Page 1
Isolation, Characterization and Cosmeceutical
Application of Bioactive Secondary Metabolites
from Marine Fungi
By
Shivankar Agrawal
B. Pharm. (Ayurveda), M.Sc. (Biochemistry)
Submitted in fulfillment of the requirements for the degree of
Doctor of Philosophy
Deakin University
September, 2017
Page 2
sfol
Retracted Stamp
Page 3
sfol
Retracted Stamp
Page 4
iii
I dedicate this thesis to God Almighty and my family…..
Page 5
iv
Acknowledgements
“Don’t take rest after your first victory because if you fail in second,
more lips are waiting to say that your first victory was just luck.”
- A.P.J Abdul Kalam
I would like to express my sincere gratitude and admiration to my Principal
supervisor Prof. Colin J. Barrow for his expert guidance, support and unflinching
encouragement throughout my Ph.D. journey. I would like to thank him for providing
excellent scientific advice through my entire thesis report with immense patience and
providing his valuable suggestions, even after his demanding schedule.
I put on record to express my deepest gratitude and profound indebtedness towards my TERI
lead supervisor, Dr. Sunil Kumar Deshmukh, Fellow and Area Convenor, Nano
Biotechnology Centre, TERI for his immense support and guidance. I would like to
thank him for his valuable discussions towards the designing of the experiments and
publications of the work.
I am extremely thankful to my associate supervisor Dr. Alok Adholeya, Director,
Nano Biotechnology Centre, TERI for giving me the opportunity to carry out this
research. Dr. Alok was the main source of inspiration behind this project. Additionally, Dr.
Alok provided me with every opportunity for success during my Ph.D. career while
allowing me the freedom to individually develop my own scientific approach to
problems. He has always been there to support and provide an insightful answer to all
my queries. His positive attitude, scientific temperament and words like “There is
nothing like No Results in research” have always been a great motivation.
I would like to take this opportunity to pay sincere gratitude to my former Associate
supervisor, Dr. Nisha Aggarwal (not working with TERI anymore) for her support in
the first two years of my Ph.D. program. She has always been a very caring and
understanding person.
I sincerely acknowledge to Dr. Debabrata Acharya, Dr. Pannalal Dey, all Fellow and
Associate Fellow of Teri-Deakin nanotechnology research center for their caring and
valuable help and support.
Page 6
v
I would also like to thank Mr. Chandrakant Tripathi and technical staff for their
expert assistance and help in handling and working on various instruments.
I am thankful to my seniors for their friendly, but valuable suggestions and guidance
throughout.
I would like to thank all my lab mates for their support. Extending, this thanks to all
the lab attendants for their help in my daily experiments.
Finally, very special thanks to my very good friends Ranjit Singh, Sreeparna
Samantha, Sandeep Sure, Amritpreet Kaur Minhas, Rita Choudhary, Ankita Bedi for
their friendship, encouragement, moral and emotional support and great company.
I would also like to thank the administrative staff both at TERI and Deakin
International Office, New Delhi and Deakin University, Australia for their help and
support.
I would like to acknowledge the financial, academic and technical support of Deakin
University, Australia and TERI, India for pursuing my Ph.D. in the field of Nano
biotechnology
Last but not least, I would like to express my gratitude to my parents and my brothers
for their support and helping me to pray.
Shivankar Agrawal
Page 7
vi
List of Publications
Published
1. Agrawal, S., Adholeya, A., & Deshmukh, S. K. (2016). The Pharmacological
Potential of Non-ribosomal Peptides from Marine Sponge and Tunicates. Frontiers in
pharmacology, 7 DOI: 10.3389/fphar.2016.00333
Communicated
1. Shivankar Agrawal, Alok Adholeya, Colin J. Barrow, Sunil Kumar Deshmukh.
“Screening of marine fungi for potential tyrosinase inhibitor and antioxidants for
cosmeceutical application”. Submitted in BMC complementary and alternative
medicine.
2. Shivankar Agrawal, Alok Adholeya, Colin J. Barrow, Sunil Kumar
Deshmukh. “In-vitro evaluation of marine derived fungi against
Propionibacterium acnes”. Submitted in Anaerobe.
3. Shivankar Agrawal, Colin J. Barrow, Sunil Kumar Deshmukh, Alok Adholeya.
“Marine fungi: An untapped Bioresource for future cosmeceutical”. Submitted in
Phytochemistry Letters.
Poster presentations
1. Shivankar Agrawal, Nisha Aggarwal, Mandira Kochar, Alok Adholeya*, Colin
Barrow. “Isolation and characterization of nonribosomal peptides from marine fungi
and their application in cosmetics”. At DIRI symposium 2012 organized by Deakin
University in association with TERI held at Gurgaon, Haryana on 27- 30, November
2012.
2. Shivankar Agrawal, Nisha Aggarwal, Mandira Kochar, Alok Adholeya, Colin
Barrow*. “Marine fungi as sources of nonribosomal peptides for cosmeceutical
applications”. Australia-India Strategic Research funded work shop on
Bio/nanotechnology applications to improve plant productivity and ecosystems
services during 5-7 March, 2014 at Geelong, Australia.
3. Shivankar Agrawal, Sunil Kumar Desmukh, Colin Barrow, Alok Adholeya*.
Cosmecutical potential of marine fungi isolated from west coast and Andaman
Page 8
List of Publications
vii
Island, India. At DIRI symposium 2015 organized by Deakin University in
association with TERI held at Gurgaon, Haryana on 27-30, November 2015.
Oral presentations
1. “Screening for antibacterial activity of fungi from Indian marine environments:
A possible alternative for new antibiotics for the treatment of skin microbial
infections” in ICEP2017 19th
international conference on Ethnopharmacology and
Pharmacology at Singapore, 08-09, January 2017 and secured best presentation
award.
Page 9
viii
Table of Contents
Chapter 1 ....................................................................................................................... 1
Introduction and literature review .................................................................................... 1
1. Introduction ................................................................................................................ 2
1.1. Marine natural products ........................................................................................ 2
1.2. Natural products from marine fungi ....................................................................... 5
1.2.1. Rate limiting factors for secondary metabolites biosynthesis in marine fungi ..... 7
1.3. Marine cosmeceuticals .......................................................................................... 7
1.3.1. Current status of cosmetics-cosmeceuticals...................................................... 8
1.4. Cosmeceuticals from marine fungi ........................................................................10
1.4.1. Marine fungi for prevention of skin aging and cancer ......................................10
1.4.2. Marine fungi for skin whitening .....................................................................12
1.4.3. Marine fungi for acne vulgaris .......................................................................15
2. Conclusion.................................................................................................................16
3. Aim of this Research ..................................................................................................17
Chapter 2 ......................................................................................................................18
Isolation and purification of marine fungi from a range of marine environment in India .....18
2.1. Introduction.............................................................................................................19
2.2. Materials and methods .............................................................................................20
2.2.1. Chemicals used .................................................................................................20
2.2.2. Study area ........................................................................................................20
2.2.3. Collection of samples ........................................................................................21
2.2.4. Isolation of marine fungi ...................................................................................22
2.2.5. Growth assessment of marine-derived fungal strains using different media conditions ..................................................................................................................23
2.3. Results and Discussion.............................................................................................23
2.3.2. Effect of nutrient concentration on fungal growth................................................30
2.4. Conclusion ..............................................................................................................33
Chapter 3 .......................................................................................................................34
Screening for antimicrobial activity of marine fungi against bacteria causing skin and wound infections in humans .......................................................................................................34
3.1. Introduction.............................................................................................................35
3.2. Materials and methods .............................................................................................38
3.2.1.. Chemicals used ................................................................................................38
3.2.2. Test organisms..................................................................................................38
3.2.2.1. Marine fungi ..............................................................................................38
3.2.2.2. Bacterial strains .........................................................................................38
3.2.2.3. Bacterial inoculum .....................................................................................38
Page 10
Table of Contents
ix
3.2.3. Broth fermentation and extraction ......................................................................39
3.2.4. Antimicrobial assay in vitro ...............................................................................40
3.2.5. Determination of minimum inhibitory concentration (MIC) .................................40
3.2.6. Determination of the antibacterial mechanism.....................................................41
3.2.7. Morphological and molecular characterization of potential marine fungi strain .....41
3.2.7.1. Scanning electron microscopy (SEM) of fungi .............................................41
3.2.7.2. DNA extraction, PCR amplification and sequencing .....................................42
3.3. Results and discussion: ............................................................................................43
3.3.1. Antimicrobial screening ....................................................................................43
3.3.2. Determination of minimum inhibitory concentration (MIC) .................................46
3.3.3. Mechanism of action (SEM analysis) .................................................................47
3.3.4. Identification of marine fungi with strong antibacterial activity ............................51
3.4. Discussion...............................................................................................................55
3.5. Conclusion ..............................................................................................................57
Chapter 4 ......................................................................................................................58
Screening of marine fungi for potential tyrosinase inhibitor and antioxidants.....................58
4.1. Introduction.............................................................................................................59
4.2. Materials and methods .............................................................................................60
4.2.1. Chemicals used .................................................................................................60
4.2.2. Test organisms..................................................................................................60
4.2.2.1 Marine fungi ...............................................................................................60
4.2.3. Cosmeceutical activity ......................................................................................60
4.2.3.1 .Culture extracts ..........................................................................................60
4.2.3.2. Anti tyrosinase assay (MBTH assay) ...........................................................61
4.2.3.3. Antioxidant assay .......................................................................................61
4.2.3.4 Morphological and molecular characterization of potential fungal strains........62
4.3. Results ....................................................................................................................62
4.3.1. In vitro depigmenting activity ............................................................................62
4.3.2. Antioxidant activity of fungal extracts ................................................................66
4.3.3. Identification of promising marine fungal strains.................................................66
4.4. Discussion...............................................................................................................68
4.5. Conclusion ..............................................................................................................68
Chapter 5 ......................................................................................................................69
Bioassay-guided isolation of antibacterial compounds from marine fungus Simplicillum lamellicola.....................................................................................................................69
5.1. Introduction.............................................................................................................70
5.2. Method and materials ...............................................................................................71
5.2.1. Chemicals used .................................................................................................71
5.2.2. Large scale fermentation and extraction..............................................................71
Page 11
Table of Contents
x
5.2.3. Detection of antibacterial compounds by thin layer chromatography with direct bioautography assay ...................................................................................................71
5.2.4. Bioassay-guided fractionation of S. lamellicola methanol extract .........................72
5.2.5. Identification of isolated antibacterial compound ................................................75
5.2.5.1. HPLC analysis ...........................................................................................75
5.2.5.2. UPLC-mass spectrometry analysis ..............................................................75
5.3. Results and discussions ............................................................................................76
5.3.1. Characterization of substances from the culture broth of marine S. lamellicola ......76
5.3.2. Antibacterial activity of pure active compound ...................................................80
5.4. Conclusions.............................................................................................................80
Chapter 6 .......................................................................................................................81
Summary and future work ...............................................................................................81
References .....................................................................................................................85
Page 12
xi
List of Tables
Chapter 1
Table 1.1: Marine natural product that are FDA-approved agents or used in clinical trial ... 2
Table 1.2: Fungi from aquatic habitats from around the world.......................................... 6
Table 1.3: Examples of some cosmeceutical ingredients from marine sources ................... 9
Table 1.4: Tyrosinase inhibitors from marine fungi ...................................................... 14
Chapter 2
Table 2.1: Samples collected from different parts of India ............................................. 24
Table 2.2: Pure fungal isolates obtained from the samples collected from different habitats
............................................................................................................... ...26
Table 2.3: Fungal mycelial growth on media A .........................................................30-31
Table 2.4: Fungal mycelial growth on media B .........................................................31-32
Chapter 3
Table 3.1: Antibacterial activity of crude fungal extracts against pathogens involves in
complicated skin infections by agar well-diffusion method ........................45-46
Table 3.2: Phylogenetic affiliations of selected fungi with strong antibacterial
activity ....................................................................................................... 51
Chapter 4
Table 4.1: Phylogenetic affiliations of selected fungi with strong activity ...................... 67
Page 13
xii
List of Figures
Chapter 1
Figure.1.1: Cosmetics and their relative branches ............................................................. 8
Figure.1.2: Worldwide major skin problems and their probable solutions ......................... 10
Figure.1.3: Telomerase inhibitors from marine sources ................................................... 12
Figure.1.4: Synthesis of melanin ................................................................................... 13
Figure.1.5: Tyrosinase inhibitors from marine fungi ....................................................... 15
Figure.1.6: Structure of Trichodin A-B .......................................................................... 16
Chapter 2
Figure.2.1: Sites of sample collection in India (Goa, Gujarat and Andaman Islands) ......... 21
Figure.2.2: Different locations where sampling was done and material collected. ............. 25
Figure.2.3: Plates showing the diversity of culturable fungal isolates from different parts of
India.......................................................................................................26-29
Figure.2.4: Fungal growth differences with nutrient avability on solid culture medium ..... 32
Chapter 3
Figure.3.1: Causative pathogens involves in complicated skin infections.......................... 36
Figure.3.2: Fungal secondary metabolites extraction .......................................................................... 39
Figure.3.3 (A and B): MIC of active fungal crude extracts against respective bacteria........ 47
Figure.3.4: Effect of fungal crude extract on Staphylococcus aureus................................ 48
Figure.3.5: Effect of fungal crude extract on Staphylococcus epidermidis ........................ 49
Figure.3.6: Effect of fungal crude extract on Bacillus megaterium ................................. 49
Figure.3.7: Effect of fungal crude extract on Pseudomonas aeruginosa and
Escherichia coli .......................................................................................... 50
Figure.3.8: Effect of fungal crude extract on Propionibacterium acnes ............................ 50
Figure.3.9: SEM morphological analysis of most active sporulating fungi ....................52-53
Figure.3.10: Phylogenetic tree of partial ITS-rDNA sequences of marine fungal strains ..... 54
Page 14
List of Figureures
xiii
Chapter 4
Figure.4.1 (A): Anti tyrosinase activity of Pladi and Dwarka marine fungal crude extracts . 63
Figure.4.1 (B): Anti tyrosinase activity of Andaman and Goa marine fungal crude extracts.64
Figure.4.2: Anti tyrosinase activity of eleven selected fungal crude extracts at different
concentrations............................................................................................. 64
Figure.4.3 (A, B and C): Dose and time dependent anti tyrosinase activity of eleven selected
fungal crude extracts ................................................................................... 65
Figure.4.4: Scavenging activity of crude extracts of selected fungi against DPPH ............. 66
Figure.4.5: Phylogenetic tree of partial ITS-rDNA sequences of fungal strains ................. 67
Figure.4.6: SEM morphological analysis of sporulating D4 strain.................................... 67
Chapter 5
Figure.5.1: Schematic representations of isolation of metabolites from fungi “D5” crude
extract ........................................................................................................ 74
Figure.5.2: Schematic representations of isolation of active compound from active fraction
1.3.4 of “D5” crude extract .......................................................................... 74
Figure.5.3: TLC bioautography of fraction 1.3.4 of “D5” crude extract . . . . . . . . . . . . . . . . . . . . . . 76
Figure.5.4: HPLC chromatogram of minor active fraction 5A .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77
Figure.5.5: HPLC chromatogram of purified active compound from fraction 6A5 ............ 77
Figure.5.6: UPLC-MS chromatograms of minor active fraction 5A ................................. 78
Figure.5.7: UPLC-MS chromatograms of active fraction 6A5 ......................................... 78
Figure.5.8: Structures of compounds identified from marine S. lamellicola ...................... 79
Figure.5.9: Fraction 6A5 with moderate antibacterial activity against S. epidermidis. .... 80
Page 15
xiv
List of Abbreviations
< - Smaller than
% - Percentage
~ - Approximately
µg/ml
- Microgram per millilitre
µl - Microlitre
µM - Micro molar
µm - Micrometre
0C - Degree Celsius
FDA - Food and Drug Administration
Pre-NDA - New Drug Application
ASW - Artificial sea water
BHIB - Brain heart infusion broth
BHIA - Brain heart infusion agar
cm - Centimetre
Cm-1 - per centimetre
CFU - colony-forming unit
CPD - Critical point drying
DMSO - Dimethyl sulfoxide
DPPH - 2,2-diphenyl-1-picrylhydrazylv
gm/ L - Grams per litre
gm - Grams
GC - Gas chromatography
HPLC - High Pressure Liquid Chromatography
hr - Hour
HRTEM - High Resolution TEM
IC50 - Half maximal inhibitory concentration
ITS - Internal transcribed spacer
kg - Kilograms
LC - Liquid chromatography
M - Molar
mbar - Millibars
mg - Milligrams
mM - Millimolar
min - Minutes
Page 16
List of Abbreviations
xv
mL - Millilitre
mm - Millimetre
mg/ml - Milligrams per millilitre
MBTH - 3-methyl-bezothiazolinonehydrazone
MQ - Milli Q
MEB - Malt extract broth
MS - Mass spectroscopy
NCBI - National Centre for Biotechnology Information
ng - Nanogram
NA - Nutrient agar
NMR - Nuclear magnetic resonance spectroscopy
PDA - Potato dextrose agar
PDB - Potato dextrose broth
ppm - parts per million
psi - pounds per square inch
RP - Reverse primer
rpm - Revolutions per minute
RT - Room temperature
Sec - Seconds
SD - Standard deviation
SWM - Sea water media
SAR - Structure activity relationship
SEM - Scanning Electron Microscopy
sp. - Species
TEM - Transmission Electron Microscopy
TLC - Thin layer chromatography
U - Enzyme Unit
UV - Ultraviolet
UV-Vis - UV-Visible
v/v - Volume by volume
UPLC - Ultra-high pressure liquid chromatography
w/v - Weight by volume
w/w - Weight by weight
α - alpha
Page 17
xvi
Abstract
Natural products and their derivatives have historically been an extremely valuable
source for new entities in agriculture, pharmaceuticals and cosmeceuticals, to deliver
a unique variety of structural templates for product development. Historically,
terrestrial plants and microorganisms such as fungi and bacteria were the most
important sources for biologically active natural products. The development of plant
based products has some unique problems associated with the process, which can be
best described as the "problem of supply" due to factors such as deforestation,
environmental pollution, global warming and inability to synthesize due to structural
complexity. The rediscovery of large numbers of previously reported compounds
from terrestrial microbes contributes to the difficulties in discovering new structures.
These problems necessitate the continuous search for novel and alternative bio
resources, particularly those that can be produced at scale such as microorganisms.
Since the middle of the last century, marine species and microorganisms have been
explored as sources for the new chemical entity (NCEs). An advance in isolation and
structure determination methods and equipment over the last thirty years has seen a
rapid increase in the number of new structures identified. Nevertheless, marine
chemical ecology and biodiversity are still relatively unexplored, with respect to the
discovery of natural products, compared with terrestrial sources. Some
researchers have specifically compared natural products from terrestrial and marine
sources. They found that compounds from marine organisms generally exhibited a
higher chemical novelty. In this Ph.D. the research aimed to isolate and characterize
marine fungal secondary metabolite and evaluating their potential use in future
cosmetic skin care products.
The study begins with the collection of marine samples for the isolation of marine
fungi. A range of marine samples were collected from diverse and unexplored marine
habitats in India, which included beaches of Indian west coast and Andaman Island.
All collected samples were subjected to isolation of marine fungi using a variety of
techniques and culture conditions, as described in chapter 2. Seventy fungal strains
were isolated from 60 marine samples. Among these 70 only 35 morphologically
different stains were used in this research work. These 35 strains were analyzed for
their optimum growth condition toward maximizing the production of secondary
Page 18
Abstract
xvii
metabolites using, by varying media conditions (salinity, nutrient strength, etc.). Of
the result, full strength PDA media in artificial sea water was found to be best for
90% of the fungal strains, in terms of their growth and production of secondary
metabolites.
All 35 strains were subjected to screening for antibacterial activity against eight
human pathogenic bacteria, including Escherichia coli (MTCC-443), Pseudomonas
aeruginosa (MTCC-424), Staphylococcus aureus (MTCC-96), Staphylococcus
epidermidis (MTCC-3615), Micrococcus luteus (MTCC-106), Bacillus subtilis
(MTCC-121), Bacillus megaterium (MTCC 1684) and Propionibacterium acnes
(MTCC-1951). The crude extracts, prepared from 20 day fungal fermentation broth,
were evaluated using agar well-diffusion and microdilution assays. Eight fungi were
found to be most active and successfully classified as Simplicillium lamellicola (D 5),
Emericellopsis minima (D 6), Leptosphaerulina sp. (AN 7), Penicillium citrinum
(AN 10), Aspergillus aculeatus (AN 11), P. chrysogenum (AN 12), A. oryzae (G 3),
A. sydowii (G 10). The relevance of this screening was also confirmed by SEM
analysis of the targeted bacteria before and after treatment with crude fungal extracts.
