-
Sism
K. Kegler , A. Habierski , K. Hahn , S. P. Amarilla , F.
Seehusenand W. Baumgartner*
*Department of Pathology, University of VeterinaryMedicine,
Bunteweg 2, D-30559 Hannover, Germany and Department ofPa o,
This is the first report describing infection of tumour cells by
L. infantum in a genital TVT from an asymptom-
Key
Visceral leishmaniasis (VL), caused by intracellular
in the absence of the vector have been reported in man
2009). This protozoon is an obligate intracellular para-
manifestations have been reported (Blavier et al., 2001)
J. Comp. Path. 2013, Vol. 149, 156e161 Available online at
wwwparasites of the Leishmania donovani complex (L. donovaniand
Leishmania infantum [syn. Leishmania chagasi]) is animportant
zoonotic and principally vector-borne dis-ease affectingman and
dogs.L. infantum is the causativeagent in Latin America and Europe
and L. donovani isendemic in East African countries, Northeast
India,Nepal and Bangladesh (Dujardin et al., 2008; Romeroand
Boelaert, 2010). Alternative routes of transmission
site of monocytes andmacrophages in organs includingthe spleen,
liver, lymph nodes and bone marrow(Grimaldi and Tesh, 1993). After
infection, clinicalmanifestations in dogs range fromasymptomatic to
sys-temic disease characterized by progressive weight loss,anaemia,
alopecia, dry exfoliative dermatitis, onychog-ryphosis,
hepatosplenomegaly and generalized lymph-adenopathy (Oliveira et
al., 1993). Inaddition, atypicalan1920
Cor
tiho
002
httpatic bitch. Transplantation of Leishmania-laden neoplastic
cells could represent an alternative route of venerealtransmission
of leishmaniasis among dogs.
2012 Elsevier Ltd. All rights reserved.
words: dog; Leishmania; transmissible venereal tumourd94;09)
resp
-ha
1-99
://dthology, Faculty of Veterinary Medicine, National University
of Asuncion, Ruta Mcal. Estigarribia km 10, San LorenzParaguay
Summary
A 2-year-old female boxer dog was presented with a vaginal
serosanguineous discharge not associated with oes-trus. There was a
friable mass occupying the upper caudal part of the vagina.
Cytological and histological ex-amination revealed a monomorphic
population of neoplastic round cells consistent with canine
transmissiblevenereal tumour (TVT). In addition, Leishmania spp.
amastigotes were found within the neoplastic tissue. Inorder to
characterize whether the amastigotes were present inside
macrophages and/or neoplastic cells, a co-localization study using
cell- and pathogen-specific markers was performed. To detect
Leishmania spp. a 5.8Sribosomal RNA (rRNA) parasite-specific
sequence was used for in-situ hybridization and Mac387 was usedas a
macrophage marker for immunohistochemistry. Leishmania spp. rRNAwas
detected insideMac387+mac-rophages andwithin the cytoplasm of some
neoplastic cells. DNA isolation and polymerase chain reaction
usingspecific primers and sequencing analysis identified the
organism as Leishmania infantum (syn. Leishmania
chagasi).INFECTIOU
Vaginal Canine TransmAssociated with Intra-tuAmastigotes in an
Asym
*, *dogs, including via blood transfusion (Harris,Giger et al.,
2002) or by venereal (Silva et al.,or congenital transmission
(Pangrazio et al.,
ondence to: W. Baumgartner (e-mail: wolfgang.baumgaertner@
nnover.de).
