5G35360 AT5G57850 AT1G80460 AT3G45140 AT1G16060 AT1G79700 AT3G28455 AT4G30440 AT5G67160 AT3G21780

BP 21 312 Pollination AT1G11280 AT1G11300 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61460 AT1G61480

186

AT1G61490 AT1G61500 AT1G61550 AT1G31650 AT1G22130 AT1G77980 AT3G07130 AT3G18000 AT5G13990

BP 21 312 Multi-multicellular organism process

AT1G11280 AT1G11300 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61460 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G31650 AT1G22130 AT1G77980 AT3G07130 AT3G18000 AT5G13990

BP 21 400 Regulation of hormone levels

AT2G23590 AT2G23600 AT2G23610 AT2G23620 AT4G25420 AT4G35190 AT5G25900 AT5G51810 AT1G76690 AT1G05010 AT1G75450 AT1G75500 AT2G43820 AT2G43840 AT2G46590 AT3G45140 AT5G13930 AT5G19530 AT5G67160 AT3G42800 AT1G02500

BP 21 559 Negative regulation of cellular metabolic process

AT1G27820 AT1G27890 AT1G47710 AT1G61470 AT3G02000 AT3G44240 AT3G44260 AT5G14070 AT5G22250 AT1G68840 AT2G22540 AT2G36050 AT3G52540 AT4G11660 AT4G16780 AT1G20330 AT3G01470 AT3G15150 AT3G15210 AT3G15850 AT3G61850

BP 20 334 Regulation of growth

AT1G10370 AT1G11420 AT1G26540 AT1G74500 AT2G46660 AT3G61880 AT1G31650 AT4G26540 AT5G56040 AT1G16060 AT1G22130 AT1G77980 AT1G79620 AT3G05640 AT3G15150 AT3G50310 AT4G28190 AT5G13990 AT5G16000 AT5G27930

BP 20 401 Secondary metabolic process

AT2G40890 AT4G39230 AT1G65060 AT3G03900 AT3G22890 AT4G14680 AT5G17050 AT5G48100 AT3G28455 AT5G48850 AT2G22420 AT2G46590 AT3G11430 AT5G41040 AT1G02920 AT1G02930 AT1G10360 AT1G10370 AT2G02930 AT4G02520

BP 20 484 Response to oxidative stress

AT1G05010 AT5G12020 AT5G12030 AT1G02930 AT4G39640 AT1G71695 AT2G22420 AT2G39040 AT5G06720 AT5G06730 AT1G66950 AT1G70520 AT2G32120 AT3G17790 AT3G50310 AT4G17490 AT5G01820 AT5G13930 AT1G56650 AT2G19810

BP 20 519 Negative regulation of nitrogen compound metabolic process

AT1G27820 AT1G27890 AT1G47710 AT1G61470 AT3G02000 AT3G44240 AT3G44260 AT5G14070 AT5G22250 AT1G68840 AT2G22540 AT2G36050 AT3G52540 AT4G11660 AT4G16780 AT1G20330 AT3G01470 AT3G15150 AT3G15210 AT3G61850

BP 19 358 Negative regulation of cellular macromolecule biosynthetic process

AT1G27820 AT1G27890 AT1G61470 AT3G02000 AT3G44240 AT3G44260 AT5G14070 AT5G22250 AT1G68840 AT2G22540 AT2G36050 AT3G52540 AT4G11660 AT4G16780 AT1G20330 AT3G01470 AT3G15150 AT3G15210 AT3G61850

BP 19 376 Negative regulation of macromolecule biosynthetic process

AT1G27820 AT1G27890 AT1G61470 AT3G02000 AT3G44240 AT3G44260 AT5G14070 AT5G22250 AT1G68840 AT2G22540 AT2G36050 AT3G52540 AT4G11660 AT4G16780 AT1G20330 AT3G01470 AT3G15150 AT3G15210 AT3G61850

BP 19 388 Anion transport AT2G40420 AT3G56200 AT4G21120 AT5G16740 AT5G40670 AT5G46800 AT1G76670 AT4G10380 AT5G58970 AT1G21070 AT1G75170 AT1G80460

187

AT2G38940 AT3G54700 AT5G42420 AT1G20823 AT4G39650 AT5G20480 AT1G31670

BP 19 396 Negative regulation of cellular biosynthetic process

AT1G27820 AT1G27890 AT1G61470 AT3G02000 AT3G44240 AT3G44260 AT5G14070 AT5G22250 AT1G68840 AT2G22540 AT2G36050 AT3G52540 AT4G11660 AT4G16780 AT1G20330 AT3G01470 AT3G15150 AT3G15210 AT3G61850

BP 19 401 Negative regulation of biosynthetic process

AT1G27820 AT1G27890 AT1G61470 AT3G02000 AT3G44240 AT3G44260 AT5G14070 AT5G22250 AT1G68840 AT2G22540 AT2G36050 AT3G52540 AT4G11660 AT4G16780 AT1G20330 AT3G01470 AT3G15150 AT3G15210 AT3G61850

BP 19 460 Organophosphate biosynthetic process

AT1G02880 AT1G10670 AT1G60810 AT1G80460 AT2G44750 AT3G02780 AT5G16440 AT5G50210 AT1G48600 AT1G02390 AT2G02220 AT3G09820 AT3G11430 AT3G18000 AT4G01950 AT5G03300 AT5G06090 AT5G35360 AT5G40610

BP 19 485 Response to metal ion

AT1G05010 AT4G24120 AT1G02500 AT1G02920 AT1G02930 AT1G68560 AT1G76680 AT2G01520 AT2G30970 AT3G09820 AT3G22890 AT4G02520 AT4G09000 AT4G19880 AT4G23670 AT4G33010 AT4G39230 AT5G02790 AT5G48100

BP 18 292 Hormone metabolic process AT2G23590 AT2G23600 AT2G23610 AT2G23620 AT4G25420 AT4G35190 AT5G25900 AT5G51810 AT1G76690 AT1G05010 AT1G75450 AT1G75500 AT2G43820 AT2G43840 AT2G46590 AT3G45140 AT5G67160 AT1G02500

BP 17 246 Detoxification AT1G71695 AT2G22420 AT2G39040 AT3G17790 AT3G49570 AT3G49580 AT4G02520 AT5G06720 AT5G06730 AT5G24655 AT5G24660 AT1G56650 AT1G02920 AT1G02930 AT1G10360 AT1G10370 AT2G02930

BP 17 254 Phosphorelay signal transduction system

AT1G01250 AT1G16060 AT1G19210 AT1G25560 AT1G53170 AT1G68840 AT1G74930 AT1G79700 AT2G40670 AT2G40940 AT3G01120 AT3G15210 AT3G23150 AT3G56380 AT4G17490 AT5G47230 AT5G51190

BP 16 180 Sulfur compound biosynthetic process

AT1G02880 AT1G10670 AT1G60810 AT2G44750 AT3G25900 AT4G39640 AT4G39650 AT1G02500 AT3G01120 AT3G03900 AT3G22890 AT4G04610 AT4G14680 AT4G21990 AT5G35360 AT5G48850

BP 16 309 Response to ethylene AT1G05010 AT1G01250 AT1G16060 AT1G19210 AT1G25560 AT1G53170 AT1G68840 AT1G74930 AT1G79700 AT2G40940 AT3G15210 AT3G23150 AT4G17490 AT5G47230 AT5G51190 AT1G56650

BP 16 382 Regulation of post-embryonic development

AT1G05010 AT1G22130 AT1G77980 AT1G10560 AT1G60190 AT1G10670 AT1G16060 AT1G20823 AT2G22540 AT2G43820 AT2G46590 AT3G22840 AT4G14690 AT4G28190 AT5G24655 AT5G57520

BP 15 83 Cell recognition AT1G11280 AT1G11300 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61460 AT1G61480 AT1G61490 AT1G61500 AT1G61550

188

BP 15 85 Pollen-pistil interaction AT1G11280 AT1G11300 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61460 AT1G61480 AT1G61490 AT1G61500 AT1G61550

BP 15 80 Recognition of pollen AT1G11280 AT1G11300 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61460 AT1G61480 AT1G61490 AT1G61500 AT1G61550

BP 15 340 Response to nitrogen compound

AT1G05010 AT1G10370 AT1G20823 AT1G66160 AT3G05200 AT3G15210 AT3G16720 AT3G46620 AT4G11660 AT4G17490 AT5G27420 AT5G37490 AT5G47230 AT5G51190 AT5G59550

BP 15 348 Response to cadmium ion AT1G02500 AT1G02920 AT1G02930 AT1G68560 AT1G76680 AT2G30970 AT3G09820 AT3G22890 AT4G02520 AT4G09000 AT4G19880 AT4G23670 AT4G33010 AT4G39230 AT5G02790

BP 15 349 Organic hydroxy compound metabolic process

AT1G80460 AT2G23590 AT2G23600 AT2G23610 AT2G23620 AT1G20330 AT1G30530 AT1G54570 AT3G10370 AT3G28455 AT2G43820 AT2G43840 AT5G48100 AT5G67160 AT3G21780

BP 14 214 Anion transmembrane transport

AT2G40420 AT3G56200 AT5G16740 AT5G46800 AT1G76670 AT5G58970 AT1G21070 AT1G80460 AT4G10380 AT4G21120 AT5G42420 AT3G54700 AT4G39650 AT5G20480

BP 14 218 Cellular response to ethylene stimulus

AT1G01250 AT1G16060 AT1G19210 AT1G25560 AT1G53170 AT1G68840 AT1G74930 AT1G79700 AT2G40940 AT3G15210 AT3G23150 AT4G17490 AT5G47230 AT5G51190

BP 14 223 Isoprenoid metabolic process AT1G78950 AT1G78955 AT3G02780 AT4G25420 AT5G16440 AT5G25900 AT5G51810 AT1G54570 AT5G23960 AT3G28455 AT1G10670 AT1G28100 AT2G46590 AT3G21780

BP 14 260 Response to organonitrogen compound

AT1G10370 AT1G20823 AT1G66160 AT3G05200 AT3G15210 AT3G16720 AT3G46620 AT4G11660 AT4G17490 AT5G27420 AT5G37490 AT5G47230 AT5G51190 AT5G59550

