Top Banner
Jacques van Helden [email protected] QuickTime™ and a decompressor are needed to see this picture. Statistics for Bioinformatics Jacques van Helden TGCATGACTGATTGGTC CGGCCGATAACAGGTGT GCTTGCACCCAGTGCCC AACGTCAACAAGCAGGA ACAACGGGCTGATAAGG GAGAAGATAAGATAAGA TAAGATAACAAATCATT GCGTCCGACCACAGGCC GACACATAGCAGAACGA TGTGAAGCA QuickTime™ and a decompressor are needed to see this picture. QuickTime™ and a decompressor are needed to see this pictur QuickTime™ and a decompressor are needed to see this picture. QuickTime™ and a decompressor are needed to see this picture. QuickTime™ and a decompressor are needed to see this picture. QuickTime™ and a decompressor are needed to see this picture.
4

Jacques van Helden [email protected] Statistics for Bioinformatics Jacques van Helden TGCATGACTGATTGGTC CGGCCGATAACAGGTGT GCTTGCACCCAGTGCCC.

Apr 01, 2015

Download

Documents

Vance Bownds
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Jacques van Helden Jacques.van.Helden@ulb.ac.be Statistics for Bioinformatics Jacques van Helden TGCATGACTGATTGGTC CGGCCGATAACAGGTGT GCTTGCACCCAGTGCCC.

Jacques van [email protected]

Qu

ickTim

e™

an

d a

de

com

pre

ssor

are

need

ed

to

see t

his

pic

ture

.

Statistics for Bioinformatics

Jacques van Helden

TGCATGACTGATTGGTCCGGCCGATAACAGGTGTGCTTGCACCCAGTGCCCAACGTCAACAAGCAGGAACAACGGGCTGATAAGGGAGAAGATAAGATAAGATAAGATAACAAATCATTGCGTCCGACCACAGGCCGACACATAGCAGAACGATGTGAAGCA

QuickTime™ and a decompressor

are needed to see this picture.

QuickTime™ and a decompressor

are needed to see this picture.

QuickTime™ and a decompressor

are needed to see this picture.

QuickTime™ and a decompressor

are needed to see this picture.

QuickTime™ and a decompressor

are needed to see this picture.QuickTime™ and a

decompressorare needed to see this picture.

Page 2: Jacques van Helden Jacques.van.Helden@ulb.ac.be Statistics for Bioinformatics Jacques van Helden TGCATGACTGATTGGTC CGGCCGATAACAGGTGT GCTTGCACCCAGTGCCC.

Univariate statistics

1. Introduction 2. Study cases

2.1 Gene expression data 2.2 Sequence lengths 2.3 Word counts in DNA sequences

3. Descriptive statistics 4. Elements of probabilities 5. Theoretical distributions 6. Statistical inference

6.1 Sampling and estimation 6.2 Fitting 6.3 Hypothesis testing

• 6.3.1 Conformity

• 6.3.2 Significance

• 6.3.3 Homogeneity

• 6.3.4 Goodness of fit

Page 3: Jacques van Helden Jacques.van.Helden@ulb.ac.be Statistics for Bioinformatics Jacques van Helden TGCATGACTGATTGGTC CGGCCGATAACAGGTGT GCTTGCACCCAGTGCCC.

Multivariate statistics

1. Introduction

2. Study cases

3. Correlation analysis

4. Regression analysis

5. Clustering

6. Principal component analysis

7. Multidimensional scaling

8. Discriminant analysis

9. Summary

Page 4: Jacques van Helden Jacques.van.Helden@ulb.ac.be Statistics for Bioinformatics Jacques van Helden TGCATGACTGATTGGTC CGGCCGATAACAGGTGT GCTTGCACCCAGTGCCC.

Books

Statistics applied to bioinformatics van Helden, J. Statisitics pr bioinformatics. Oxford University Press. To appear in

2009. Ewens, W. J. & Grant, G. R. (2001). Statistical Methods in bioinformatics:

an introduction. Statistics for Biology and Health (Dietz, K., Krickeberg, K., Samet, J. & Tsiatis, A., Eds.), Springer, New York.

Univariate analysis Dagnelie, P. (1973). Theorie et methodes statistiques - applications

agronomiques. 2d edit, Les presses agronomiques de Gembloux, Gembloux - Belgium.

Zar, J. H. (1999). Biostatistical analysis. 4th edit (Ryu, T., Ed.), Prentice Hall, Upper Saddle River.

Multivariate analysis Kachigan, S. K. (1991). Multivariate statistical analysis: a conceptual

introduction. 2d edit, Radius Press, New York. Hastie, T., Tibshirani, R. & Friedman, J. (2001). The elements of statistical

learning - data mining, inference and prediction. Springer series in statistics. 1 vols, Springer-Verlag, New-York.

Flury, B. (1997). A first course in multivariate statistics, Springer-Verlag, New York.

Huberty, C. J. (1994). Applied Discriminant analysis. Wiley series in probability and mathematical statistics (al., B. e., Ed.), John Wiley & sons, New York.