75/$ - see front matter
x.doi.org/10.1016/j.jcpa.2012.11.241DISEASE
sible Venereal Tumouroural Leishmania spp.ptomatic Female
Dog
* *
.sciencedirect.com
www.elsevier.com/locate/jcpaas well as coinfections with
ehrlichiosis and babesiosis.Leishmania spp.haveoccasionallybeen
reported incuta-neous canine transmissible venereal tumour
(TVT)cells (Ciaramella et al., 1997; Levy et al., 2006).TVT is a
transplantable round cell tumour affect-
ing the external genitalia of dogs (Das and Kumar,
2012 Elsevier Ltd. All rights reserved.
-
2000). It is mostly transmitted sexually and less oftenby
sniffing or licking. Despite many studies, the originof the
specific cell linage of TVT remains obscure.The expression of
lysozyme, alpha-1-antitrypsin andvimentin suggest a
reticuloendothelial origin(Mozos et al., 1996; Marchal et al.,
1997). Genomicstudies have shown that the tumour may have arisenat
the time of domestication of the dog (Rebbeck et al.,2009).The
present report describes a female dog with vag-
inal TVT and asymptomatic VL, in which tumourcells and
tumour-infiltrating macrophages containedintracellular amastigotes
of Leishmania spp.A 2-year-old female boxer dog was presented to
the
Veterinary Hospital, Faculty of Veterinary Medicineof the
National University of Asuncion because ofa vaginal serosanguineous
discharge not associatedwith oestrus. The dog was apparently
healthy and
Leishmania spp. Amastithere was a non-encapsulated, lobulated,
whiteegrey,friable mass, approximately 3 cm in diameter, withhigh
bleeding tendency located in the upper caudalpart of the vagina.
Fine needle aspirates taken fromthis mass and stained by Giemsa
revealed a populationof round cells with distinct cell boundaries,
pale baso-philic vacuolated cytoplasm, round to oval
eccentricnuclei with granular chromatin and prominent nucle-oli.
Numerous oval structures, 2e3 mm in diameter,with a basophilic
nucleus and a rod-shaped kinetoplastand consistent with Leishmania
spp. amastigotes, werepresent within macrophages and also
extracellularly.In addition, some tumour cells appeared to contain
in-tracytoplasmic amastigotes (Fig. 1). Confirmation ofLeishmania
spp. infection was achieved by analysis ofbone marrow aspirates and
serology using a commer-
Fig. 1. Impression smear from vaginal TVT. Neoplastic roundcells
characterized by pale basophilic vacuolated cyto-
plasm and eccentric nuclei. Leishmania spp. amastigotesare
present within a neoplastic cell (arrow). Giemsa. Bar,20 mm.cial
kit containing immunochromatographic stripswith recombinant
antigenK39 (rK39) fromL. infantum(Sundar et al., 2002).Biopsy
samples were collected from the vaginal
mass, fixed in 10% neutral buffered formalin and em-bedded in
paraffin wax. Sections were stained withhaematoxylin and eosin
(HE). In order to furthersubstantiate the observation that
amastigotes werepresent within macrophages and neoplastic cells,
co-localization was performed by in-situ hybridization(ISH) for the
detection of parasites in combinationwith immunohistochemistry
(IHC) for cell immuno-phenotyping. For ISH, an oligonucleotide
probe la-belled with digoxigenin (DIG) was designed, basedon
previously published sequences (el Tai et al.,2000; Schonian et
al., 2003). The probe sequence(50TGATACCACTTATCGCACTT30)
detectedthe 5.8S ribosomal RNA (rRNA) of Leishmania spp.ISH was
performed as described by Jacobsen et al.(2009) and Dinhopl et al.
