Jasmonic acid influences mycorrhizal colonization in tomato plants by modifying the expression of genes involved in carbohydrate partitioning

Physiologia Plantarum 133: 339–353. 2008 Copyright ª Physiologia Plantarum 2008, ISSN 0031-9317

Jasmonic acid influences mycorrhizal colonization in tomatoplants by modifying the expression of genes involved incarbohydrate partitioningMiriam Tejeda-Sartorius, Octavio Martınez de la Vega and John Paul Delano-Frier*

Unidad de Biotecnologıa e Ingenierıa Genetica de Plantas (Cinvestav-Campus Guanajuato), Km 9.6 del Libramiento Norte Carretera Irapuato-Leon,

Apartado Postal 629, C.P. 36821, Irapuato, Guanajuato, Mexico

Correspondence

*Corresponding author,

e-mail: [email protected]

Received 5 December 2007;

revised 23 January 2008

doi: 10.1111/j.1399-3054.2008.01081.x

The role of jasmonic acid (JA) on mycorrhizal colonization by Glomus

fasciculatum in tomato plants was examined using mutant plants over-

expressing prosystemin (PS) or affected in the synthesis of JA (suppressor of

prosystemin-mediated responses 2, spr2). The degree of mycorrhizal colo-nization was determined by measuring frequency (F%) and intensity (M%) of

colonization and arbuscule abundance (A%). Gene expression and bio-

chemical analyses were also performed in roots to detect changes in carbon (C)

partitioning. Colonization was similar in mycorrhizal PS and wild-type roots,

except for a higher A% in the former. Conversely, colonization was severely

reduced in roots of spr2 mutants. No association was found between levels of

expression of genes coding for systemic wound responsive proteins (or SWRPs)

and other defense-related proteins in roots and mycorrhization levels in theseplants. On the other hand, the degree of mycorrhizal colonization correlated

with changes in the transcriptional regulation of a number of genes involved in

sucrose hydrolysis and transport, cell wall invertase activity and mycorrhizal-

specific fatty acid content in roots. The results obtained suggest that one of the

mechanisms by which JA might operate to modulate the mycorrhization

process could be through its influence on the regulation of C partitioning in the

plant. The significant colonization increase observed in mycorrhizal spr2

plants supplied with exogenous methyl jasmonate supports its role as a positiveregulator of the symbiosis.

Introduction

The roots of the majority of higher plants are associated

symbiotically with arbuscular mycorrhizal fungi (AMF) of

the Glomeromycota phylum (Schussler et al. 2001). An

important feature of the arbuscular mycorrhizal (AM)

symbiosis is the nutrient exchange between both part-

ners, which is believed to take place in plant cortical cells

containing specialized fungal structures called arbus-cules. AMF supports the plant’s growth by facilitating the

uptake of minerals from soil, especially phosphate. In

return, an estimated 4–20% of the sugars produced by

photosynthesis are allocated to the roots, with a signifi-

cant portion being transferred to the fungus (Douds et al.

1988, 2000). Consequently, the synthesis, metabolism

and transport of carbohydrates are modified during the

AM symbiosis as a necessary mechanism to ensure an

optimal carbohydrate supply to sustain the colonizedroots, which is supported by increased photosynthetic

Abbreviations – AM, arbuscular mycorrhizal; AMF, arbuscular mycorrhizal fungi; CWI, cell wall invertase; JA, jasmonic acid; MJ,

methyl jasmonate; PCR, polymerase chain reaction; PI, proteinase inhibitor; PS, prosystemin overexpressing plants; SA, salicylic acid;

spr2, suppressor of prosystemin-mediated responses 2; SWRP, systemic wound responsive proteins.

Physiol. Plant. 133, 2008 339

rates upon mycorrhizal colonization (Black et al. 2000,

Wright et al. 1998), as well as changes in expression

profile of genes involved in sucrose-cleaving enzymes

like sucrose synthase and invertases (Blee and Anderson

2000, Garcıa-Rodrıguez et al. 2007, Hohnjec et al.

2003), sugar transporters (Garcıa-Rodrıguez et al. 2005,Harrison 1996) and H1-ATPases (Ferrol et al. 2000, 2002,

Gianinazzi-Pearson et al. 2000).

Partitioning of carbohydrates from mature leaves to sink

mycorrhizal roots can alter the source–sink relationship

of plants (Hause et al. 2007, Lerat et al. 2003, Vierheilig

et al. 2002 and references therein) similar to what

happens during the interaction with invading organisms.

In both cases, an extra sink factor is created that divertsthe flow of sucrose to the infected or colonized sites (Paul

and Foyer 2001). Thus, in order to meet the respiratory

demand of this new sink, a higher sugar export capa-

city and more efficient phloem loading/unloading are

needed. These events are characterized by the enhanced

expression of sucrose transporters, as reported for mem-

bers of the sucrose transporters protein carriers family

(SUT) family (Weise et al. 2000) or the sucrose transporter 3from Arabidopsis thaliana (AtSUC3) transporter in Arabi-

dopsis thaliana (Meyer et al. 2004), and/or by the induction

of apoplastic invertases, which are usually upregulated

after pathogen infection or wounding (Benhamou, et al.

1991, Ohyama et al. 1998, Zhang et al. 1996).

Jasmonic acid (JA) is a phytohormone related to

multiple developmental and growth processes, including

photosynthesis gene modulation (Reinbothe et al. 1993a,1993b) and carbon (C) partitioning (Babst et al. 2005).

Besides, its function in defense against pathogens and

insect pests is widely documented (Li et al. 2002a, Liu et al.

2005, Thaler et al. 2004). JA is biosynthesized through the

octadecanoid pathway, being the final product of the

peroxidation of linolenic acid, an 18:3 unsaturated fatty

acid (reviewed in Blee 2002, Schaller et al. 2005, Turner

et al. 2002). Recent models indicate that JA is the long-distance wound signal necessary to activate the systemic

accumulation of defense-related proteins in tomato, such

as proteinase inhibitors (PIs), which are necessary to

control insect herbivory (McGurl et al. 1992, 1994,

Orozco-Cardenas et al. 1993). Systemic signaling is

believed to be facilitated by a positive amplification loop

in which JA, or a related oxylipin, gradually accumulates

across the vasculature as the result of a self-inducing cyclein which systemin, a wound-related polypeptide signal, is

considered to play a crucial role (Li et al. 2002b,

Schilmiller and Howe 2005, Stenzel et al. 2003).

Most of the experimental evidence gathered to date

indicates that JA might play an important role in the

mycorrhizal symbiosis. Regvar et al. (1996) observed that

soil drenching followed by foliar JA treatment (5 mM,

once a week) had a positive effect on shoot length, root

growth, tuber development and mycorrhizal coloniza-

tion of garlic plants, although when it was applied at

higher concentrations (0.05–5 mM) to the shoots Tro-

paeolum majus, Carica papaya and Cucumis sativus, it

drastically reduced mycorrhizal colonization (Ludwig-Muller et al. 2002). Additionally, an increase of jasmo-

nate levels upon mycorrhizal colonization has been

documented in cucumber, barley and soybean (Hause

et al. 2002, Meixner et al. 2005, Vierheilig and Piche,

2002), and in mycorrhizal barley plants, an induction of

the expression of two jasmonate responsive genes (allene

oxide synthase [AOS] and JIP23) was found (Hause et al.

2002). Interestingly, AOS and JIP23 transcripts and pro-teins were localized specifically in arbuscule-containing

cells. Moreover, the antisense-mediated suppression of

allene oxide cyclase, an octadecanoid pathway enzyme,

in Medicago truncatula reduced JA content and mycor-

rhizal colonization rate, manifested by a significant

reduction in arbuscule abundance (Isayenkov et al.

2005).

Altogether, the above findings support the importanceof JA in the establishment of the AM symbiosis. It has been

postulated that JA could exert a positive effect on the

AM symbiosis by regulating flavonoid biosynthesis and

defense gene expression, cytoskeleton rearrangements,

sink strength reinforcement (Isayenkov et al. 2005) and

lipid metabolism (Stumpe et al. 2005). However, more

detailed studies are needed to elucidate the specific

function(s) that JA might have in the positive regulation ofthe mycorrhizal symbiosis. A role in C partitioning was

supported by the finding that exogenous JA accelerated

photosynthate export from leaves and favored a greater

partitioning to the stems and roots in poplar (Babst et al.

2005). The proposed mechanisms offered to explain these

changes were a decreased leaf phloem loading time

because of an increased expression or activity of sucrose

transporters required for the mobilization of fixed Cstored as starch during the day, a shift in C- and nitrogen-

based metabolites to stem and root storage and/or the

generation of long-distance signals from leaves to roots

capable of affecting nutrient uptake and assimilation.