Results show that the presence of active molecules in crude extracts causes damage
to bacterial cell membranes. Marine isolate S. lamellicola (D 5) was the most active
extract against both Gram-negative and Gram-positive bacteria, with a MIC value of
1mg/ml. This promising strain was further exploited for the bioassay-guided
fractionation and isolation of bioactive compounds.
The aim of the next part of our investigation was the screening of marine fungi to
search for potential tyrosinase inhibitors and antioxidants to control
hyperpigmentation and photo aging of the skin. Fungal crude extracts were subjected
for MBTH and DPPH radical scavenging assays for depigmentation and antioxidant
potential, respectively. “Fungus P 2” was shown to be related to Talaromyces
stipitatus and “Fungus D 4” was grouped with Aspergillus terreus. The PDA extracts
of P2 and D4 showed antityrosinase activity (45%, 43%, respectively) at the lowest
concentration 0.125 mg/mL. They also exhibited 94%, 97%, antioxidant activity,
respectively, at a concentration of 0.500 mg/mL. Due to their bioactivity, these two
fungi were selected for the future study. This is the first report of antityrosinase
activity from T. stipitatus.
Page 19
Abstract
xviii
The final research aim of this study was the isolation and characterization of active
antibacterial molecules present in the crude extract of marine fungi S. lamellicola (D
5). Bioassay guided isolation was performed using TLC direct bioautography against
S. epidermidis. One bioactive compound, 5, 6-dihydro-6-pentyl-5, 6-dihydropyran-2-
one (1), was isolated from the crude extract by chromatographic methods and
characterized using LC-MS/MS analysis. Two additional compounds were
tentatively identified as simplifungin (2) and a new derivative of halymecin G (3), by
comparing LC-MS/MS data with that of reported metabolites from Simplicillium sp.
The antibacterial activity of compound (1) has not previously been reported.
Through this work, we have identified a marine fungal strain S. lamellicola (D 5) that
is an efficient producer of antibacterial compounds against S. epidermidis. We also
found that the marine fungi P 2 (Talaromyces stipitatus) and D 4 (Aspergillus
terreus) are the potent producer of bioactive metabolites with antityrosinase and
antioxidants activity.
Page 20
1
Chapter 1
Introduction and literature review
Page 21
Chapter 1
2
1. Introduction
Nature provides a diversity of pharmacologically active biomolecules. These natural
biomolecules are important for the development of novel pharmaceuticals as well as
cosmeceuticals. Between 1989-1995 around 60% of Food and Drug Administration
(FDA) approved drugs and pre-NDA (New Drug Application) candidates were
obtained from the natural environment (1). Natural products are obtained from both
terrestrial and marine environments. Approximately 270,000 natural products have
been discovered and some of them are in the market, either as medical drugs or in
clinical use (2, 3).
1.1. Marine natural products
The marine ecosystem covers about 70% of the earth surface and is extraordinarily
rich in biological diversity, particularly in tropical environments. According to the
Global Biodiversity Assessment by the United Nations Environment Programme,
oceans consist of 178,000 marine species across 34 phyla. Marine organisms
comprise approximately half of the total biodiversity on earth and have shown to
produce novel biomolecules (4, 5). In the past 50 years, exploration of marine
bioresources for their unique natural products has been an important area of research.
Of the estimated 270,000 known natural products, 30,000 compounds have been
obtained from marine organisms (Blunt et al., 2015). Out of these, 9 are approved as
medical drugs and 12 are undergoing clinical trials (Table 1.1) (6).
Table 1.1: Marine natural products that are FDA-approved agents or used in clinical trial (6)
Clinical
Status
Compound
Name
Source
Organism
Structural class Molecular
Target
Disease Area
FDA
approved
Cytarabine (Ara-
C)
Sponge Nucleoside DNA
polymerase
Cancer
FDA
approved
Vidarabine (Ara-
A)
Sponge Nucleoside Viral DNA
polymerase I
Antiviral
FDA
approved
Ziconotide Cone Snail Cysteine Knot
Peptide
N-type
Ca2+
channel
Pain
FDA
approved
Eribulin
Mesylate
(E7389)
Sponge Complex
Polyketide
Microtubules Cancer
FDA
approved
Omega-3-acid
ethyl esters
Fish Omega-3 fatty
acids
Triglyceride-
synthesizing
enzymes
Hypertriglyceridemia
Page 22
Chapter 1
3
FDA
approved
Trabectedin (ET-
743) (EU
registered only)
Tunicate NRPS-derived
Alkaloid
Minor groove
of DNA
Cancer
FDA
approved
Brentuximab
vedotin (SGN-
35)
Mollusk Antibody drug
conjugate (MM
auristatin E) –
Linear
NRPS/PKS
CD30 and
microtubules
Cancer
Phase III Plitidepsin
(Aplidine)
Tunicate Cyclic
Depsipeptide
Rac1 and JNK
activation
Cancer
Phase II DMXBA (GTS-
21)
Worm Alkaloid α7 nicotinic
acetylcholine
receptor
Cognition,
Schizophrenia
Phase III Plinabulin (NPI
2358)
Fungus Diketopiperazine Microtubules
and JNK stress
protein
Cancer
Phase II Elisidepsin Mollusk Cyclic
Depsipeptide
Plasma
membrane
fluidity
Cancer
Phase II Zalypsis
(PM00104)
Nudibranch Alkaloid DNA binding Cancer
Phase II Glembatumumab
vedotin (CDX-
011)
Mollusk Antibody drug
conjugate (MM
auristatin E) –
Linear
NRPS/PKS
Glycoprotein
NMB &
microtubules
Cancer
Phase I Marizomib
(Salinosporamide
A; NPI-0052)
Bacterium NRPS with β-
lactone & γ-
lactam
20S
proteasome
Cancer
Phase I Trabectedin
analog
(PM01183)
Tunicate NRPS Alkaloid Minor groove
of
DNA<comma>
Nucleotide
Excision
Repair
Cancer
Phase I SGN-75 Mollusk Antibody drug
conjugate (MM
auristatin F) –
Linear
NRPS/PKS
CD70 and
microtubules
Cancer
Phase I ASG-5ME Mollusk Antibody drug
conjugate (MM
auristatin E) -
linear
NRPS/PKS
ASG-5 and
microtubules
Cancer
Phase I Hemiasterlin
derivative
(E7974)
Sponge Modified linear
tripeptide
(NRPS-PKS)
Microtubules Cancer
Phase I Bryostatin 1 Bryozoan Polyketide Protein kinase
C
Cancer, Alzheimer's
Phase I Pseudopterosins Soft Coral Diterpene
glycoside
Eicosanoid
metabolism
Wound healing
Page 23
Chapter 1
4
An extreme physical and chemical condition in the marine environment create stress
that contributes to the production of a unique variety of biomolecules by marine
organisms (7). Sponges, corals and other marine invertebrates have been an ongoing
source of novel chemical structures with many of these compounds exhibiting
interesting biological activities. However, the applicability of many promising
substances was hampered due to the presence of these organisms in relatively low
amounts and the complex structures making chemical synthesis at scale difficult.
Low recovery rates (less than 1 gm of substances such as halichondrin, ecteinascidin
or bryostatin obtained from a ton of sponges, ascidia or bryozoa, respectively) as well
as problems associated with mariculture of most marine macroorganisms made it
extremely difficult to produce substances in amounts sufficient for further studies (8,
9). Thus, marine microbial bioresources such as cyanobacteria, fungi and diverse
groups of marine eubacteria were of interest since many of these organisms can be
produced through fermentation at large scale. In fact, some compounds previously
isolated from macro-organisms, such as sponges and tunicates, were actually
metabolic products of associated microbes (10).
Approximately 3000 natural products have been identified from marine micro-
organisms by the end of 2008 (11). Some marine bacteria and fungi have provided
promising new lead structures for drug discovery (12, 13). An important example is
the discovery of Cephalosporin C (a non-ribosomal peptide secondary metabolite)
from the marine fungi Cephalosporium sp. (14). Over the past decade, more than
10,000 marine natural products have been isolated from marine organisms including
marine fungi (2, 7). During this period, approximately 1000 new natural products
have been isolated from marine fungi, including terpenoids, alkaloids, shikimate-
derived metabolites, lipids and most importantly polyketides and non-ribosomal
peptides (NRPs) (14). These compounds have a potential as pharmaceuticals,
nutraceuticals and cosmeceuticals.
Page 24
Chapter 1
5
1.2. Natural products from marine fungi
Terrestrial fungi have been more widely investigated for bioactive secondary
compound production than marine fungi. Marine fungi are more difficult to collect
and grow and sometime require high salt levels, causing fermentor corrosion. These
fungi are divided into two groups on the basis of their ability to grow in marine
conditions, as obligate and facultative marine fungi (15). Obligate marine fungi grow
fast and sporulate exclusively in a marine or estuarine habitat, while facultative
marine fungi are generally obtained from fresh water or terrestrial environment that
can grow (and possibly sporulate) in the marine environment (15). Marine fungi are
mostly found in algae, corals and detritus of marine macrophytes. Over 1500 species
of marine fungi including about 530 species of obligate marine fungi are known. At
present, it is difficult to ascertain the obligate or facultative nature of fungi and
therefore, a more general expression “marine-derived fungi” is used (16). Durieu and
Montagne (1869) discovered the first obligate marine fungus on the rhizomes of the
sea grass, Posidonia oceanica. The first facultative marine fungus, Phaeosphaeria
typharum, was identified by Desmazieres in 1849 (15).
Marine fungi are major decomposers of woody and herbaceous substrates in marine
ecosystems and they also degrade dead animal (17). A broad variety of substrates are
available in marine and estuarine environments for fungal growth. These include
seaweeds, decaying leaves, mangroves, dead animals, algae and shells of various
mollusks (14). Most of these fungi grow on lignocellulosic material in the coastal as
well as deep sea environments (18). Coral reefs are also a rich source of marine fungi
that produce novel secondary metabolites due to the presence of other biotic
components present in the reefs (19). Till date, 3047 species of fungi have been
reported from aquatic habitats around the world (Table 1.2). Worldwide, nearly
100000 fungal species are known and about 27500 species are reported in India. The
higher filamentous marine fungi include 530 species in 321 genera, which includes
Ascomycota (424 sp. 251 genera), Mitosporic fungi (94 sp. 61 genera) and
Basidiomycota (12 sp. 9 genera) (20, 21).
Page 25
Chapter 1
6
Table 1.2: Fungi from aquatic habitats from around the world Adapted from (22)
Marine fungi may have developed specific metabolic pathways that are not seen in
terrestrial fungi (23, 24). Marine mangroves and algicolous fungi are significant
sources of new bioactive compounds (16). The production of secondary metabolites
seems highly dependent on the culture conditions and the origin of strains (25). The
use of seawater for isolation and growth of marine-derived fungal species can
enhance the recovery of fungi that yield secondary metabolites, as compared to the
use of media prepared in distilled water (26-30). To produce these metabolites and to
maximize the potential chemical diversity, they need to be grown in various nutrient
limited media by varying carbon and nitrogen concentration.
Fungi can be cultivated for the isolation of a number of metabolites such as
glucoamlyase, amylase, α-glucosidase, and proteases. For example, Penicillium sp.
grown under limited carbon has shown to produce penicillins, whereas same fungi
grown under phosphorus and nitrogen limitation produce cephalosphorin,
vancomycin, and carbapenems (31). It is impossible to estimate how many marine
derived fungi have been screened so far for bioactive compounds. But the number of
new bioactive compounds reported from marine fungi has increased steadily over the
years: 1 (1981), 100 (2002), 272 (2004) with l690 new bioactive compounds reported
from 2006 – 2010 (14,32,33). A broad array of pharmacological activities, ranging
Taxonomic group Number of species
Chytridiomycota 576
Freshwater meiosporic ascomycota 450
Mangrove meiosporic ascomycota 612
Marine meiosporic and mitosporic ascomycota 465
Indoldian meiosporic fungi 290
Aeroaquatic meiosporic fungi 90
Miscellaneous meiosporic fungi 405
Oomycota (Saprolegniales) 138
Basidiomycota from freshwater habitats 11
Basidiomycota from brackish and marine habitats 10
Total number 3047
Page 26
Chapter 1
7
from antimicrobial to anti-cancerous has been found in fungal metabolites (14),
although only a few marine fungal derived drugs are currently in the market (34).
1.2.1. Rate limiting factors for secondary metabolites biosynthesis in marine fungi
Secondary metabolites are synthesized mainly under stress conditions due to either
nutrition limitation or excess of carbon sources. The five main sources for the
synthesis of secondary metabolites are (1) amino acids, (2) shikimic acid pathway,
(3) polyketide biosynthesis pathway from acetyl-CoA, (4) mevalonic acid pathway
from acetyl-CoA (5) polysaccharides and peptidopolysaccharides. The production of
secondary metabolites by marine fungi varies due to several factors such as media
composition, salt concentration and other fermentation processes. The effect of sea
water concentration on hyphal growth and anti-microbial metabolite production was
studied in various marine fungal strains and was found to increase the hyphal as well
as metabolite production with increased sea water concentration (26, 27).
The antibiotic lipoxazolidinones produced by the marine fungal strain NPS8920 and
levels increase in natural sea water based media (29). Miao et al., (30), also estimated
the effect of salinity and nutrition on the growth and bioactivity of marine fungi
Arthrinium c.f. saccharicola. This study concluded that higher salt concentration
decreased fungal growth but increased bioactivity. Also, the higher concentration of
peptone and malt extract in growth media enhances fungal growth but decreases
antibacterial activity, whereas the opposite occurred at higher glucose concentrations.
Wang et al., (28), studied secondary metabolites production in the marine fungi,
Spicaria elegans at 3% and 10% salinity. Five new compounds were produced at
10% salinity, which was absent at 3% salinity. Thus it can be concluded that
regulation of physicochemical conditions is important for optimizing secondary
metabolite production in marine fungi.
1.3. Marine cosmeceuticals
The word cosmeceutical has been derived from blending of the terms „cosmetic‟ and
„pharmaceuticals‟ by Abbert Kligman in 1984 (35). Cosmeceuticals are topical or
oral cosmetic pharmaceutical hybrids intended to enhance beauty through bioactive
ingredient having a drug like benefits (36, 37). Therefore cosmetics have been placed
between non-prescribed and prescribed products (38). Cosmetics are defined as
Page 27
Chapter 1
8
substance intended to be applied to the human body for cleaning, beautifying,
promoting attractiveness without affecting its structure and function (Figure 1.1). It
is anticipated that the global cosmeceuticals market will reach US$ 61 Billion by
2020. (http://www.researchandmarkets.com/research/246mph/global)
Figure 1.1: Cosmetics and their relative branches
1.3.1. Current status of cosmetics-cosmeceuticals
A variety of lifestyle and environmental factors cause various cosmetics and
dermatological problems (37). Natural cosmeceutical products that are safe and
efficacious are important for overcoming these problems. Plant derived ingredients
have some limitations because plants can contain toxic metabolites, grow too slow or
composition varies by seasonal changes (39). Marine flora and fauna produce
chemically different biomolecules in comparison to terrestrial sources and so are of
interest, particularly where organisms can be grown in large quantities, such as
macro- and microalgae. Examples include the Greek company Apivita that is using
sea fennel in sun care products, whilst Italy-based Lacote has a comprehensive range
of anti-cellulite skin care products formulated with Guam seaweed. Sea algae, rich in
vitamins and minerals, are becoming a common source of anti-ageing actives. Other
brands are using sea minerals in their formulations, looking to emulate the success of
Dead Sea mineral-based products.
Page 28
Chapter 1
9
The popularity of marine ingredients is leading to concerns that large-scale sourcing,
or non-sustainable production methods, could disrupt marine ecosystems already
under strain. Marine microorganisms can be grown outside of the ocean in fermenters
and so are sustainable. Many novel bioactive molecules have been isolated from
marine plants, animals and microbes for cosmeceutical applications, including
phlorotannins, polysaccharides, carotenoid pigments, collagen, chitooligosaccharide
(COS) derivatives, enzymes, peptides and other natural materials. For example,
Phlorotanins from marine algae Ecklonia cava have anti-wrinkle (40) and anti
tyrosinase activity (41). Some of these biomolecules are produced commercially by
culturing specific marine organism which is used in cosmetics e.g. Myrothenones A
and B (Cyclopentenone) from Myrothecium sp. (marine fungi) and Homothallin-II
from Trichoderma viride H1-7 have skin whitening activity (42, 43). Moreover,
various marine natural products including nutritional supplement ingredients are
being developed into cosmeceutical (Table 1.3).
Table 1.3: Examples of some cosmeceutical ingredients from marine sources Adapted
and modified from (37)
Cosmetic Ingredients Marine Resources Applications/Activities
Mussel glycogen Sepia subaculeate Give smoothness brightness and luster
to skin
Aluminum silicate Sea mud Anticaking agent, Anti- psoriasis
Shell powder Oysters Skin whitening, scrubs
Turtle oil Chelonia mydas Smoothing and moisturizing agent
Phycoerythrin pigments
protein
Red algae Pigment
Proteoglycans Brown algae Boost skin collagen , improve skin
density
Omega-3-fatty acids Algae, animals Tissue repair, increase skin collagen
production
Peptide Sea weeds, sea food By-
product
Increase skin collagen production
Phytoplankton Sea animals Cellular regeneration
Collagen Marine fish Anti-wrinkle, sunscreen
However, the potential of secondary metabolites from marine fungi as a
cosmeceutical ingredient has only been partially evaluated. Only a few compounds
have been isolated and utilized as a cosmetic ingredient from marine fungi.
Therefore, there is considerable potential in screening marine fungal isolates and
their secondary metabolites for their cosmeceutical efficacy.
Page 29
Chapter 1
10
1.4. Cosmeceuticals from marine fungi
Skin is the largest organ in our body and it plays an extremely important role in
protecting our body from external environmental stress and pathogens. Skin
cosmeceuticals were developed after research on common skin problems like
hyperpigmentation, skin cancer, skin microbial infections, wound healing, and
wrinkles associated with sun damage and aging (Figure 1.2).
Figure 1.2: Worldwide major skin problems and their probable solutions
1.4.1. Marine fungi for prevention of skin aging and cancer
According to Euromonitor International, anti-aging skin care is a large and dynamic
business, covering 22% of the global skin care market, worth US$ 66 billion in 2007
and is supposed to reach US$ 131 billion by 2019 (44, 45). The United States
population of individuals over the age of 65 represented 13% in 2000 and it is
expected to increase to 20% by 2030 (46). This data indicates an upcoming
requirement for increasing efforts to prevent aging, including developing safe and
effective cosmeceuticals.
Aging is a complex, multifactorial biological process that occurs in all living
creatures at variable rates. Various surgical and topical methods have been applied to
alter the aging process (47). There are two types of skin aging processes, intrinsic
and extrinsic. The intrinsic or innate aging refers to the natural programmed cellular
aging. It is characterized by a decrease in collagen synthesis, degeneration of elastic
fiber networks, and loss of hydration. On the other hand, extrinsic aging (premature
cutaneous aging) occurs as the result of external factors such as smoking, excessive
Page 30
Chapter 1
11
alcohol consumption, poor nutrition, pollution, and particularly solar exposure. Solar
exposure mostly causes skin wrinkling and undesired pigmentation. Extrinsic aging,
also known as photo aging, has been studied extensively (48). Skin aging is governed
by intrinsic genetic factors and mediated by extrinsic influences. Telomere shortening
and metabolic oxidative damage generates reactive oxygen species (ROS), play a
critical role in the aging process. Healthy telomeres are essential for a long life of
cells but it shortens with aging. Telomerase (eukaryotic ribonucleoprotein (RNP)
complex, contains an essential RNA and a protein reverse transcriptase subunit) is an
enzyme which is responsible for maintaining the length of telomeres by an addition
of guanine rich repetitive sequences (49). Thus, regulating telomerase activity delay
the aging process.
Current research has proven that telomeres and telomerase have a strong correlation
to aging and cancer (50, 51). Telomerase (eukaryotic ribonucleoprotein, RNP)
maintains telomere length stability in almost all cancer cells. Until now there has
been no report on any topical skin care product, systemic drugs, or any other
treatment options that can target telomerase for aging and cancer therapeutic
approaches (inhibit telomerase with the intention of imparting anti-proliferative and
apoptosis inducing effects (52). Only a few biomolecules have been isolated from
various terrestrial as well as marine sources as telomerase inhibitors from marine
sources. Example: Dictyodendrins A–E, five new alkaloids were isolated from the
marine sponge Dictyodendrilla verongiformis, which inhibited telomerase
completely at a concentration of 50µg/ml (53). Marine sponge Axinella infundibula
were the source of Axinelloside A (highly sulfated lipopolysaccharide), Meridine and
ascididemin. All of these compounds strongly inhibit human telomerase at IC50
values of 2.0 µg/ml, 11 and ≥80µl respectively (54, 55) (Figure 1.3). Until now no
such activities has been reported with marine fungal secondary metabolites. Hence
exploring marine fungi for such targets may provide new molecules to treat these
problems.