(2011)with some modifica-tions. Briefly, sections were attached to
Superfrostplus slides (Menzel-Glaser, Braunschweig,Germany),
dewaxed in Rotihistol (Carl Roth,Karlsruhe, Germany), hydrated in
graded ethanoland washed in diethylpyrocarbonate (DEPC)-treated
water. Proteolytic treatment was with 4.3 mlproteinase K in
Tris-buffered saline at 37C for15 min. The slides were then rinsed
with 0.2% glycinein phosphate buffered saline (PBS), post-fixed in
4%paraformaldehyde (PFA) and washed in PBS. Afteracetylation and
prehybridization, slides were coveredwith hybridization mixture
(HB-mix) containing18 ml RNA, 20 ml ssDNA, 80 ml dextran
sulphateand 3 ml Leishmania probe (100 ng/ml) and
hybridizedovernight in a humid chamber at 52C. The detectionsystem
consisted of an anti-DIG antibody conjugatedto alkaline phosphatase
(1 in 200 dilution; Fab Frag-ments; Roche Diagnostics, Mannheim,
Germany)and the substrates nitroblue tetrazolium chloride(NBT) and
5-bromo-4-chloro-3-indolyl phosphate(BCIP). The staining reaction
was terminated byplacing the slides in TriseEDTA buffer (TE
buffer,pH 8.0). A skin sample containing amastigotes ofLeishmania
spp. was used as a positive control. Nega-tive controls included
slides in which the HB-mixlacked the Leishmania probe.Subsequently,
IHCusingMac387 as amacrophage
marker (monoclonal antibody, diluted 1 in 200; Da-koCytomation,
Hamburg, Germany) and a standardavidinebiotineperoxidase complex
(ABC, VectorLaboratories, Burlingame, California, USA) methodwas
performed. After incubation of slides in 4%
gotes in Canine TVT 157H2O2 in PBS, heat-induced (microwave)
antigenicretrieval was performed followed by incubation withgoat
normal serum (1 in 5 dilution) and then with
-
cent to the ulcerated region and less frequently amongneoplastic
cells. In addition, scattered neoplastic cellscontaining Leishmania
spp. were identified (Fig. 2).Neoplastic cells did not express
Mac387, CD3 orCD79a, but were labelled strongly for expression of
vi-mentin and lysozyme. Infiltrating macrophages ex-pressed Mac387,
lysozyme and vimentin. T and Blymphocytes expressing CD3 and CD79a,
respec-tively, were also identified.Leishmania spp. rRNA was
demonstrated by ISH
inside Mac387+ macrophages and within the cyto-plasm of some
neoplastic cells (Fig. 3). PCR assay re-sulted in the amplification
of a 53 bp fragment. Acomparison of the nucleotide sequence of the
ampli-con revealed the absence of a cytosine residue at posi-tion
32, identifying the parasite as L. infantum (Fig. 4).This
represents the first report of Leishmania spp.
within neoplastic cells in a TVT located in the genitalarea of
an asymptomatic female dog. In regions in
ler et al.the primary antibody for 90 min. Slides were washedin
PBS and incubated with biotinylated secondaryantibody (goat
anti-mouse IgG, 1 in 200 dilution;Vector Laboratories) for 30 min.
Labelling was visu-alized by incubation with
3-amino-9-ethylcarbazole(AEC) followed by counterstaining with
Mayershaematoxylin. Finally, slides were mounted underAquatex
(Merck Millipore, Darmstadt, Germany).In addition, monoclonal
antibodies specific for vi-
mentin (diluted 1 in 100; DakoCytomation) andCD79a (diluted 1 in
60; DakoCytomation) and poly-clonal antibodies specific for
lysozyme (diluted 1 in250; DakoCytomation) and CD3 (diluted 1 in
3,000;DakoCytomation) were used to detect mesenchymalcells, B
cells, macrophages and T cells, respectively.Primary antibodies
were omitted for negative controlsand replaced by isotype-matched
antibodies from thesame animal species but of irrelevant
specificity.To further characterize the Leishmania spp.