In this work, an attempt to further analyze JA

involvement during the AM symbiosis in tomato was

performed employing tomato plants affected in the JA

signaling pathway. Accordingly, the degree of mycorrhi-zal colonization together with changes in C partitioning

were examined in the 35S::prosystemin (McGurl et al.

1994) and suppressor of prosystemin-mediated responses

2 (spr2) (Howe and Ryan 1999) mutant tomato plants. The

former (hereby denominated as PS plants) is character-

ized by the constitutive overexpression of prosystemin,

which promotes the constitutive and atypical release

340 Physiol. Plant. 133, 2008

(without wounding) of systemin and the consequent

accumulation of a group of defense-related proteins

collectively known as systemic wound responsive pro-

teins (or SWRPs), that includes several PIs and proteases,

signal pathway-associated proteins and others, such as

threonine deaminase, which could have an importantrole in defense against insect herbivores (Bergey et al.

1996, Chen et al. 2005, 2007). This phenotype, aptly

suggestive of plants maintained in a permanently

wounded state, appears to be caused by a constantly

activated JA signaling pathway. In the spr2 mutants, the

lack of a chloroplast fatty acid desaturase results in

a significant reduction of the 18:3 fatty acid pool in

leaves, leading to a severe reduction of JA biosynthesis,which does not increase in response to several types of

biotic stress (Li et al. 2003). Moreover, additional GC-MS

analyses of spr2 root extracts indicated that JA is absent

in this mutant plant tissue (our unpublished data). In

consequence, these plants are more susceptible to

damage by chewing insects mostly because of reduced

SWRP accumulation and exhibit other metabolic

changes, such as modified rates of volatile organiccompound emissions that alter their interaction with

insect pests (Li et al. 2003, Sanchez-Hernandez et al.

2006).

This work also included the analysis of genes specif-

ically involved in plant carbohydrate metabolism or

transport, some of which, as mentioned above, were

previously found by several workers to play a role in

mycorrhizal colonization, namely those coding for a cellwall-bound invertase (Lin6), sucrose synthase (Sus3), an

H1-ATPase pump (LHA1) and a sugar (possibly vacuolar)

transporter (LeST3). Additionally, the study of a group

of genes whose expression in mycorrhizal symbiosis has

not been examined before was included, namely, two

plasma membrane hexose transporters (LeHT2 and

LeHT3) and three sucrose transporters (LeSUT1, LeSUT2

and LeSUT4).

Materials and methods

Mycorrhizal colonization

Seeds of wild-type (WT) tomato (Solanum lycopersicm L.

cv. Castlemart) 35S::Prosystemin (PS) and of the spr2

mutant plants were germinated in a methyl bromide-sterilized soil mixture constituted by three parts Sunshine

Mix 3TM, one part loam, two parts mulch, one part

vermiculite (Sun Gro Horticulture, Vancouver, BC,

Canada) and one part perlite (Termolita S.A., Nuevo Leon,

Mexico). The latter two inert materials were added to

increase the porosity of the soil. The plants were removed

from this soil matrix once they reached the four-expanded-

leaf stage and their roots were thoroughly rinsed out with

tap water and transplanted to 300-ml pots containing

autoclaved expanded perlite (Hortiperl; Termolita S.A.). At

the time of transplanting, they were inoculated with 100 g

of a soil-based inoculum ofGlomus fasciculatum (ca. 1000

spores) that was propagated in sorghum (Sorghum bicolor)roots. Control plants were supplied with 100 g of the same

soil mixture (1:1 sand–loam mixture) in which sorghum

plants were grown.

The plants were fertilized once a week with a Long

Asthon solution in which the P content was reduced to

7 mM until harvest. They were kept in a growth room with

a 16/8-h light/dark photoperiod at 27�C (light) and 23�C(dark). Light (approximately 250 mmol m22 s21) wassupplied by 2 groups of 14 fluorescent lamps, one on

each sidewall (F96T12CW-1500, 215 W, 4150 K color

temperature; GE Lighting de Mexico, Nuevo Leon,

Mexico) and 2 high-intensity discharge mercury vapor

lamps placed on the ceiling (HR400DX33; 400 W,

3900 K color temperature; GE Lighting de Mexico). Time–

course experiments performed to evaluate mycorrhizal

colonization revealed that plants reached sufficientlyabundant colonization levels at 40 days post-inoculation

(dpi) to allow reliable comparisons between genotypes to

be made. At 15 and 25 dpi, the colonization rates were

very low and, moreover, further analysis was hindered

because of the scarcity of root tissue available (data not

shown). Thus, all the results herewith reported were

obtained with plants harvested at 40 dpi. At this time

point, the root system was split lengthways. One half wasstained to evaluate mycorrhizal colonization, whereas

the remaining root tissue was frozen, ground in liquid

nitrogen and stored at 280�C until required for analysis

(see below). Sampling was always performed at ca. 14 h

into the photoperiod. At this late point in the photoperiod,

starch and sucrose concentrations in plant tissues are

considered to be near or at their maximal levels, poised

for night-time starch catabolism and sugar export (Dick-son 1987, Gerhardt et al. 1987).

The evaluation of mycorrhizal colonization was per-

formed in root fragments (ca. 100 per genotype) stained

with trypan blue (Phillips and Hayman 1970), and the

mycorrhizal colonization was determined according to

Trouvelot et al. (1986). Colonization was expressed as

frequency (F%) and intensity (M%) of mycorrhizal

colonization and as arbuscule abundance (A%) in theroot system, respectively.

Methyl jasmonate complementation experiments

Plants were grown and inoculated as above. An initial

experiment was performed in which methyl jasmonate

(MJ) was applied at different dpi (2, 8, 16 and 30 dpi) to

Physiol. Plant. 133, 2008 341

WT and spr2 plants, all of which were subsequently

harvested at the established 40-dpi time point in order to

determine the stage at which exogenous MJ was most

effective on AM colonization. MJ application consisted of

applying two 5 ml drops of 5 mM MJ (Sigma-Aldrich

Chemical Co., St. Louis, MO) diluted in 0.01% Triton-X-100 (Sigma-Aldrich) on two mature leaves chosen arbi-

trarily (one drop per leaf). In control plants, only 0.01%

Triton-X-100 was applied under identical conditions.

This mode of application (in detergent or lanolin paste)

has proven to be sufficient to elicit defense responses in

tobacco, tomato and other plants by several workers

(Rocha-Granados et al. 2005, van Dam et al. 2001, Zhang

and Baldwin 1997 and unpublished data) and theconcentration employed was identical to that used by

Regvar et al. (1996) in mycorrhizal garlic plants. On the

basis of this preliminary assay, two additional MJ

complementation experiments were performed in which

MJ was applied 16 dpi on the foliage of WT, PS and spr2

plants. In both assays, mycorrhizal colonization was

evaluated at 40 dpi, whereas in the second one, only WT

and spr2 roots were analyzed to determine the expressionlevels of specific cell wall invertase (CWI) and sucrose

synthase genes (see below) because in JA-supplemented

PS mycorrhizal plants, no changes in colonization were

detected.

Gene expression assays

Root RNA extraction was performed using the ConcertReagent (Invitrogen, Carlsbad, CA) or TRIzol (Invitrogen)

RNA extraction kits, according to the manufacturer’s

instructions. Extracted RNA was treated with DNAase

and used as a template for reverse transcription with

SuperScript II enzyme (Invitrogen). The reaction was

performed as recommended, employing 2 mg of RNA

and a d(T20) oligonucleotide. The resulting first-strand

cDNAs were used to amplify fragments of genesspecifically involved in sugar hydrolysis or sugar trans-

port. Initial gene expression screening assays included

the analysis of a battery of genes involved in sucrose

and hexose/sugar transport (LeSUT1, LeSUT2, LeSUT4

LeHT2, LeHT3 and LeST3) in sucrose hydrolysis, such as

the mycorrhizal-related cell wall-bound invertase (Lin6)

and sucrose synthase (Sus3) and also an H1-ATPase

pump (LHA1). The expression of a number of SWRPs,such as prosystemin, the systemin receptor SR160,

wound-induced calcium-dependent kinase (CDPK) and

calmodulin, JA biosynthetic genes such as LOX,AOC and

OPR3, late defense genes coding for inhibitors of serine-/

threonine-type proteinases (PI-1 and PI-2), a cysteine

(Lcyp) and a subtilysin-type protease and a serine

carboxypeptidase (SCP) were also monitored. A screening

for pathogen resistance-related genes, such as those

coding for pathogen-related protein 2 (PR-P2), a tomato

NADPH oxidase homologue (Lerboh) and an osmotin-

like PR was also included. To the best of our knowledge,

the role in mycorrhization of many of the above defense

genes and the majority of the SWRP genes included in thisstudy has not been analyzed before. Most genes assayed

showed no changes in expression or had patterns that did

not correlate with the AM colonization patterns observed

(Table 1). The genes that showed a correlation with

increased/decreased mycorrhization in the model plants

employed were further studied. The primer sequences

employed for their amplification, the polymerase chain

reaction (PCR) conditions, including annealing temper-ature, the expected product size and accession numbers

are shown in Table 2. Care was exercised to ensure that

all the assays were performed within the exponential

phase of amplification by testing 25-, 30- and 35-cycle

PCR protocols. All preliminary results showed that 30-

cycle PCR amplifications allowed the generation of

dependable semiquantitative data. The amplification of

the plant-specific elongation translation factor EFa1 wasused in all cases as an RNA-loading control (Table 2).