Page 31
Chapter 1
12
Figure 1.3: Telomerase inhibitors from marine sources
1.4.2. Marine fungi for skin whitening
Human skin color ranges from the darkest brown to the lightest pinkish-white due to
the presence of melanin. Melanin is the major skin pigment that protects skin from
harmful UV radiation. Longer exposure to ultraviolet (UV) radiation increases skin
melanogenesis and usually results in darkening of the skin. However, it may also
occasionally lead to the development of hyperpigmentation.
The biosynthesis pathway for melanin formation was first elucidated by Raper in
1928 and later modified by Cooksey in 1997. Tyrosinase (EC 1.14.18.1), a copper-
containing glycoprotein, is located in the membrane of melanosome and produced
only by melanocytic (56). Melanogenesis takes place in the melanosomes by three
specific enzymes namely, tyrosinase, tyrosinase-related protein (TRP)-1, and TRP-2.
There are two types of melanin which are synthesized within melanosomes:
Page 32
Chapter 1
13
eumelanin (a dark brown-black insoluble polymer) and pheomelanin (light red-
yellow sulphur-containing polymer). L-tyrosine amino acid is the building stone
which acts as a substrate for the enzyme and is generally transported into the
melanosome by facilitated diffusion. The two proteins TRP-1 and TRP-2 are
structurally related to tyrosinase and share approximately 40% amino acid homology.
TRP-1 increases the ratio of eumelanin to pheomelanin and hence increases
tyrosinase stability (57, 58). Tyrosinase, catalyzes the first two steps of melanin
synthesis, that is, hydroxylation of L-tyrosine to dopaquinone that is subsequently
converted into L-dihydroxyphenylalanine (L-DOPA) through auto-oxidation
followed by oxidation of DOPA is converted to dopaquinone (59, 60). The remaining
steps of the melanogenic pathway are shown in Figure 1.4 which includes the
synthesis of eumelanin and pheomelanin.
Tyrosinase inhibitors have been proposed to be clinically useful for the treatment of
some dermatological diseases associated with melanin synthesis like
hyperpigmentation, melasma, cafe´aulait spot and solar lentigo, and are important in
cosmetics applications such as skin lightening (61). A large number of in vitro
tyrosinase inhibitors have been found, although only a few have shown to exhibit any
significant effects in clinical trials (62, 63).
Figure 1.4: Synthesis of melanin (62)
Page 33
Chapter 1
14
Table 1.4 and Figure 1.5 describe in vitro tyrosinase inhibitors from marine fungi.
Two new 3-amino-5-ethenylcyclopentenones, myrothenones A and B have been
isolated from fungus of genus of Myrothecium. Only myrothenones A exhibited
tyrosinase inhibitory activity, with an IC50 value of 0.8 muM. This compound is more
active than kojic acid (IC50 value 7.7 muM)(43), which is currently used in various
skin whitening products. The marine fungus Botrytis sp. was the source of a new α-
Pyrone derivative, 6-[(E)-Hept-1-enyl]-α-pyrone. This compound also exhibited
greater tyrosinase inhibitory activity than kojic acid (IC50 value 4.5, 15.5 μM
respectively)(64). A competitive inhibitor of mushroom tyrosinase homothallin-II
have been isolated from marine derive T. viride (42). Two new sesquiterpenes, 1β,
5α, 6α, 14-tetraacetoxy-9α-benzoyloxy-7β H-eudesman-2β, 11-diol and 4α, 5α-
diacetoxy-9α-benzoyloxy-7βH-eudesman-1β, 2β, 11, 14-tetraol, were produced as
stress metabolites in the cultured mycelia of Pestalotiopsis sp. Z233 isolated from the
algae Sargassum horneri. These compounds showed tyrosinase inhibitory activities
with an IC50 value of 14.8 μM and 22.3 μM, respectively(65).
Table 1.4: Tyrosinase inhibitors from marine fungi
Sr. No. Source Biomolecule Cosmetic
activity
References
1. Myrothecium sp.
(Marine fungi)
Myrothenones A and B
(Cyclopentenone)
Tyrosinase
Inhibitory
(43)
2. Botrytis sp.
(Marine fungi)
6-[(E)-Hept-1-enyl]-α-pyrone
(α-Pyrone Derivative)
Tyrosinase
Inhibitory
(64)
3. T. viride H1-7
(Marine fungi)
Homothallin-II Tyrosinase
Inhibitory
(42)
4. Pestalotiopsis sp.
Z233 (Fungi)
1β,5α,6α,14-tetraacetoxy-9α-benzoyloxy-
7β H-eudesman-2β 11-diol and
4α,5α-diacetoxy-9α-benzoyloxy-7βH-
eudesman-1β,2β,11, 14-tetraol
Tyrosinase
Inhibitory
(65)
Page 34
Chapter 1
15
HO
HN
O
OAbs
OH
O
NH
H
Myrothenone BMyrothenone A
OO
6-[(E)-Hept-1-enyl]-a-pyrone
HO
O
N
Homothallin II
O
O
O
HO
OO
OH
O
O
OO
O
OH
HO
OOH
OH
O
O
4a,5a-diacetoxy-9a-benzoyloxy-7ßH-eudesman-1ß,2ß,11, 14-tetraol
1ß,5a,6a,14-tetraacetoxy-9a-benzoyloxy-7ß H-eudesman-2ß 11-diol
Figure 1.5: Structures of tyrosinase inhibitors from marine fungi
1.4.3. Marine fungi for acne vulgaris
Acne vulgaris (commonly known as acne or pimples) is the most common skin
disorder caused by Propionibacterium acnes. It affects approximately 50 million
people in US, and many more throughout the world. Globally more than 80% of the
population suffers from acne at some stage in their life. Acne can be extremely
painful and cause lasting marks or scars as well as lead to psychosocial suffering.
Economically, it is estimated that US consumers spend more than 1.2 billion dollars
each year for the treatment of acne (66).
The prevalence of skin colonization by antibiotic-resistant P. acnes in acne patients
over a 10-year period (67) showed that the proportion of patients with strains
resistant to one or more commonly used anti-acne antibiotics is increasing.
Therefore, there is a need to discover new biomolecules against P. acnes. Recently,
Sargafuran obtained from marine brown algae, Sargassum macrocarpum has shown
potent anti-acne activity (68). Two unusual pyridones, trichodin A and trichodin B,
were extracted from mycelia and culture broth of the marine fungus, Trichoderma sp.
strain MF106 isolated from the Greenland Seas (Figure 1.6). The trichodin A
showed antibiotic activities against the clinically relevant microorganism,
Staphylococcus epidermidis, with IC50 values of 24 μM and 4 μM, respectively (69).
Page 35
Chapter 1
16
NH
ORO
O
H
H
Trichodin A R=H
Trichodin B R=O
OHHO
HO
Figure 1.6: Structure of Trichodin A-B
2. Conclusion
Marine research has and will continue to offer novel marine-based lead compounds
for industrial applications. However, the immense microbial diversity of the marine
environment is still only partially explored. Marine fungi are rich-sources of
structurally diverse and pharmacologically active metabolites, with great industrial
potential and accessibility, and thus they have attracted attention for health and
cosmetic applications. The above literature presents research on marine fungal
secondary metabolites and their application to skin aging, as well as for
depigmentation and antimicrobial applications in the cosmetic industry. However, the
use of fungal secondary metabolites for cosmeceutical application remains relatively
unexplored, particularly for marine fungi.
Page 36
Chapter 1
17
3. Aim of this Research
Natural products are important sources of drug and lead to drug discovery in a wide
variety of therapeutic indications. The primary aim of this study was to investigate
Indian west coast and Islands as a possible source for novel marine fungal strains that
produce secondary metabolites with cosmeceutical potential.
My research objectives to established suitable methods for isolating marine fungi
from various marine samples by plating methods and different culture conditions,
and to establish artificial marine liquid culture media for fungal fermentation.
Objectives for this project also included (a) setting up an assay model for
cosmeceutical activity screening, (b) identification of the taxonomy of isolated active
fungal strains, (c) extraction of secondary metabolites from active fungal culture
broth using bioassay guided isolation methods and (d) identification and structure
elucidation of isolated active pure compounds.
Page 37
18
Chapter 2
Isolation and purification of marine fungi from a
range of marine environment in India
Page 38
Chapter 2
19
2.1. Introduction
The marine ecosystem is one of the most extreme, complex and the largest aquatic
system on earth, which makes it difficult to fully investigate, including accessing its
biodiversity. It includes oceans, intertidal ecology, salt marsh, lagoons, estuaries,
coral reefs, mangroves, deep sea and sea floor. Marine habitats are generally divided
into two types, coastal and open ocean habitats. Most marine life is found in coastal
habitats (70). According to the Primordial Soup Theory, “the origin of life occurred
in a body of water, possibly a pond or ocean, by the combination of chemicals and
some form of energy which gave the building blocks like amino acids”, that may
have led to the evolution of the newer species (71). The marine ecosystem has a vast
variety of organisms that are different in their physiology and adaptations. According
to the Global Biodiversity Assessment by the United Nations Environment Program,
oceans consist of 178,000 marine species in 34 phyla. It is estimated that 102 fungi,
103 bacteria, and 107 viruses are likely to exist in one milliliter of seawater (72).
Marine fungi are extensively distributed in marine environments, are found on a wide
variety of substrata (73) and at varying depths (74). Most of these fungi grow on
lignocellulosic material in the coastal as well as deep sea environment (18). Coral
reefs, decaying seaweeds, sand grains and the east skins of marine invertebrates are
also a rich source of marine fungi (75). However, each substratum supports a specific
mycota, but some species may also be found on other substrata. Marine fungi are an
ecological group of organism and are to be found in all oceans of the world. Some
fungi are restricted to tropical or temperate waters while others are cosmopolitan in
their distribution (Jones, 1988). New species are still being described, especially
from new sea areas and substrata which not previously examined for example
mangroves (14, 21, 76).
In India, the west coast and the Andaman Islands are one of the most important
marine environments for its biogeological characteristics and has been not well
studied with respect to marine fungi. Marine fungi are an important class of marine
organisms that are responsible for recycling of complex organic material (77, 78) and
biodeterioration of materials in the sea (79, 80). In addition to this, they are a very
promising bioresource for discovering natural products that may be of economic
importance (14, 81). In this chapter, we present data on the diversity and occurrence
Page 39
Chapter 2
20
of culturable marine fungi on various substrata (sea grasses, wood and seaweed)
collected at various locations in the west coast and the Andaman Islands.
2.2. Materials and methods
2.2.1. Chemicals used
All analytical grade chemicals were purchased from Fischer Scientific (Mumbai,
India) and used without further purification. Potato dextrose agar (PDA), Malt extract
and Mycological peptone were procured from HiMedia (Mumbai, India) and were
sterilized by autoclaving at 1200C for 15 mins before use.
2.2.2. Study area
The study area covered the Western Coastal Plains that lies between Western Ghats
and the Arabian Sea. The plains begin at Gujarat in the north and end at Kerala in the
south. It also includes the states of Maharashtra, Goa and Karnataka. The rivers that
flow through this region are Narmada, Tapi, Zuari and Mandovi. This vast area has a
variety of niches such as the Gulf of Kutch, Gulf of Khambhat and Salsette Island.
The Gulf of Kutch is an inlet of the Arabian Sea along the west coast of India, in the
state of Gujarat. The maximum depth of Gulf of Kutch is 401 feet (122 m). The first
national marine park of India is also situated in it. There are 42 islands on the
Jamnagar coast in the Marine National Park, most of them surrounded by reefs. The
Andaman Islands form an archipelago in the Bay of Bengal between India, to the
west, and Myanmar, to the north and east.
Sample collection was done from different beaches of the north and south Goa,
which have very limited tourist activities like Arambol, Querim and Agonda beaches,
and also from the marine estuary Chapora River. Samples have been collected from
low tidal areas having high biodiversity. From Dwarka, samples have been collected
from a small pit of sea water near the sea which was rich in marine algae and
sediment. Various marine samples were also collected from Havelock beach in the
Andaman Islands of India (Figure 2.1).
Page 40
Chapter 2
21
Figure 2.1: Sites of sample collection in India (Goa, Gujarat and Andaman Islands)
2.2.3. Collection of samples
Sample collection was done after the rainy season during no moon days and low-tide
periods in November to December, since in the rainy season very high amount of
terrestrial water have been mixed with sea water causing contamination with
terrestrial organisms. Materials from the deep intertidal zone (depth ~5-10 meters)
were sampled. Marine algae, sea sediments/ estuary sediments, sea plants, mangrove
plants (wood, leaves, and roots), dead animals and sea water were collected in sterile
polypropylene bags and screw cap bottles, respectively. The collected samples were
brought to the laboratory for isolation and purification of marine fungi.
Marine Algae: - Algae samples (Caulerpa sp., Halimeda sp., Padina sp.,
Sargassum sp. and unidentified alga) were collected from different sites that
are associated with coral, mangrove and woods along with sea water.
Sea sediments: - Sediments were collected from the inner part of the sea (2-
3 km from beach shore) along with sea water, using a large spatula (12”
length).
Page 41
Chapter 2
22
Sea plants: - Sea plants were collected when they come up during low tide,
in a plastic bottle along with sea water.
Mangrove plants: - Mangrove plant species (Avicenna marina and
Rhizophora sp.) were collected and stored in a sterile zip bag.
Dead animals: - Dead Sea animals like sea mussels and sea shell were
collected sedimentation sites.
Sea Water: - Stratified samples of marine water were collected in pre sterile
screw cap plastic 5 L bottle from six different depths, which varied from 5 to
200 centimetres in depth.
2.2.4. Isolation of marine fungi
The sediment samples were diluted at 10 and 100 fold with autoclaved aged seawater
(Sea water collected from Indian Ocean was stored at room temperature for more
than 5 years and this was provided by Dr. Sandeep Garg from Goa University, India)
and sea water was used directly as inoculum. 100 µl of each sample was spread onto
PDA media plates (39 gm potato dextrose agar in 1,000 ml of naturally aged
seawater, pH 7.5 ± 0.2). The antibiotics, streptomycin and penicillin, at 100 and 50
mg/L concentrations respectively, were added to each agar plate to inhibit the growth
of bacteria. Algal samples were rinsed with sterile aged seawater several times until
sea sand was removed and then plated on media plates. Likewise, plant material and
dead animals were sterilized with 70 % ethanol for 10 seconds to kill the residual
epiphytes and washed with sterile seawater to remove ethanol, and dried with sterile
tissue paper. Subsequently, the samples were cut into pieces using a sterilized knife
and pressed onto the media to inoculate endophytic fungi. Two replicate media plates
were used for each sample. All plates were incubated at room temperature (28 ± 2
°C) for 21 days. After 2 days of incubation, media plates were examined daily for the
presence of developing fungal growth. Distinct fungal colonies on the media plates
were then transferred to new media plates with artificial sea water (ASW) (82),
instead of natural sea water, for further purification and maintenance (83).
Page 42
Chapter 2
23
2.2.5. Growth assessment of marine-derived fungal strains using different media
conditions
Radial growth experiments were performed to assess the growth and development of
isolated marine fungi to investigate the importance of specific nutrients. The
experiments were performed on the following media:
1. Media A (PDA in 100% sea water with pH 7.5 (High nutrient)
2. Media B (Sea water media (SWM), 1.0% glucose, 0.5% peptone, 0.1% yeast
extract and 1.7% agar, final pH of 7.5) (Low nutrient)
The agar plates (90mm) were inoculated at a central insertion point and the colony
diameters were measured after 2, 5, 7, 10, 15 and 20 days of cultivation in an
incubator at 28±2°C. Radial growth of a fungal colony measured by Vernier caliper,
when the growth was not round the average of length and width was taken into the
account. Each experiment was carried out in triplicate.
2.3. Results and Discussion
A total of 70 fungal isolates were isolated from marine samples collected from
various locations on the west coast and Islands of India (Figure 2.2, Table 2.1).
Coral reefs are considered an excellent source for the isolation of marine fungi and
other organisms having bioactivity (75). 28 Fungal strains were isolated from
Dwarka (22.2377N x 68.9673E, Gujarat) and 13 strains from Paldi (23.0121N x
72.5589E, Gujarat). A total of twelve marine fungi were isolated from sediments
collected from havelock beach Andaman Islands (11.7400N x 92.6586E). 17 fungal
strains were isolated from marine samples collected from different beaches in Goa
(28.38N x 72.12E) (Table 2.2, Figure 2.3). However, several of these fungal isolates
did not show any growth on lab prepared artificial media.
Page 43
Chapter 2
24
Table 2.1: Samples collected from different parts of India (21.7679° N, 78.8718° E)
Sr.
No
Name of
the Place
Coordinates of
the Place
Types of
sample
collected
Total
Number
of sample
collected
Conditions/ Date
Goa§, India (28º38' N x 72°12' E)
1. Cacra
Beach,
North Goa
15° 26' 52" N x
73° 50' 19" E
Sea
sediments,
sea weeds,
sea animals,
sea water
10 Two day previous to NMD*
Time:- 2-4 PM Low tide (-0.06),
13/11/2012
2. Arambol
Beach,
North Goa
15° 41' 14" N x
73° 42' 11" E
Sea
sediments,
sea weeds,
sea animals,
sea water
10 One day previous to NMD
Time:- 3-5 PM Low tide (-0.01),
13/11/2012
3. Querim
Beach,
North Goa
15° 42' 57" N x
73° 41' 25" E
Sea
sediments,
sea weeds,
sea animals,
sea water
15 NMD Time:- 4-5 PM
Low tide (-0.12), 14/11/2012
4. Agonda
Beach,
South Goa
15° 2' 41" N x
73° 59' 8" E
Sea
sediments,
sea weeds,
sea animals,
sea water
12 One day after NMD
Time:- 3:30-5 PM Low tide (-
0.11), 14/11/2012
5. Chapora
River, North
Goa
15° 36' 21" N x
73° 44' 26" E
Sediments,
water.
2 Two day after NMD
Time:- 4:30-5:30 PM Low tide (-
0.11), 15/11/2012
Gujarat, India (23º00' N x 72°00' E)
6. Dwarkanath
Temple,
Dwarka
22.23' 77"N x
68.96' 73"E
Sea
sediments,
algae, sea
water
10 One day previous to NMD
Time:- 1-3 PM Low tide (-0.02),
20/12/2012
7. Paldi 23.01' 21"N x
72.55' 89"E
Sea
sediments,
algae, sea
water
5 One day previous to NMD
Time:- 4-5 PM Low tide (-0.02),
20/12/2012
Andaman and Nicobar, India (11.7400N x 92.6586 E)
8. Havelock
island
11.58N x
93.00E
Sea
sediments,
algae, sea
water, wood.
5 One day previous to NMD
Time:- 3-5 PM , 29/12/2012
Note: - * NMD: - No moon day
§:- These beaches are relatively less explored by tourists and less contaminated
Page 44
Chapter 2
25
Figure 2.2: Different locations where sampling was done and material collected
Page 45
Chapter 2
26
Table 2.2: Pure fungal isolates obtained from the samples collected from different
habitats
Sr.
No.
Place Coordinates of the
Place
No of
fungal
isolates
Culturable
fungal
isolates
Culture
conditions
for isolation
A. Dwarka (Gujarat) 22.2377N x 68.9673E 28 10
PDA media
in sea water,
28ºC
B. Paldi (Gujarat) 23.0121N x 72.5589E 13 06
C. Andaman & Nicobar 11.7400N x 92.6586E 12 11
D. Goa 28.38N x 72.12E 17 08
Page 48
Chapter 2
29
Figure 2.3: Plates showing the diversity of culturable fungal isolates from different
parts of India (D= Dwarka, P= Paldi, AN= Andaman & Nicobar, G=Goa)
Page 49
Chapter 2
30
2.3.2. Effect of nutrient concentration on fungal growth
Mycelial growth of the isolated marine fungi in different nutrient concentrations
(media A and media B) was investigated after incubation at 28°C and the results are
summarized in Table 2.3 and 2.4. The nutrient concentration greatly affected the
growth of fungi. The fungus grew two times faster in high-nutrient media (medium
A) than in low-nutrient media (medium B). The density and appearance of mycelia
was greater in media A, however, sporulation occurred earlier in media B (Figure 4).