involved,
DNA was extracted from the wax block using a com-mercial kit
(QIAmp DNA FFPE Tissue, Qiagen,Hilden, Germany). Briefly, for
polymerase chainreaction (PCR) assay, the forward
primer50GATGATTAGAGACCATTGTA30 and the reverseprimer
50CAATTCATGGGTGTCATC30 (EurofinsMWG Operon, Ebersberg, Germany)
were used toamplify a 53 base pair (bp) segment of the 18S rRNAgene
for L. donovani (GenBank accession numberX07773.1) and L. infantum
(GenBank accession num-ber GQ332359.1). The amplicon was purified
usingQIAquick Gel Extraction kit (Qiagen) and clonedinto pCR4-TOPO
vector (Invitrogen, Darmstadt,Germany). Plasmid isolation was
performed using Nu-cleoSpin Plasmid Quick Pure
(MachereyeNagel,Duren, Germany). The insert was sequenced (SEQ-LAB
Sequence Laboratories Gottingen, Germany) us-ing M13 forward and
reverse primers.Histopathology revealed a non-encapsulated and
expansive mass. Tumour cells were generally ar-ranged in sheets
and were separated by a delicate fi-brovascular stroma. Individual
cells were round,with a moderate amount of pale eosinophilic
cyto-plasm andmainly indistinct borders. The cells had
ec-centrically located nuclei with coarse granularchromatin and a
single prominent, round eosinophilicnucleolus. Anisokaryosis and
anisocytosis were mildto moderate and there were 4e8 mitoses per
high-power field (40 microscope objective). In some sec-tions,
neoplastic cells elevated the overlying mucosaleading to
attenuation of the epithelium and focal ul-ceration withmild
submucosal oedema and fibrosis. Asmall number of lymphocytes,
plasma cells and mod-
158 K. Kegerate numbers of macrophages were distributedamong the
neoplastic cells. Macrophages harbouringLeishmania spp. amastigotes
were mostly present adja-which VL is considered endemic, two types
of changesare described in infected people and dogs: specific
le-sions caused by L. infantum itself and those in whichthe finding
of amastigotes are incidental to anotherprimary condition
(Ciaramella et al., 1997; Boschet al., 2002). In people, infection
with Leishmaniaspp. occurs mostly in immunosuppressed
patients.Kaposis sarcoma parasitized by Leishmania spp. hasbeen
described in patients with HIV infection(Gallego et al., 1996;
Gonzalez-Beato et al., 2000). Indogs, tumours such as T-cell
lymphoma (Manzilloet al., 2008) and haemangiosarcoma (Margaritoet
al., 1994) have been reported concomitant withleishmaniasis.
Fig. 2. Vaginal TVT. Solid sheet of neoplastic round cells
sepa-rated by a delicate fibrovascular stroma and parasitizedby
Leishmania spp. Numerous mitotic figures are observed.
HE. Bar, 50 mm. Inset A. Higher magnification of a
Leish-mania-laden tumour cell. Inset B. Higher magnification ofa
macrophage harbouring numerous amastigotes.
-
Leishmania spp. AmastiCo-existence of Leishmania spp. and TVT
has beendescribed in symptomatic dogs with neoplastic cuta-neous
nodules (Albanese et al., 2002) and oral andnasal masses (Levy et
al., 2006) in which Leishmania-laden neoplastic cells were observed
in cytologicalsmears. However, Catone et al. (2003) failed to
dem-onstrate intracytoplasmic amastigotes in tumour cellsin a TVT
located in the glans penis of a dog withsymptomatic VL. In the
present study, Leishmaniaspp. identified by ISH were noted within
infiltrating
Fig. 3. Vaginal TVT. Colocalization of Leishmania spp.
amasti-gotes by ISH and IHC. Hybridization of rRNA of Leish-mania
is identified by a purple to black signal
indicatingamastigoteswithin the cytoplasmof amacrophage express-ing
Mac387 in red (arrowhead) and within a neoplasticcell negative for
Mac387 (arrow). Bar, 20 mm.Mac387+ macrophages and TVT cells.It has
been postulated that TVT cells arise from
a reticuloendothelial lineage; however, the specificcell type
involved remains unknown (Mukaratirwaand Gruys, 2003).
Immunophenotyping studies usingmarkers specific for vimentin,
lysozyme and alpha-1-antitrypsin did not allow the unequivocal
identifica-tion of all TVT cells (Mozos et al., 1996; Marchalet
al., 1997). Moreover, macrophages and neutrophilsalso express these
markers. In contrast, Mac387 im-munoreactivity was found in
macrophages of theintra- and peritumoural infiltrate, but not
associatedwith TVT cells (Perez et al., 1998). A similar patternof
immunoreaction was observed in the present case.