PCR was conducted using 2 ml of first-strand cDNA and

recombinant Taq DNA polymerase (Invitrogen) under

specified conditions. The amplicons were cloned in

TOPO 2.1 vectors (Invitrogen) and sequenced to confirm

Table 1. List of SWRP, pathogen-defense and sugar transport genes

analyzed in this study whose expression patterns did not correlate with

the difference in mycorrhizal colonization observed between WT, PS and

spr2 plants.

Genes Expression

Prosystemin–JA related

Prosys Constitutive only in PS roots

SR160 (*) Without changes at 40 dpi (*) or changes not

related to AM colonization (**)CDPK (*)

LOX (**)

AOC (*)

OPR3 (*)

Pl-1 (*)

Pl-2 (*)

Lcyp (**)

SCP (**)

Pathogen related

PR-P2 Without changes at 40 dpi

Lerboh

Osmotin-like

Sugar transport related

LeSUT1 Changes not related to AM colonization

LeSUT2

LeHT3 Not detected

LeHT2

342 Physiol. Plant. 133, 2008

their identity. Control reactions without reverse transcrip-tase were included in order to guarantee no contamina-

tion by genomic DNA. A densitometry analysis of all PCR

products was conducted using KODAK 1D image analysis

software (Eastman Kodak Co., Rochester, NY), comparing

their optical density with that of the EFa1 control bands.

Biochemical assays: determination of solublesugars, starch and mycorrhiza-related fatty acidcontent in roots

Soluble sugars and starch were extracted according to

Wright et al. (1998), except for the use of lyophilized root

tissue (50 mg) as starting material. Sucrose, glucose,

fructose and starch contents were measured using

enzyme-based methods as instructed in the Sucrose/

D-Glucose/D-Fructose and Starch kits, respectively(Boehringer Mannheim/R-Biopharm, Darmstadt, Ger-

many), except that the final reaction volume was reduced

to fit a microplate format (250 ml per reaction). Esterified

fatty acid content in roots was determined according to

Park and Goins (1994), with modifications. Briefly, the

saponifiable lipids in 100-mg samples of frozen fresh root

tissue were subjected to hydrolysis and subsequent

transmethylation with methanolic BF3 (Sigma-Aldrich)at 90�C for 15 min to obtain the fatty acid methyl esters

that were analyzed by GC-MS, employing the methyl

ester of heptadecanoic acid (17:0) as an internal standard.

About 1 ml samples were injected into a Hewlett-Packard

GC model 5890 equipped with a HP-5MS capillary

column (30 m length � 0.25 mm of internal diameter

and 0.25 mm film thickness) coupled to a MS detector

(Hewlett-Packard model 5972 MSD). The injector tem-perature was kept at 250�C. The initial oven temperature

was 150�C for 3 min, increasing at a rate of 4�C min21 up

to a final temperature of 280�C, which was maintained for

25 min. Helium was used as carrier gas at constant flow

(1 ml min21). The identification of compounds was

performed by comparing the mass spectra with those

available in the AMDIS program and the National Institute

of Standards and Technology (NIST) database using theNIST MS DATABASE program, version 2.0. Fatty acid

quantification was performed by comparing the peakareas of interest to those of a standard curve prepared with

heptadecanoic acid.

Biochemical assays: determination of CWI activityin roots

The enzymatic activity of CWI was assayed according to

Wright et al. (1998) with modifications, such as the use oflyophilized root tissue as starting material and the

Sucrose/D-Glucose/D-Fructose kit for the measurement

of the glucose released by CWI activity.

Experimental design

Experiment 1

The experiment was designed as a factorial 3 � 2 with

the factor genotype at levels WT, PS and spr2 and thefactor mycorrhizal colonization at levels ‘2’ (absent and

non-inoculated) and ‘1’ (present and inoculated with

G. fasciculatum). Experimental units were individual

plants and each treatment combination was replicated

five times. To block random factors, the whole experi-

ment was repeated twice at two different times and this

factor was considered as block in the ANOVAs. For the

treatments with mycorrhizal colonization present, thevariables F%, M% and A% were measured in each plant

individually and analyzed. For gene expression (Lin6,

Sus3, LHA1, LeST3 and LeSUT4), CWI activity and sugar

and fatty acid composition assays, a pooled sample was

obtained from the 5 plants in each treatment combination

and block, resulting in 12 samples from which RNA,

protein or sugars were extracted and analyzed, replicat-

ing the respective assay protocol 2 (Lin6 and LeST3expression; Figs 3A and 5A) or 3 times (Sus3, LeSUT4,

LHA1 expression, sugar content and CWI activity; Figs 3

B, 5B, C, 6 and 7). In the case of esterified fatty acids

content, the measurements were performed only from

one biological experiment; thus, the lipids were extracted

from six samples. It is important to notice that the

replication of the protocols for the gene expression and

Table 2. Reverse transcriptase–PCR assays: primer sequences, annealing temperatures and size of expected amplicons.

Gene Annealing temperature (�C) Product size (bp) Primer sequences (5# to 3#) (forward, reverse) Accession number

Lin6 64 763 gggcagagatggatactgga, aagaccaccttgaaccgttg AB004558

Sus3 63 534 ttggattttgagcccttcac, ggcaggaacttgatccaaaa AJ011319

LeST3 64 769 gacgttggcgttaacaggat, tgcattcactgcagcataca AJ278765

LeSUT4 63 741 cggttgggcgttacaactat, agcaggatcacccaaacaac AF176950

LHA1 63 543 gacttgctccaaaagccaag, cctgttgagcaagacgatga M60166

EFa1 54 241 gcgttgagactggtgtgat, gatgatgacctgggcagtg X144449

Physiol. Plant. 133, 2008 343

biochemical assays within the same block represent

pseudo replicates measuring only random variation of the

assays within the same pooled biological sample, while

the assays performed in the samples coming from

different blocks represent genuine replicates that take

into account both sources of experimental error.

Experiment 2

The experiment was designed as a complete randomized

factorial 5 � 2 with the factor MJ at levels ‘2’ (notapplied) or ‘1’ (applied) at four different dpi (2, 8, 16 and

30 dpi) and the factor genotype at levels WT and spr2.

Experimental units were individual plants, and the

treatment combinations MJ ‘2’ (not applied) to genotypes

WT and spr2 were replicated 20 times, while the

remaining treatment combinations were replicated 5

times. The variable A% was measured in each plant indi-

vidually and subjected to analysis.

Experiment 3

The experiment was designed as a complete random-

ized factorial 3 � 2 with the factor genotype at levelsWT, PS and spr2 and the factor MJ at levels ‘2’ (not

applied) or ‘1’ (applied). Experimental units were

individual plants, and each treatment combination was

replicated five times. The variables A%, M% and F%

were measured in each plant individually and ana-

lyzed. For gene expression experiments (Lin6 and

Sus3), a pooled sample was obtained from the five

plants in each treatment combination from which RNAwas extracted and analyzed, replicating the gene

expression protocol at least twice in each sample.

The replication of measurements in the gene expression

experiments represents pseudo replicates of the same

pooled biological sample, measuring only random

variation of the experimental protocol. However, given

that these samples came from a pool of five plants with

the same treatment, they are likely to represent a robustestimate of the true gene expression value in each

treatment combination.

Statistical analysis

All variables measured in the three experiments were

subjected to ANOVA followed by Tukey’s honest significant

differences test for the significant factors or interac-

tions. All analyses were performed in the R statistical

language (R Development Core Team 2007; http://

www.R-project.org).

Results

Degree of mycorrhizal colonization and the effectof exogenous MJ

The results shown in Fig. 1 show the mean values

obtained from two independent experiments that were

analyzed as blocks. Colonization parameters were

significantly lower in spr2 plants when compared with

WT (A%, P ¼ 0.005; F% and M%, P � 0.0001) and PS

(A%, F% and M%, P � 0.0001). Interestingly, roots of PS

plants had higher A% than roots of WT (P � 0.0001),

whereas no differences were observed between thesegenotypes in F% and M%.