BP 14 322 Cofactor biosynthetic process AT1G02880 AT1G10670 AT1G60810 AT2G44750 AT5G50210 AT1G02500 AT1G23360 AT3G02780 AT3G59400 AT5G16440 AT5G35360 AT5G57850 AT4G14690 AT3G22840

BP 13 133 Response to karrikin AT1G01300 AT1G10370 AT1G30530 AT1G66390 AT1G70420 AT1G80460 AT3G13790 AT3G21090 AT3G22840 AT4G24110 AT5G17050 AT5G48540 AT5G51810

BP 13 137 Response to chitin AT1G20823 AT1G66160 AT3G05200 AT3G15210 AT3G16720 AT3G46620 AT4G11660 AT4G17490 AT5G27420 AT5G37490 AT5G47230 AT5G51190 AT5G59550

BP 13 194 Pigment metabolic process AT5G43860 AT1G30530 AT3G02780 AT3G59400 AT5G16440 AT5G13930 AT1G10670 AT1G28100 AT1G56650 AT1G66370 AT1G66380 AT4G14690 AT3G22840

189

BP 13 236 Organic anion transport AT2G40420 AT3G56200 AT4G21120 AT5G16740 AT5G40670 AT5G46800 AT1G76670 AT5G58970 AT1G21070 AT1G75170 AT1G80460 AT5G42420 AT4G39650

BP 12 160 Pigment biosynthetic process AT1G30530 AT3G02780 AT3G59400 AT5G16440 AT5G13930 AT1G10670 AT1G28100 AT1G56650 AT1G66370 AT1G66380 AT4G14690 AT3G22840

BP 12 180 Cellular oxidant detoxification AT1G71695 AT2G22420 AT2G39040 AT3G17790 AT3G49570 AT3G49580 AT4G02520 AT5G06720 AT5G06730 AT5G24655 AT5G24660 AT1G56650

BP 12 181 Terpenoid metabolic process AT1G78950 AT1G78955 AT4G25420 AT5G25900 AT5G51810 AT1G54570 AT5G23960 AT3G28455 AT1G10670 AT1G28100 AT2G46590 AT3G21780

BP 12 192 Cellular detoxification AT1G71695 AT2G22420 AT2G39040 AT3G17790 AT3G49570 AT3G49580 AT4G02520 AT5G06720 AT5G06730 AT5G24655 AT5G24660 AT1G56650

BP 12 195 Isoprenoid biosynthetic process

AT1G78950 AT1G78955 AT3G02780 AT4G25420 AT5G16440 AT5G25900 AT5G51810 AT5G23960 AT3G28455 AT1G10670 AT1G28100 AT2G46590

BP 12 204 Cellular response to toxic substance

AT1G71695 AT2G22420 AT2G39040 AT3G17790 AT3G49570 AT3G49580 AT4G02520 AT5G06720 AT5G06730 AT5G24655 AT5G24660 AT1G56650

BP 12 243 Antibiotic metabolic process AT2G23590 AT2G23600 AT2G23610 AT2G23620 AT2G43820 AT2G43840 AT1G71695 AT2G22420 AT2G39040 AT5G06720 AT5G06730 AT5G67160

BP 11 130 Cellular modified amino acid metabolic process

AT1G02920 AT1G02930 AT1G10360 AT1G10370 AT2G02930 AT3G25900 AT4G02520 AT4G39640 AT4G39650 AT2G24580 AT5G57850

BP 11 150 Regulation of developmental growth

AT1G31650 AT4G26540 AT5G56040 AT1G22130 AT1G77980 AT1G79620 AT3G15150 AT3G50310 AT4G28190 AT5G13990 AT5G16000

BP 11 194 Seedling development AT1G05010 AT5G04500 AT1G10560 AT1G60190 AT1G16060 AT1G78020 AT2G43820 AT2G46590 AT3G07130 AT3G22840 AT4G14690

BP 11 211 Hormone biosynthetic process AT4G25420 AT4G35190 AT5G25900 AT5G51810 AT1G76690 AT1G05010 AT1G75500 AT2G46590 AT3G45140 AT5G67160 AT1G02500

BP 10 138 Amine metabolic process AT1G31690 AT1G31710 AT4G35190 AT5G19530 AT1G31490 AT1G31670 AT1G75450 AT1G75500 AT3G18000 AT1G69040

BP 10 155 Terpenoid biosynthetic process

AT1G78950 AT1G78955 AT4G25420 AT5G25900 AT5G51810 AT5G23960 AT3G28455 AT1G10670 AT1G28100 AT2G46590

BP 10 169 Seed germination AT1G05010 AT5G04500 AT1G10560 AT1G60190 AT1G16060 AT2G43820 AT2G46590 AT3G07130 AT3G22840 AT4G14690

BP 10 177 Secondary metabolite biosynthetic process

AT2G40890 AT4G39230 AT3G03900 AT3G22890 AT4G14680 AT5G48850 AT2G22420 AT3G11430 AT5G41040 AT5G48100

190

BP 10 184 Response to reactive oxygen species

AT1G05010 AT5G12020 AT5G12030 AT1G66950 AT1G70520 AT2G32120 AT3G17790 AT3G50310 AT4G17490 AT1G56650

BP 10 194 Polysaccharide catabolic process

AT1G68560 AT3G23920 AT1G11925 AT1G22880 AT1G64390 AT1G71380 AT3G27400 AT5G04310 AT5G24090 AT1G43670

BP 9 71 Toxin metabolic process AT3G03900 AT3G22890 AT4G14680 AT1G02920 AT1G02930 AT1G10360 AT1G10370 AT2G02930 AT4G02520

BP 9 152 Phospholipid biosynthetic process

AT3G02780 AT5G16440 AT1G48600 AT1G02390 AT3G11430 AT3G18000 AT4G01950 AT5G06090 AT5G40610

BP 9 163 Fatty acid biosynthetic process AT1G10670 AT1G60810 AT3G15850 AT5G35360 AT1G76680 AT1G76690 AT3G45140 AT1G16060 AT1G79700

BP 8 51 Negative regulation of translation

AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250 AT2G22540 AT3G01470

BP 8 53 Negative regulation of cellular amide metabolic process

AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250 AT2G22540 AT3G01470

BP 8 57 Glutathione metabolic process AT1G02920 AT1G02930 AT1G10360 AT1G10370 AT2G02930 AT4G02520 AT4G39640 AT4G39650

BP 8 70 Benzene-containing compound metabolic process

AT2G23590 AT2G23600 AT2G23610 AT2G23620 AT2G43820 AT2G43840 AT5G57850 AT5G67160

BP 8 77 Flavonoid biosynthetic process AT1G30530 AT5G07990 AT5G13930 AT5G17050 AT1G56650 AT1G66370 AT1G66380 AT2G40890

BP 8 83 Regulation of seed germination

AT1G05010 AT1G10560 AT1G60190 AT1G16060 AT2G43820 AT2G46590 AT3G22840 AT4G14690

BP 8 87 Regulation of seedling development

AT1G05010 AT1G10560 AT1G60190 AT1G16060 AT2G43820 AT2G46590 AT3G22840 AT4G14690

BP 8 96 Flavonoid metabolic process AT1G30530 AT5G07990 AT5G13930 AT5G17050 AT1G56650 AT1G66370 AT1G66380 AT2G40890

BP 8 126 Positive regulation of developmental process

AT1G05010 AT1G10670 AT1G79620 AT2G43820 AT2G46590 AT3G22840 AT4G14690 AT5G14930

BP 8 131 Cofactor catabolic process AT4G39640 AT4G39650 AT5G43860 AT1G71695 AT2G22420 AT2G39040 AT5G06720 AT5G06730

BP 8 136 Phenylpropanoid metabolic process

AT2G40890 AT4G39230 AT1G65060 AT5G17050 AT5G48100 AT2G22420 AT3G11430 AT5G41040

191

BP 7 48 Salicylic acid metabolic process

AT2G23590 AT2G23600 AT2G23610 AT2G23620 AT2G43820 AT2G43840 AT5G67160

BP 7 57 Sulfur amino acid biosynthetic process

AT3G25900 AT4G39640 AT4G39650 AT3G01120 AT3G03900 AT4G04610 AT4G21990

BP 7 70 Serine family amino acid metabolic process

AT2G26080 AT4G33010 AT4G39640 AT4G39650 AT3G03900 AT4G04610 AT4G21990

BP 7 77 Sulfur amino acid metabolic process

AT3G25900 AT4G39640 AT4G39650 AT3G01120 AT3G03900 AT4G04610 AT4G21990

BP 7 77 Cellular carbohydrate catabolic process

AT3G23920 AT1G22880 AT1G64390 AT1G71380 AT1G80460 AT3G10370 AT1G43670

BP 7 82 Amino acid transport AT2G40420 AT3G56200 AT4G21120 AT5G16740 AT5G40670 AT5G46800 AT5G58970

BP 7 87 Chlorophyll metabolic process AT5G43860 AT3G02780 AT3G59400 AT5G16440 AT1G10670 AT4G14690 AT3G22840

BP 7 101 Porphyrin-containing compound metabolic process

AT5G43860 AT3G02780 AT3G59400 AT5G16440 AT1G10670 AT4G14690 AT3G22840

BP 7 102 Tetrapyrrole metabolic process

AT5G43860 AT3G02780 AT3G59400 AT5G16440 AT1G10670 AT4G14690 AT3G22840

BP 7 104 Organic acid transmembrane transport

AT2G40420 AT3G56200 AT5G16740 AT5G46800 AT5G58970 AT1G80460 AT4G21120

BP 7 104 Carboxylic acid transmembrane transport

AT2G40420 AT3G56200 AT5G16740 AT5G46800 AT5G58970 AT1G80460 AT4G21120

BP 6 20

Exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay

AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

BP 6 24 Cutin biosynthetic process AT1G02390 AT3G11430 AT4G01950 AT5G06090 AT1G16060 AT1G79700

BP 6 27 Nuclear-transcribed mRNA catabolic process, exonucleolytic

AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

BP 6 34 Nuclear-transcribed mRNA catabolic process,

AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

192

deadenylation-dependent decay

BP 6 39 RNA phosphodiester bond hydrolysis, exonucleolytic

AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

BP 6 44 Jasmonic acid metabolic process

AT2G23590 AT2G23600 AT2G23610 AT2G23620 AT1G76690 AT3G45140

BP 6 49 Toxin catabolic process AT1G02920 AT1G02930 AT1G10360 AT1G10370 AT2G02930 AT4G02520