Fig. 4. Alignment of nucleotide sequence obtained from
PCRproduct of the vaginal TVT against sequences of the 18SrRNA gene
for L. donovani (GenBank X07773.1) and L. in-fantum (GenBank
GQ332359.1). The absence of a cytosineresidue at position 32
characterizes the Leishmania sp. in-volved in the vaginal canine
TVT as L. infantum.This differential marker expression could be
used todiscriminate between Leishmania-laden neoplasticcells and
macrophages harbouring amastigotes.Moreover, the capacity of tumour
cells to internalizeamastigotes suggests phagocytic and/or
receptor-mediated endocytosis that could be related to the
pro-posed histiocytic phenotype of TVT (Albanese et al.,2002; Levy
et al., 2006; Marino et al., 2012).The present case lacked clinical
signs of VL and the
diagnosis was based on the incidental finding of amas-tigotes
within the vaginal neoplastic tissue. L. infantumis normally found
in the skin of symptomatic andasymptomatic dogs (Solano-Gallego et
al., 2004)and shows a tropism for the epididymis, glans penisand
prepuce (Diniz et al., 2005), but not for femalegenital organs
(Silva et al., 2008). In the presentcase, Leishmania-laden
macrophages were mostlyfound adjacent to areas of ulceration and
less fre-quently between neoplastic cells. TVT might triggeran
inflammatory cell influx (Perez et al., 1998) thatcontributes to
the recruitment of Leishmania-ladenmacrophages if VL infection
precedes the develop-ment of TVT. However, macrophages could be
at-tracted to the neoplastic tissue because of thepresence of
amastigotes within tumour cells, as it oc-curs in the skin after
inoculation of Leishmania spp.by sandflies (Solano-Gallego et al.,
2004).Although alternative routes of transmission for VL
have been demonstrated, including venereal transmis-sion in dogs
(Silva et al., 2009), the role of Leishmania-laden TVT cells acting
as a source of infection duringcopulation or after cutaneous
implantation is un-known. However, a clinicopathological study of
TVTand dogs suffering from VL indicated that this sourceof
infection represents only a limited risk factor becauseof the low
number of cases inwhich amastigotes are ob-served within neoplastic
tissues (Marino et al., 2012).However, further studies are still
needed to assess theinfectious potential and epidemiological impact
of tu-mour cells harbouring Leishmania spp., consideringthat TVT
andVL are endemic in similar geographicalregions. Moreover, whether
amastigotes within neo-plastic cells are still viable and
infectious remains tobe determined. Nevertheless, the viability of
Leishmaniaspp. in other phagocytic cells such as neutrophils,
den-dritic cells and also in fibroblasts indicates that a rangeof
cell types can support the parasite (Williams, 1988;Hervas
Rodriguez et al., 1996; Gueirard et al., 2008).There is
currentlymuch discussion about themove-
ment of dogs with VL between endemic and non-endemic countries
within the European Union(Dujardin et al., 2008; Mencke, 2011). The
present
gotes in Canine TVT 159case suggests that consideration should
also be givento the movement of dogs with TVT as these animalsmay
also have subclinical VL. Furthermore, mating
-
Diniz S, Melo M, Borges A, Bueno R, Reis B et al. (2005)
1013e1018.
lerel Tai N, Osman O, el Fari M, Presber W, Schonian G(2000)
Genetic heterogeneity of ribosomal internal tran-scribed spacer in
clinical samples of Leishmania donovanispotted on filter paper as
revealed by single-strand con-formation polymorphisms and
sequencing. TransactionsGenital lesions associated with visceral
leishmaniasisand shedding of Leishmania sp. in the semen of
naturallyinfected dogs. Veterinary Pathology, 42, 650e658.
Dujardin J, Campino L, Ca~navate C, Dedet J, Gradoni Let al.
(2008) Spread of vector-borne diseases and neglectof leishmaniasis,
Europe. Emerging Infectious Diseases, 14,of such dogs may represent
an underestimated sourceof Leishmania spp. infection, especially in
areas wherethe role of sandflies as vectors is still
questionable(Mencke, 2011).
Acknowledgments
The authors thankMrs.D.Waschke,Mrs. B. Buck andMrs. P. Gruenig
for excellent technical assistance.K. Kegler received a scholarship
from DAAD,Germany.