No differences in colonization frequency and intensity

(F% and M%, respectively) were observed between

MJ-treated WT and PS mycorrhizal plants and their

non-treated controls, whereas exogenous MJ treatment

increased these parameters in spr2 plants (Fig. 2A).

However, the treatment was unable to completely com-

pensate for the negative effect on mycorrhizal coloniza-tion observed in spr2 plants because F% and M% were

still significantly lower (P � 0.0001) than that detected in

the other two genotypes. On the other hand, pair-wise

comparisons between same genotypes showed that A%

was significantly increased in MJ-treated WT (P ¼ 0.041)

and spr2 (P ¼ 0.045) mycorrhizal plants. Conversely, the

higher A% consistently observed in PS plants was

unaffected by MJ treatment. The results shown in Fig. 2Bcorroborated those shown above because MJ was able to

increase A% in WT and spr2 plants when applied at

different times after the initial inoculation with G. fas-

ciculatum. The most highly significant day:MJ interac-

tions were obtained at 16 and 30 dpi (P < 0.0001).

Similar results were observed in F% and M% (results not

shown). The positive effect was also concentration

dependent because it was suppressed when MJ was

WT PS spr20

10

20

30

40

50

60 A

M

F

Col

oniz

atio

n (%

)

Fig. 1. Degree of AM colonization, at 40 dpi, in roots of WT,

35S::Prosystemin (PS) and spr2 tomato plants inoculated with Glomus

fasciculatum. Themean arbuscule abundance (A), colonization frequency

(F) and intensity of mycorrhizal colonization (M) in the root system are

shown. Means are the result of determinations in 10 plants grown at 2

distinct times. F values for the blocking (F1,26 � 11.46, P � 0.002) and

genotype (F2,26 � 26.1,P < 0.0001)effectswere significant forA, FandM.

344 Physiol. Plant. 133, 2008

cumulatively applied in all four time points selected

(results not shown), which agreed with the findings of

Ludwig-Muller et al. (2002) showing that high doses of JA(0.05–5 mM), applied every second day, reduced colo-

nization.

Cell wall-bound invertase (Lin6) and sucrosesynthase (Sus3) gene expression

A significant increase in Lin6 expression was detected in

roots of mycorrhizal WT plants (P ¼ 0.026), whereasAMF colonization did not affect the expression of this

gene in roots of PS and spr2 plants (Fig. 3A). Lin6

expression showed a tendency to have the lowest levels in

roots of spr2 plants. However, the statistical analysis

showed that the difference was only significant between

mycorrhizal spr2 and WTroots (P ¼ 0.029). On the other

hand, Sus3 was induced in roots of mycorrhizal WT

(P ¼ 0.0064), whereas the significant and constitutively

high levels in roots of PS plants were not affected by AMF

colonization (Fig. 3B). Constitutive Sus3 expression

levels correlated with the higher A% detected inmycorrhizal PS plants compared with mycorrhizal WT

plants. In stark contrast, Sus3 expression levels were

practically undetectable in roots of spr2 plants and were

not further modified by mycorrhizal colonization.

Decreased Sus3 expression levels in roots of mycorrhizal

spr2 plants were significantly lower than those in

mycorrhizal PS and WT roots (P � 0.001) and correlated

with the low AMF colonization observed.The exogenous application of MJ increased the

expression of Lin6 and Sus3 in roots of mycorrhizal spr2

plants to levels detected in mycorrhizal WT roots. The MJ

complementation of Lin6 expression was barely within

statistical significance (P ¼ 0.054) (Fig. 4A), whereas it

was clearly evident for Sus3 (P ¼ 0.03) (Fig. 4B).

0

20

40

60

80

WT PS spr2 WT PS spr2 WT PS spr2

A M F

Col

oniz

atio

n (%

)

0

5

10

15

20

25

MJ– 2 8 16 30 MJ– 2 8 16 30Arb

uscu

le a

bund

ance

(%

) WT spr2

Time (dpi) at which MJ was applied

MJ–MJ+

MJ–MJ+

A

B

Fig. 2. (A) Effect of exogenous MJ application (at 16 dpi) on mycorrhizal

roots of WT, 35S::Prosystemin (PS) and spr2 plants inoculated with

Glomus fasciculatum. Themean of arbuscule abundance (A), mycorrhizal

colonization frequency (F) and intensity of mycorrhizal colonization (M) in

the root system measured at 40 dpi are shown. Means are the result of

determinations in 10 plants grown at 2 distinct times. F values for the

genotype effect (F2,24 � 35.7, P < 0.0001) were significant for A, F and

M and for the MJ (F1,24 � 8.62, P � 0.007) and genotype � MJ

interaction (F2,24 � 4.82, P � 0.017) effects for A and M only. (B) Effect

of MJ treatment on arbuscule abundance in roots of WT and spr2

mycorrhizal plants inoculated with G. fasciculatum. MJ was applied at

different time points post-inoculation and plants were harvested at

40 dpi. F values for the genotype (F1,70 ¼ 14.3, P ¼ 0.0003) and day of

application (F4,70 ¼ 23.36, P < 0.0001) were highly significant.

Fig. 3. Gene expression of the extracellular invertase Lin6 (A) and sucrose

synthase Sus3 (B), at 40 dpi, in roots of WT, 35S::Prosystemin (PS) and

spr2 tomato plants inoculated with Glomus fasciculatum. The mean

expression of these genes in relative units is shown. Means are the result

of determinations in 10 plants. F values for the blocking (F1,17 ¼ 16.7,

P ¼ 0.0007), genotype (F2,17 ¼ 4.1, P ¼ 0.035) and genotype � mycor-

rhiza interaction (F2,17 ¼ 6.2, P ¼ 0.009) effects were significant for

Lin6. For Sus3, F values for genotype (F2,23 ¼ 27.4, P < 0.0001),

mycorrhiza (F1,23 ¼ 7.2, P ¼ 0.013) and genotype � mycorrhiza inter-

action (F2,23 ¼ 4.6, P ¼ 0.02) effects were significant. A representative

amplification of Lin6 and Sus3 and the constitutively expressed EFa1gene, used as loading standard, is shown.

Physiol. Plant. 133, 2008 345

Conversely, the MJ treatment had no effect on the

expression of both genes in mycorrhizal roots of WT

plants.

Sugar and sucrose transporter gene expression

As mentioned above, the expression of many of the genes

involved in sugar or sucrose transport remained unaf-fected by mycorrhization in the roots of the plants

examined. Following this trend, the constitutive expres-

sion of LeST3, classified as a putative monosaccharide

transporter of the sugar transporter subgroup of the major

facilitator superfamily (Garcıa-Rodrıguez et al. 2005),

remained unaffected by AMF colonization in roots of WT

and PS plants (Fig. 5A) but was repressed in mycorrhizal

spr2 roots (P ¼ 0.018). The expression of the sucrosetransporter LeSUT4 was also unaffected by mycorrhiza-

tion in WT roots (Fig. 5B). However, it was completely

suppressed in mycorrhizal spr2 roots (P ¼ 0.06) and

downregulated in mycorrhizal PS roots (P ¼ 0.007).

Plasma membrane H1-ATPase (LHA1) geneexpression

LHA1 is one of at least seven genes encoding forH1-ATPases that are expressed in tomato. This particular

H1-ATPase is believed to be necessary for the generation

Fig. 4. Effect of exogenous MJ application (at 16 dpi) on mycorrhizal

roots on the gene expression levels of Lin6 (A) and Sus3 (B) inWTand spr2

plants inoculated with Glomus fasciculatum. The mean expression of

these genes in relative units measured at 40 dpi is shown. Means are the

result of determinations in five plants. F values for the genotype

(F1,4 � 6.2, P � 0.059) and genotype � MJ interaction (F1,4 � 9.8,

P � 0.035) effects were significant for Lin6 and Sus3. A representative

amplification of Lin6 and Sus3 and the constitutively expressed EFa1gene, used as loading standard, is shown.

Fig. 5. Gene expression of the vacuolar sugar transporter LeST3 (A),

sucrose transporter LeSUT4 (B), and plasma membrane H1-ATPase LHA1

(C), at 40 dpi, in roots of WT, 35S::Prosystemin (PS) and spr2 tomato

plants inoculated with Glomus fasciculatum. The mean expression of

these genes in relative units is shown. Means are the result of

determinations in 10 plants grown at 2 distinct times. F values for the

genotype (F2,17 ¼ 9.0, P ¼ 0.002; F2,23 ¼ 17.1, P < 0.0001), mycor-

rhiza (F1,17 ¼ 5.3, P ¼ 0.033; F1,23 ¼ 6.47, P ¼ 0.018) and genotype �mycorrhiza interaction (F2,17 ¼ 4.3, P ¼ 0.031; F2,23 ¼ 12.3, P ¼0.0002) effects were significant for LeST3 and LeSUT4, respectively.