BP 6 62 Chlorophyll biosynthetic process

AT3G02780 AT3G59400 AT5G16440 AT1G10670 AT4G14690 AT3G22840

BP 6 68 Pyrimidine-containing compound biosynthetic process

AT1G02880 AT2G44750 AT1G02390 AT3G11430 AT4G01950 AT5G06090

BP 6 71 Amino acid transmembrane transport

AT2G40420 AT3G56200 AT5G16740 AT5G46800 AT5G58970 AT4G21120

BP 6 71 Porphyrin-containing compound biosynthetic process

AT3G02780 AT3G59400 AT5G16440 AT1G10670 AT4G14690 AT3G22840

BP 6 74 Tetrapyrrole biosynthetic process

AT3G02780 AT3G59400 AT5G16440 AT1G10670 AT4G14690 AT3G22840

BP 6 75 Response to nematode AT1G59740 AT1G64780 AT1G76670 AT2G01340 AT4G17490 AT3G27400

BP 6 81 Response to high light intensity

AT2G32120 AT3G22840 AT4G14690 AT5G12030 AT3G15850 AT4G17490

BP 6 84 Nuclear-transcribed mRNA catabolic process

AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

BP 6 85 Pyrimidine-containing compound metabolic process

AT1G02880 AT2G44750 AT1G02390 AT3G11430 AT4G01950 AT5G06090

BP 6 86 Positive regulation of post-embryonic development

AT1G05010 AT1G10670 AT2G43820 AT2G46590 AT3G22840 AT4G14690

BP 5 14 Sulfate assimilation AT3G03900 AT3G22890 AT4G14680 AT4G04610 AT4G21990

193

BP 5 23 Positive regulation of seed germination

AT1G05010 AT2G43820 AT2G46590 AT3G22840 AT4G14690

BP 5 26 Positive regulation of small molecule metabolic process

AT1G16060 AT1G79700 AT3G28455 AT1G75500 AT2G46590

BP 5 29 Cysteine biosynthetic process AT4G39640 AT4G39650 AT3G03900 AT4G04610 AT4G21990

BP 5 38 Cysteine metabolic process AT4G39640 AT4G39650 AT3G03900 AT4G04610 AT4G21990

BP 5 41 Diterpenoid metabolic process AT4G25420 AT5G25900 AT5G51810 AT1G54570 AT2G46590

BP 5 51 Regulation of meristem growth AT4G26540 AT5G56040 AT3G15150 AT3G50310 AT4G28190

BP 5 54 Serine family amino acid biosynthetic process

AT4G39640 AT4G39650 AT3G03900 AT4G04610 AT4G21990

BP 5 54 Cellular polysaccharide catabolic process

AT3G23920 AT1G22880 AT1G64390 AT1G71380 AT1G43670

BP 5 55 Glucan catabolic process AT3G23920 AT1G22880 AT1G64390 AT1G71380 AT1G43670

BP 5 61 Regulation of unidimensional cell growth

AT1G31650 AT1G22130 AT1G77980 AT1G79620 AT5G13990

BP 4 15 Regulation of anthocyanin biosynthetic process

AT5G13930 AT1G56650 AT1G66370 AT1G66380

BP 4 17 CDP-diacylglycerol biosynthetic process

AT1G02390 AT3G11430 AT4G01950 AT5G06090

BP 4 17 CDP-diacylglycerol metabolic process

AT1G02390 AT3G11430 AT4G01950 AT5G06090

BP 4 22 Positive regulation of lipid biosynthetic process

AT1G16060 AT1G79700 AT3G28455 AT2G46590

BP 4 24 Oxylipin biosynthetic process AT1G76680 AT1G76690 AT3G15850 AT3G45140

BP 4 24 Positive regulation of lipid metabolic process

AT1G16060 AT1G79700 AT3G28455 AT2G46590

194

BP 4 25 Regulation of root meristem growth

AT4G26540 AT5G56040 AT3G15150 AT3G50310

BP 4 25 Oxylipin metabolic process AT1G76680 AT1G76690 AT3G15850 AT3G45140

BP 4 25 Regulation of anthocyanin metabolic process

AT5G13930 AT1G56650 AT1G66370 AT1G66380

BP 4 26 Regulation of flavonoid biosynthetic process

AT5G13930 AT1G56650 AT1G66370 AT1G66380

BP 4 32 Anthocyanin-containing compound biosynthetic process

AT5G13930 AT1G56650 AT1G66370 AT1G66380

BP 4 34 Gibberellin biosynthetic process

AT4G25420 AT5G25900 AT5G51810 AT2G46590

BP 4 34 Regulation of pollen tube growth

AT1G31650 AT1G22130 AT1G77980 AT5G13990

BP 4 36 Gibberellin metabolic process AT4G25420 AT5G25900 AT5G51810 AT2G46590

BP 4 37 Root meristem growth AT4G26540 AT5G56040 AT3G15150 AT3G50310

BP 4 37 Diterpenoid biosynthetic process

AT4G25420 AT5G25900 AT5G51810 AT2G46590

BP 4 38 Regulation of cell morphogenesis involved in differentiation

AT1G31650 AT1G22130 AT1G77980 AT5G13990

BP 4 38 Regulation of cell development AT1G31650 AT1G22130 AT1G77980 AT5G13990

BP 3 7 Preprophase band assembly AT3G05750 AT3G58650 AT5G26910

BP 3 7 Glycerol-3-phosphate metabolic process

AT1G80460 AT3G10370 AT5G40610

BP 3 7 Cellular response to sulfur starvation

AT3G49580 AT5G24660 AT5G48850

195

BP 3 7 Alditol phosphate metabolic process

AT1G80460 AT3G10370 AT5G40610

BP 3 8 Hydrogen sulfide biosynthetic process

AT3G03900 AT3G22890 AT4G14680

BP 3 9 Hydrogen sulfide metabolic process

AT3G03900 AT3G22890 AT4G14680

BP 3 12 L-amino acid transport AT4G21120 AT5G40670 AT5G46800

BP 3 12 Cellular response to red light AT2G46590 AT3G22840 AT4G14690

BP 3 13 Establishment of cell polarity AT3G05750 AT3G58650 AT5G26910

BP 3 13 UDP-galactose transmembrane transport

AT1G76670 AT1G21070 AT5G42420

BP 3 13 Tracheary element differentiation

AT2G40470 AT5G19530 AT5G25830

BP 3 17 Negative regulation of ethylene-activated signaling pathway

AT2G40940 AT3G15210 AT3G23150

BP 3 17 Negative regulation of phosphorelay signal transduction system

AT2G40940 AT3G15210 AT3G23150

BP 3 18 Thioester biosynthetic process AT1G10670 AT1G60810 AT5G35360

BP 3 18 Acyl-CoA biosynthetic process AT1G10670 AT1G60810 AT5G35360

BP 3 19 Establishment or maintenance of cell polarity

AT3G05750 AT3G58650 AT5G26910

BP 3 20 Cellular response to UV AT2G42690 AT3G22840 AT4G14690

BP 3 21 Toxin biosynthetic process AT3G03900 AT3G22890 AT4G14680

196

BP 3 21 Negative regulation of intracellular signal transduction

AT2G40940 AT3G15210 AT3G23150

BP 2 2 Adenosine salvage AT3G09820 AT5G03300

BP 2 2 Adenosine biosynthetic process

AT3G09820 AT5G03300

BP 2 3 Methylammonium transport AT3G16240 AT1G64780

BP 2 3 Benzoate metabolic process AT2G43820 AT2G43840

BP 2 3 Sulfate reduction AT4G04610 AT4G21990

BP 2 3 Dimethylallyl diphosphate biosynthetic process

AT3G02780 AT5G16440

BP 2 3 Dimethylallyl diphosphate metabolic process

AT3G02780 AT5G16440

BP 2 4 Selenium compound metabolic process

AT3G01120 AT3G22890

BP 2 4 Response to UV-A AT3G22840 AT4G14690

BP 2 4 Cellular response to UV-A AT3G22840 AT4G14690

BP 2 4 Positive regulation of cutin biosynthetic process

AT1G16060 AT1G79700

BP 2 5 NADH oxidation AT5G40610 AT3G10370

BP 2 5 Adenosine metabolic process AT3G09820 AT5G03300

BP 2 5 Glycerol-3-phosphate catabolic process

AT3G10370 AT5G40610

BP 2 5 Actin filament network formation

AT4G26700 AT5G55400

197

BP 2 6 Alditol catabolic process AT1G80460 AT3G10370

BP 2 6 Glycine decarboxylation via glycine cleavage system

AT2G26080 AT4G33010

BP 2 6 Glycerol catabolic process AT1G80460 AT3G10370

BP 2 6 Positive regulation of fatty acid biosynthetic process

AT1G16060 AT1G79700

BP 2 6 Cellular response to high light intensity

AT3G22840 AT4G14690

BP 2 7 Nuclear-transcribed mRNA poly(A) tail shortening

AT3G44260 AT5G22250

BP 2 7 Aspartate metabolic process AT5G50210 AT2G30970

Process Genes in

list Total genes

Functional Category AT Genes

CC 6 18 CCR4-NOT core complex AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

CC 21 321 Anchored component of membrane

AT1G64640 AT1G64760 AT2G19440 AT3G01070 AT3G11660 AT3G52470 AT3G53330 AT4G01380 AT4G12880 AT5G07475 AT5G15350 AT3G43720 AT4G26320 AT5G56540 AT1G02405 AT1G07460 AT1G23040 AT1G62790 AT1G70990 AT3G22600 AT5G04310

CC 120 3832 Cell periphery

AT1G07460 AT1G11280 AT1G11300 AT1G51500 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G64640 AT1G64760 AT1G64780 AT1G66950 AT1G70520 AT1G71695 AT1G75500 AT2G01340 AT2G15760 AT2G18260 AT2G19440 AT2G25790 AT2G36380 AT2G39040 AT3G01070 AT3G10960 AT3G11660 AT3G21090 AT3G52470 AT3G53330 AT4G01380 AT4G10770 AT4G12880 AT4G18780 AT4G24120 AT4G26540 AT5G07475 AT5G15350 AT5G16000