References
Albanese F, Poli A, Millanta F, Abramo F (2002) Primarycutaneous
extragenital canine transmissible venereal tu-mour with
Leishmania-laden neoplastic cells: a furthersuggestion of
histiocytic origin? Veterinary Dermatology,13, 243e246.
Blavier A, Keroack P, Denerolle I, Goy-Thollot L,Chabanne J et
al. (2001) Atypical forms of canine leish-maniosis. Veterinary
Journal, 162, 108e120.
Bosch R, Rodrigo A, Sanchez P, Galvez, Enrique M et al.(2002)
Presence of Leishmania organisms in specific andnon-specific skin
lesions in HIV-infected individualswith visceral leishmaniasis.
International Journal of Derma-tology, 41, 670e675.
Catone G, Marino G, Poglayen G, Gramiccia M,Ludovisi A et al.
(2003) Canine transmissible venerealtumour parasitized by
Leishmania infantum. Veterinary Re-search Communications, 27,
549e553.
Ciaramella P, Oliva G, De Luna R (1997) A retrospectiveclinical
study of canine leishmaniasis in 150 dogs natu-rally infected by
Leishmania infantum. Veterinary Record,141, 539e543.
Das U, Kumar AD (2000) Review of canine transmissiblevenereal
sarcoma. Veterinary Research Communications,24, 545e556.
Dinhopl N, Mostegl M, Richter B, Nedorost N,Maderner A et al.
(2011) In-situ hybridisation for the de-tection of Leishmania
species in paraffin wax-embeddedcanine tissues using a
digoxigenin-labelled oligonucleo-tide probe. Veterinary Record,
169, 525.
160 K. Kegof the Royal Society of Tropical Medicine and Hygiene,
94,575e579.Gallego M, Aguilar A, Plaza S, Gomez J, Burgos F et
al.(1996) Kaposis sarcoma with an intense parasitizationby
Leishmania. Cutis, 57, 103e105.
Giger U, Oakley D, Owens S, Schantz P (2002) Leishmaniadonovani
transmission by packed RBC transfusion to ane-mic dogs in the
United States.Transfusion, 42, 381e383.
Gonzalez-Beato M, Moyano B, Sanchez C, Gonzalez-Beato M,
Perez-Molina J et al. (2000) Kaposissarcoma-like lesions and other
nodules as cutaneous in-volvement in AIDS-related visceral
leishmaniasis. Brit-ish Journal of Dermatology, 143, 1316e1318.
Grimaldi J, Tesh R (1993) Leishmaniases of the NewWorld: current
concepts and implications for future re-search. Clinical
Microbiology, 6, 230e250.
Gueirard E, Laplante A, Rondeau C, Milon G,Desjardins M (2008)
Trafficking of Leishmania donovanipromastigotes in non-lytic
compartments in neutrophilsenables the subsequent transfer of
parasites to macro-phages. Cellular Microbiology, 10, 100e111.
Harris M (1994) Suspected transmission of
leishmaniasis.Veterinary Record, 135, 339.
Hervas Rodriguez J, Mozos E, Mendez A, Perez J,
Gomez-Villamandos J (1996) Leishmania infection of canine
skinfibroblasts in vivo. Veterinary Pathology, 33, 469e473.
Jacobsen B,Krueger L, Seeliger F, BruegmannM, Segales Jet al.
(2009) Retrospective study on the occurrence ofporcine circovirus 2
infection and associated entities inNorthern Germany. Veterinary
Microbiology, 138, 27e33.
Levy E, Mylonakis M, Saridomichelakis M,Polizopoulou Z,
Psychogios V et al. (2006) Nasal andoral masses in a dog.
Veterinary Clinical Pathology, 35,115e118.
Manzillo VF, Pagano A, Guglielmino R, Gradoni L,Restucci B et
al. (2008) Extranodal gamma-delta T-cell lymphoma in a dog with
leishmaniasis. VeterinaryClinical Pathology, 37, 298e301.