Of the 35 fungi isolates, 3 strains grew more abundantly in media B, while the
growth of remaining strains was suppressed. These findings will be utilized in later
work to optimize bioactive metabolite production in these fungi.
Table 2.3: Fungal mycelial growth on medium A
Fungal code Days Radial growth diameter (in mm)
2nd 5th 7th 10th 15th 20th
P2 12 35 65 FPG FPG -
P3/2 GI 15 30 40 60 FPG
P4 10 15 19 30 40 55
P8 24 50 FPG FPG FPG -
P9 GI 30 65 FPG FPG -
P10 16 28 40 50 66 FPG
D2 GI 12 20 29 35 43
D3 00 GI 10 24 40 66
D4 22 55 FPG FPG - -
D5 GI GI 10 20 25 30
D6 13 24 40 50 60 FPG
D8 GI 18 29 40 50 FPG
D15 GI 14 24 40 52 60
D25 25 28 FPG FPG - -
D28 00 22 50 65 FPG -
D34 15 28 55 70 FPG -
AN1 35 FPG FPG FPG FPG -
AN2 00 10 19 25 30 39
AN4 GI 20 35 45 52 70
AN5 10 25 40 50 65 FPG
AN6/1 20 28 40 46 53 FPG
AN6/2 40 FPG FPG FPG FPG -
AN7 GI 22 35 50 70 FPG
AN9 15 22 30 40 56 FPG
AN10 10 20 35 50 65 FPG
AN11 30 60 FPG FPG FPG FPG
AN12 30 FPG FPG FPG FPG FPG
G2 00 GI 40 70 FPG FPG
G3 25 FPG FPG FPG FPG FPG
G4 10 16 29 35 52 FPG
G7 16 40 70 FPG FPG FPG
G8 50 7 FPG FPG FPG FPG
G10 GI 25 45 60 FPG -
Page 50
Chapter 2
31
G14 GI 10 30 45 50 62
G15 GI 10 35 45 49 56
Table 2.4: Fungal mycelial growth on medium B
Fungal code Days Radial growth diameter (in mm)
2nd 5th 7th 10th 15th 20th
P2 12 26 55 FPG FPG FPG
P3/2 GI 13 25 35 55 FPG
P4 9 13 20 28 33 39
P8 14 40 FPG FPG FPG FPG
P9 GI 15 65 FPG FPG FPG
P10 7 20 35 55 65 FPG
D2 GI 10 16 25 32 40
D3 00 GI 30 45 55 FPG
D4 16 35 FPG FPG FPG FPG
D5 GI GI 9 20 25 30
D6 12 25 40 60 67 FPG
D8 GI 18 30 40 60 FPG
D15 GI 10 2 25 40 49
D25 15 40 FPG FPG FPG FPG
D28 00 20 45 65 FPG FPG
D34 12 22 40 50 57 FPG
AN1 24 55 FPG FPG FPG FPG
AN2 GI 9 15 20 28 34
AN4 GI 25 35 55 63 70
AN5 GI 25 36 50 70 FPG
AN6/1 15 20 32 41 50 FPG
AN6/2 33 60 FPG FPG FPG FPG
AN7 GI 20 30 55 70 FPG
AN9 13 22 28 45 50 FPG
AN10 GI 10 30 50 60 FPG
AN11 00 30 FPG FPG FPG FPG
AN12 25 FPG FPG FPG FPG FPG
G2 GI 13 42 50 62 FPG
G3 20 FPG FPG FPG FPG FPG
G4 10 15 19 25 29 35
G7 10 25 70 FPG FPG FPG
G8 258 60 FPG FPG FPG FPG
G10 GI 18 20 30 68 FPG
G14 GI 5 20 30 40 44
Page 51
Chapter 2
32
G15 GI 5 25 25 45 49
Note: GI= Growth initiate, FPG= Full Plate Growth, D= Dwarka, P= Paldi, AN= Andaman &
Nicobar, G=Goa
Figure 2.4: Fungal growth differences with nutrient avability on solid culture medium
Page 52
Chapter 2
33
2.4. Conclusion
70 marine fungi were isolated from various samples collected from the west coast
and Andaman Island of India. Of these, only 35 strains were culturable. Radial
growth experiments on different solid media plate showing a clear difference in
fungal mycelia growth and spore formation. Higher mycelial production was
observed in nutrient rich media and earlier spore formation was observed in nutrient
deficient media.
Page 53
34
Chapter 3
Screening for antimicrobial activity of marine fungi
against bacteria causing skin and wound infections in
humans
Page 54
Chapter 3
35
3.1. Introduction
Millions of people worldwide are affected by infectious diseases caused by bacteria
and fungi (84). Skin and skin structure infections (SSSI) represent a significant
category of infectious disease. Acute bacterial skin and skin-structure infection
(ABSSSI) are among the most prevalent in the world and the 28th most common
infections diagnosis in hospitalized patients (85, 86). According to U.S. Food and
Drug Administration (FDA), ABSSSI can be divided into two categories,
uncomplicated and complicated. Uncomplicated includes simple abscesses,
impetiginous lesions, furuncles, and cellulitis, mainly caused by Staphylococcus
aureus and Streptococcus pyogenes. Many traumatic wound infections can also be
considered uncomplicated when they are the result of common skin colonizers that
have entered through a break in the skin‟s natural defenses. These infections are
typically monomicrobial and caused by Gram positive organisms (87). Complicated
SSSIs characteristically involve deeper soft tissue or require significant surgical
intervention, such as infected ulcers, burns, and major abscesses or a significant
underlying disease state that complicates the response to treatment (88). The
complicated category includes infections either involving superficial infections or
abscesses in an anatomical site, such as the rectal area, where the risk of anaerobic or
Gram-negative pathogen involvement is higher and should be considered
complicated infections (89) (Figure 3.1). Antibiotics are among the most commonly
used drugs. Since the discovery of penicillin by Sir Alexander Fleming in 1928,
antibiotics have protected billions of lives and played an important role in human
history. Unexpectedly, many pathogens have developed resistant towards current
antibiotics and this problem has become more and more serious (90). Additionally,
the revitalization of almost vanished pathogens like Mycobacterium tuberculosis and
the emergence of some new infectious diseases, such as cryptococcal meningitis,
toxoplasmosis, H1N1, Ebola and severe acute respiratory syndrome (SARS) (90, 91).
All these new problems necessitate the continuous search for novel and alternative
antibiotics and antifungals.
Page 55
Chapter 3
36
Figure 3.1: Causative pathogens involves in complicated skin infections (92)
Natural products have a wide range of structural diversity and a history of discovery
as new and novel antibiotics and chemotherapeutic agents. Terrestrial bacteria and
fungi have been wisely screened as sources of valuable bioactive metabolites with
novel structures for antibiotic purposes (93-95). However, the rediscovery of high
numbers of previously reported compounds has significantly diminished the study of
the terrestrial microbial resource (95). Recently, less explored habitats and ecological
niches such as the oceans and extreme conditions are being investigated. Recent
reviews demonstrate that marine fungi have become promising sources of bioactive
compounds (14, 96, 97). Due to unique physiochemical conditions in the marine
environments, marine-derived fungi have produced a variety of novel bioactive
compounds that have a potential for pharmaceutical and industrial uses (98, 99).
However, limited numbers of novel marine fungi have been isolated from marine
habitats as compared to their estimated high biodiversity (100). Research on marine
fungi has been relatively neglected, although the fungi are extremely potent
producers of secondary metabolites and bioactive substances.
In the last decade, many novel bioactive natural products from marine fungi have
been discovered that possess cytotoxic, anticancer, antiviral, antibacterial or
antifungal activities (32, 97). Marine fungal produced a wide range of secondary
metabolites belonging to the alkaloids, macrolides, terpenoids, peptide derivatives
Page 56
Chapter 3
37
and other structure classes (101). These marine fungal derived compounds have
provided new drug candidates to fight the infectious diseases (81). Although the most
famous instance was the discovery of cephalosporins (non-ribosomal peptide) with
cephalosporin C from a marine strain of Acremonium chrysogenum in 1945 by G.
Brotzu (102), there are also more recent promising examples which include, halovir
and its naturally occurring analogs, which are potent inhibitors of Herpes simplex
viruses 1 and 2 from the marine-derived fungus of the genus Scytalidium (103). The
sponge-derived fungus Penicillium chrysogenum provides a new alkaloid
sorbicillactone A, with strong activity against leukemia cells and low cytotoxicity
(104). The marine fungus Pestalotia sp. was the source of the new chlorinated
benzophenone compound pestalone, which showed potent antibiotic activity against
Methicillin-resistant Staphylococcus aureus (MRSA, MIC=37 ng/mL) and
vancomycin-resistant Enterococcus faecium (VREF, MIC=78 ng/mL), revealing its
potential as a new antibiotic (105).
The aim of this study was to evaluate collected marine fungal strains from west coast
and Islands of India for their ability to prevent the growth of causative pathogens
involves in complicated skin infections. All 35 fungal strains that were able to be
grown in media were screened for antibacterial activity and then the most active
isolates were subjected to microscopic analysis and molecular identification using
molecular biological techniques. Scanning electron microscopy (SEM) was also used
to study the possible effects of extracts on targeted bacterial cells.
Page 57
Chapter 3
38
3.2. Materials and methods
3.2.1.. Chemicals used
All analytical grade chemicals were purchased from Fischer Scientific (Mumbai,
India) and were used without further purification. Nutrient agar (NA), Nutrient broth
(NB), Brain heart infusion agar (BHIA), Brain heart infusion broth (BHIB) and
Müller-Hinton agar were procured from HiMedia (Mumbai, India) and were
sterilized by autoclaving at 1200C for 15min at 15psi before use.
3.2.2. Test organisms
3.2.2.1. Marine fungi
35 fungal strains used in this work were isolated from various marine samples
collected from west coast and Islands of India (Chapter 2, Table 2.2 and Figure 2.3 in
Section 2.3.1)
3.2.2.2. Bacterial strains
The following microorganisms were used for antimicrobial screening: Escherichia
coli (MTCC-443), Pseudomonas aeruginosa (MTCC-424), Staphylococcus aureus
(MTCC-96), Staphylococcus epidermidis (MTCC-3615), Micrococcus luteus
(MTCC-106), Bacillus subtilis (MTCC-121), Bacillus megaterium (MTCC 1684)
and Propionibacterium acnes (MTCC-1951). These organisms were procured from
Institute of Microbial Technology (IMTECH) Chandigarh, India.
3.2.2.3. Bacterial inoculum
A loopful of pure colonies of the all tested microorganisms, except P. acnes, was
inoculated into 20 ml nutrient broth and incubated at 37°C for 4 h. P. acnes was
inoculated into 20 ml of brain heart infusion media broth with 1% glucose for 72 h
under anaerobic conditions. Anaerobic condition during media preparation was
maintained as described by Singh et al., 2014 (106). The turbidity of all actively
growing bacterial suspension was adjusted to match the turbidity standard of 0.5
McFarland standard [(1.5 x 108 colony-forming unit, CFU/ml), prepared by mixing
0.5 ml of 1.75% (w/v) barium chloride dihydrate to 99.5 ml of 0.18 M (v/v)]
sulphuric acid with continuous mixing. The bacterial suspension so prepared was
used for testing their sensitivity to the samples under investigation (107).
Page 58
Chapter 3
39
3.2.3. Broth fermentation and extraction
All fungal strains were cultured in 500 ml Erlenmeyer flasks containing 200 ml of
potato dextrose broth (PDB, HiMedia) and malt extract broth (malt extract 17gm/L,
mycological peptone 3gm/L) in (ASW), separately at 28 ± 2°C for 15-20 days under
shaking conditions at 140 rpm. After 20 days fermentation (Initially fungal growth
curve study was performed using ergosterol assay to evaluation optimum growth in
liquid broth), broths were separated from the mycelium by filtration. The supernatant
was mixed with 10% activated Diaion HP-20 resin (Mitsubishi Chemical Co.) and
the mixture was shaken for 30 min on a shaker. Then the mixture was packed in a
glass column, washed with distilled water until the eluent was no longer cloudy and
eluted with 50 ml methanol. Methanol was evaporated using a rotary evaporator
(BUCHI Rota vapor R-200), and crude extract was collected and stored in the cold
(108). The fungal mycelia were also soaked in methanol for 24 hours. The methanol
layer was collected and evaporated to dryness to give the cell methanol extract. The
broth and mycelial extracts were compared on TLC and when they were found same
both the extracts were pooled (Figure 3.2). The dry crude extracts were dissolved in
autoclaved Milli-Q water to prepare stock solutions of 5 mg/ml and kept for
biological testing.
Figure 3.2: Fungal secondary metabolites extraction
Page 59
Chapter 3
40
3.2.4. Antimicrobial assay in vitro
An agar well-diffusion method described by (109) was used to determine the
antimicrobial activity. Mueller Hinton agar no. 2 (HiMedia, India) was prepared and
cooled to 40 - 45ºC and the bacterial inoculum (1.5×108 CFU/mL, 0.5 McFarland)
prepared above was then added aseptically to the molten agar and poured into sterile
petri dishes to give a solid plate. Wells (6 mm diameter) were made in each of these
plates using sterile cork borer. The wells were filled with 50 µl of test compound (5
mg/ml). The plates were first incubated at 4 ºC for 15 min and then at 37ºC for 18-24
h under aerobic and anaerobic conditions, respectively. The antimicrobial spectrum
of the extract was determined for the bacterial species in terms of zone sizes around
each well. The diameters of zones of inhibition (ZOI) produced by the test were
recorded and compared with those produced by positive control antibiotic,
tetracycline (5 mg/mL, Sigma-Aldrich). For negative control, pure solvent
(autoclaved Milli-Q water) were used instead of the extract. The experiment was
performed two times in triplicates to minimize error and to check the reproducibility
of results. The average values were recorded.
The % antimicrobial activity was calculated by applying the expression:
3.2.5. Determination of minimum inhibitory concentration (MIC)
The MIC of active extracts were determined by a microdilution assay in 96-well
microtiter plates according to the broth microdilution guideline of the Clinical and
Laboratory Standards Institute (CLSI)(110). The fresh cultures were prepared at 24 h
and 72 h broth cultures of E. coli, P. aeruginosa, S. aureus, S. epidermidis, M. luteus,
B. subtilis, B. megaterium and P. acnes and OD was set at 0.5 McFarland standard
(1.5×108 CFU/mL) at 600 nm with respective media broth. The bacterial suspension
and the serially diluted (1, 0.5, 0.25, 0.07 mg/mL) fungal crude extracts were added
to 96-well plates to obtain the final volume of 200 µl. The microplates were
incubated at 37˚C with continuous shaking. After 18 h and 48 h (for P. acne), the
optical density at 600 nm was measured with a microplate reader. Tetracycline was
% Inhibition= 100 - (ZOI positive control − ZOI sample) / ZOI positive control ×100
Page 60
Chapter 3
41
used as positive controls. The MIC values were determined at the zero optical density
concentration. All experiments were repeated three times.
3.2.6. Determination of the antibacterial mechanism
Extracts with strong antimicrobial activity were further investigated for their possible
effects on targeted cells by scanning electron microscopic analysis. All test
organisms were grown overnight to mid-logarithmic phase or at a fixed OD of 1.5 at
600 nm. All test organisms in the present study were treated with a fixed
concentration of 2 mg/mL of crude fungal extracts and incubated at 37˚C with
continuous shaking. After 18 h and 48 h (for P. acne) the culture was centrifuged at
5,000 rpm for 5 min; the supernatant was removed and washed three times with
startle water. Test organisms were then fixed in 2.5% glutraldehyde in 25mm
phosphate buffer solution (PBS) for 5-6 hrs at 4°C, then washed with PBS 3 times for
10 min. Then the sample was dehydrated with an ethanol series (30%, 50%, 70%,
90% and 100% ethanol). Samples were dried using a critical point dryer (Emitech
K850, Berkshire, U.K.) were sputtered coated with gold and palladium coating at
120mA for 15 mins using sputter coater (Quorum Technologies SC7620, Berkshire,
U.K). The samples were scanned under SEM (Model EVMA10, ZEISS, Germany) at
TERI-Deakin Nano Biotechnology Centre.
3.2.7. Morphological and molecular characterization of potential marine fungi strain
The bioactive fungal isolates were identified initially by morphological
characterization by scanning electron microscopy (SEM, Model EVMA10, ZEISS,
Germany). Subsequently, they were identified by molecular techniques based on the
analyses of their nuclear ribosomal internal transcribed spacer (ITS) regions.
3.2.7.1. Scanning electron microscopy (SEM) of fungi
Morphological features of selective fungal isolates were observed through SEM (Carl
Zeiss, Oberkochen, Germany). Fungal isolates were cultured on PDA sea water
media and incubated at 280C ± 2 for 4-5 days. After that, fungal growth was taken
and then immersed in a fixative solution (Modified Karnovsky‟s fixative 2.5%
glutaraldehyde- 2.5% paraformaldehyde, 0.05M cacodilate buffer, 0.001M CaCl2) at
pH 7.2, followed by washing with Cacodilate buffer (thrice for 10mins each). Then
post-fixation was done by 1% osmium tetraoxide solution and water for 1hr (111).
Page 61
Chapter 3
42
The samples were then washed with sterile distilled water three times and then
subjected to dehydration in acetone (25%, 50%, 75%, 90% and 100%) for 10 min
each followed by critical point drying (CPD) (Emitech K850, Berkshire, U.K.). The
samples were assembled on double-sided carbon tape placed on aluminum stubs. The
samples were then coated with gold-palladium in a sputter coater (Quorum
Technologies SC7620, Berkshire, U.K.) and viewed in SEM at an accelerating
voltage of 10kV.
3.2.7.2. DNA extraction, PCR amplification and sequencing
Fungi were cultured in potato dextrose broth (PDB) in ASW for one week. Fungal
genomic DNA was performed using the DNeasy Plant Mini Kit (Qiagen) following
manufacturer‟s instruction. Primer pairs ITS1/ITS4 (5‟-TCC GTA GGT GAA CCT
GCG G-3‟/ 5‟-TCC TCC GCT TAT TGA TAT GC-3‟) and
ITS1F/ITS4B(5‟CTTGGTCATTTAGAGGAAGTAA3‟/5‟CAGGAGACTTGTACA
CGGTCCAG-3‟) were used for the PCR reactions (112). The final PCR reaction mix
was of 25 µl reaction volumes containing 2.5 µl of 10x buffer, 1.5 µl of MgCl2 (25
mM), 0.5 µl of dNTP (10 mM), 1 µl of ITS1 primer (5 pm), 1 µl of ITS4 primer (5
pm), 0.2 µl of Taq Polymerase (2.5 U), 3 µl of DNA sample (5 µg/ ml), and
remaining volume was made up using sterile Milli-Q Water. The PCR reaction was
carried out in Veriti 96-well Thermal Cycler (Applied Biosystems, Massachusetts,
U.S.A) with conditions as follows: denaturation for 5 min at 94ᵒC, 33 elongation
cycles (50 s at 95˚C, 50 s at 56˚C, 1 min at 72ᵒC) final extension for 10 min at 72˚C
and last at 4˚C. Negative controls were used to confirm the absence of contamination.
The final products were analyzed by electrophoresis on 1% Agarose (Sigma-Aldrich,
St. Louis, USA). The amplified DNA was cut from the gel using Gel extraction kit
(Qiagen, Germany). The purified PCR-DNA products were sequenced by Xcelrislabs
Ltd., an Indian Biotechnology Company using the same primers. The sequences were
analyzed by Finch TV 1.4.0 (113). The sequences were then compared with the
NCBI GenBank database by the BLASTN program. Phylogenetic relationships were
estimated using MEGA7.0.18 (114).
Page 62
Chapter 3
43
3.3. Results and discussion:
3.3.1. Antimicrobial screening
Organic extracts of fermentation broth and mycelia of the 35 isolated marine fungi
strains were screened for antibacterial activities at 5 mg/mL concentration against
eight human pathogenic bacteria (E. coli, P. aeruginosa, S. aureus, S. epidermidis,
M. luteus, B. subtilis, B. megaterium and P. acnes). As showed in Table 3.1, 18
fungal strains (41.8 %) displayed different levels of antibacterial activities against the
tested pathogenic bacteria. Among those, the malt extracts of fungal strains Dwarka
5, Andaman 12, Goa 10 showed the strongest inhibition (93%, 86% and 83%,
respectively) activity S. aureus. PDA extract of Goa 10 and malt extracts of
Andaman 12 and Goa 3 showed the strongest inhibitory activity against M. luteus,
with 77%, 86%, 75%, respectively. Similarly, the growth of B. subtilis was strongly
inhibited by malt extracts of Dwarka 5 and Andaman 10 and PDA extract of
Andaman 10. PDB extracts of fungal strains Andaman 10 and Andaman 11 showed
79%, 66% inhibition activity, respectively, against B. megaterium. The extract of
Dwarka 5 showed higher inhibitory activity then did the positive control. The Growth
of anaerobic bacteria P. acnes was strongly inhibited by PDA extracts of Dwarka 5
and Goa 10 and malt extract of Andaman 12 (60%, 60% and 70%, respectively).