198

AT5G20480 AT5G20630 AT5G23400 AT5G49730 AT5G49740 AT1G01300 AT1G02500 AT1G02930 AT1G09750 AT1G19110 AT1G20823 AT1G21460 AT1G22880 AT1G24530 AT1G48100 AT1G59740 AT1G60870 AT1G68560 AT1G71380 AT1G78300 AT2G02930 AT2G19810 AT2G22420 AT2G28950 AT2G38940 AT2G40890 AT2G45820 AT2G46150 AT3G05200 AT3G05640 AT3G09820 AT3G13790 AT3G16060 AT3G16240 AT3G22890 AT3G28180 AT3G43720 AT3G52710 AT3G54700 AT3G58650 AT4G02520 AT4G08520 AT4G09000 AT4G10380 AT4G21120 AT4G22790 AT4G29190 AT4G39640 AT4G39650 AT4G39955 AT5G03300 AT5G13170 AT5G27930 AT5G58970 AT5G63530 AT1G26770 AT1G31650 AT1G45616 AT1G47890 AT1G53210 AT1G61460 AT2G02220 AT2G03090 AT2G24610 AT2G40610 AT3G01840 AT3G02885 AT3G26980 AT3G42800 AT3G47110 AT4G03210 AT4G26320 AT5G13990 AT5G52340 AT5G56540

CC 102 3155 Plasma membrane

AT1G07460 AT1G11280 AT1G11300 AT1G51500 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G64640 AT1G64760 AT1G64780 AT1G66950 AT1G70520 AT1G75500 AT2G01340 AT2G15760 AT2G18260 AT2G19440 AT2G25790 AT2G36380 AT3G01070 AT3G10960 AT3G11660 AT3G21090 AT3G52470 AT3G53330 AT4G01380 AT4G10770 AT4G12880 AT4G18780 AT4G24120 AT4G26540 AT5G07475 AT5G15350 AT5G16000 AT5G20480 AT5G23400 AT5G49730 AT5G49740 AT1G02500 AT1G19110 AT1G20823 AT1G21460 AT1G22880 AT1G24530 AT1G59740 AT1G60870 AT1G71380 AT1G78300 AT2G02930 AT2G19810 AT2G38940 AT2G40890 AT2G45820 AT2G46150 AT3G05200 AT3G05640 AT3G09820 AT3G13790 AT3G16060 AT3G16240 AT3G22890 AT3G28180 AT3G43720 AT3G52710 AT3G54700 AT3G58650 AT4G02520 AT4G08520 AT4G09000 AT4G10380 AT4G21120 AT4G22790 AT4G29190 AT4G39650 AT4G39955 AT5G03300 AT5G13170 AT5G27930 AT5G58970 AT5G63530 AT1G31650 AT1G45616 AT1G47890 AT1G53210 AT1G61460 AT2G02220 AT2G24610 AT3G01840 AT3G26980 AT3G42800 AT3G47110 AT4G26320 AT5G56540

CC 6 26 CCR4-NOT complex AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

199

CC 12 172 Anchored component of plasma membrane AT1G64640 AT1G64760 AT2G19440 AT3G01070 AT3G11660 AT3G52470 AT3G53330 AT4G01380 AT4G12880 AT5G07475 AT5G15350 AT3G43720

CC 2 2 Mitochondrial respiratory chain supercomplex AT3G05550 AT5G27760

CC 6 62 P-body AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

CC 16 339 Intrinsic component of plasma membrane

AT1G64640 AT1G64760 AT1G64780 AT2G19440 AT3G01070 AT3G11660 AT3G52470 AT3G53330 AT4G01380 AT4G10770 AT4G12880 AT5G07475 AT5G15350 AT1G21460 AT3G43720 AT5G13170

Process Genes in

list Total genes

Functional Category AT Genes

MF 148 4302 Transferase activity

AT1G02390 AT1G02500 AT1G02880 AT1G02920 AT1G02930 AT1G05280 AT1G07460 AT1G10360 AT1G10370 AT1G10670 AT1G11280 AT1G11300 AT1G30530 AT1G60810 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G70520 AT1G80460 AT2G02930 AT2G19670 AT2G25790 AT2G30970 AT2G37730 AT2G43820 AT2G43840 AT2G44750 AT2G45830 AT3G03900 AT3G09820 AT3G11430 AT3G21750 AT3G21760 AT3G21780 AT3G21790 AT3G21800 AT3G22890 AT3G25900 AT3G46620 AT3G50080 AT3G50310 AT3G55700 AT3G55710 AT3G61270 AT4G01730 AT4G01950 AT4G02520 AT4G14680 AT4G15260 AT4G15280 AT4G18780 AT4G19880 AT4G26540 AT4G29510 AT4G36950 AT4G39640 AT4G39650 AT5G03300 AT5G06090 AT5G16000 AT5G17030 AT5G17040 AT5G17050 AT5G19530 AT5G20480 AT5G23400 AT5G41430 AT5G45020 AT5G50210 AT5G57850 AT5G58350 AT5G59550 AT5G67080 AT5G67250 AT1G10560 AT1G20330 AT1G20823 AT1G29340 AT1G48600 AT1G54570 AT1G79620 AT2G02220 AT3G01120 AT3G05200 AT3G15150 AT5G22740 AT5G27420 AT5G38280 AT5G41040 AT1G04920 AT1G23360 AT1G31490 AT1G34040

200

AT1G34060 AT1G60190 AT1G61460 AT1G64780 AT1G66160 AT1G70250 AT1G76410 AT2G28840 AT2G35710 AT2G40940 AT2G47010 AT3G01840 AT3G08900 AT3G15095 AT3G16720 AT3G18000 AT3G23150 AT3G28180 AT3G46920 AT3G47110 AT3G48180 AT3G50270 AT3G50280 AT3G50300 AT3G58790 AT4G03210 AT4G16600 AT4G18250 AT5G01710 AT5G01820 AT5G02780 AT5G02790 AT5G04500 AT5G12970 AT5G13930 AT5G37490 AT5G38130 AT5G44820 AT5G45660 AT5G56040 AT5G57500 AT5G60700 AT5G67150 AT5G67160 AT5G67390 ATMG00300

MF 10 59 Glutathione transferase activity AT1G02920 AT1G02930 AT1G10360 AT1G10370 AT2G02930 AT4G02520 AT4G19880 AT5G45020 AT5G02780 AT5G02790

MF 6 19 Poly(A)-specific ribonuclease activity AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

MF 18 222 Calmodulin binding AT1G26700 AT2G24610 AT5G53760 AT1G11280 AT1G11300 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61460 AT1G61480 AT1G61490 AT1G61500 AT1G61550

MF 14 153 Transferase activity, transferring alkyl or aryl (other than methyl) groups

AT1G02500 AT1G02920 AT1G02930 AT1G10360 AT1G10370 AT2G02930 AT4G02520 AT4G19880 AT5G19530 AT5G45020 AT5G50210 AT3G01120 AT5G02780 AT5G02790

MF 4 8 Glycerol-3-phosphate O-acyltransferase activity

AT1G02390 AT3G11430 AT4G01950 AT5G06090

MF 20 312 UDP-glycosyltransferase activity

AT1G05280 AT1G30530 AT2G37730 AT2G43820 AT2G43840 AT3G21750 AT3G21760 AT3G21780 AT3G21790 AT3G21800 AT3G55700 AT3G55710 AT4G15260 AT4G15280 AT5G17030 AT5G17040 AT5G17050 AT1G04920 AT3G58790 AT4G18780

MF 25 445 Transferase activity, transferring hexosyl groups

AT1G05280 AT1G30530 AT2G37730 AT2G43820 AT2G43840 AT2G45830 AT3G55700 AT3G55710 AT3G61270 AT4G18780 AT5G17030 AT5G17040 AT5G17050 AT3G21750 AT3G21800 AT4G15280 AT5G22740 AT1G04920 AT3G21760 AT3G21780 AT3G21790 AT3G58790 AT4G03210 AT4G15260 AT5G57500

MF 11 101 Quercetin 3-O-glucosyltransferase activity AT1G30530 AT2G43820 AT2G43840 AT3G55700 AT3G55710 AT5G17030 AT5G17040 AT5G17050 AT3G21750 AT3G21800 AT4G15280

MF 4 8 Sn-1-glycerol-3-phosphate C16:0-DCA-CoA acyl transferase activity

AT1G02390 AT3G11430 AT4G01950 AT5G06090

MF 7 39 Oxidoreductase activity, acting on the CH-NH2 group of donors

AT1G31690 AT1G31710 AT2G26080 AT4G33010 AT1G05010 AT1G31490 AT1G31670

MF 31 640 Transferase activity, transferring glycosyl groups

AT1G05280 AT1G30530 AT2G37730 AT2G43820 AT2G43840 AT2G45830 AT3G21750 AT3G21760 AT3G21780 AT3G21790 AT3G21800 AT3G55700 AT3G55710 AT3G61270 AT4G15260 AT4G15280 AT4G18780 AT5G17030

201

AT5G17040 AT5G17050 AT5G22740 AT1G04920 AT2G35710 AT3G28180 AT3G58790 AT4G03210 AT4G16600 AT5G04500 AT5G12970 AT5G45660 AT5G57500

MF 22 374 Carbohydrate binding

AT1G05010 AT1G07460 AT1G11280 AT1G11300 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61460 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G64390 AT1G68560 AT5G53110 AT1G12710 AT1G63090