Marchal T, Chabanne L, Kaplanski C, Rigal D, Mangol J(1997)
Immunophenotype of the canine transmissiblevenereal tumour.
Veterinary Immunology and Immunopatho-logy, 57, 1e11.
Margarito J, Ginel P, Molleda J, Moreno P, Novales Met al.
(1994) Haemangiosarcoma associated with leish-maniasis in three
dogs. Veterinary Record, 134, 66e67.
Marino G, Gaglio G, Zanghi A (2012) Clinicopathologicalstudy of
canine transmissible venereal tumour in leish-maniotic dogs.
Journal of Small Animal Practice, 53,323e327.
Mencke N (2011) The importance of canine leishmaniosisin
non-endemic areas, with special emphasis on the situ-ation in
Germany. Berliner und Munchener TierarztlicheWochenschrift, 124,
434e442.
Mozos E, Mendez A, Gomez-Villamandos J, Martn de lasMulas J,
Perez J (1996) Immunohistochemical charac-terization of canine
transmissible venereal tumor. Veter-inary Pathology, 33,
257e263.
Mukaratirwa S, Gruys E (2003) Canine transmissible vene-real
tumour: cytogenetic origin, immunophenotype,
et al.and immunobiology. A review. Veterinary Quarterly,
25,101e111.
-
Oliveira G, Santoro F, Sadigursky M (1993) The sub-clinical form
of experimental visceral leishmaniasisin dogs. Memorias do
Instituto Oswaldo Cruz, 88,243e248.
Pangrazio K, Costa E, Amarilla S, Cino AG, Silva T et al.(2009)
Tissue distribution of Leishmania chagasi and le-sions in
transplacentally infected fetuses from symptom-atic and
asymptomatic naturally infected bitches.Veterinary Parasitology,
165, 327e331.
Perez J, Day MJ, Mozos E (1998) Immunohistochemicalstudy of the
local inflammatory infiltrate in spontaneouscanine transmissible
venereal tumour at different stagesof growth. Veterinary Immunology
and Immunopathology, 64,133e147.
Rebbeck CA, Thomas R, Breen M, Leroi AM, Burt A(2009) Origins
and evolution of a transmissible cancer.Evolution, 63,
2340e2349.
Romero GAS, Boelaert M (2010) Control of visceral leish-maniasis
in Latin America: a systematic review. PLoSNeglected Tropical
Diseases, 4, e584.
Schonian G, Nasereddin A, Dinse N, Schweynoch C,Schallig H et
al. (2003) PCR diagnosis and characteriza-tion of Leishmania in
local and imported clinical samples.Diagnostic Microbiology and
Infectious Disease, 47,349e358.
Silva F, Oliveira R, Silva T, Xavier M, Nascimento E et
al.(2009) Venereal transmission of canine visceral leish-maniasis.
Veterinary Parasitology, 160, 55e59.
Silva F, Rodrigues A, Rego I, Santos R, Oliveira R et al.(2008)
Genital lesions and distribution of amastigotesin bitches naturally
infected with Leishmania chagasi. Vet-erinary Parasitology, 151,
86e90.
Solano-Gallego L, Fernandez-Bellon H, Morell P,Fondevila D,
Alberola J et al. (2004) Histological andimmunohistochemical study
of clinically normal skinof Leishmania infantum-infected dogs.
Journal of Compara-tive Pathology, 130, 7e12.
Sundar S, Pa K, SahuM, Kumar V,Murray H (2002)
Im-munochromatographic strip-test detection of anti-K39antibody in
Indian visceral leishmaniasis.Annals of Trop-ical Medical
Parasitology, 96, 19e23.
Williams R (1988) Invasion of immune dendritic cells
byLeishmania major and Leishmania mexicana mexicana. Journalof
Parasitology, 74, 186e187.
Received, June 20th, 2012Accepted, November 29th, 2012
Leishmania spp. Amastigotes in Canine TVT 161
Vaginal Canine Transmissible Venereal Tumour Associated with
Intra-tumoural Leishmania spp. Amastigotes in an Asymptomatic
...AcknowledgmentsReferences