PDA extracts of Dwarka 5 and Andaman 7 and malt extract of Andaman 10 all
showed higher inhibition then the positive control against S. epidermidis. Growth of
gram negative bacteria P. aeruginosa was effectively inhibited by PDA extracts of
Dwarka 5 and Dwarka 6 (87%, 50%, respectively). Only PDA extract of Andaman
10 showed inhibition against E. coli.
In the present study, we found that crude extracts of some fungi had significant
antibacterial activities. This indicates that different fungi can produce intracellular
bioactive metabolites or secrete extracellular bioactive compounds. In addition, the
results indicated that the fungal extracts exhibited higher inhibition activities to
Gram-positive bacteria, such as P. acnes, S. aureus, B. subtilis and B. megaterium
than to Gram-negative bacteria, which might be a result of different cell wall
compositions of Gram-positive and Gram-negative bacteria. Many diseases are
known to be caused by gram-positive bacteria, such as infections of the respiratory
tract and skin. The gram- positive bacteria can produce exotoxin which can infect
humans. The fungi with higher bioactivity toward gram-positive bacteria are a
Page 63
Chapter 3
44
possible source of new drug leads for development to eventually treat these diseases.
Our results indicate that the marine-derived fungi isolated in this study are a
promising source of natural product candidates for isolation and structural studies.
Dwarka 5, Andaman 7, 10 and 12 were particularly promising and exhibited a broad
range of activity. Subsequent experiments were conducted to determine minimum
inhibitory concentrations and mode of action of selected fungal extracts.
Page 64
Chapter 3
45
Table 3.1: Antibacterial activity of crude fungal extracts against pathogens involves in
complicated skin infections by agar well-diffusion method
Zone of inhibition
No
.
Marin
e
Fungi
Code
Media
Extract
Gram (+) bacteria Gram (-)
bacteria
S.
aureu
s
M.
luteu
s
B.
subtili
s
B.
megaterium
P.
acnes
S.
epidermidi
s
E.
col
i
P.
aeruginos
a
Diameter ( in mm) Inclusive of 6 mm of well
1. P 2 PDA - - 12 12 - - - -
MALT - - - - - - - -
2. P 3/2 PDA - - - - - - - -
MALT - - - - - - - -
3. P 4 PDA 15 - - - - 16 - -
MALT - - - - - - - -
4. P 8 PDA 11 20 - - 15 - -
MALT - - - - - - - -
5. P 9 PDA - - - - - - - -
MALT - 10 - - - - -
6. P 10 PDA - - - - - - - -
MALT - - - - - - - -
7. D 2 PDA - - - - - - - -
MALT - - - - - - - -
8. D 3 PDA - - - - - - - -
MALT - - - - - - - -
9. D 4
PDA - - - - - - - -
MALT - - - - - - - -
10. D 5
PDA 25 20 22 25 30 27 - 35
MALT 28 22 23 25 30 12 Hz - 35
11. D 6
PDA 15 17 13 12 15 11 Hz - 20
MALT 16 17 12 12 17 16 - 20
12. D 8
PDA - - - - - - - -
MALT - - - - 16 - - -
13. D 15
PDA 11 - - - 10 - - -
MALT - - - - - - - -
14. D 25 PDA - - - - - - - -
MALT - - - - - - - -
15. D 28 PDA - - - - - - - -
MALT - - - - - - - -
16. D 34 PDA - - - - - - - -
MALT - - - - - - - -
17. G 2 PDA - - - - - - - -
MALT - - - - - - - -
18. G 3 PDA - - - - - - - -
MALT 23 34 11 12 30 - - 15
19. G 4
PDA 16 16 15 15 10 15 Hz - 15 Hz
MALT
- - - - - - - -
20. G 7
PDA - - - - - - - -
MALT - - - - - - - -
21. G 8 PDA - 20 15 - 18 16 - -
MALT - 16 14 - 16 - -
22. G 10 PDA 21 35 - - 30 - - 15
MALT 25 32 - - 30 - - 12
Page 65
Chapter 3
46
Note: Hz = Hazy, D= Dwarka, P= Paldi, AN= Andaman & Nicobar, G=Goa
3.3.2. Determination of minimum inhibitory concentration (MIC)
The MIC of all active crude extracts was determined using a colorimetric micro
dilution method. We have found that all active crude extract have shown 90-99 %
inhibition at 1 mg/ml concentration against their respective bacterial strains (Figure
3.3 A, B). We can conclude that the MIC values of the best active crude extracts
ranged from 1 to 1.5 mg/ml. However this is the MIC value of crude extract and after
getting bioactive compound one can decide the dose. It will also be decided after
checking the toxicity dose of active principle. Further purification and identification
of active compounds are described later in this thesis.
23. G 14 PDA - - - - - - - -
MALT - - - - - - - -
24. G 15 PDA - - - - 10 - - -
MALT - - - - - - - -
25. AN1 PDA - - - - - - - -
MALT 7 - - - - - - -
26. AN2 PDA - - - - - - - -
MALT - - - - 15 - - -
27. AN4 PDA - - - - - - - -
MALT - - - - - - - -
28. AN5 PDA - - - - - - - -
MALT - - - - - - - -
29. AN6/
1
PDA - - - - - - - -
MALT - - - - - - - -
30. AN6/
2
PDA - - - - - - - -
MALT - - - - - - - -
31. AN7 PDA - 11 7 - 20 22 - 16
MALT - - - - - - - -
32. AN9 PDA - - - - - - - -
MALT - - - - - - - -
33. AN10 PDA 17 17
Hz
20 19 10 16 15 16
MALT 20 20 22 20 25 20 - 17
34. AN11 PDA 10 20 16 16 17 16 - -
MALT - 11 7 - - - - -
35. AN12 PDA 15 19 - - - - - -
MALT 26 39 14 14 35 - - 15
36. Tetra WATER 30 45 25 24 50 16 35 40
Page 66
Chapter 3
47
Figure 3.3 A, B: MIC of active fungal crude extracts against respective bacteria
3.3.3. Mechanism of action (SEM analysis)
The effects of the most active crude extracts against their susceptible test
microorganisms were investigated by SEM. SEM images of the targeted 8 bacterial
cells revealed ultrastructural changes due to the active extracts. Control bacterial
cells had well defined, intact shapes and were smooth. After treatment with crude
extract (2mg/mL) for 18 hr. the cells showed considerable morphological alterations,
including deformation, shrinkage, collapsed and broken cells. Cell wall shrinkage
Page 67
Chapter 3
48
and breakage were observed in S. aureus treated with D5, AN12 and G10 fungal
extracts (Figure 3.4). Cell wall shrinkage and breakage were also observed in S.
epidermidis treated with D5, AN7 and AN10 (Figure 3.5). Membrane invagination
was observed in B. megaterium when treated with D5, AN10 and AN11 (Figure 3.6).
Similarly, cell surface deformation was noticed in the cell surface of P. aeruginosa
and E.coli cells treated with D5, D6 and AN10 (Figure 3.7). Cell wall shrinkage and
breakage were observed in P. acnes treated with D5, AN12 and G10 fungal extracts
(Figure 3.8).
Figure 3.4: Effect of fungal crude extract on Staphylococcus aureus
Page 68
Chapter 3
49
Figure 3.5: Effect of fungal crude extract on Staphylococcus epidermidis
Figure 3.6: Effect of fungal crude extract on Bacillus megaterium
Page 69
Chapter 3
50
Figure 3.7: Effect of fungal crude extract on Pseudomonas aeruginosa and E. coli
Figure 3.8: Effect of fungal crude extract on Propionibacterium acnes
Page 70
Chapter 3
51
3.3.4. Identification of marine fungi with strong antibacterial activity
A total of 35 isolates were screened for antibacterial activity. Consequently, eight
strongly active marine fungal isolates (D5, D6, AN 7, AN 10, AN 11, AN 12, G 3,
and G10) were selected for SEM, sequencing and identification based on ITS
sequences (Figure 3.9, 3.10). According to NCBI nucleotide blast analysis, among
the 8 identified fungi, all belonged to the phylum Ascomycota including genera
Penicillium, Aspergillus, Emericellopsis, Simplicillium and Leptosphaerulina. These
identified fungi and their best matches in the NCBI database are summarized in
Table 3.2. Six isolates matched their closest relatives with 99 % similarity except for
AN 7 (95%). It should be noted that the strain AN 7 was unsuccessfully identified on
fungal ITS sequences.
Table 3.2: Phylogenetic affiliations of selected fungi with strong antibacterial activity
Strain Morphological
identification
Closest identified relative Access. No. Identity
(% )
D 5 Simplicillium sp. Simplicillium lamellicola KC894712.1 99
D 6 Emericellopsis sp Emericellopsis minima KT290876.1 99
AN 7 Leptosphaerulina sp. Leptosphaerulina sp. JN850998.1 95
AN 10 Penicillium sp. Penicillium citrinum KT898717.1 99
AN 11 Aspergillus sp. Aspergillus aculeatus JX501355.1 99
AN 12 Penicillium sp. Penicillium chrysogenum KU925907.1 99
G 3 Aspergillus sp. Aspergillus oryzae HM145964.1 99
G 10 Aspergillus sp. Aspergillus sydowii JN851052.1 100
Page 72
Chapter 3
53
Figure 3.9: SEM morphological analysis of most active sporulating fungi
Page 73
Chapter 3
54
Figure 3.10: Phylogenetic tree of partial ITS-rDNA sequences of marine fungal strains
The evolutionary history was inferred us ing the Neighbor-Joining method. The optimal tree with the
sum of branch length = 1.39517377 is shown. The percentage of replicate trees in which the associated
taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The tree is
drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to
infer the phylogenetic tree. The evolutionary distances were computed us ing the Maximum Composite
Likelihood method and are in the units of the number of base substitutions per site. The analysis
involved 43 nucleotide sequences. All positions containing gaps and missing data were eliminated.
There were a total of 362 positions in the final dataset. Evolutionary analyses were conducted in
MEGA7.
Page 74
Chapter 3
55
3.4. Discussion
Thirty five fungal strains were selected which were isolated from range of marine
environment in India. 8 isolates exhibited biological activity, representing 5 genera of
fungi. Fungus “D5” was grouped with S. lamellicola (Figure 3.10), which is known
to produce antibacterial mannosyl lipids, halymecins F and G and (3R,5R)-3-O-b-
Dmannosyl-3,5-dihydrodecanoic acid (115). In a recent study by (116), a S.
lamellicola isolated from Antarctica marine sediments exhibited both antibacterial
and antifungal activity.
Fungus “D6” was grouped with E. minima (Figure 3.10) which is known to produce
the sesquiterpenes (5E)-2-methyl-5-[(1'R*, 5'R*)-2-methylidene-7-oxobicyclo [3.2.1]
oct-6-ylidene]-4-oxopentanoic acid and dihydroisocoumarin cis-(3R, 4R)-4-
hydroxymellein. Both compounds were found to show neither antimicrobial nor in
vitro growth inhibitory activities on three human tumor cell lines (117). However, in
our study, we found that the crude extract of our marine fungal strain D6 E. minima
showed significant antibacterial activity. This could be because of the different hosts
or culture conditions resulting in different production of secondary metabolites.
Fungus “AN7” related to Leptosphaerulina sp. (Figure 3.10) was however not tested
for any of these activities. Recently (118), discovered new 6-methylpyridinone
derivatives from the marine-derived fungus Leptosphaerulina sp. using 1H NMR
prescreening and tracing the diagnostic signals.
Out of 8 selected fungi only 2, “AN 10” and “AN 12”, were related to Penicillium sp.
P. citrinum and P. chrysogenum (Figure 3.10). Both fungal strains displayed
antimicrobial activity against both gram positive and negative bacteria. In a study by
(119), two structurally unique steroids, isocyclocitrinol A and 22-
acetylisocyclocitrinol A, were isolated from a saltwater culture of P. citrinum
(Axinella sp., Papua New Guinea). Both compounds exhibited weak antibacterial
activity against S. epidermidis and Enterococcus durans. Two new diterpene, JBIR–
59 and 124, were obtained from P. citrinum SpI080624G1f01 (Ishigaki Island,
Okinawa,Japan) (120, 121). Two anthraquinone-citrinin derivatives penicillanthranin
A and B, isolated from P. citrinum PSU–F51 (Gorgonian, Annella sp., Similan
Islands, Thailand) were found active against both the wild and methicillin-resistant S.
aureus with a MIC value of 16 μg/ml (122). Penicitrinols G and H and 1,7-
Page 75
Chapter 3
56
dihydroxy-8-(methoxycarbonyl)-9-oxo-9H-xanthene-3-carboxylic acid three
polyketides were isolated from P. citrinum SCSGAF 0167 (Echinogorgia aurantiaca,
South China Sea, China)(123). P. citrinum (Gastrointestine of the parrot fish Scalus
ovifrons, Okinawa Island, Japan) produced scalusamides A–C in which only
scalusamide A displayed antibacterial activity against M. luteus with a MIC value of
33.3 μg/ml (124).
Similarly chrysotriazoles A and B were obtained from endophytic P. chrysogenum
(brown alga Sargassum palladium, Fujian, China)(125). The diketopiperazine 365
was obtained from endophytic P. chrysogenum (mangrove leaves Porteresia
coarctata, Chorao Is., Goa, India) and displayed antibacterial activity comparable to
that of streptomycin (126). Recently (127), found that a crude extract of P.
chrysogenum DSOA associated with Indian Ocean marine sponge (Tedania
anhelans) exhibited antimycobacterial activity.
Aspergillus species are mostly known for their role as a pathogen. However, they
also play important roles in industry and our environment. Our last three fungi
belong to same group. Fungus “AN 11” was grouped with A. aculeatus (Figure
3.10), which is known to produce useful multi polysaccharide degrading enzymes for
industrial applications (128). We did not assess enzymatic properties in our study.
Several bioactive compounds have been isolated from the marine strain A. aculeatus
in the last 10 years; however these strains have not been tested for any of these
activities. Fungus “G 3” was grouped with A. oryzae (Figure 3.10) which is known
to produce the indoloditerpene derivatives Asporyzins A–C. Only asporyzin C
exhibited strong activity against E. coli (129). Asporyergosterol was isolated from an
endophytic A. oryzae (H. japonica, Yantai, China)(130).
Fungus “G 10” was grouped with A. sydowii (Figure 3.10) which is known to
produce M. tuberculosis protein tyrosine phosphatase A (PTPA) inhibitors sydowiol
A–C (131). The endophytic fungus A. sydowii, isolated from the red alga
Acanthophora spicifera (collected from Rameswaram, south India), produced two
new chlorinated 2,5-diarylcyclopentenones, sydowins A and B (132).
Page 76
Chapter 3
57
3.5. Conclusion
In this study, 35 marine fungi were screened for antibacterial activity. Eight fungi
were successfully classified at the genus level based on ITS region sequences with
relatives in the NCBI database, except for one isolate (AN 7). They were distributed
among five genera (Penicillium, Aspergillus, Emericellopsis, Simplicillium and
Leptosphaerulina). Crude extracts of these eight fungi displayed different levels of
antibacterial activities to pathogenic bacteria, and some strains of the genera
Penicillium, Emericellopsis and Simplicillium showed strong growth inhibition to S.
aureus, S. epidermidis and M. luteus and P. acne. The combined data gathered from
this investigation contributes to the knowledge of fungal diversity and antibacterial
bioactivities associated with Indian marine environments. In conclusion, “D5” S.
lamellicola was found to be the most potent fungi isolated in this study and is
investigated in more detail, as described later in this thesis.
Page 77
58
Chapter 4
Screening of marine fungi for potential tyrosinase
inhibitor and antioxidants
Page 78
Chapter 4
59
4.1. Introduction
The skin is an essential organ of the body. It protects our body from adverse effects
caused by direct contact with the outside environment. Ultraviolet (UV) irradiation is
the most common and pernicious environmental factor that injures the skin (133).
Melanin is a mixture of heterogeneous biopolymers, responsible for the color of
human skin, hair, and eyes and protecting skin against radiation. The process of
melanin synthesis is called melanogenesis; which occurs within melanosomes,
membrane-bound granules, from melanocyte and is then transferred to keratinocytes
(134). But the accumulation of abnormal melanin induces pigmentation disorders,
such as melasma, freckles, ephelide, and senile lentigines (135). This process is
regulated by a variety of environmental, hormonal, and genetic factors, such as
ultraviolet (UV) exposure, α-melanocyte-stimulating hormone (α-MSH),
melanocortin 1 receptor (MC1R), and agouti-related protein (136-138). Tyrosinase, a
copper-containing monooxygenase, is a key enzyme that catalyzes melanin synthesis
in melanocytes (139). Therefore, tyrosinase inhibitors may be clinically useful for the
treatment of some dermatological diseases associated with melanin
hyperpigmentation and important in cosmetics for skin whitening (140).
In last decade, a large number of natural and synthetic compounds have been
discovered or developed as tyrosinase inhibitors (62, 141). Many of them like kojic
acid (142), arbutin, ascorbic acid derivatives, retinoic acid, azealic acid, ellagic acid,
chlorophorin, norartocarpanone, hydroquinone, catechins, aloesin, resveratrol.
oxyresveratrol, and 4,4′-dihydroxybiphenyl and other natural products are now in the
market (63, 140). However, there are still serious health concerns with some of these
ingredients, such as irreversible cutaneous damage, ochronosis, inflammation of
synthetic compounds and less effectiveness of available natural products due to their
adverse effects, poor skin penetrations, and low formulation stabilities (143, 144).
More research is needed toward the discovery and development of new cosmetic
ingredients, such as effective and safe tyrosinase inhibitors.
An imbalance state between intracellular antioxidants and intracellular reactive
oxygen species (ROS) or the so-called state of oxidative stress is a known
contributing factor for a wide range of human diseases. For example, cancers,
neurological disorders (Alzheimer and Parkinson), aging, atherosclerosis, diabetes,
Page 79
Chapter 4
60
rheumatoid arthritis, inflammation, and other oxygen related diseases (145, 146).
Antioxidants are vital substances, playing an important role in the prevention of
oxidative damage of biomolecules and cells and ROS-induced diseases by reacting
with free radicals, scavenging free radicals and chelating free catalytic metals (147).
Due to increasing safety concerns involved with consumption of synthetic
antioxidants, exploitation of cheaper and safer sources of antioxidants from natural
origins, and especially from marine sources, is of interest. The strong antioxidant
power of some marine fungal species was demonstrated in several reviews (2, 148,
149). Marine resources have are good sources of bioactive compounds for the
development of new drugs and health foods. Marine fungi are known to be rich
producer of a variety of natural products. Hence, there is the possibility to identify
novel bioactive compounds with antityrosinase and antioxidant potential from marine
fungi obtained from west coast and Islands of India. In this study, we investigated
skin depigmenting and antioxidant activity of extracts from some recently collected
marine fungal.
4.2. Materials and methods
4.2.1. Chemicals used
All analytical grade chemicals were purchased from Fischer Scientific (Mumbai,
India) and used as such without further purification. Mushroom tyrosinase, kojic acid
and L-DOPA were purchased from Sigma, India.
4.2.2. Test organisms
4.2.2.1 Marine fungi
35 fungal strains used in this work were isolated from various marine samples
collected from west coast and Islands of India (Table 2.2 and Figure 2.3 in Section
2.3.1)
4.2.3. Cosmeceutical activity
4.2.3.1 .Culture extracts
The method for secondary metabolite extraction of 35 isolated marine fungi was
described in Chapter 3, Figure 3.2 in Section 3.2.3.
Page 80
Chapter 4
61
4.2.3.2. Anti tyrosinase assay (MBTH assay)
The DOPA oxidase activity of tyrosinase was measured using a colorimetric assay,
which relies on the oxidation of L-DOPA to dopaquinone, which can be reacted with
3-methyl-bezothiazolinonehydrazone (MBTH) to form a pink product with peak
absorbance at 508 nm (Winder, 1994). Briefly, A typical reaction mixture of total
volume 200 µl contained 120 µl of assay buffer (100 mM potassium phosphate (pH
6.8), 2% (v/v) N, N‟-dimethylformamide, 5 mM MBTH), 40 µl of mushroom
tyrosinase (10 unit) and 40 µl of 1.5 mM L-DOPA solution. To study the inhibitory
effect of fungal crude extracts, 40 µl of crude (5mg/ml) replaced the assay buffer.