MF 114 3679 Cation binding

AT1G05010 AT1G31690 AT1G31710 AT2G15680 AT2G26080 AT3G15353 AT3G17790 AT4G33010 AT1G02920 AT1G02930 AT1G53210 AT2G01520 AT2G01530 AT2G30970 AT3G09820 AT4G23670 AT5G02600 AT5G03300 AT5G63530 AT1G02500 AT1G11925 AT1G20823 AT1G21340 AT1G22160 AT1G27820 AT1G27890 AT1G31490 AT1G31670 AT1G33720 AT1G33730 AT1G43670 AT1G47380 AT1G61470 AT1G71695 AT1G76410 AT1G78020 AT2G18350 AT2G19810 AT2G22420 AT2G26580 AT2G26695 AT2G28840 AT2G35710 AT2G39040 AT2G40890 AT2G40940 AT2G45550 AT2G45560 AT2G45570 AT2G45580 AT2G46210 AT2G46590 AT2G46660 AT3G02780 AT3G05200 AT3G05640 AT3G07130 AT3G10150 AT3G15150 AT3G16720 AT3G23150 AT3G25855 AT3G25900 AT3G27400 AT3G44240 AT3G44260 AT3G45140 AT3G46620 AT3G55350 AT3G61040 AT3G61580 AT3G61850 AT3G61880 AT4G04610 AT4G05020 AT4G16600 AT4G17280 AT4G18780 AT4G20990 AT4G21000 AT4G21490 AT4G21990 AT4G25420 AT4G26700 AT4G29190 AT4G39795 AT5G04310 AT5G04500 AT5G06720 AT5G06730 AT5G07990 AT5G16440 AT5G20630 AT5G22250 AT5G23960 AT5G25830 AT5G25900 AT5G27420 AT5G27930 AT5G35360 AT5G39890 AT5G43270 AT5G47530 AT5G48100 AT5G49730 AT5G49740 AT5G50210 AT5G51810 AT5G54390 AT5G55400 AT5G57520 AT5G59220 AT5G59550 ATMG00300

MF 16 216 Glucosyltransferase activity AT1G30530 AT2G43820 AT2G43840 AT2G45830 AT3G55700 AT3G55710 AT3G61270 AT4G18780 AT5G17030 AT5G17040 AT5G17050 AT3G21750 AT3G21800 AT4G15280 AT1G04920 AT4G03210

MF 4 9 Glycerol-3-phosphate 2-O-acyltransferase activity

AT1G02390 AT3G11430 AT4G01950 AT5G06090

MF 15 201 Copper ion binding AT1G05010 AT1G31690 AT1G31710 AT3G15353 AT1G02920 AT1G02930 AT2G01520 AT2G01530 AT2G30970 AT3G09820 AT4G23670 AT5G03300 AT1G31490 AT1G31670 AT5G48100

MF 6 31 3 -5 -exoribonuclease activity AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

MF 112 3664 Metal ion binding AT1G05010 AT1G31690 AT1G31710 AT2G15680 AT3G15353 AT3G17790 AT1G02920 AT1G02930 AT1G53210 AT2G01520 AT2G01530 AT2G30970 AT3G09820 AT4G23670 AT5G02600 AT5G03300 AT5G63530 AT1G02500

202

AT1G11925 AT1G20823 AT1G21340 AT1G22160 AT1G27820 AT1G27890 AT1G31490 AT1G31670 AT1G33720 AT1G33730 AT1G43670 AT1G47380 AT1G61470 AT1G71695 AT1G76410 AT1G78020 AT2G18350 AT2G19810 AT2G22420 AT2G26580 AT2G26695 AT2G28840 AT2G35710 AT2G39040 AT2G40890 AT2G40940 AT2G45550 AT2G45560 AT2G45570 AT2G45580 AT2G46210 AT2G46590 AT2G46660 AT3G02780 AT3G05200 AT3G05640 AT3G07130 AT3G10150 AT3G15150 AT3G16720 AT3G23150 AT3G25855 AT3G25900 AT3G27400 AT3G44240 AT3G44260 AT3G45140 AT3G46620 AT3G55350 AT3G61040 AT3G61580 AT3G61850 AT3G61880 AT4G04610 AT4G05020 AT4G16600 AT4G17280 AT4G18780 AT4G20990 AT4G21000 AT4G21490 AT4G21990 AT4G25420 AT4G26700 AT4G29190 AT4G39795 AT5G04310 AT5G04500 AT5G06720 AT5G06730 AT5G07990 AT5G16440 AT5G20630 AT5G22250 AT5G23960 AT5G25830 AT5G25900 AT5G27420 AT5G27930 AT5G35360 AT5G39890 AT5G43270 AT5G47530 AT5G48100 AT5G49730 AT5G49740 AT5G50210 AT5G51810 AT5G54390 AT5G55400 AT5G57520 AT5G59220 AT5G59550 ATMG00300

MF 13 170 UDP-glucosyltransferase activity AT1G30530 AT2G43820 AT2G43840 AT3G55700 AT3G55710 AT5G17030 AT5G17040 AT5G17050 AT3G21750 AT3G21800 AT4G15280 AT1G04920 AT4G18780

MF 6 35 Exoribonuclease activity AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

MF 6 35 Exoribonuclease activity, producing 5 -phosphomonoesters

AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

MF 59 1664 Oxidoreductase activity

AT1G05010 AT1G23800 AT1G31690 AT1G31710 AT1G33730 AT1G59950 AT1G59960 AT1G71695 AT1G76680 AT1G76690 AT2G24580 AT2G26080 AT2G39040 AT2G40890 AT2G45550 AT2G45560 AT2G45570 AT2G45580 AT2G46660 AT3G10370 AT3G15850 AT3G61040 AT3G61880 AT4G25420 AT4G33010 AT5G07990 AT5G25900 AT5G40610 AT5G48100 AT5G49740 AT5G51810 AT2G22420 AT3G45140 AT3G61580 AT4G04610 AT4G21990 AT4G39230 AT5G49730 AT1G31490 AT1G31670 AT1G33720 AT1G64640 AT1G75450 AT2G46210 AT3G01070 AT3G02000 AT3G17790 AT3G53330 AT4G01380 AT4G02520 AT4G05020 AT4G12880 AT4G21490 AT5G06720 AT5G06730 AT5G07475 AT5G14070 AT5G15350 AT5G39890

MF 6 39 Sulfur compound binding AT1G02920 AT1G02930 AT2G02930 AT4G02520 AT1G02880 AT2G44750

MF 4 14 Primary amine oxidase activity AT1G31690 AT1G31710 AT1G31490 AT1G31670

203

MF 2 2 Adenosine kinase activity AT3G09820 AT5G03300

MF 2 2 Glycine dehydrogenase (decarboxylating) activity

AT2G26080 AT4G33010

MF 2 2 Isopentenyl-diphosphate delta-isomerase activity

AT3G02780 AT5G16440

MF 2 2 Thiamine diphosphokinase activity AT1G02880 AT2G44750

MF 2 2 Glycine binding AT2G26080 AT4G33010

MF 5 29 Oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor

AT1G31690 AT1G31710 AT1G05010 AT1G31490 AT1G31670

MF 2 2 Oxidoreductase activity, acting on the CH-NH2 group of donors, disulfide as acceptor

AT2G26080 AT4G33010

MF 2 2 Thiamine binding AT1G02880 AT2G44750

MF 2 2 Neurotransmitter binding AT2G26080 AT4G33010

MF 2 2 Sphingolipid delta-8 desaturase activity AT3G61580 AT2G46210

MF 2 2 Benzoic acid glucosyltransferase activity AT2G43820 AT2G43840

MF 4 16 Methyl salicylate esterase activity AT2G23590 AT2G23600 AT2G23610 AT2G23620

MF 4 17 Methyl jasmonate esterase activity AT2G23590 AT2G23600 AT2G23610 AT2G23620

MF 2 2 Flavonoid binding AT1G02930 AT4G02520

MF 2 2 Camalexin binding AT1G02930 AT4G02520

MF 2 2 Quercitrin binding AT1G02930 AT4G02520

204

MF 3 8 Adenylylsulfate kinase activity AT3G03900 AT3G22890 AT4G14680

MF 7 68 Amino acid transmembrane transporter activity

AT2G40420 AT3G56200 AT4G21120 AT5G16740 AT5G40670 AT5G46800 AT5G58970

MF 4 19 Glutathione binding AT1G02920 AT1G02930 AT2G02930 AT4G02520

MF 4 19 Oligopeptide binding AT1G02920 AT1G02930 AT2G02930 AT4G02520

MF 5 36 Methyl indole-3-acetate esterase activity AT2G23590 AT2G23600 AT2G23610 AT2G23620 AT5G14930

MF 7 74 Polygalacturonase activity AT1G10640 AT1G48100 AT1G60590 AT2G43870 AT3G59850 AT2G23900 AT3G48950

MF 8 96 Quercetin 7-O-glucosyltransferase activity AT1G30530 AT2G43820 AT2G43840 AT3G55700 AT3G55710 AT5G17030 AT5G17040 AT5G17050

MF 2 3 Phosphoethanolamine N-methyltransferase activity

AT1G48600 AT3G18000

MF 2 3 Adenylyl-sulfate reductase activity AT4G04610 AT4G21990

MF 2 3 12-oxophytodienoate reductase activity AT1G76680 AT1G76690

MF 20 436 Transferase activity, transferring acyl groups

AT1G02390 AT1G10670 AT1G60810 AT3G11430 AT4G01730 AT4G01950 AT4G39640 AT4G39650 AT5G06090 AT1G54570 AT5G41040 AT1G31490 AT1G80460 AT3G50270 AT3G50280 AT3G50300 AT5G13930 AT5G38130 AT5G67150 AT5G67160

MF 2 3 Adenylyl-sulfate reductase (glutathione) activity

AT4G04610 AT4G21990

MF 2 3 Salicylic acid glucosyltransferase (glucoside-forming) activity

AT2G43820 AT2G43840

MF 2 3 UDP-glucose:4-aminobenzoate acylglucosyltransferase activity

AT2G43820 AT2G43840

MF 2 3 Hypoglycin A gamma-glutamyl transpeptidase activity

AT4G39640 AT4G39650

205

MF 2 3 Leukotriene C4 gamma-glutamyl transferase activity

AT4G39640 AT4G39650

MF 45 1334 Phosphotransferase activity, alcohol group as acceptor

AT1G07460 AT1G11280 AT1G11300 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G70520 AT1G80460 AT2G25790 AT3G03900 AT3G09820 AT3G22890 AT3G50310 AT4G14680 AT4G26540 AT4G36950 AT5G03300 AT5G16000 AT5G20480 AT5G23400 AT5G58350 AT5G67080 AT1G79620 AT2G02220 AT5G38280 AT1G61460 AT1G70250 AT2G40940 AT3G01120 AT3G01840 AT3G23150 AT3G46920 AT3G47110 AT4G18250 AT5G01820 AT5G56040

MF 6 62 Exonuclease activity, active with either ribo- or deoxyribonucleic acids and producing 5 -phosphomonoesters

AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

MF 3 13 UDP-galactose transmembrane transporter activity

AT1G21070 AT1G76670 AT5G42420

MF 2 4 Peptidyltransferase activity AT4G39640 AT4G39650

MF 2 4 Sulfate adenylyltransferase (ATP) activity AT3G22890 AT4G14680

MF 2 4 Glutathione hydrolase activity AT4G39640 AT4G39650

MF 8 112 Organic acid transmembrane transporter activity

AT2G40420 AT3G56200 AT4G21120 AT5G16740 AT5G40670 AT5G46800 AT5G58970 AT1G80460

MF 8 112 Carboxylic acid transmembrane transporter activity

AT2G40420 AT3G56200 AT4G21120 AT5G16740 AT5G40670 AT5G46800 AT5G58970 AT1G80460

MF 18 410 Hydrolase activity, hydrolyzing O-glycosyl compounds

AT1G10640 AT1G48100 AT1G60590 AT2G43870 AT3G59850 AT5G24090 AT1G68560 AT3G23920 AT1G22880 AT1G64390 AT1G64760 AT1G71380 AT2G19440 AT2G23900 AT3G01120 AT3G13790 AT3G48950 AT4G03210

MF 2 5 ATP citrate synthase activity AT1G10670 AT1G60810

MF 2 5 Glycerol-3-phosphate dehydrogenase [NAD+] activity

AT3G10370 AT5G40610

MF 2 5 Sulfate adenylyltransferase activity AT3G22890 AT4G14680

206

MF 6 71 3 -5 exonuclease activity AT1G27820 AT1G27890 AT1G61470 AT3G44240 AT3G44260 AT5G22250

MF 49 1548 Kinase activity

AT1G07460 AT1G11280 AT1G11300 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G70520 AT1G80460 AT2G25790 AT3G03900 AT3G09820 AT3G22890 AT3G50310 AT4G14680 AT4G26540 AT4G36950 AT5G03300 AT5G16000 AT5G20480 AT5G23400 AT5G58350 AT5G67080 AT1G79620 AT2G02220 AT5G38280 AT1G02880 AT1G61460 AT1G70250 AT2G40940 AT2G44750 AT2G47010 AT3G01120 AT3G01840 AT3G15095 AT3G23150 AT3G46920 AT3G47110 AT4G18250 AT5G01820 AT5G56040

MF 11 201

Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen

AT1G33730 AT2G40890 AT2G45550 AT2G45560 AT2G45570 AT2G45580 AT2G46660 AT3G61040 AT3G61880 AT5G07990 AT5G25900

MF 2 5 Glutathione gamma-glutamylcysteinyltransferase activity

AT4G39640 AT4G39650

MF 19 451 Hydrolase activity, acting on glycosyl bonds

AT1G10640 AT1G48100 AT1G60590 AT2G43870 AT3G59850 AT4G35190 AT5G24090 AT1G68560 AT3G23920 AT1G22880 AT1G64390 AT1G64760 AT1G71380 AT2G19440 AT2G23900 AT3G01120 AT3G13790 AT3G48950 AT4G03210

MF 2 5 Ethylene receptor activity AT2G40940 AT3G23150

MF 2 5 Gibberellin 20-oxidase activity AT4G25420 AT5G51810

MF 2 5 Ethylene binding AT2G40940 AT3G23150

MF 2 5 Alkene binding AT2G40940 AT3G23150

MF 17 389 Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen

AT1G33730 AT2G40890 AT2G45550 AT2G45560 AT2G45570 AT2G45580 AT2G46660 AT3G15850 AT3G61040 AT3G61880 AT4G25420 AT5G07990 AT5G25900 AT5G51810 AT3G61580 AT1G33720 AT2G46210

MF 38 1137 Cofactor binding

AT1G02920 AT1G02930 AT2G02930 AT2G26080 AT4G02520 AT4G33010 AT5G50210 AT1G76680 AT3G01120 AT1G05010 AT1G31490 AT1G31670 AT1G31690 AT1G31710 AT1G33720 AT1G33730 AT1G71695 AT1G75450 AT1G76690 AT1G80460 AT2G22420 AT2G30970 AT2G39040 AT2G40890 AT2G45550 AT2G45560 AT2G45570 AT2G45580 AT2G46660 AT3G61040

207

AT3G61880 AT4G04610 AT4G21990 AT5G06720 AT5G06730 AT5G07990 AT5G25900 AT5G40610

MF 4 32 Modified amino acid binding AT1G02920 AT1G02930 AT2G02930 AT4G02520

MF 32 916 Protein serine/threonine kinase activity

AT1G07460 AT1G11280 AT1G11300 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G70520 AT3G50310 AT4G36950 AT5G16000 AT5G58350 AT5G67080 AT2G02220 AT1G61460 AT1G79620 AT2G40940 AT3G23150 AT3G47110 AT4G26540 AT5G01820 AT5G20480 AT5G38280 AT5G56040

MF 39 1179 Protein kinase activity

AT1G07460 AT1G11280 AT1G11300 AT1G61360 AT1G61370 AT1G61380 AT1G61390 AT1G61400 AT1G61420 AT1G61430 AT1G61440 AT1G61480 AT1G61490 AT1G61500 AT1G61550 AT1G70520 AT2G25790 AT3G50310 AT4G26540 AT4G36950 AT5G16000 AT5G20480 AT5G23400 AT5G58350 AT5G67080 AT1G79620 AT2G02220 AT5G38280 AT1G61460 AT1G70250 AT2G40940 AT3G01120 AT3G01840 AT3G23150 AT3G46920 AT3G47110 AT4G18250 AT5G01820 AT5G56040

MF 17 394 Heme binding AT1G33720 AT1G33730 AT1G71695 AT2G22420 AT2G39040 AT2G40890 AT2G45550 AT2G45560 AT2G45570 AT2G45580 AT2G46660 AT3G61040 AT3G61880 AT5G06720 AT5G06730 AT5G07990 AT5G25900

MF 18 430 Tetrapyrrole binding AT3G59400 AT1G33720 AT1G33730 AT1G71695 AT2G22420 AT2G39040 AT2G40890 AT2G45550 AT2G45560 AT2G45570 AT2G45580 AT2G46660 AT3G61040 AT3G61880 AT5G06720 AT5G06730 AT5G07990 AT5G25900

MF 19 465 Lyase activity

AT2G02220 AT5G23960 AT1G10640 AT1G10670 AT1G11925 AT1G34040 AT1G34060 AT1G60590 AT2G23600 AT2G23900 AT2G43870 AT3G27400 AT3G48950 AT3G59850 AT4G20990 AT4G21000 AT5G04310 AT5G24850 AT5G57850

MF 9 155 Organic anion transmembrane transporter activity

AT2G40420 AT3G56200 AT4G21120 AT5G16740 AT5G40670 AT5G46800 AT1G76670 AT5G58970 AT1G80460

MF 3 18 L-amino acid transmembrane transporter activity

AT4G21120 AT5G40670 AT5G46800

MF 16 373 Transferase activity, transferring acyl groups other than amino-acyl groups

AT1G02390 AT3G11430 AT4G01730 AT4G01950 AT5G06090 AT1G54570 AT5G41040 AT1G31490 AT1G80460 AT3G50270 AT3G50280 AT3G50300 AT5G13930 AT5G38130 AT5G67150 AT5G67160

MF 4 37 Quinone binding AT1G31490 AT1G31670 AT1G31690 AT1G31710

MF 49 1636 DNA-binding transcription factor activity AT1G22130 AT1G30650 AT1G77980 AT2G22540 AT2G34830 AT3G18550 AT4G11660 AT1G79700 AT4G17490 AT1G01250 AT1G16060 AT1G19210

208

AT1G25560 AT1G53170 AT1G68840 AT1G74930 AT1G78700 AT1G80460 AT2G46270 AT3G01120 AT3G01470 AT3G15210 AT4G16780 AT5G06710 AT5G25830 AT5G47230 AT5G51190 AT1G21340 AT1G56650 AT1G66370 AT1G66380 AT1G66390 AT1G74500 AT1G75250 AT2G19810 AT2G21650 AT2G22750 AT2G26580 AT2G38090 AT2G46590 AT3G01600 AT3G61850 AT4G29190 AT4G37850 AT4G39250 AT5G14490 AT5G43270 AT5G57520 AT5G64530

MF 2 8 Ferric-chelate reductase activity AT5G49740 AT5G49730

MF 2 8 Oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor

AT5G49740 AT5G49730

MF 2 8 Protein-arginine omega-N asymmetric methyltransferase activity

AT2G19670 AT4G29510

MF 2 8 Quercetin 4 -O-glucosyltransferase activity AT2G43840 AT3G21800

MF 3 23 Phosphorelay sensor kinase activity AT2G40940 AT3G01120 AT3G23150

MF 3 24 Protein histidine kinase activity AT2G40940 AT3G01120 AT3G23150

MF 3 24 Phosphotransferase activity, nitrogenous group as acceptor

AT2G40940 AT3G01120 AT3G23150

MF 2 9 Histone-arginine N-methyltransferase activity

AT2G19670 AT4G29510

MF 2 9 Intramolecular oxidoreductase activity, transposing C=C bonds

AT3G02780 AT5G16440

MF 14 341 Phosphatase activity AT1G02390 AT1G43670 AT1G47380 AT3G05640 AT3G11430 AT3G17790 AT4G01950 AT5G06090 AT5G27930 AT5G54390 AT5G59220 AT3G07130 AT2G38600 AT3G10150

* A total of 231 BP, 9 CC and 101 MF enriched functional categories were identified at FDR, p < 0.05.