For LHA1, only the F value for the genotype effect (F2,23 ¼ 14.5,

P < 0.0001) was significant. A representative amplification of LeST3,

LeSUT4 and LHA1 and the constitutively expressed EFa1 gene, used as

loading standard, is shown.

346 Physiol. Plant. 133, 2008

of the electrochemical gradient of protons that drives

active secondary transport systems and is also known to

be regulated by mycorrhizal colonization. The above

coincided with the upregulation of the weak basal LHA1

expression levels in WT roots in response to mycorrhizal

colonization (P ¼ 0.043) (Fig. 5C). In contrast, higherconstitutive levels, with respect to non-colonized WTand

spr2 roots (P � 0.017), were detected in roots of PS

plants, which were not increased by mycorrhizal colo-

nization. Basal LHA1 expression levels in roots of spr2

were not different from those of WT plants. However, in

contrast with the latter plants, the expression of this gene

was not upregulated in mycorrhizal spr2 roots and

remained significantly lower than that in the roots ofmycorrhizal WT and PS plants (P � 0.03). This finding,

together with the observation that LHA1 expression levels

in leaves of PS plants were also constitutively high and

not further affected by mycorrhizal colonization (results

not shown), suggests that this gene could be considered

as an additional member of the SWRP family that

hyperaccumulates in PS plants either by increased levels

of JA or by enhanced sensitivity to this phytohormone.This supports the possibility that its upregulation in

mycorrhizal WT roots could have been produced also

by a mycorrhizal-induced JA accumulation.

Starch, sucrose and reducing sugar levels

Irrespective of the genotype and treatment, starch

remained undetected in roots of tomato plants (resultsnot shown). This result was in accordance with the low-

starch levels usually detected in other tomato storage

organs (Miron and Schaffer 1991). Sucrose and reducing

sugar levels in roots of WT plants remained unaffected by

mycorrhizal colonization (Fig. 6). In roots of PS plants,

sucrose levels were the highest, particularly when

compared with spr2 roots (P < 0.0001), and mycorrhizal

colonization caused a significant reduction (P ¼ 0.026)

to levels similar to those detected in WT plants. In con-

trast to sucrose, the glucose (P ¼ 0.030) and fructose

(P ¼ 0.008) content in roots of PS plants was significantlylower than WT and not further affected by AMF

colonization. The roots of spr2 plants showed an opposite

pattern of soluble sugar level, having the lowest sucrose

content (P < 0.0001). An increase was detected in roots

of mycorrhizal spr2 plants, which reached sucrose levels

that were no longer different from those detected in

mycorrhizal WTroots. They also accumulated the highest

amounts of glucose (P < 0.0001), whose levels, unlikethe other two genotypes examined, were reduced by

colonization (P ¼ 0.0005). Nevertheless, glucose levels

in mycorrhizal spr2 roots were still significantly higher

than those in equivalent PS roots (P ¼ 0.006). Addition-

ally, a significant mycorrhizal-induced accumulation of

fructose was observed (P < 0.0001), which reached

levels that were significantly higher than those detected

in WT and PS mycorrhizal roots (P � 0.0002).

Esterified fatty acid levels

The levels of the esterified, fungus-specific palmitvac-

cenic acid (Olsson 1999) were not significantly different

in mycorrhizal roots of WT and PS plants, whereas they

remained undetected in mycorrhizal spr2 roots (Table 3).

Conversely, the esterified palmitic acid content remainedconstant in the roots of all plants examined, whereas that

of esterified oleic acid increased to significantly higher

levels in mycorrhizal roots of WT and PS plants but

remained undetected in roots of spr2 plants, irrespective

of mycorrhizal colonization.

0

2

4

6

8

10

WT PS spr2 WT PS spr2 WT PS spr2

sucrose glucose fructose

NMM

Sol

uble

sug

ar (

µg m

g–1 D

W)

Fig. 6. Sucrose (S) and reducing sugars (glucose G and fructose Fr)

content in mycorrhizal (M) and non-mycorrhizal (NM) roots of WT,

35S::Prosystemin (PS) and spr2 plants. F values for the genotype

(F2,21 � 24.5, P < 0.0001), mycorrhiza (F1,21 � 5.7, P � 0.026) and

genotype � mycorrhiza interaction (F2,21 � 8.75, P � 0.0017) effects

were significant for S, G and Fr, whereas the blocking effect was

significant for S only (F1,21 ¼ 88.9, P < 0.0001).

Table 3. Esterified fatty acids content in mycorrhizal (M) and non-

mycorrhizal (NM) roots of WT, 35S::Prosystemin (PS) and spr2 plants.

F values for the genotype (F2,6 ¼ 14.53, P ¼ 0.005; F2,10 ¼ 60.8,

P < 0.0001), mycorrhiza (F2,6 ¼ 56.53, P < 0.0001; F2,10 ¼ 112.8,

P < 0.0001) and genotype � mycorrhiza interaction (F2,6 ¼ 14.53,

P ¼ 0.005; F2,10 ¼ 26.15, P ¼ 0.0001) were highly significant for

palmitvaccenic acid and oleic acid, respectively; nd, not detected.

Palmitvaccenic

acid (16:1)

(ng mg21 FW)

Palmitic acid

(16: 0)

(ng mg21 FW)

Oleic acid (18:1)

(ng mg21 FW)

NM M NM M NM M

WT nd 0.08 1.73 2.23 nd 0.15

PS nd 0.07 2.06 1.87 0.07 0.18

spr2 nd nd 1.52 2.00 nd nd

Physiol. Plant. 133, 2008 347

CWI activity

CWI activity in non-mycorrhizal roots of WT did not differfrom that in equivalent PS roots but resulted significantly

higher than CWI activity in non-colonized spr2 roots

(P ¼ 0.001; Fig. 7). AMF colonization did not affect CWI

activity in roots of mycorrhizal WT and PS plants but

repressed it in mycorrhizal spr2 roots (P ¼ 0.012).

Interestingly, the results derived from the biochemical

assays performed in WTand spr2 plants did not correlate

with the gene expression analysis (compare Figs 3A and7). These findings suggest that the difference in Lin6

transcript accumulation observed between mycorrhizal

and non-mycorrhizal WT roots, which did not translate

into higher CWI activity levels, probably reflected the

contribution of the other members of the CWI gene family

present in tomato roots, and probably unaffected by

mycorrhization, to the total activity detected. On the

other hand, the downregulation of CWI activity detectedin mycorrhizal spr2 roots, which otherwise showed no

change in Lin6 transcript abundance, suggests that in the

absence of adequate JA levels in roots, the AMF symbiosis

has an inhibitory effect on CWI activity.

Discussion

The importance of JA as a positive regulator of the

mycorrhizal symbiosis in diverse plant models has been

established (Hause et al. 2002, 2007, Isayenkov et al.

2005, Regvar et al. 1996, Vierheilig 2004). In this work,the role that the systemin/JA signaling pathway might play

in the establishment of the mycorrhizal symbiosis in

tomato was examined using the spr2 mutant, affected in

the synthesis of JA (Li et al. 2003), and the prosystemin

(PS) overexpressing plants, characterized by a ‘perma-

nently wounded state’ associated with the hyperaccumu-

lation of SWRPs (Bergey et al. 1996) or secondary

metabolites (Chen et al. 2006). Interestingly, these

phenotypes are considered to be JA dependent because

young (2-week-old) PS plantlets with two expanded

leaves are capable of accumulating up to two- to three-fold higher JA levels than WT plants, whereas older (6-

week-old) plants have been found to be more responsive

to its exogenous application or to conditions that elicit its

accumulation (Chen et al. 2006, Stenzel et al. 2003).

We observed that mycorrhizal colonization was sup-

pressed in spr2 mutant plants as evidenced by the drastic

reduction in colonization (Fig. 1). The negative effect

could be attributed to a deficiency in JA synthesis, asdemonstrated by the results derived from the MJ

complementation assays shown in Fig. 2. These results

coincided with findings that demonstrated that the sup-

pression of a JA biosynthesis-related gene in M. trunca-

tula leads to a reduction in JA levels and arbuscule

abundance (Isayenkov et al. 2005) and with the pre-

viously observed ability of spr2 plants to respond

normally to exogenously applied MJ (Li et al. 2002b).They also suggested that JA synthesized/applied in the

shoot can positively influence AMF colonization by

modifying the expression of genes known to increase

sink strength, as shown by the upregulation of Lin6 and

Sus3 in roots of mycorrhizal spr2 plants (Fig. 4).