Reaction mixture without enzyme was first incubated at 37°C for 5 min. Enzyme was
added and the mixture was incubated at 37°C for 10 min; then absorbance was
measured at 505 nm using a microtiter plate-reader (BioTek, Synergy™ H1). The
absorbance of the mixture without tyrosinase was used as the control. Kojic acid was
used as positive controls. The optical density of the inhibition in the control was
considered to represent 100%. The data are expressed as mean percentages and the
results were repeated in triplicate.
The % antityrosinase activity was calculated by applying the expression:
4.2.3.3. Antioxidant assay
Antioxidant activity of the crude extracts was determined by DPPH free radical
scavenging assay as described by (110) with slight modification. 20 μL of crude
extract in water was mixed with 180 μL of DPPH in methanol (0.1 mM) in wells of a
96-well plate. The plate was kept in the dark for 30 min, after which the absorbance
of the solution was measured at 517 nm in a microtiter plate-reader (BioTek,
Synergy™ H1). Appropriate blanks (water) and standards (quercetin solutions in
water) were run simultaneously. Extracts were first tested at a single concentration of
5 mg/mL, and those showing good evidence of antioxidant activity were tested over a
range of concentrations.
% Inhibition= (A control − A sample) / A control ×100
Where A is absorbance at 508 nm
Page 81
Chapter 4
62
The data are expressed as mean percentages and the results were repeated in
triplicate.
Inhibition of the DPPH free radical in percentage (I %) was calculated as:
4.2.3.4 Morphological and molecular characterization of potential fungal strains
The method described in Section 3.2.7.
4.3. Results
4.3.1. In vitro depigmenting activity
In present study, we used the MBTH assay to evaluate the depigmenting activity of
marine fungal extracts. The data shown in Figure 4.1 indicated that the mushroom
tyrosinase activity was inhibited by fungal extracts. We observed that at fixed
concentration (1mg/mL), six strains have shown more than 40% inhibition and five
strains showed more than 20% inhibition. It was also observed that PDA extracts had
higher activity then malt extracts. We have selected the eleven most active strains to
check their activity at different concentrations and found that PDA extracts of P2 and
D4 strains displayed the highest antityrosinase activity (45%, 43%, respectively) at
the lowest concentration (0.125mg/mL, Figure 4.2).
Dose and time dependent anti-tyrosinase activity of crude extracts of the selected
eleven most active strains were also evaluated. The results indicated that anti-
tyrosinase activity of extracts increased with increasing concentration; however this
activity decreased over time (Figure 4.3 A, B, C). We hypothesized that either
enzyme present in the extract degrades the active compound, or crude extract acts
noncompetitively. The tyrosinase inhibition ability might depend on the hydroxyl
groups of the phenolic compounds of the fungal extracts that could form a hydrogen
I % = [(A control − A sample) / A control] ×100
Where A control is the absorbance of the control reaction (full reaction,
without the tested extract or quercetin) and A sample was the absorbance
in the presence of the sample. DPPH solution was prepared freshly.
Decreased absorbance of the reaction mixture indicates stronger DPPH
free radical-scavenging activity.
Page 82
Chapter 4
63
bond to the active site of the enzyme, leading to a lower enzymatic activity. Some
tyrosinase inhibitors act through hydroxyl groups that bind to the active site on
tyrosinase, resulting in steric hindrance or changed conformation (62). The
antioxidant activity may also be an important mechanisms for tyrosinase inhibitory
activity, and so this was also been evaluated.
Page 83
Chapter 4
64
Figure 4.1: (A) Anti tyrosinase activity of Pladi and Dwarka marine fungal crude
extracts (B) Anti tyrosinase activity of Andaman and Goa marine fungal crude extracts
Figure 4.2: Anti tyrosinase activity of eleven selected fungal crude extracts at different
concentrations
0
10
20
30
40
50
60
70
80
90
100
P2
P
P2
M
P4
P
P8
P
P8
M
D4P
D4M
D6P
D25
P
A6/2
P
A6/2
M
A10
P
A10
M
G8P
G10
P
G15
P
koji
c a
cid
% In
hib
itio
n
Fungal code
Anti tyrosinase activity of selected fungal crude extracts at
different concentrations
0.5 mg/ml
1 mg/ml
2 mg/ ml
Page 84
Chapter 4
65
Figure 4.3: Dose and time dependent anti tyrosinase activity of eleven selected fungal crude extracts
0
20
40
60
80
100
% In
hib
itio
n
Fungal code
Anti tyrosinase activity of fungal crude extracts at final
concentration of 0.5 mg/mL
10MIN
20MIN
30MIN
A
0
20
40
60
80
100
P2
P
P2
M
P4
P
P8
P
P8
M
D4P
D4M
D6P
D25
P
A6/2
P
A6/2
M
A10
P
A10
M
G8P
G10
P
G15
P
koji
c a
cid
% In
hib
itio
n
Fungal code
Anti tyrosinase activity of fungal crude extracts at final
concentration of 1 mg/mL
10 MIN
20 MIN
30 MIN
B
0
20
40
60
80
100
% In
hib
itio
n
Fungal code
Anti tyrosinase activity of fungal crude extracts at final
concentration of 2mg/mL
10MIN
20MIN
30MIN
C
Page 85
Chapter 4
66
4.3.2. Antioxidant activity of fungal extracts
The scavenging effects of eleven fungal extracts on DPPH radicals increased with
increasing concentration. At 0.125, 0.25 and 0.50 mg/mL, the scavenging activities
of extracts on DPPH radical were 55–79, 62–83 and 86–97%, respectively (Figure
4.4). The results show that the PDA extract of P2 and D4 exhibited the highest
activity (94%, 97%, respectively) at 0.500 mg/mL, however at 0.125–0.500 mg/mL,
quercetin showed an excellent scavenging activity of 99–100 percent.
Figure 4.4: Scavenging activity of crude extracts of selected fungi against DPPH
4.3.3. Identification of promising marine fungal strains
A total of 35 fungal strains were isolated and screened for anti-tyrosinase and
antioxidant activity. The eleven most strongly active marine fungal isolates (P2, P4,
P8, D4, D6, D25, AN 6/2, AN 10, G 8, G 10, and G15) were selected for further
study. Of the eleven selected fungal strains the two best (P2 and D4) were selected
for SEM, sequencing and identification based on ITS sequences. These fungi were
identified as Talaromyces sp. and Aspergillus sp. respectively (Figure 4.7). Their
best matches in the NCBI database are shown in Table 4.1, Figure 4.5 and 4.6.
0
10
20
30
40
50
60
70
80
90
100
P2
P
P2
M
P4
P
P8
P
P8
M
D4
P
D4
M
D6
P
D2
5P
A6/
2P
A6/
2M
A10
P
A10
M
G8
P
G1
0P
G1
5P
Qu
erc
eti
n
Scav
en
gin
g a
cti
vit
y (
%)
Fingal Code
Scavenging effect on DPPH
500 mg/mL
250 mg/mL
125 mg/mL
Page 86
Chapter 4
67
Table 4.1: Phylogenetic affiliations of selected fungi with strong activity
Strain Morphological
identification
Closest identified relative Access. No. Identity
(% )
P2 Talaromyces sp. Talaromyces stipitatus KJ413383 99
D4 Aspergillus sp Aspergillus terreus KJ958375 99
Figure 4.5: Phylogenetic tree of partial ITS-rDNA sequences of fungal strains
The evolutionary history was inferred using the Neighbor-Joining method. The optimal tree with the
sum of branch length = 0.45289971 is shown. The percentage of replicate trees in which the associated
taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The tree
is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to
infer the phylogenetic tree. The evolutionary distances were computed using the Maximum
Composite Likelihood method and are in the units of the number of base substitutions per site. The
analysis involved 9 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding.
All positions containing gaps and missing data were eliminated. There were a total of 328 positions in
the final dataset. Evolutionary analyses were conducted in MEGA7.
Figure 4.6: SEM morphological analysis of sporulating D4 strain
Page 87
Chapter 4
68
4.4. Discussion
Thirty five (35) fungal strains were selected for this study. Only 2 out of 35 fungi,
“Fungus P 2” related to T. stipitatus and “Fungus D 4” grouped with A. terreus,
displayed both strong antityrosinase and antioxidant activities at the lowest
concentration. Therefore, these two fungi were selected for further study. This is the
first report of antityrosinase activity from T. stipitatus.
A. terreus was found to produce an extracellular polysaccharide, YSS, which had
good antioxidant activity, as determined by its scavenging ability on DPPH radicals
(150). Two new rubrolides, rubrolides R and S were previously isolated from the
fermentation broth from A. terreus OUCMDZ-1925. Rubrolide R showed
comparable antioxidation against 2,20-azino-di(3-ethylbenzthiazoline-6-sulfonic
acid) (ABTS) radicals to that of trolox and ascorbic acid, with an IC50 value of 1.33
mM (151). A novel UV-A protecting dipyrroloquinone, terreusinone has been
isolated from the marine algicolous fungus A. terreus (152). Many other potential
compounds like sesterterpenoids, terretonins H and I (153), Lumazine containing
peptides Terrelumamides A and B (154) and terrein (155) were isolated from marine
A. terreus. This is the first report of antityrosinase activity from A. terreus.
4.5. Conclusion
Inhibitor of tyrosinase is an important class of bioactive compounds, particularly for
cosmetic use. This study is the first report showing combined antioxidant and
antityrosinase activities from the marine fungi Talaromyces stipitatus and Aspergillus
terreus. The results obtained in this study show that compounds present in the
extracts of Fungus “P2” and “D4” act as inhibitors of mushroom tyrosinase.
However, they showed lower inhibitory activity than Kojic acid and Quercetin. The
reducing power of the extracts increased in a dose-dependent manner. Furthermore,
the fungal culture filtrate extracts inhibited mushroom tyrosinase and decreased
melanin synthesis in a dose-dependent manner, which may be mediated through its
antioxidant activity. These extracts and their isolated active compounds have
potential as and skin whiteners for future cosmeceutical use.
Page 88
69
Chapter 5
Bioassay-guided isolation of antibacterial compounds
from marine fungus Simplicillum lamellicola
Page 89
Chapter 5
70
5.1. Introduction
Strain “D5” is a white cottony fungal strain isolated from a marine algal sample
collected from Dwarka, India. This strain was found to be active against
Staphylococcus epidermidis bacteria that cause skin microbial infection in humans,
as reported in chapter 3. This fungal strain was identified as Simplicillium lamellicola
by morphological and molecular methods. The genus Simplicillium is known to
produce a variety of compounds but has not been fully chemically characterized.
A deep sea derived fungal strain Simplicillium obclavatum EIODSF 020 was the
source of eight new linear peptides, simplicilliumtides A–H. None of the compounds
showed growth inhibition towards Staphylococcus aureus, Pseudomonas aeruginosa,
Bacillus amyloliquefaciens, and Bacillus stearothermophilus (156). Chemical
investigation of the crude extract of a sponge-derived fungus Simplicillium sp. YZ-11
gave a new minor diketopiperazine alkaloid cyclo-(2-hydroxy-Pro-Gly) and a natural
lactone (S)-dihydro-5-[(S)- hydroxyphenylmethyl]-2(3H)-furanone. However, no
activity has been reported for these compounds (157). Three novel mannosyl lipids,
halymecins F, G and (3R,5R)-3-O-β-D-mannosyl-3,5-dihydrodecanoic acid were
isolated from fungus S. lamellicola. These three novel compounds inhibited the
growth of phytopathogenic bacteria, with halymecin F displaying the strongest
antibacterial activity (115). A new pyrrolidine alkaloid, Preussin B, was isolated
from the crude extract of the fungus Simplicillium lanosoniveum TAMA 173. This
compound showed weak antifungal activity against Saccharomyces cerevisiae with
an IC50 value of 25 μg/mL (158). A sample of the fungus Simplicillium sp. FKI-5985
collected from Aogashima, Tokyo, Japan, was the source of Aogacillins A and B.
Both compounds were displayed antibacterial activity against methicillin-resistant
Staphylococcus aureus (MRSA) at MIC values of 2.0 μg/mL (159). To the best of
our knowledge, this is the first report of S. lamellicola from a marine environment.
This chapter reports bioassay guided isolation of the active component of S.
lamellicola, using TLC bio autography assay for antibacterial activity. The successful
isolation of one active biomolecule and establishment of general isolation protocol
for active metabolites are presented. Identification of the isolated metabolites was
done using UPLC-MS/MS.
Page 90
Chapter 5
71
5.2. Method and materials
5.2.1. Chemicals used
All analytical grade chemicals were purchased from Fischer Scientific (Mumbai,
India) and used without further purification. PDB and Müller-Hinton agar were
procured from HiMedia (Mumbai, India) and were sterilized by autoclaving before
use.
5.2.2. Large scale fermentation and extraction
S. lamellicola (D5) was maintained on PDA artificial sea water (ASW) at 28°C ± 2,
pH 7.5. Agar plugs were used to inoculate eight 500 mL Erlenmeyer flasks
containing 250 mL of PDB in ASW pH 7.5. Flasks were incubated at 28°C ± 1 on a
rotary shaker at 140 rpm for five days and used as seed culture. Eight 5 L Erlenmeyer
flasks, each containing 2500 mL of liquid medium, prepared as above, were
individually inoculated with 10 % (250 mL) of seed culture and then incubated at
28°C ± 1 on a rotary shaker at 140 rpm for twenty days. The fermented broth was
filtered through cheesecloth to separate the supernatant and mycelia (160). The
supernatant was passed through an activated Diaion HP-20 resin column (Mitsubishi
Chemical Co.). Then the column was washed with 500 ml of distilled water and
finally eluted with 100% methanol until no activity was observed in the collected
fraction (108). The collected methanol fractions with activity were pooled and
evaporated, using a Rotary evaporator (BUCHI Rota vapor R-200). The fungal
mycelia were also soaked in methanol for 24 hours. The methanol layer was
collected and evaporated to dryness to give a methanol extract of fungal cell biomass,
which was combined with the above crude extract. The crude extract (6gm) was
collected and stored in cold condition.
5.2.3. Detection of antibacterial compounds by thin layer chromatography with direct
bioautography assay
TLC was performed on aluminium-backed TLC plates (Merck, silica gel 60 F254). A
suitable mobile phase was standardized based on the separation of antimicrobial
compounds. TLC was carefully marked and 5 µL of crude extract (5mg/mL in
methanol) was spotted onto the plate using a glass capillary. A chloroform: methanol
(9:1) solvent system was used for the separation of active principles. The
Page 91
Chapter 5
72
chromatographic chamber was first saturated with system solvent followed by
spotting TLC plates for chromatographic separation. TLC strips were dried to
completely remove traces of the eluting solvents; TLC plates were then observed in
visible as well as ultraviolet light (365 and 254 nm). The color of resolved bands and
Rf values were recorded and marked. TLC plates were prepared in duplicate for
analyzing band separation and bioautography, respectively (161).
A contact bioautography against S. epidermidis was used (162). Mueller Hinton agar
no. 2 (HiMedia, India) was prepared and cooled to 40 - 45ºC and bacterial inoculum
(1.5×108 CFU/mL, 0.5 McFarland), prepared as described in chapter 3, 3.1.2.3, was
then added aseptically to the molten agar and poured into sterile petri dishes to give a
solid plate. Dried and developed TLC plates were then placed on to the media and
were left for a period of refrigerated for one hour for diffusion. Thereafter, TLC
plates were removed from the surface with the help of sterile forceps and the plates
were incubated for 24 hours. The areas of inhibition were marked and checked with
reference TLC to determine which spot was active. For clear observation and
photography of inhibition spots dishes were stained with methylthiazolyldiphenyl-
tetrazolium bromide (MTT) (5 mg/mL) solution in water.
5.2.4. Bioassay-guided fractionation of S. lamellicola methanol extract
Six grams of the dried methanol extract of S. lamellicola D 5 was suspended in 100
ml of distilled water and partitioned three times with 100 ml of each organic solvent
in increasing polarity (petroleum ether, hexane, chloroform and ethyl acetate
(EtOAc). The organic layer was concentrated to yield a solid residue. All organic
extracts were subjected to TLC bioautography assay against S. epidermidis bacteria.
The bioactive chloroform fraction 1.3 (500 mg) (Figure 5.1) was then adsorbed onto
silica gel (5 g) and subjected to column chromatography on silica gel (60 X 20 cm,
100 g, 60–120 mesh). Elution was achieved using stepwise gradients of 400 mL
aliquots of each of petroleum ether (100%); – hexane (100%); – hexane:chloroform
(50: 50) ;– hexane:chloroform (20:80), respectively (Figure 5.1). Collected tubes
were subjected to thin layer chromatography (TLC) on silica gel 60F254 plates using
solvent system chloroform:methanol (80:20). Aliquots with similar TLC profiles
were pooled to obtain fractions. TLC based antibacterial assay as described above
showed fraction 1.3.4 was active. Fraction 1.3.4 (180mg) was further subjected to
Page 92
Chapter 5
73
column chromatography on silica gel (60 X 20 cm, 100 g, 200–400 mesh). Elution
was achieved using solvent gradients of 250 mL aliquots of each of chloroform
(100%), – chloroform:methanol (99.5:0.5), – chloroform:methanol (99:01), –
chloroform:methanol (98:02), – chloroform:methanol (95:05) and methanol (100%),
using a stepwise gradient elution. Aliquots were collected and observed on TLC.
Aliquots with similar TLC profiles were polled to obtained 7 fractions (1A-7A). All
were subjected to TLC based antibacterial assay. Fraction 5A showed partial activity
and 6A showed significant antibacterial activity. Fraction 6A (20mg) was further
purified using column chromatography on silica gel (60 X 20 cm, 100 g, 200–400
mesh). Elution was achieved using solvent gradients of 200 mL aliquots of each of
chloroform (100%), – chloroform:methanol (99.5:0.5), – chloroform:methanol
(99:01), – chloroform:methanol (98:02), – chloroform:methanol (95:05) and
methanol (100%) using a stepwise gradient elution. Aliquots were collected and
observed on TLC. Aliquots with similar TLC profiles were polled to obtain 7
fractions (6A1-6A7) (Figure 5.2). All were subjected to TLC based antibacterial
assay. Only fraction 6A5 showed antibacterial activity.
Isolated pure compound 6A5 and fraction 5A obtained from the previous column
were subjected to MPLC and UPLC-MS/MS for fingerprinting and identification of
metabolites.
Page 93
Chapter 5
74
Figure 5.1: Schematic representation of isolation of metabolites from fungi “D5” crude
extract
Figure 5.2: Schematic representation of isolation of active compound from active
fraction 1.3.4 of “D5” crude extract
Page 94
Chapter 5
75
5.2.5. Identification of isolated antibacterial compound
5.2.5.1. HPLC analysis
Identification of active compounds from fraction 5A and 6A5 was done using high-
performance liquid chromatography (HPLC) and LC-MS analysis. Chromatographic
analysis was performed on a HPLC system (Shimadzu, Kyoto, Japan) equipped with
a controller (CBM - 20A), quaternary pump (LC- 20AT), solvent degasser system
(DEU- 20 A5), auto sampler (SIL- 20A) and photo diode array detector (SPDM-
20A). Inbuilt software (Shimadzu, LC solution) was used to control the HPLC pump
and acquire the data form the photodiode array. Initial Separations were performed
with C-18 Phenomenex reverse phase 250 mm column, 5 μm spherical particles and
10 μl injects at 30 minute intervals was: flow rate 1 ml/min. An isocratic ratio 20:80
of solvent A (HPLC grade water) and B (HPLC grade C2H3N), respectively, was
used to elute compounds from the column. The flow rate was 1.0 mL/min, and the
eluent was monitored at 215 nm.
5.2.5.2. UPLC-mass spectrometry analysis
Sample 5A and 6A5 was prepared in concentration of 1 mg/ml and subjected to
UPLC-MS/MS (At Advanced Instrumentation Research Facility (AIRF, JNU, New
Delhi). UPLC analyses were performed on a Waters Acquity Ultra Performance
Liquid Chromatographic system with quadrupole mass spectrometer (Waters,
Milford, MA, USA). To achieve chromatograms with better resolution in a short
analysis time, the chromatographic conditions were optimized. UPLC separation was
achieved on an Acquity UPLC BEH C18 column using the mobile phase 0.1%
formic acid in water (solvent A) and acetonitrile (solvent B) at a flow rate of 0.300
ml/min; a gradient elution was performed. The total run time was 20 min. The
injection volume was 5.0 µl. The UPLC system was interfaced with quadrupole mass
spectrometer (Waters, USA). The same column, elution gradient and flow rate were
used during the UPLC-MS/MS analysis. Both positive and negative ion modes were
investigated, and the results showed that higher sensitivities and more information
were obtained in negative mode. Mass spectrometry was therefore operated in the
negative ion electrospray mode.