209

Appendix A6: Detail information of the differentially expressed genes related to various phytohormones

Hormone Malus domestica gene ID

Corresponding Arabidopsis thaliana ortholog/s

Gene > Defline Gene > Length

Gene > Chromosome

. Primary Identifier

ETHYLENE

MD02G1096500 AT1G19210 AP2 domain/ETHYLENE-RESPONSIVE TRANSCRIPTION FACTOR ERF017 708 Chr02

MD03G1231800 AT1G53170 AP2 domain/ETHYLENE-RESPONSIVE TRANSCRIPTION FACTOR ERF8 693 Chr03

MD03G1292200 AT2G40940 TWO-COMPONENT SENSOR HISTIDINE KINASE // ETHYLENE RESPONSE SENSOR 1 3380 Chr03

MD04G1058200 AT4G17490 AP2 domain/EREBP-LIKE FACTOR 6 (EREBP6) 7541 Chr04

MD06G1051900 AT5G47230 AP2 domain (AP2)//ETHYLENE-RESPONSIVE TRANSCRIPTION FACTOR ERF5 999 Chr06

MD07G1151700 AT1G01250 AP2 domain/ETHYLENE-RESPONSIVE TRANSCRIPTION FACTOR ERF023 567 Chr07

MD07G1248600 AT5G51190 AP2 domain/EREBP-LIKE FACTOR 105 (EREBP105) 945 Chr07

MD09G1114800 AT1G05010 1-AMINOCYCLOPROPANE-1-CARBOXYLATE OXIDASE 3 1756 Chr09

MD10G1248100 AT4G20880 ETHYLENE-REGULATED NUCLEAR PROTEIN ERT2-LIKE PROTEIN-RELATED 1500 Chr10

MD12G1028500 AT1G03400 1-AMINOCYCLOPROPANE-1-CARBOXYLATE OXIDASE 4-RELATED 2133 Chr12

MD13G1141700 AT1G02500 S-ADENOSYLMETHIONINE SYNTHASE 2 (SAM2) 2308 Chr13

MD13G1209700 AT3G23150 ETHYLENE RECEPTOR 2-LIKE (ETR2) 4595 Chr13

MD15G1221100 AT1G19210 AP2 domain/ETHYLENE-RESPONSIVE TRANSCRIPTION FACTOR ERF017 714 Chr15

210

Malus domestica gene ID

Corresponding Arabidopsis thaliana ortholog/s

Gene > Defline Gene > Length

Gene > Chromosome

. Primary Identifier

MD16G1047700 AT1G25560, AT1G68840

RAV-like factor (RAV)//AP2/ERF AND B3 DOMAIN CONTAINING TRANSCRIPTION FACTOR RAV1 1209 Chr16

MD17G1106300 AT1G05010 1-AMINOCYCLOPROPANE-1-CARBOXYLATE OXIDASE 4 1725 Chr17

MD17G1261000

AT1G56650, AT1G66370, AT1G66380, AT1G66390 TRANSCRIPTION FACTOR MYB113-RELATED 2991 Chr17

ABA

MD03G1034900 AT4G17190 FARNESYL DIPHOSPHATE SYNTHASE (FDPS) 5646 Chr03

MD03G1172200 AT1G51500, AT3G21090 ATP-BINDING CASSETTE TRANSPORTER G 12-LIKE 4652 Chr03

MD04G1197100 AT3G05640 PROTEIN PHOSPHATASE 2C 34-RELATED 3833 Chr04

MD05G1170300 AT1G69260 NINJA-FAMILY PROTEIN AFP1-RELATED 1493 Chr05

MD06G1177100 AT1G10560 U-BOX DOMAIN-CONTAINING PROTEIN 18-RELATED 2064 Chr06

MD07G1291000 AT5G27930 PROTEIN PHOSPHATASE 2C 73 2397 Chr07

MD10G1029100 AT5G59550 ABA/WDS induced protein (ABA_WDS) 961 Chr10

MD11G1096200 AT3G46620 E3 UBIQUITIN-PROTEIN LIGASE RDUF1-like 1139 Chr11

MD12G1146500 AT1G07460 L-TYPE LECTIN-DOMAIN CONTAINING RECEPTOR KINASE IV.1-RELATED 828 Chr12

MD14G1126900 AT1G32640 Transcription factor HAND2/Transcription factor TAL1/TAL2/LYL1 2463 Chr14

MD16G1160000 AT1G24020 MAJOR ALLERGEN Mal d 1 2763 Chr16

MD16G1160100 AT1G24020 MAJOR ALLERGEN Mal d 1.03G 480 Chr16

MD16G1160300 AT1G24020 MAJOR ALLERGEN Mal d 1.03G 835 Chr16

MD16G1160400 AT1G24020 MAJOR ALLERGEN Mal d 1-like 1142 Chr16

MD16G1160500 AT1G24020 MAJOR ALLERGEN Mal d 1.06A 861 Chr16

MD17G1044000 AT3G28455 CLAVATA3/ESR (CLE)-RELATED PROTEIN 25 1942 Chr17

GA MD02G1198000 AT4G25420, AT5G51810 GIBBERELLIN-20 OXIDASE-RELATED 1753 Chr02

MD03G1273300 AT3G63010 GIBBERELLIN RECEPTOR GID1B 2486 Chr03

211

Malus domestica gene ID

Corresponding Arabidopsis thaliana ortholog/s

Gene > Defline Gene > Length

Gene > Chromosome

. Primary Identifier

MD07G1153300 AT2G46590 Dof DOMAIN, ZINC FINGER(zf-Dof) 1303 Chr07

MD09G1263900 AT3G02885 EXTENSIN, PROLINE-RICH PROTEIN // GIBBERELLIN-REGULATED PROTEIN 12-RELATED 1142 Chr09

MD15G1034400 AT5G25900 ENT-KAURENE OXIDASE 3755 Chr15

AUXIN

MD02G1086600 AT3G42800 Protein BIG GRAIN 1-like C 1197 Chr02

MD05G1359500 AT3G07390 AUXIN-INDUCED IN ROOT CULTURES PROTEIN 12 3102 Chr05

MD08G1022400 AT1G75500 PROTEIN WALLS ARE THIN 1 3631 Chr08

MD08G1070200 AT5G19530 THERMOSPERMINE SYNTHASE (ACL5) 3831 Chr08

MD10G1035800 AT1G34040, AT1G34060

SUBGROUP I AMINOTRANSFERASE RELATED // TRYPTOPHAN AMINOTRANSFERASE-RELATED PROTEIN 3-RELATED 3061 Chr10

MD13G1285100 AT5G13930 NARINGENIN-CHALCONE SYNTHASE 2603 Chr13

MD16G1198700 AT3G22810, AT4G14740 GENOMIC DNA, CHROMOSOME 3, P1 CLONE: MWI23-RELATED 3724 Chr16

MD17G1261000 AT1G56650 TRANSCRIPTION FACTOR MYB113-RELATED 2991 Chr17

MD14G1210700 AT5G07990 FLAVONOID 3'-MONOOYGENASE (E1.14.13.21) 4031 Chr14

SA

MD02G1003300 AT2G43820 PATHOGEN-INDUCIBLE SALICYLIC ACID GLUCOSYLTRANSFERASE [EC:2.4.1.-] Glc b1-2 SA (SGT1) 2427 Chr02

MD02G1161600

AT2G23590, AT2G23600, AT2G23610, AT2G23620 SALICYLIC ACID-BINDING PROTEIN 2-LIKE 1268 Chr02

MD02G1175500

AT3G50270, AT3G50280, AT3G50300, AT5G38130, AT5G67150, AT5G67160

ANTHRANILATE N-HYDROXYCINNAMOYL/BENZOYLTRANSFERASE-LIKE PROTEIN-RELATED 1353 Chr02

MD15G1146700 AT2G43840 GLUCOSYL/GLUCURONOSYL TRANSFERASES // SUBFAMILY NOT NAMED 2307 Chr15

212

Malus domestica gene ID

Corresponding Arabidopsis thaliana ortholog/s

Gene > Defline Gene > Length

Gene > Chromosome

. Primary Identifier

JA

MD02G1161600

AT2G23590, AT2G23600, AT2G23610, AT2G23620 SALICYLIC ACID-BINDING PROTEIN 2-LIKE 1268 Chr02

MD02G1175500

AT3G50270, AT3G50280, AT3G50300, AT5G38130, AT5G67150, AT5G67160

ANTHRANILATE N-HYDROXYCINNAMOYL/BENZOYLTRANSFERASE-LIKE PROTEIN-RELATED 1353 Chr02

MD02G1317800 AT3G45140 LIPOXYGENASE (LOX2S) 7877 Chr02

MD13G1285100 AT5G13930 NARINGENIN-CHALCONE SYNTHASE 2603 Chr13

MD15G1401300 AT1G76680, AT1G76690 NADH OXIDOREDUCTASE-RELATED // SUBFAMILY NOT NAMED 3865 Chr15

MD17G1261000

AT1G56650, AT1G66370, AT1G66380, AT1G66390 TRANSCRIPTION FACTOR MYB113-RELATED 2991 Chr17

CYTOKININ

MD01G1168100 AT2G40670, AT3G56380

RESPONSE REGULATOR OF TWO-COMPONENT SYSTEM // TWO-COMPONENT RESPONSE REGULATOR ARR16-RELATED 1130 Chr01

MD05G1130400 AT4G35190 CYTOKININ RIBOSIDE 5'-MONOPHOSPHATE PHOSPHORIBOHYDROLASE LOG5 1963 Chr05

MD11G1255800 AT3G15150 E3 SUMO-PROTEIN LIGASE MMS21 3193 Chr11

MD15G1021500 AT1G75450 CYTOKININ DEHYDROGENASE 5 6378 Chr15

BS MD11G1267200 AT1G78700 BES1/BZR1 HOMOLOG PROTEIN 3 4087 Chr11

*Upregulated DEGs within each hormone has marked with orange and downregulated genes marked with blue color

213

Appendix A7: Detail information of the differentially expressed genes that are putatively encoding different transcription factors

Malus domestica gene ID

Corresponding Arabidopsis thaliana ortholog/s

Gene > Defline Gene > Length

Gene > Chr.