Additional biochemical and molecular assays also

suggested that the absence of JA disrupts the expression/

activity patterns of a group of genes/enzymes involved insucrose hydrolysis and sugar transport in mycorrhizal

spr2 roots. Consequently, the expression of a number

of genes included in this study that were observed to

be affected by AMF colonization was suppressed by

mycorrhizal colonization in spr2 roots (Figs 3 and 5).

Suppressed LHA1 expression could have negatively

affected colonization levels considering that this gene is

known to favor the mycorrhizal process by lowering ATPlevels in colonized cells, leading to increased plasmo-

desmal size and sucrose import (Blee and Anderson

1998). In addition, the significantly low CWI activity

levels in mycorrhizal spr2 plants (Fig. 7) coupled with

the barely detectable accumulation of Lin6 transcripts

(Fig. 3A) probably also contributed to the low levels of

AMF colonization in mycorrhizal spr2 plants. This was in

agreement with several reports that have describeda positive correlation between CWI activity or expres-

sion and mycorrhizal colonization in tomato plants and

other plant models (Garcıa-Rodrıguez et al. 2007,

Schaarschmidt et al. 2006, 2007, Wright et al. 1998).

The transcriptional downregulation of Sus3 observed in

roots of spr2 plants, which was not affected by AMF

colonization, contrasted with the clear induction

PS spr20.00

0.05

0.10

0.15

0.20

0.25

WT

CW

I act

ivity

( µg

gluc

ose

mg–1

DW

roo

t min

–1)

NMM

Fig. 7. CWI activity, at 40 dpi, in roots of WT, 35S::Prosystemin (PS) and

spr2 tomato plants inoculated with Glomus fasciculatum. The mean

activity of this enzyme is shown.Means are the result of determinations in

10 plants grown at 2 distinct times. F values for the genotype

(F2,29 ¼ 38.1, P < 0.0001), mycorrhiza (F1,29 ¼ 5.7, P ¼ 0.024) and

genotype � mycorrhiza interaction (F2,29 ¼ 3.8, P ¼ 0.033) effectswere

significant.

348 Physiol. Plant. 133, 2008

observed in mycorrhizal WTroots (Fig. 3B). This negative

expression of Sus3 could have further contributed to the

low colonization detected, considering that the induced

expression of sucrose synthase genes has been shown to

be positively associated with mycorrhization in roots of

several species (Blee and Anderson 2002, Garcıa-Rodrıguez et al. 2007, Hohnjec et al. 2003, Ravnskov

et al. 2003).

A possible disruption of C partitioning was manifested

by the significantly higher glucose 1 fructose/sucrose

ratio detected in spr2 roots, irrespective of mycorrhizal

colonization (Fig. 6). This was suggestive of an inade-

quate sucrose transport, supported by the observed

repression of LeSUT4 in mycorrhizal spr2 roots (Fig. 5B)and was consistent with reports describing the essential

role played by other sucrose transporters in the regulation

of C partitioning (Kuhn et al. 1996, Lalonde et al. 1999,

Riesmeier et al. 1994). The downregulation of LeSUT4

expression in mycorrhizal PS roots also coincided with

significantly lower sucrose levels. On the other hand, the

lower glucose content detected in non-colonized PS roots

probably reflected the higher metabolic costs associatedwith the constitutive expression of most of the genes

examined in this study. However, the differences in sugar

levels detected in mycorrhizal roots of the plants tested,

particularly when compared with WT plants, were not

conclusive enough to indicate that they constituted

a determinant factor influencing mycorrhizal coloniza-

tion in this study. Conversely, the absence of palmitvac-

cenic and oleic acids in mycorrhizal spr2 roots (Table 3)was in agreement with their low colonization abundance

(Fig. 1), taking into account that the accumulation of

these fatty acids is considered to be a marker of root

colonization and fungal C supply (Schaarschmidt et al.

2007, Stumpe et al. 2005).

The lack of induced LeST3 expression in roots of WT

and PS plants (Fig. 5A) was consistent with a previous

report by Garcıa-Rodrıguez et al. (2005) describing thatmycorrhization (and also oomycete root infection)

increased LeST3 transcript accumulation in leaves but

not in roots. The observed result also indicated that this

transporter is most probably not essential for sugar supply

during the mycorrhizal symbiosis, although it could play

a secondary role, as suggested by the correlation found

between its drastic downregulation in mycorrhizal spr2

roots and their low colonization levels. A similar ex-pression profile was observed for LeSUT4 (Fig. 5B), a

sucrose transporter putatively involved in determining

sink strength and regulation of extracellular sucrose levels

by means of its reuptake in sink tissues (Weise et al. 2000).

The mechanisms behind the downregulation that mycor-

rhizal colonization had on the levels of LeST3 and

LeSUT4 and LeSUT4 expression in mycorrhizal spr2 and

PS roots, respectively, are unknown and will require

further research to be clarified, although it is tempting to

speculate that likely changes produced in the overall

hormone balance in the mutant plants during mycorrh-

ization might have contributed to the effect observed.

This proposal is supported, at least for LeSUT4, byprevious data reporting the proven sensitivity of sucrose

transporters, in general, to changes in phytohormone

levels (Saftner and Wyse 1984, Sauer 2007).

On the other hand, a significantly higher A% was

observed in roots of mycorrhizal PS plants. These results

suggest that mycorrhizal colonization, in terms of A%,

was favored in PS plants by either higher JA basal levels in

the early stages of colonization and/or an improvedability to synthesize JA in older plants in response to

a symbiosis-related stimuli, in accordance to the report of

Stenzel et al. (2003). However, the finding that the

exogenous application of MJ significantly increased A%

in WT but did not affect colonization in PS plants (Fig. 2A)

suggests that JA in PS plants is more than sufficient for

efficient colonization and that the increased JA sensitivity

and/or biosynthetic activity conferred by PS overexpres-sion provided an advantage that allowed higher arbus-

cule abundance in the latter plants. The results also

suggest that higher A% was not related to increased

sucrose transport to the roots and/or increase in sink

strength because of CWI and/or Sus3 gene expression,

which was in agreement with the significantly lower

sucrose content detected in mycorrhizal roots of these

plants. However, the observed reduction in root sucroseconcentration may not have been necessarily because of

a decreased transport but because of an increased sink

activity with increased rates of carbohydrate consump-

tion. Thus, higher A% could have explained lower suc-

rose concentrations by itself without having to influence

sucrose transport.

The data shown in Table 1 also indicated that the

changes in colonization observed, in particular the higherA% in roots of PS plants, were probably independent of

SWRP and pathogen defense-related gene expression in

roots. This suggested that other possible mechanisms

that have been reported to influence colonization, such

as changes in proteolytic activity (Takeda et al. 2007 and

references therein) and/or susceptibility to the mycorrhi-

zal fungus because of a modified salicylic acid

(SA)-dependent defense response as a consequence ofa JA–SA cross talk, did not contribute to the modified

patterns of colonization observed in the mutant plants.

However, a cautionary note that should be considered

as this discussion draws to an end is the possibility that

the comparison of gene expression in mycorrhizal vs

non-mycorrhizal roots might not have been an optimal

indicator of the mechanisms leading to the differences in

Physiol. Plant. 133, 2008 349

colonization observed in this study, considering that the

former often have slower growth rates which are

frequently accompanied by downregulation of many

genes. Thus, changes in gene expression or activity could

have been more or less similar when comparing non-

mycorrhizal and mycorrhizal roots because none of thegenes herewith analyzed are known to be specifically

activated in presence of mycorrhizal fungi. It is needless

to say that any technical improvement leading to a way to

separate the impact of slower root growth from that

caused by the presence of mycorrhizal fungi on gene

expression will be extremely helpful to solve this

potential experimental limitation in molecular and bio-

chemical studies of the mycorrhizal symbiosis. Also to bepondered is the fact that the presence of mycorrhizal

fungi increases the sink strength of the roots but not

always to the extent that it becomes a stronger sink than

the more actively growing non-mycorrhizal roots. In one

case, the roots themselves require carbohydrates,

whereas in the other, it is partly the roots and partly the

fungi. Therefore, it should be acknowledged that some of

the above results could be explained by a shift in Callocation within the roots rather than between roots and

other sink tissues, which were not analyzed here.

Nevertheless, this study emphasizes that JA synthesis is

required for the establishment of the mycorrhizal sym-

biosis in plants and shows that the effect observed could

occur through the regulation of C partitioningbya number

of genes involved in sugar transport and sucrose

hydrolysis. However, other JA-related mechanism(s) pos-sibly involved in arbuscule development should not be

ruled out and merit further research.