Page 95
Chapter 5
76
5.3. Results and discussions
This study focused on the identification of antibacterial metabolites produced by the
marine S. lamellicola and the in vitro activities of these compounds against human
pathogenic bacteria to identify either novel or lead compounds to synthesize
derivatives with enhanced activities. The Aogacillins A and B were previously
identified from a culture broth of terrestrial Simplicillium sp. FKI-5985 with
antibacterial activity against methicillin-resistant S. aureus (MRSA)(159). However,
we isolated the strain S. lamellicola from marine habitat. In this study, we have
characterized previously unidentified antibacterial metabolites produced by marine S.
lamellicola.
5.3.1. Characterization of substances from the culture broth of marine S. lamellicola
To reveal the antimicrobial constituents by bioautography, 5 mg/ml of D5 crude
extract was spotted on TLC. The anti- S. epidermice bioautography of this TLC
clearly showed that there was at least one or two antibacterial component. The crude
extract was further fractionated with various solvents. We found that the chloroform
layer significantly inhibited the growth of S. epidermice and so the material was
patriated by repeated silica gel column chromatography to provide 7 fractions. Using
bioassay-guided fractionation, the antibacterial metabolites were isolated from the 6th
fraction by like normal phase Colum chromatography at atmospheric pressure.
Figure 5.3: TLC bioautography of fraction 1.3.4 of “D5” crude extract
Page 96
Chapter 5
77
Figure 5.4 HPLC chromatogram of minor active fraction 5A
Figure 5.5: HPLC chromatogram of purified active compound from fraction 6A5
Page 97
Chapter 5
78
Figure 5.6: UPLC-MS chromatograms of minor active fraction 5A
Figure 5.7: UPLC-MS chromatograms of active fraction 6A5
Page 98
Chapter 5
79
The present study identifies three compounds which were previously reported the be
isolated from Simplicillium sp. One compound was identified as 5, 6-dihydro-6-
pentyl-5, 6-dihydropyran-2-one, with the molecular formula is C10H18O3 as
determined by ESI-MS m/z ([M + Cl] -168). Compound 2 identified as simplifungin,
with molecular formula C18H37NO4 as determined by ESI-MS m/z ([M + Cl] - 331).
Compound 3 was identified as a derivative of halymecin G. Its molecular formula is
C20H38O6 as determined ESI-MS m/z ([M + Cl] -374) (Figure 5.8). The structure
confirmation of these three compounds by NMR is under investigation and will be
reported in due course.
O
O CH3
5,6-Dihydro-6-pentyl-5,6-dihydropyran-2-one (1) MW=168
NH2
H3C
OH COOH
OH
Simplifungin (2) MW=331
O O O
OR O OH O OH O OH
OH
O
O
O
HO
OH
HO
OHHalymecin G (R)= OAc, MW=779
O OH
O OH OORCompound 3 (R)=OH, MW=374
Figure 5.8: Structures of compounds identified from marine S. lamellicola
Page 99
Chapter 5
80
5.3.2. Antibacterial activity of pure active compound
The in vitro antibacterial activity of purified compound 6A5 was tested by direct
bioautography and caused growth inhibition of S. epidermidis bacteria. This
compound was identified as 5, 6-dihydro-6-pentyl-5, 6-dihydropyran-2-one.
Figure 5.9: Fraction 6A5 with moderate antibacterial activity against S. epidermidis
5.4. Conclusions
The active constituent of marine fungus S. lamellicola was isolated and reported in
this chapter. Fungi “D5” produced one active antibacterial compound, which was
showed moderate active. Antibacterial bioassay-directed fractionation was used to
isolate 5, 6-dihydro-6-pentyl-5, 6-dihydropyran-2-one from 6A5 fraction. The
bioassay of fraction 5A showed minor inhibition. When analyzed the same, a peak at
Rt 1.198 (of the bioactive compound) was present in the fraction, which could be the
probable reason of its activity. UPLC-MS/MS data of 5A revealed presence of
compound “simplifungin” (m/z = 331, [M + Cl] - =368-37). We also propose a
derivative of previously reported compound “halymecin G” with m/z =374.
Page 100
81
Chapter 6
Summary and future work
Page 101
Chapter 6
82
Widespread application of natural products in many different fields, including
medicine, food, cosmetics and agriculture has increased the demand for new and
novel bioactive natural chemical entities. The marine world is a vast resource
containing structurally complex and novel chemical entities with unique
pharmacology. The complexity of the marine environment results in the evolution of
diverse genetically encoded biomolecules with a variety of ecological and metabolic
roles in marine organisms. The most promising bioactive marine natural products
have been derived from microbial bioresources such as bacteria, cyanobacteria and
fungi, particularly as these organisms can be used as production systems for these
often structurally complex compounds. However marine fungi remain a relatively
untapped bioresource for bioactive molecules, compared with terrestrial fungi.
The main goal of the research work described in this thesis was to discover novel
natural products with cosmeceutical potential by employing targeted
pharmacological methods. To achieve this goal, the present study describes the
isolation and identification of some new marine fungi, screening of these fungi for
bioactive compounds, the isolation and structure elucidation of some bioactive
secondary metabolites, and some assessment of the pharmacological activity of the
isolated compounds. Specifically, the antibacterial, antityrosinase and antioxidant
activities of the marine fungi extracts and purified compounds were assessed.
Chapter 2 describes the occurrence, distribution and diversity of culturable marine
fungi on various substrata (sea grasses, wood and seaweed) collected at various
locations in the Indian west coast and Andaman Islands. Effects of nutrient and salt
concentration on the fungal growth for secondary metabolites production were
investigated using a range of media conditions. The isolated fungal strains (70
strains) were maintained on potato dextrose agar in artificial sea water incubated at
28°C ± 2 for 7-10 days. Individual fungal colonies were picked and checked for
further purity by sub culturing on potato dextrose agar in artificial sea. Of these, only
35 strains were culturable and subjected for growth assessment experiments on
different solid media plate (Media A (PDA in 100% sea water with pH 7.5 (High
nutrient), Media B (Sea water media (SWM), 1.0% glucose, 0.5% peptone, 0.1%
yeast extract and 1.7% agar, final pH of 7.5) (Low nutrient), showing a clear
difference in fungal mycelia growth and spore formation. Higher mycelial production
was observed in nutrient rich media and earlier spore formation was observed in
Page 102
Chapter 6
83
nutrient deficient media. The results described in this study will be useful for
selection of growth media and culture conditions for new active fungi for optimised
production of secondary metabolites.
In chapter 3, the primary aim was to evaluate antibacterial activity of all isolated
marine fungal strains. Selected strains were further characterized using microscopic
technique including phase contrast and SEM. A common protocol for secondary
relatives in the NCBI database, except for one isolates (AN 7). These were
Simplicillium lamellicola (D 5), Emericellopsis minima (D 6), Leptosphaerulina sp.;
(AN 7), Penicillium citrinum (AN 10), Aspergillus aculeatus (AN 11), P.
chrysogenum (AN 12), A. oryzae (G 3) and A. sydowii (G 10). SEM analysis of the
targeted bacteria before and after treatment with crude fungal extracts showed that
the presence of secondary metabolites in the extracts caused damage to bacterial cell
membrane. Isolate Simplicillium lamellicola (D 5) was the most active extract against
both Gram-negative and Gram-positive bacteria. This promising strain was
investigated further using bioassay-guided fractionation for the isolation of bioactive
compounds.
Chapter 4 describes the effect of selected marine fungi on the pigmentation and
photoaging of skin. Extracellular secondary metabolites of fungal fermentation were
concentrated by using Diaion HP20 resin. Here, the first target was inhibition of the
melanin forming enzyme tyrosinase by the crude extract of each fungal strain. This
was analyzed using a MBTH assay. The activity of the eleven most active strains was
investigated over a range of concentrations (0.5-2.0 mg/ml). These extracts were also
tested for antioxidant activity. Two of the isolates, Talaromyces stipitatus (P2) and
Aspergillus terreus (D4) were found to have potent activity, comparable with that of
the positive controls Quercetin and Kojic acid. To date, reports concerning
antioxidant and antityrosinase metabolites from marine fungi are rare. This study
demonstrates that marine fungi are a potentially an excellent source for the discovery
of novel cosmeceutical agents.
Chapter 5 describes the purification and identification of antibacterial bioactive
molecules from S. lamellicola extract, via bioassay-guided fractionation using TLC
bioautography assay. From 20 lit of fermented broth, 6 gm of crude extract was
prepared by using Diaon HP 20 extraction. Contact bioautography of the extract
Page 103
Chapter 6
84
showed one spot inhibiting activity against Staphylococcus epidermidis bacteria.
Silica gel column chromatography was performed to purify the active compound
present in the extract. We isolated one pure active compound, identified as 5, 6-
dihydro-6-pentyl-5, 6-dihydropyran-2-one. One the basis of UPLC-MS/MS data we
also proposed the presence of the compound “simplifungin” (m/z = 331, [M + Cl] -
=368-37) and a new derivative of the previously reported compound “halymecin G”,
with m/z =374.
This thesis is the first report of the isolation of marine S. lamellicola from an Indian
marine environment and its evaluation for antibacterial activity against a range of
human pathogenic bacteria. The antityrosinase activity of Talaromyces stipitatus is
reported for the first time. Both of these fungi are promising strains for further
investigation. Future work will target the isolation and identification of antityrosinase
compounds from T. stipitatus and modification of the identified antibacterial
compound from S. lamellicola to increase its biological activity.
Page 104
85
References
1. Grabley S, Thiericke R. Drug discovery from nature: Springer Science &
Business Media; 1998.
2. Blunt JW, Copp BR, Keyzers RA, Munro M, Prinsep MR. Marine Natural
Products. Natural product reports. 2015;32(2):116-211.
3. Katz L, Baltz RH. Natural product discovery: past, present, and future.
Journal of industrial microbiology & biotechnology. 2016:1-22.
4. Jimeno J, Faircloth G, Sousa-Faro J, Scheuer P, Rinehart K. New Marine
Derived Anticancer Therapeutics─ A Journey from the Sea to Clinical Trials. Marine
drugs. 2004;2(1):14-29.
5. Vignesh S, Raja A, James RA. Marine drugs: Implication and future studies.
International Journal of Pharmacology. 2011;7:22-30.
6. Gerwick WH, Moore BS. Lessons from the past and charting the future of
marine natural products drug discovery and chemical biology. Chemistry & biology.
2012;19(1):85-98.
7. Kijjoa A, Sawangwong P. Drugs and cosmetics from the sea. Marine drugs.
2004;2(2):73-82.
8. Molinski TF, Dalisay DS, Lievens SL, Saludes JP. Drug development from
marine natural products. Nature Reviews Drug Discovery. 2009;8(1):69-85.
9. Mayer AM, Glaser KB, Cuevas C, Jacobs RS, Kem W, Little RD, et al. The
odyssey of marine pharmaceuticals: a current pipeline perspective. Trends in
Pharmacological Sciences. 2010;31(6):255-65.
10. Piel J. Metabolites from symbiotic bacteria. Natural product reports.
2009;26(3):338-62.
11. Laatsch H. Antibase 2012: The natural compound identifier: Wiley-Vch;
2012.
12. Murphy B, Jensen P, Fenical W. The Chemistry of Marine Bacteria. In:
Fattorusso E, Gerwick WH, Taglialatela-Scafati O, editors. Handbook of Marine
Natural Products: Springer Netherlands; 2012. p. 153-90.
13. Waters AL, Hill RT, Place AR, Hamann MT. The expanding role of marine
microbes in pharmaceutical development. Current Opinion in Biotechnology.
2010;21(6):780-6.
Page 105
References
86
14. Rateb ME, Ebel R. Secondary metabolites of fungi from marine habitats.
Natural product reports. 2011;28(2):290-344.
15. Borse B, Bhat D, Borse K, Tuwar N, Pawar N. Marine fungi of India
(Monograph): Broadway Publishing House; 2012.
16. Bugni TS, Ireland CM. Marine-derived fungi: a chemically and biologically
diverse group of microorganisms. Natural product reports. 2004;21(1):143-63.
17. Hyde KD, Jones EG, Leaño E, Pointing SB, Poonyth AD, Vrijmoed LL. Role
of fungi in marine ecosystems. Biodiversity and Conservation. 1998;7(9):1147-61.
18. Jones EBG, Sakayaroj J, Suetrong S, Somrithipol S, Pang K. Classification of
marine Ascomycota, anamorphic taxa and Basidiomycota. Fungal Diversity.
2009;35(1):187.
19. Thomas TR, Kavlekar DP, LokaBharathi PA. Marine drugs from sponge-
microbe association-a review. Marine drugs. 2010;8(4):1417-68.
20. Jones EG. Fifty years of marine mycology. Fungal Diversity. 2011;50(1):73-
112.
21. Jones E. Are there more marine fungi to be described? Botanica Marina.
2011;54(4):343-54.
22. Shearer C, Descals E, Kohlmeyer B, Kohlmeyer J, Marvanová L, Padgett D,
et al. Fungal biodiversity in aquatic habitats. Biodiversity and Conservation.
2007;16(1):49-67.
23. Liberra K, Lindequist U. Marine fungi-a prolific resource of biologically
active natural products? Die Pharmazie. 1995;50(9):583-8.
24. Abdel-Lateff A. Chaetominedione, a new tyrosine kinase inhibitor isolated
from the algicolous marine fungus Chaetomium sp. Tetrahedron Letters.
2008;49(45):6398-400.
25. Kossuga MH, Romminger S, Xavier C, Milanetto MC, Valle MZd, Pimenta
EF, et al. Evaluating methods for the isolation of marine-derived fungal strains and
production of bioactive secondary metabolites. Revista Brasileira de Farmacognosia.
2012;22(2):257-67.
26. Masuma R, Yamaguchi Y, Noumi M, Ōmura S, Namikoshi M. Effect of sea
water concentration on hyphal growth and antimicrobial metabolite production in
marine fungi. Mycoscience. 2001;42(5):455-9.
Page 106
References
87
27. Huang J, Lu C, Qian X, Huang Y, Zheng Z, Shen Y. Effect of salinity on the
growth, biological activity and secondary metabolites of some marine fungi. Acta
Oceanologica Sinica. 2011;30(3):118-23.
28. Wang Y, Lu Z, Sun K, Zhu W. Effects of high salt stress on secondary
metabolite production in the marine-derived fungus Spicaria elegans. Marine drugs.
2011;9(4):535-42.
29. Sunga MJ, Teisan S, Tsueng G, Macherla VR, Lam KS. Seawater
requirement for the production of lipoxazolidinones by marine actinomycete strain
NPS8920. Journal of industrial microbiology & biotechnology. 2008;35(7):761-5.
30. Miao L, Kwong TF, Qian P-Y. Effect of culture conditions on mycelial
growth, antibacterial activity, and metabolite profiles of the marine-derived fungus
Arthrinium cf saccharicola. Applied Microbiology and Biotechnology.
2006;72(5):1063-73.
31. Lawrence RN. Rediscovering natural product biodiversity. Drug Discovery
Today. 1999;4(10):449-51.
32. Saleem M, Ali MS, Hussain S, Jabbar A, Ashraf M, Lee YS. Marine natural
products of fungal origin. Natural product reports. 2007;24(5):1142-52.
33. Duarte K, Rocha-Santos TA, Freitas AC, Duarte AC. Analytical techniques
for discovery of bioactive compounds from marine fungi. Trends in Analytical
Chemistry. 2012;34:97-110.
34. Kiuru P, D‟Auria MV, Muller CD, Tammela P, Vuorela H, Yli-Kauhaluoma
J. Exploring marine resources for bioactive compounds. Planta Medica.
2014;80(14):1234-46.
35. Draelos ZD. The future of cosmeceuticals: an interview with Albert Kligman.
Dermatologic Surgery. 2005;31(7):890.
36. Dureja H, Kaushik D, Gupta M, Kumar V, Lather V. Cosmeceuticals: An
emerging concept. Indian Journal of Pharmacology. 2005;37(3):155.
37. Kim S-K. Marine cosmeceuticals: trends and prospects: CRC Press; 2011.
38. Amer M, Maged M. Cosmeceuticals versus pharmaceuticals. Clinics in
dermatology. 2009;27(5):428-30.
39. Chermahini SH, Majid FAA, Sarmidi MR. Cosmeceutical value of herbal
extracts as natural ingredients and novel technologies in anti-aging. Journal of
Medicinal Plants Research. 2011;5:3074-7.
Page 107
References
88
40. Athukorala Y, Kim K-N, Jeon Y-J. Antiproliferative and antioxidant
properties of an enzymatic hydrolysate from brown alga, Ecklonia cava. Food and
Chemical Toxicology. 2006;44(7):1065-74.
41. Yoon NY, Eom T-K, Kim M-M, Kim S-K. Inhibitory effect of phlorotannins
isolated from Ecklonia cava on mushroom tyrosinase activity and melanin formation
in mouse B16F10 melanoma cells. Journal of Agricultural and Food Chemistry.
2009;57(10):4124-9.
42. Tsuchiya T, Yamada K, Minoura K, Miyamoto K, Usami Y, Kobayashi T, et
al. Purification and determination of the chemical structure of the tyrosinase inhibitor
produced by Trichoderma viride strain H1-7 from a marine environment. Biological
and Pharmaceutical Bulletin. 2008;31(8):1618-20.
43. Li X, Kim MK, Lee U, Kim S-K, Kang JS, Choi HD, et al. Myrothenones A
and B, cyclopentenone derivatives with tyrosinase inhibitory activity from the
marine-derived fungus Myrothecium sp. Chemical and Pharmaceutical Bulletin.
2005;53(4):453-5.
44. Gasco-Buisson MC. Key trends driving anti-aging skin care in 2009 and
beyond. Textbook of aging skin: Springer; 2010. p. 1197-205.
45. Bronaugh RL, Katz LM. Cosmetics and aging skin. Textbook of Aging Skin:
Springer; 2010. p. 1063-8.
46. Kosmadaki MG, Gilchrest BA. The demographics of aging in the United
States: implications for dermatology. Archives of Dermatology. 2002;138(11):1427-
8.
47. Gorouhi F, Maibach H. Role of topical peptides in preventing or treating aged
skin. International journal of cosmetic science. 2009;31(5):327-45.
48. Baumann L. Skin ageing and its treatment. The Journal of Pathology.
2007;211(2):241-51.
49. Yaar M, Eller MS. Mechanisms of aging. Archives of Dermatology.
2002;138(11):1429.
50. Geserick C, Blasco MA. Novel roles for telomerase in aging. Mechanisms of
Ageing and Development. 2006;127(6):579-83.
51. Martínez P, Blasco MA. Telomeric and extra-telomeric roles for telomerase
and the telomere-binding proteins. Nature Reviews Cancer. 2011;11(3):161-76.
Page 108
References
89
52. Dikmen ZG, Gellert GC, Jackson S, Gryaznov S, Tressler R, Dogan P, et al.
In vivo inhibition of lung cancer by GRN163L: a novel human telomerase inhibitor.
Cancer Research. 2005;65(17):7866-73.
53. Warabi K, Matsunaga S, van Soest RW, Fusetani N. Dictyodendrins AE, the
First Telomerase-Inhibitory Marine Natural Products from the Sponge
Dictyodendrilla v erongiformis 1. The Journal of Organic Chemistry.
2003;68(7):2765-70.
54. Guittat L, De Cian A, Rosu F, Gabelica V, De Pauw E, Delfourne E, et al.
Ascididemin and meridine stabilise G-quadruplexes and inhibit telomerase in vitro.
Biochimica et Biophysica Acta (BBA)-General Subjects. 2005;1724(3):375-84.
55. Warabi K, Hamada T, Nakao Y, Matsunaga S, Hirota H, Van Soest RW, et al.
Axinelloside A, an Unprecedented Highly Sulfated Lipopolysaccharide Inhibiting
Telomerase, from the Marine Sponge, Axinella infundibula 1. Journal of the
American Chemical Society. 2005;127(38):13262-70.
56. Jeon S, Kim K, Koh J, Kong K. Inhibitory effects on L-dopa oxidation of
tyrosinase by skin-whitening agents. Bulletin Korean Chemical Society.
2005;26(7):1135.
57. Lee H-S, Shin K-H, Ryu G-S, Chi G-Y, Cho I-S, Kim H-Y. Synthesis of
small molecule-peptide conjugates as potential whitening agents. Bulletin Korean
Chemical Society. 2012;33(9):3004-8.
58. Abu Ubeid A, M Hantash B. Minireview: peptide analogs and short sequence
oligopeptides as modulators of skin pigmentation. Current topics in Medicinal
Chemistry. 2014;14(12):1418-24.
59. Solano F, Briganti S, Picardo M, Ghanem G. Hypopigmenting agents: an
updated review on biological, chemical and clinical aspects. Pigment Cell Research.