Primary Identifier

Gene > Chr

Location .Start

Gene > Chr

Location .End

MD00G1068800 AT2G22750, AT4G37850 TRANSCRIPTION FACTOR BHLH18-RELATED 2349 Chr00 13493469 13495817

MD02G1096500 AT1G19210, AT1G74930 AP2 domain (AP2) ETHYLENE-RESPONSIVE TRANSCRIPTION FACTOR ERF017 708 Chr02 7623930 7624637

MD03G1231800 AT1G53170, AT3G15210 AP2 domain (AP2)/ERF4 693 Chr03 31718140 31718832

MD04G1058200 AT4G17490, AT5G47230 AP2 domain (AP2) EREBP-like factor 5 (EREBP5) 7541 Chr04 7283821 7291361

MD04G1064700 AT4G11660 HEAT SHOCK TRANSCRIPTION FACTOR // HEAT STRESS TRANSCRIPTION FACTOR B-2B 1843 Chr04 8697125 8698967

MD05G1065500 AT2G21650, AT4G39250 DUPLICATED SANT DNA-BINDING DOMAIN-CONTAINING PROTEIN//RADIALIS-like 2 1016 Chr05 12019271 12020286

MD05G1265200 AT1G30650, AT2G34830 WRKY DNA -binding domain (WRKY) TRANSCRIPTION FACTOR 14 4562 Chr05 40011060 40015621

MD06G1051900 AT4G17490, AT5G47230 AP2 domain (AP2)/ERF5 999 Chr06 7252563 7253561

MD06G1211100 AT3G18550 TRANSCRIPTION FACTOR TCP18 2844 Chr06 34380518 34383361

MD07G1151700 AT1G01250 AP2 domain (AP2) ETHYLENE-RESPONSIVE TRANSCRIPTION FACTOR ERF023 567 Chr07 22122629 22123195

MD07G1248600 AT5G51190 AP2 domain (AP2) EREBP-like factor 105 (EREBP105) 945 Chr07 31793773 31794717

MD08G1113200 AT5G25830 TRANSCRIPTION FACTOR GATA 12-LIKE GATA BINDING FACTOR 12-LIKE 1697 Chr08 10042163 10043859

MD12G1034200 AT2G36050, AT3G52540 TRANSCRIPTION REPRESSOR OFP13-like 876 Chr12 3751599 3752474

MD13G1012600 AT1G31050 TRANSCRIPTION FACTOR BHLH111 3017 Chr13 753937 756953

MD14G1221800 AT3G18550 TRANSCRIPTION FACTOR TCP18 2563 Chr14 30342865 30345427

MD15G1171100 AT2G26580 YABBY DOMAIN CLASS TRANSCRIPTION FACTOR 4399 Chr15 13285307 13289705

Malus domestica gene ID

Corresponding Arabidopsis thaliana ortholog/s

Gene > Defline Gene > Length

Gene > Chr. Primary Identifier

Gene > Chr Location .Start

Gene > Chr Location .End

214

MD15G1221100 AT1G19210, AT1G74930 AP2 domain (AP2) ETHYLENE-RESPONSIVE TRANSCRIPTION FACTOR ERF017 714 Chr15 17887545 17888258

MD15G1313200 AT2G22540 MADS-box protein JOINTLESS-like isoform X3 4779 Chr15 31619578 31624356

MD15G1362500 AT1G22130, AT1G77980 MADS BOX PROTEIN // F2E2.20-RELATED 5215 Chr15 43737493 43742707

MD16G1047700 AT1G25560, AT1G68840 AP2/ERF and B3 domain-containing transcription repressor RAV1 1209 Chr16 3329564 3330772

MD17G1261000 AT1G56650, AT1G66370, AT1G66380, AT1G66390 TRANSCRIPTION FACTOR MYB113-RELATED 2991 Chr17 32150472 32153462

*Upregulated DEGs marked with orange and downregulated genes marked with blue color.

215

Appendix A8: Detail information of the differentially expressed genes that are related to cell wall remodelling

Malus domestica gene ID

Corresponding Arabidopsis thaliana ortholog/s

Gene > Defline Gene > Length

Gene >

Chromosome

MD00G1087900 AT2G43870, AT3G59850 POLYGALACTURONASE 1 2345 Chr00

MD00G1125400 AT1G26770 EXPANSIN-A10-LIKE 2029 Chr00

MD01G1100600 AT5G04310 PECTIN LYASE-LIKE SUPERFAMILY PROTEIN-RELATED 5815 Chr01

MD01G1135600 AT3G55500 EXPANSIN-A16-RELATED 1643 Chr01

MD03G1090700 AT2G28950 EXPANSIN-A6 3648 Chr03

MD05G1100900 AT1G71380 1,4-BETA-XYLAN ENDOHYDROLASE-RELATED 3178 Chr05

MD05G1296600 AT4G18780 CELLULOSE SYNTHASE A CATALYTIC SUBUNIT 8 [UDP-FORMING] 5394 Chr05

MD06G1006900 AT3G57260 Glucan endo-1,3-beta-D-glucosidase / Laminarinase 2134 Chr06

MD06G1105900 AT1G64390 ENDOGLUCANASE 19-RELATED 4470 Chr06

MD06G1120700 AT3G48950 ENDO-1,4-BETA-GLUCANASE 2827 Chr06

MD06G1195100 AT2G03090 EXPANSIN-A1-LIKE 1417 Chr06

MD06G1203900 AT3G08900 (1 of 8) K13379 - alpha-1,4-glucan-protein synthase [UDP-forming] 2 2462 Chr06

MD07G1233100 AT2G40610 EXPANSIN-A8 2056 Chr07

MD07G1279000 AT2G23900 ENDO-POLYGALACTURONASE-LIKE PROTEIN-RELATED 2737 Chr07

MD07G1282800 AT5G24090 Chitinase 903 Chr07

MD08G1147800 AT5G42420 Endoglucanase 45-like domain containing protein isoform X1 700 Chr08

MD09G1102600 AT4G03210 XYLOGLUCAN ENDOTRANSGLUCOSYLASE 3187 Chr09

MD10G1003400 AT1G22880 ENDO-1,4-BETA-GLUCANASE-3 // ENDOGLUCANASE 3-RELATED 3741 Chr10

MD10G1145600 AT1G21070, AT1G76670 SOLUTE CARRIER FAMILY 35 2420 Chr10

MD11G1054500 AT2G40610 EXPANSIN-A8 1869 Chr11

MD11G1156200 AT5G22740 GLUCOMANNAN 4-BETA-MANNOSYLTRANSFERASE 2 5646 Chr11

MD12G1002300 AT1G64760, AT2G19440 GLUCAN ENDO-1,3-BETA-GLUCOSIDASE 8-RELATED 2708 Chr12

MD13G1042700 AT1G68560 Xylan 1,4-beta-xylosidase 5465 Chr13

MD13G1094100 AT1G10640, AT1G60590 Pectinase 4246 Chr13

MD14G1128000 AT1G64390 ENDOGLUCANASE 19-RELATED 4991 Chr14

216

*Upregulated DEGs marked with orange and downregulated genes marked with blue color.

Malus domestica gene ID

Corresponding Arabidopsis thaliana ortholog/s

Gene > Defline Gene > Length

Gene >

Chromosome

MD15G1024000 AT5G66460 mannan endo-1,4-beta-mannosidase (MAN) 3035 Chr15

MD16G1070600 AT1G26770 EXPANSIN-A-1-LIKE 1857 Chr16

MD16G1095400 AT1G10640, AT1G60590 PECTIN LYASE-LIKE PROTEIN 4278 Chr16

MD16G1140500 AT1G48100 Pectinase 5819 Chr16

MD17G1038900 AT3G28180 XYLOGLUCAN GLYCOSYLTRANSFERASE 4 2522 Chr17

MD17G1141200 AT3G58790 GALACTURONOSYLTRANSFERASE 15-RELATED 11498 Chr17

217

Appendix A9: Compound microscopic view of fruit-AZ cells sampled at the end of the fruit retention study (49 days after harvest). (a) AZ-cells from control fruit and (b) shows the AZ-cells from the hexanal treated fruit. Lactophenol cotton blue dye was used to stain the AZ tissues. Treated fruit AZ layers more organized with more defined horizontal layers that stained better than control

a b

218

Appendix B1: Primer sequence of genes putatively encoding phospholipase D and calcium sensor proteins

No Gene Gene ID/accession # (Malus domestica)

Forward primer Reverse Primer

1 MdCaM2 MDP0000183898 ATGGGACCATTGATTTTCCA CAGCCTCACGAATCATCTCA

2 MdCaM4 MDP0000277474 TGCTACCTCCCATCCTTCAG CATCTTCCTCGCCATCAAAT

3 MdCML1 MD02G1202000 GACGGTTACCTGGACCGTTA TTCCCGTCTTTGTTGGAGTC

4 MdCML18 MD10G1094100 TGCAACCTCATCTTTTGCAG TTCCCTCACAATCCCTTCAG

5 MdPLDα1 XM_008375733.3 CAGAGGTGGAGAAAGCAAGG AGCTGCATCTTCAGGCGTAT

6 MdPLDα4 XM_008393094.3 TGAGATCCAAGGGGAGTTTG GTTATCGCCATTGTCGGACT

7 MdAct XM_008362405.3 GTGGATTGCAAAGGCAGAGT CATAATTTGCTCGCCTCCAT

8 MdHis3 AY347801.1 TGGAACTGTTGCTCTTCGTG CTCAAACAACCCGACAAGGT

*Sequence information for genes 1-4 obtained from Genome Database for Rosaceae and 5-8 were obtained from NCBI-gene database.

219

Appendix B2: Effects of preharvest sprays on fruit quality traits fresh weight, firmness and TSS in ‘Honeycrisp’ apples after removal from cold storage (2.5 oC) to room temperature storage (~20 oC)

Values represent the mean ± SD of 10 randomly selected fruit. Means followed by different letters indicate significant differences among hexanal, HarvistaTM and control treatments at the same sampling time based on the Tukey-Kramer test at α = 0.05.

Days removal after cold storage

Variant Treatment 30 60 90

Mean fresh weight over 14 d at 20 oC (g) Control 262 (252 - 272) b 257 (247 - 266) b 339 (317 - 360) a

Hexanal 284 (275 - 294) a 280 (271 - 290) a 326 (305 - 348) a

Harvista 260 (250 - 269) b 254 (245 - 264) b 272 (251 - 293) b

Mean firmness over 14 d at 20 oC (N) Control 54.55 (52.88 - 56.21) c 54.28 (52.33 - 56.27) a 51.70 (49.66 - 53.74) a

Hexanal 60.31 (58.64 - 61.98) b 56.9 (54.94 - 58.85) a 52.72 (50.68 - 54.77) a

Harvista 64.27 (62.6 - 65.94) a 56.42 (54.47 - 58.37) a 50.73 (48.69 - 52.77) a

Mean TSS over 14 d at 20 oC (oBrix) Control 12.09 (11.87 - 12.31) b 12.89 (12.75 - 12.99) a 12.58 (12.32 - 12.84) b

Hexanal 12.99 (12.77 - 13.22) a 12.93 (12.82 - 13.03) a 13.63 (13.37 - 13.89) a

Harvista 12.95 (12.73 - 13.17) a 12.86 (12.75 - 12.97) a 13.36 (13.10 - 13.63) a