Acknowledgements – M. T.-S. was supported by a doctoral

scholarship (No. 157791) granted by The National Council of

Science and Technology (Conacyt, Mexico). We are grateful to

Dr Vıctor Olalde Portugal (Cinvestav, Guanajuato) for pro-

viding the G. fasciculatum inoculum, Dr Gregg Howe

(Michigan State University) for kindly supplying the spr2 and

35S::prosystemin tomato seeds and the Tomato Genetic

Resource Center at the University of California, Davis, for

donating the cv. Castlemart tomato seeds.

References

Babst BA, Ferrieri RA, Gray DW, Lerdau M, Schlyer DJ,

Schueller M, Thorpe MR, Orians CM (2005) Jasmonic acid

induces rapid changes in carbon transport and partitioning

in Populus. New Phytol 167: 63–72

Benhamou N, Grenier J, Chrispeels MJ (1991) Accumulation

of b-fructosidase in the cell walls of tomato roots following

infection by a fungal wilt pathogen. Plant Physiol 97:

739–750

Bergey DR, Howe GA, Ryan CA (1996) Polypeptide signaling

for plant defensive genes exhibits analogies to defense

signaling in animals. Proc Natl Acad Sci USA 93:

12053–12058

Black KG, Mitchell DT, Osborne BA (2000) Effect of

mycorrhizal-enhanced leaf phosphate status on carbon

partitioning, translocation and photosynthesis in

cucumber. Plant Cell Environ 23: 797–809

Blee E (2002) Impact of phyto-oxylipins in plant defense.

Trends Plant Sci 7: 315–321

Blee KA, Anderson AJ (1998) Regulation of arbuscule

formation by carbon in the plant. Plant J 16: 523–530

Blee KA, Anderson AJ (2000) Defense responses in plants to

arbuscular mycorrhizal fungi. In: Podila GK, Douds DD

(eds) Current Advances in Mycorrhizal Research. The

American Phytopathological Society, St Paul, MN, pp 27–44

Blee KA, Anderson AJ (2002) Transcripts for genes encoding

soluble acid invertase and sucrose synthase accumulate in

root tip and cortical cells containing mycorrhizal

arbuscules. Plant Mol Biol 50: 197–211

Chen H, Wilkerson CG, Kuchar JA, Phinney BS, Howe GA

(2005) Jasmonate-inducible plant enzymes degrade

essential amino acids in the herbivore midgut. Proc Natl

Acad Sci USA 102: 19237–19242

Chen H, Jones AD, Howe GA (2006) Constitutive activation

of the jasmonate signaling pathway enhances the

production of secondary metabolites in tomato. FEBS Lett

580: 2540–2546

Chen H, Gonzalez-Vigil E, Wilkerson CG, Howe GA (2007)

Stability of plant defense proteins in the gut of insect

herbivores. Plant Physiol 143: 1954–1957

Dickson RE (1987) Diurnal changes in leaf chemical

constituents and 14C partitioning in cottonwood. Tree

Physiol 3: 157–170

Douds DD, Johnson CR, Koch KE (1988) Carbon cost for the

fungal symbiont relative to the net leaf P accumulation

in split-root VA mycorrhizal symbiosis. Plant Physiol 86:

491–496

Douds DD, Pfeffer PE, Shachar-Hill Y (2000) Carbon

partitioning, cost and metabolism of arbuscular

mycorrhizae in arbuscular mycorrhizas: physiology and

function. In: Kapulnik Y, Douds DD Jr (eds) Arbuscular

Mycorrhizas: Molecular Biology and Physiology. Kluwer

Avademic Publishers, Dordrecht, pp 107–130

Ferrol N, Barea JM, Azcon-Aguliar C (2000) Molecular

approaches to study plasma membrane H1-ATPases in

arbuscular mycorrhizas. Plant Soil 226: 219–225

Ferrol N, Pozo MJ, Antelo M, Azcon-Aguilar C (2002)

Arbuscular mycorrhizal symbiosis regulates membrane

H1-ATPase gene expression in tomato plants. J Exp Bot 53:

1683–1687

Garcıa-Rodrıguez S, Pozo MJ, Azcon-Aguilar C, Ferrol N

(2005) Expression of a tomato sugar transporter is

increased in leaves of mycorrhizal or Phytophthora

parasitica-infected plants. Mycorrhiza 15: 489–496

350 Physiol. Plant. 133, 2008

Garcıa-Rodrıguez S, Azcon-Aguilar C, Ferrol N (2007)

Transcriptional regulation of host enzymes involved in the

cleavage of sucrose during arbuscular mycorrhizal

symbiosis. Physiol Plant 129: 737–746

Gerhardt R, Stitt M, Heldt HW (1987) Subcellular metabolite

levels in spinach leaves: regulation of sucrose synthesis

during diurnal alterations in photosynthetic partitioning.

Plant Physiol 83: 399–407

Gianinazzi-Pearson V, Arnould C, Oufattole M, Arango M,

Gianinazzi S (2000) Differential activation of H1-ATPases

genes by an arbuscular mycorrhizal fungus in root cells of

transgenic tobacco. Planta 211: 609–613

Harrison MJ (1996) A sugar transporter from Medicago

trucatula: altered expression pattern in roots during

vesicular-arbuscular (VA) mycorrhizal association. Plant J

9: 491–503

Hause B, Maier W, Miersch O, Maucher H, Krammel R,

Strack D (2002) Induction of jasmonate biosynthesis in

arbuscular mycorrhizal barley roots. Plant Physiol 130:

1213–1220

Hause B, Mrosk C, Isayenkov S, Strack D (2007) Jasmonates

in arbuscular mycorrhizal interactions. Phytochemistry 68:

101–110

Hohnjec N, Perlick AM, Puhler A, Kuster H (2003) The

Medicago truncatula sucrose synthase gene MtSucS1 is

activated both in the infected region of root nodules

and in the cortex of roots colonized by arbuscular

mycorrhizal fungi. Mol Plant Microbe Interact 10:

903–915

Howe GA, Ryan CA (1999) Suppressors of systemin signaling

identify genes in the tomato wound response pathway.

Genetics 153: 1411–1421

Isayenkov S, Mrosk C, Stenzel I, Strack D, Hause B (2005)

Suppression of allene oxide cyclase in hairy roots of

Medicago truncatula reduces jasmonate levels and the

degree of mycorrhization with Glomus intraradices. Plant

Physiol 139: 1401–1410

Kuhn C, Quick WP, Schulz A, Sonnewald U, Frommer WB

(1996) Companion cell-specific inhibition of the potato

sucrose transporter SUT1. Plant Cell Environ 19:

1115–1123

Lalonde S, Boles E, Hellman H, Barker L, Patrick JW,

Frommer WB (1999) The dual function of sugar carriers:

transport and sugar sensing. Plant Cell 11: 707–726

Lerat S, Lapointe L, Piche Y, Vierheilig H (2003) Variable

carbon sink strength of different Glomus mosseae strains

colonizing barley roots. Can J Bot 81: 886–889

Li C, Williams MM, Loh Y-T, Lee GI, Howe GA (2002a)

Resistance of cultivated tomato to cell content-feeding

herbivores is regulated by the octadecanoid-signaling

pathway. Plant Physiol 130: 494–503

Li L, Li C, Lee G, Howe GA (2002b) Distinct roles for

jasmonate synthesis and action in the systemic wound

response of tomato. Proc Natl Acad Sci USA 99:

6416–6421

Li C, Liu G, Xu C, Lee IG, Bauer P, Ling HQ, Ganal MW,

Howe GA (2003) The tomato Suppressor of

prosystemin-mediated responses2 gene encodes a fatty

acid desaturase required for the biosynthesis of jasmonic

acid and the production of a systemic wound signal for

defense gene expression. Plant Cell 15: 1646–1661

Liu Y, Ahn J-E, Datta S, Salzman RA, Moon J,

Huyghues-Despointes B, Pittendrigh B, Murdock LL,

Koiwa H, Zhu-Salzman K (2005) Arabidopsis vegetative

storage protein is an anti-insect acid phosphatase. Plant

Physiol 139: 1545–1556

Ludwig-Muller J, Bennett R, Garcıa-Garrido J, Piche Y,

Vierheilig H (2002) Reduced arbuscular mycorrhizal root

colonization in Tropaeolum majus and Carica papaya after

jasmonic acid application cannot be attributed to

increased glucosinolate. J Plant Physiol 159: 517–523

McGurl B, Pearce G, Orozco-Cardenas M, Ryan CA (1992)

Structure, expression, and antisense inhibition of the

systemin precursor gene. Science 255: 1570–1573

McGurl B, Orozco-Cardenas M, Pearce G, Ryan CA (1994)

Overexpression of the prosystemin gene in tomato plants

generates a systemic signal that constitutively induces

proteinase inhibitor synthesis. Proc Natl Acad Sci USA 91:

9799–9802

Meixner C, Ludwig-Muller J, Miersch O, Gresshoff P,

Staehelin C, Vierheilig H (2005) Lack of mycorrhizal

autoregulation and phytohormonal changes in the

supernodulating soybean mutant nts1007. Planta 222:

709–715

Meyer S, Lauterbach C, Niedermeier M, Barth I, Sjolound

RD, Sauer N (2004) Wounding enhances expression of

AtSUC3, a sucrose transporter from Arabidopsis sieve

elements and sink tissues. Plant Physiol 134: 684–693

Miron D, Schaffer A (1991) Sucrose phosphate synthase,

sucrose synthase, and invertase activities in developing

fruit of Lycopersicon esculentum Mill. and the sucrose

accumulating Lycopersicon hirsutum Humb. and Bonpl.1.

Plant Physiol 95: 623–627

Ohyama A, Nishimura S, Hirai M (1998) Cloning of cDNA

for a cell wall-bound acid invertase from tomato

(Lycopersicon esculentum) and expression of soluble

and cell wall-bound invertases in plants and wounded

leaves of L. esculentum and L. peruvianum. Genes Genet

Syst 73: 149–157

Olsson PA (1999) Signature fatty acids provide tools for

determination of distribution and interactions of

mycorrhizal fungi in soil. FEMS Microbiol Ecol 29:

303–310

Orozco-Cardenas M, McGurl B, Ryan CA (1993) Expression

of an antisense prosystemin gene in tomato plants

reduces resistance toward Manduca sexta larva. Proc

Natl Acad Sci USA 90: 8273–8276

Park PW, Goins RE (1994) In situ preparation of fatty acid

methyl esters for analysis of fatty acid composition in

foods. J Food Sci 59: 1262–1266

Physiol. Plant. 133, 2008 351

Paul MJ, Foyer CH (2001) Sink regulation of photosynthesis.

J Exp Bot 52: 1383–1400

Phillips JM, Hayman DS (1970) Improved procedures for

cleaning roots and staining parasitic and vesicular-

arbuscular mycorrhizal fungi for rapid assessment of

infection. Trans Br Mycol Soc 55: 158–161

R Development Core Team (2007) R: A Language and

Environment for Statistical Computing. R Foundation for

Statistical Computing, Vienna, ISBN 3-900051-07-0,

URL http://www.R-project.org

Ravnskov S, Wu Y, Graham JH (2003) Arbuscular

mycorrhizal fungi differentially affect expression of genes

coding for sucrose synthases in maize roots. New Phytol

157: 539–545

Regvar M, Gogala N, Zalar P (1996) Effects of jasmonic acid

on mycorrhizal Allium sativum. New Phytol 134: 703–707

Reinbothe S, Reinbothe C, Parthier B (1993a) Methyl

jasmonate-regulated translation of nuclear-encoded

chloroplast proteins in barley (Hordeum vulgare L. cv.

salome). J Biol Chem 268: 10606–10611

Reinbothe S, Reinbothe C, Heintzen C, Seidenbecher C,

Parthier B (1993b) A methyl jasmonate-induced shift in the

length of the 5’untranslated region impairs translation of

the plastid rbcL transcript in barley. EMBO J 12:

1505–1512

Riesmeier JW, Willmitzer L, Frommer WB (1994) Evidence

for an essential role of the sucrose transporter in

phloem loading and assimilate partitioning. EMBO J 13:

1–7

Rocha-Granados MC, Sanchez-Hernandez C, Martınez-

Gallardo NA, Ochoa-Alejo N, Delano-Frier JP (2005) The

expression of the hydroxyproline-rich glycopeptide

systemin precursor A in response to (a)biotic stress and

elicitors is indicative of its role in the regulation of the

wound response in tobacco (Nicotiana tabacum L.). Planta

222: 794–810

Saftner RA, Wyse RE (1984) Effect of plant hormones on

sucrose uptake by sugar beet root tissue discs. Plant

Physiol 74: 951–955

Sanchez-Hernandez C, Lopez MG, Delano-Frier JP (2006)

Reduced levels of volatile emissions in jasmonate-deficient

spr2 tomato mutants favour oviposition by insect

herbivores. Plant Cell Environ 29: 546–557

Sauer N (2007) Molecular physiology of higher plant sucrose

transporters. FEBS Lett 581: 2309–2317

Schaarschmidt S, Roitsch T, Hause B (2006) Arbuscular

mycorrhizal induce gene expression of the apoplastic

invertase LIN6 in tomato (Lycopersicon esculentum) roots.

J Exp Bot 57: 4015–4023

Schaarschmidt S, Gonzalez M-C, Roitsch T, Strack D,

Sonnewald U, Hause H (2007) Regulation of arbuscular

mycorrhization by carbon. The symbiotic interaction

cannot be improved by increased carbon availability

accomplished by root-specifically enhanced invertase

activity. Plant Physiol 143: 1827–1840

Schaller F, Schaller A, Stintzi A (2005) Biosynthesis and

metabolism of jasmonates. J Plant Growth Regul 23:

179–199

Schilmiller AL, Howe GA (2005) Systemic signaling in the

wound response. Curr Opin Plant Biol 8: 369–377

Schussler A, Schwarzott D, Walker C (2001) A new fungal

phylum, the Glomeromycota: phylogeny and evolution.

Mycol Res 105: 1413–1421

Stenzel I, Hause B, Maucher H, Pitzschke A, Miersch O,

Ziegler J, Ryan CA, Wasternack C (2003) Allene oxide

cyclase dependence of the wound response and

vascular bundle-specific generation of jasmonates in

tomato-amplification in wound signaling. Plant J 33:

577–589

Stumpe M, Carsjens JG, Stenzel I, Gobel C, Lang I,

Pawlowsky K, Hause B, Feussner I (2005) Lipid metabolism

in arbuscular mycorrhizal roots of Medicago truncatula.

Phyochemistry 66: 781–791

Takeda N, Kistner C, Kosuta S, Winzer T, Pitzschke A,

Groth M, Sato S, Kaneko T, Tabata S, Parniske M (2007)

Proteases in plant root symbiosis. Phytochemistry 68:

111–121

Thaler JS, Owen B, Higgins VJ (2004) The role of the

jasmonate response in plant susceptibility to diverse

pathogens with a range of lifestyles. Plant Physiol 135:

530–538

Trouvelot A, Kough JL, Gianinazzi-Pearson V (1986) Mesure

du taux de mycorhization VA d‘un system radiculaire.

Recherche de methods d’estimation ayant une signification

fonctionnele. In: Gianinazzi-Pearson V, Gianinazzi S

(eds) Mycorrhizae: Physiology and Genetics. INRA, Paris,

pp 217–222

Turner JG, Ellis C, Devoto A (2002) The jasmonate signal

pathway. Plant Cell 14: S153–S164

van Dam NM, Horn M, Mares M, Baldwin IT (2001)

Ontogeny constrains systemic protease inhibitor

response in Nicotiana attenuata. J Chem Ecol 27:

547–568

Vierheilig H, Piche Y (2002) Signalling in arbuscular

mycorrhiza: facts and hypothesis. In: Buslig B, Manthey J

(eds) Flavonoids in Cell Function. Kluwer Academic

Publishers/Plenum Press, New York, pp 23–39

Vierheilig H, Bago B, Lerat S, Piche Y (2002)

Shoot-produced, light-dependent factors are partially

involved in the expression of the arbuscular mycorrhizal

(AM) status of AM host and non-host plants. J Plant Nutr

Soil Sci 165: 21–25

Vierheilig H (2004) Regulatory mechanisms during the

plant-arbuscular mycorrhizal fungus interaction. Can J Bot

82: 1166–1176

Weise A, Barker L, Kuhn C, Lalonde S, Buschmann H,

Frommer W, Ward JM (2000) A new subfamily of sucrose

transporters, SUT4, with low affinity/high capacity

localized in enucleate sieve elements of plants. Plant Cell

12: 1345–1355

352 Physiol. Plant. 133, 2008

Wright DP, Read DJ, Scholes JD (1998) Mycorrhizal sink

strength influences whole plant carbon balance of

Trifolium repens L. Plant Cell Environ 21: 881–891

Zhang Z-P, Baldwin IT (1997) Transport of [2_14C]

jasmonic acid from leaves to roots mimics wound-

induced changes in endogenous jasmonic acid pools in

Nicotiana sylvestris. Planta 203: 436–441

Zhang L, Cohn NS, Mitchell JP (1996) Induction of a pea

cell-wall invertases gene by wounding and its localized

expression in phloem. Plant Physiol 112: 1111–1117

Edited by J. K. Schjørring

Physiol. Plant. 133, 2008 353