2006;19(6):550-71.
60. Fais A, Corda M, Era B, Fadda MB, Matos MJ, Santana L, et al. Tyrosinase
inhibitor activity of coumarin-resveratrol hybrids. Molecules. 2009;14(7):2514-20.
61. Reszko AE, Berson D, Lupo MP. Cosmeceuticals: practical applications.
Dermatologic clinics. 2009;27(4):401-16.
62. Chang T-S. An updated review of tyrosinase inhibitors. International journal
of molecular sciences. 2009;10(6):2440-75.
63. Wu B. Tyrosinase inhibitors from terrestrial and marine resources. Current
topics in Medicinal Chemistry. 2014;14(12):1425-49.
Page 109
References
90
64. Zhang D, Li X, Kang JS, Choi HD, Son BW. A New α-Pyrone Derivative, 6-
[(E)-Hept-1-enyl]-α-pyrone, with Tyrosinase Inhibitor Activity from a Marine Isolate
of the Fungus Botrytis. Bull Korean Chem Soc. 2007;28(5):887.
65. Wu B, Wu X, Sun M, Li M. Two novel tyrosinase inhibitory sesquiterpenes
induced by CuCl2 from a marine-derived fungus Pestalotiopsis sp. Z233. Marine
drugs. 2013;11(8):2713-21.
66. Lee DJ, Van Dyke GS, Kim J. Update on pathogenesis and treatment of acne.
Current Opinion in Pediatrics. 2003;15(4):405-10.
67. Coates P, Vyakrnam S, Eady E, Jones C, Cove J, Cunliffe W. Prevalence of
antibiotic‐resistant propionibacteria on the skin of acne patients: 10‐year surveillance
data and snapshot distribution study. British Journal of Dermatology.
2002;146(5):840-8.
68. Kamei Y, Sueyoshi M, Hayashi K-i, Terada R, Nozaki H. The novel anti-
Propionibacterium acnes compound, Sargafuran, found in the marine brown alga
Sargassum macrocarpum. The Journal of antibiotics. 2009;62(5):259-63.
69. Wu B, Oesker V, Wiese J, Schmaljohann R, Imhoff JF. Two New Antibiotic
Pyridones Produced by a Marine Fungus, Trichoderma sp. Strain MF106. Marine
drugs. 2014;12(3):1208-19.
70. Hedgepeth J. Sandy beaches: Geological Society of America; 1957. 587-608
p.
71. Bhatnagar I, Kim SK. Immense essence of excellence: marine microbial
bioactive compounds. Marine drugs. 2010;8(10):2673-701.
72. Kubanek J, Jensen PR, Keifer PA, Sullards MC, Collins DO, Fenical W.
Seaweed resistance to microbial attack: a targeted chemical defense against marine
fungi. Proceedings of the National Academy of Sciences. 2003;100(12):6916-21.
73. Jones EG, Byrne P. Physiology of the higher marine fungi. Recent Advances
in Aquatic Mycology EB Gareth Jones ed. 1976.
74. Battley EH. Marine Mycology: The Higher Fungi. Jan Kohlmeyer , Erika
Kohlmeyer. The Quarterly Review of Biology. 1980;55(2):185-.
75. Thomas TRA, Kavlekar DP, LokaBharathi PA. Marine drugs from sponge-
microbe association-A review. Marine drugs. 2010;8(4):1417-68.
76. Hyde K, Jones E. Marine mangrove fungi. Marine ecology. 1988;9(1):15-33.
77. Hooley P, Whitehead M. The genetics and molecular biology of marine fungi.
Mycologist. 2006;20(4):144-51.
Page 110
References
91
78. Cuomo V, Jones EG, Grasso S. Occurrence and distribution of marine fungi
along the coast of the Mediterranean Sea. Progress in Oceanography.
1988;21(2):189-200.
79. Jones E. The distribution of marine fungi on wood submerged in the sea.
Biodeterioration of materials: Elsevier publishing co.; 1968. p. 460-85.
80. Jones E, Irvine J, editors. The role of marine fungi in the biodeterioration of
materials. Biodeterioration of materials Proceedings of the 2nd international
biodeterioration symposium Lunteren, the netherlands, 13th-18th september 1971;
1972: Applied Science.
81. Xu L, Meng W, Cao C, Wang J, Shan W, Wang Q. Antibacterial and
Antifungal Compounds from Marine Fungi. Marine drugs. 2015;13(6):3479-513.
82. Keller MD, Selvin RC, Claus W, Guillard RR. Media for the culture of
oceanic ultraphytoplankton1, 2. Journal of Phycology. 1987;23(4):633-8.
83. Rajasekar T, Balaji S, Kumaran S, Deivasigamani B, Pugzhavendhan S.
Isolation and characterization of Marine fungal metabolites against clinical
pathogens. Asian Pacific Journal of Tropical Disease. 2012;2:S387-S92.
84. Persidis A. Antibacterial and antifungal drug discovery. Nature
biotechnology. 1999;17(11):1141-2.
85. Elixhauser A, Steiner C. Most Common Diagnoses and Procedures in US
Community Hospitals, 1996. Healthcare Cost and Utilization Project, HCUP
Research Note Rockville, MD Agency for Health Care Policy and Research 1999:99-
0046.1999.
86. Russo A, Concia E, Cristini F, De Rosa F, Esposito S, Menichetti F, et al.
Current and future trends in antibiotic therapy of acute bacterial skin and skin-
structure infections. Clinical Microbiology and Infection. 2016;22:S27-S36.
87. DiNubile MJ, Lipsky BA. Complicated infections of skin and skin structures:
when the infection is more than skin deep. Journal of Antimicrobial Chemotherapy.
2004;53(suppl 2):ii37- ii50.
88. Nichols RL. Optimal treatment of complicated skin and skin structure
infections. Journal of Antimicrobial Chemotherapy. 1999;44(suppl 1):19-23.
89. Shah M, Shah HD. Acute bacterial skin and skin structure infections: current
perspective. Indian Journal of Dermatology. 2011;56(5):510.
Page 111
References
92
90. Cassell GH, Mekalanos J. Development of antimicrobial agents in the era of
new and reemerging infectious diseases and increasing antibiotic resistance. Jama.
2001;285(5):601-5.
91. Daszak P, Cunningham AA, Hyatt AD. Emerging infectious diseases of
wildlife--threats to biodiversity and human health. Science. 2000;287(5452):443-9.
92. Giordano P, Weber K, Gesin G, Kubert J. Skin and skin structure infections:
treatment with newer generation fluoroquinolones. Therapeutics and clinical risk
management. 2007;3(2):309.
93. Radjasa OK. Marine Fungi: The Untapped Diversity of Marine
Microorganisms. Journal of Coastal Zone Management. 2015;2015.
94. Kelecom A. Secondary metabolites from marine microorganisms. Anais da
Academia Brasileira de Ciencias. 2002;74(1):151-70.
95. Jensen PR, Fenical W. Marine microorganisms and drug discovery: current
status and future potential. In Drugs from the Sea 2000: 6-29.
96. Bhadury P, Mohammad BT, Wright PC. The current status of natural
products from marine fungi and their potential as anti-infective agents. Journal of
industrial microbiology & biotechnology. 2006;33(5):325-37.
97. Bugni TS, Ireland CM. Marine-derived fungi: a chemically and biologically
diverse group of microorganisms. Natural product reports. 2004;21(1):143-63.
98. Jones E. Marine fungi: some factors influencing biodiversity. Fungal
Diversity. 2000;4(193):53-73.
99. Raghukumar C. Marine fungal biotechnology: an ecological perspective.
Fungal Diversity. 2008;31:19-35.
100. Richards TA, Jones MD, Leonard G, Bass D. Marine fungi: their ecology and
molecular diversity. Annual review of marine science. 2012;4:495-522.
101. Ebada SS, Proksch P. Marine-Derived Fungal Metabolites. Hb25_Springer
Handbook of Marine Biotechnology: Springer; 2015. p. 759-88.
102. Newton GG, Abraham E. Cephalosporin C, a new antibiotic containing
sulphur and D-α-aminoadipic acid. Nature. 1955;175(4456):548-.
103. Rowley DC, Kelly S, Kauffman CA, Jensen PR, Fenical W. Halovirs A–E,
new antiviral agents from a marine-derived fungus of the genus Scytalidium.
Bioorganic & medicinal chemistry. 2003;11(19):4263-74.
104. Bringmann G, Lang G, Gulder TA, Tsuruta H, Mühlbacher J, Maksimenka K,
et al. The first sorbicillinoid alkaloids, the antileukemic sorbicillactones A and B,
Page 112
References
93
from a sponge-derived Penicillium chrysogenum strain. Tetrahedron.
2005;61(30):7252-65.
105. Cueto M, Jensen PR, Kauffman C, Fenical W, Lobkovsky E, Clardy J.
Pestalone, a new antibiotic produced by a marine fungus in response to bacterial
challenge. Journal of natural products. 2001;64(11):1444-6.
106. Singla A, Verma D, Lal B, Sarma PM. Enrichment and optimization of
anaerobic bacterial mixed culture for conversion of syngas to ethanol. Bioresource
technology. 2014;172:41-9.
107. Arora DS, Kaur GJ. Antibacterial activity of some Indian medicinal plants.
Journal of Natural Medicines. 2007;61(3):313-7.
108. Pandey S, Sree A, Sethi DP, Kumar CG, Kakollu S, Chowdhury L, et al. A
marine sponge associated strain of Bacillus subtilis and other marine bacteria can
produce anticholinesterase compounds. Microbial Cell Factories. 2014;13(1):1.
109. Perez C, Pauli M, Bazerque P. An antibiotic assay by the agar well diffusion
method. Acta Biol Med Exp. 1990;15:113-5.
110. Clarke G, Ting KN, Wiart C, Fry J. High correlation of 2, 2-diphenyl-1-
picrylhydrazyl (DPPH) radical scavenging, ferric reducing activity potential and total
phenolics content indicates redundancy in use of all three assays to screen for
antioxidant activity of extracts of plants from the malaysian rainforest. Antioxidants.
2013;2(1):1-10.
111. Silva DM, Batista LR, Rezende EF, Fungaro MHP, Sartori D, Alves E.
Identification of fungi of the genus Aspergillus section Nigri using polyphasic
taxonomy. Brazilian Journal of Microbiology. 2011;42(2):761-73.
112. White TJ, Bruns T, Lee S, Taylor J. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods
and applications. 1990;18(1):315-22.
113. Mishra KN, Aaggarwal A, Abdelhadi E, Srivastava D. An efficient horizontal
and vertical method for online dna sequence compression. International Journal of
Computer Applications. 2010;3(1):39-46.
114. Kumar S, Tamura K, Nei M. MEGA: molecular evolutionary genetics
analysis software for microcomputers. Computer Applications in the Biosciences.
1994;10(2):189-91.
115. Le Dang Q, Shin TS, Park MS, Choi YH, Choi GJ, Jang KS, et al.
Antimicrobial activities of novel mannosyl lipids isolated from the biocontrol fungus
Page 113
References
94
Simplicillium lamellicola BCP against phytopathogenic bacteria. Journal of
Agricultural and Food Chemistry. 2014;62(15):3363-70.
116. Gonçalves VN, Carvalho CR, Johann S, Mendes G, Alves TM, Zani CL, et
al. Antibacterial, antifungal and antiprotozoal activities of fungal communities
present in different substrates from Antarctica. Polar Biology. 2015;38(8):1143-52.
117. Pinheiro Â, Dethoup T, Bessa J, Silva AM, Kijjoa A. A new bicyclic
sesquiterpene from the marine sponge associated fungus Emericellopsis minima.
Phytochemistry Letters. 2012;5(1):68-70.
118. Chen T, Lam C-K, Chen W-D, Chen X-H, Feng G-K, Zhu X-F, et al. NMR
screening approach for discovery of new 6-methylpyridinone derivatives from the
marine-derived fungus Leptosphaerulina sp. Arabian Journal of Chemistry. 2015.
119. Amagata T, Amagata A, Tenney K, Valeriote FA, Lobkovsky E, Clardy J, et
al. Unusual C25 Steroids Produced by a Sponge-Derived Penicillium citrinum.
Organic Letters. 2003;5(23):4393-6.
120. Ueda J-y, Hashimoto J, Inaba S, Takagi M, Shin-ya K. JBIR-59, a new
sorbicillinoid, from a marine-derived fungus Penicillium citrinum SpI080624G1f01.
Journal of Antibiotics. 2010;63(4):203.
121. Kawahara T, Takagi M, Shin-ya K. JBIR-124: a novel antioxidative agent
from a marine sponge-derived fungus Penicillium citrinum SpI080624G1f01. Journal
of Antibiotics. 2012;65(1):45.
122. Khamthong N, Rukachaisirikul V, Phongpaichit S, Preedanon S, Sakayaroj J.
Bioactive polyketides from the sea fan-derived fungus Penicillium citrinum PSU-
F51. Tetrahedron. 2012;68(39):8245-50.
123. Sun Y-L, Zhang X-Y, Zheng Z-H, Xu X-Y, Qi S-H. Three new polyketides
from marine-derived fungus Penicillium citrinum SCSGAF 0167. Natural product
research. 2014;28(4):239-44.
124. Tsuda M, Sasaki M, Mugishima T, Komatsu K, Sone T, Tanaka M, et al.
Scalusamides AC, New Pyrrolidine Alkaloids from the Marine-Derived Fungus
Penicillium citrinum. Journal of natural products. 2005;68(2):273-6.
125. An CY, Li XM, Li CS, Gao SS, Shang Z, Wang BG. Triazoles and Other N‐
Containing Metabolites from the Marine‐Derived Endophytic Fungus Penicillium
chrysogenum EN‐118. Helvetica Chimica Acta. 2013;96(4):682-7.
Page 114
References
95
126. Devi P, Rodrigues C, Naik C, D‟souza L. Isolation and characterization of
antibacterial compound from a mangrove-endophytic fungus, Penicillium
chrysogenum MTCC 5108. Indian journal of microbiology. 2012;52(4):617-23.
127. Visamsetti A, Ramachandran SS, Kandasamy D. Penicillium chrysogenum
DSOA associated with marine sponge (Tedania anhelans) exhibit antimycobacterial
activity. Microbiological research. 2016;185:55-60.
128. Suwannarangsee S, Arnthong J, Eurwilaichitr L, Champreda V. Production
and characterization of multipolysaccharide degrading enzymes from Aspergillus
aculeatus BCC199 for saccharification of agricultural residues. Journal of
Microbiology and Biotechnology. 2014;24(10):1427-37.
129. Qiao M-F, Ji N-Y, Liu X-H, Li K, Zhu Q-M, Xue Q-Z. Indoloditerpenes from
an algicolous isolate of Aspergillus oryzae. Bioorganic & medicinal chemistry letters.
2010;20(19):5677-80.
130. Qiao M-F, Ji N-Y, Liu X-H, Li F, Xue Q-Z. Asporyergosterol, a new steroid
from an algicolous isolate of Aspergillus oryzae. Natural Product Communications.
2010;5(10):1575-8.
131. Liu X, Song F, Ma L, Chen C, Xiao X, Ren B, et al. Sydowiols A–C:
Mycobacterium tuberculosis protein tyrosine phosphatase inhibitors from an East
China Sea marine-derived fungus, Aspergillus sydowii. Tetrahedron Letters.
2013;54(45):6081-3.
132. Teuscher F, Lin W, Wray V, Edrada RA, Padmakumar K, Proksch P, et al.
Two new cyclopentanoids from the endophytic fungus Aspergillus sydowii associated
with the marine alga Acanthophora spicifera. Natural Product Communications.
2006;1(11):927-33.
133. Matsumura Y, Ananthaswamy HN. Toxic effects of ultraviolet radiation on
the skin. Toxicology and Applied Pharmacology. 2004;195(3):298-308.
134. Simon JD, Peles D, Wakamatsu K, Ito S. Current challenges in understanding
melanogenesis: bridging chemistry, biological control, morphology, and function.
Pigment Cell & Melanoma Research. 2009;22(5):563-79.
135. Briganti S, Camera E, Picardo M. Chemical and instrumental approaches to
treat hyperpigmentation. Pigment Cell Research. 2003;16(2):101-10.
136. Petit L, Pierard G. Skin‐lightening products revisited. International journal of
cosmetic science. 2003;25(4):169-81.
Page 115
References
96
137. Scott MC, Suzuki I, Abdel‐Malek ZA. Regulation of the human melanocortin
1 receptor expression in epidermal melanocytes by paracrine and endocrine factors
and by ultraviolet radiation. Pigment Cell Research. 2002;15(6):433-9.
138. Hwang J-H, Lee BM. Inhibitory effects of plant extracts on tyrosinase, L-
DOPA oxidation, and melanin synthesis. Journal of Toxicology and Environmental
Health, Part A. 2007;70(5):393-407.
139. Karioti A, Protopappa A, Megoulas N, Skaltsa H. Identification of tyrosinase
inhibitors from Marrubium velutinum and Marrubium cylleneum. Bioorganic &
Medicinal Chemistry. 2007;15(7):2708-14.
140. Parvez S, Kang M, Chung HS, Bae H. Naturally occurring tyrosinase
inhibitors: mechanism and applications in skin health, cosmetics and agriculture
industries. Phytotherapy Research. 2007;21(9):805-16.
141. Kim Y-J, Uyama H. Tyrosinase inhibitors from natural and synthetic sources:
structure, inhibition mechanism and perspective for the future. Cellular and
Molecular Life Sciences 2005;62(15):1707-23.
142. Battaini G, Monzani E, Casella L, Santagostini L, Pagliarin R. Inhibition of
the catecholase activity of biomimetic dinuclear copper complexes by kojic acid.
Journal of Biological Inorganic Chemistry. 2000;5(2):262-8.
143. Nakagawa M, Kawai K, Kawai K. Contact allergy to kojic acid in skin care
products. Contact Dermatitis. 1995;32(1):9-13.
144. Takizawa T, Mitsumori K, Tamura T, Nasu M, Ueda M, Imai T, et al.
Hepatocellular tumor induction in heterozygous p53-deficient CBA mice by a 26-
week dietary administration of kojic acid. Toxicological Sciences. 2003;73(2):287-
93.
145. Valko M, Leibfritz D, Moncol J, Cronin MT, Mazur M, Telser J. Free
radicals and antioxidants in normal physiological functions and human disease. The
International Journal of Biochemistry & Cell Biology. 2007;39(1):44-84.
146. Hekimi S, Lapointe J, Wen Y. Taking a “good” look at free radicals in the
aging process. Trends in Cell Biology. 2011;21(10):569-76.
147. Tiwari AK. Imbalance in antioxidant defence and human diseases: Multiple
approach of natural antioxidants therapy. CURRENT SCIENCE-BANGALORE-.
2001;81(9):1179-87.
148. Blunt JW, Copp BR, Keyzers RA, Munro MH, Prinsep MR. Marine natural
products. Natural product reports. 2014;31(2):160-258.
Page 116
References
97
149. Mayer A, Rodríguez AD, Taglialatela-Scafati O, Fusetani N. Marine
pharmacology in 2009–2011: Marine compounds with antibacterial, antidiabetic,
antifungal, anti-inflammatory, antiprotozoal, antituberculosis, and antiviral activities;
affecting the immune and nervous systems, and other miscellaneous mechanisms of
action. Marine drugs. 2013;11(7):2510-73.
150. Wang C, Mao W, Chen Z, Zhu W, Chen Y, Zhao C, et al. Purification,
structural characterization and antioxidant property of an extracellular polysaccharide
from Aspergillus terreus. Process Biochemistry. 2013;48(9):1395-401.
151. Zhu T, Chen Z, Liu P, Wang Y, Xin Z, Zhu W. New rubrolides from the
marine-derived fungus Aspergillus terreus OUCMDZ-1925. Journal of Antibiotics.
2014;67(4):315.
152. Lee SM, Li XF, Jiang H, Cheng JG, Seong S, Choi HD, et al. Terreusinone, a
novel UV-A protecting dipyrroloquinone from the marine algicolous fungus
Aspergillus terreus. Tetrahedron Letters. 2003;44(42):7707-10.
153. Oleinikova GK, Denisenko VA, Berdyshev DV, Pushilin MA, Kirichuk NN,
Menzorova NI, et al. Two new sesterterpenoids, terretonins H and I, from the marine-
derived fungus Aspergillus ustus. Phytochemistry Letters. 2016;17:135-9.
154. You M, Liao L, Hong SH, Park W, Kwon DI, Lee J, et al. Lumazine Peptides
from the Marine-Derived Fungus Aspergillus terreus. Marine drugs.
2015;13(3):1290-303.
155. Yin Y, Gao Q, Zhang F, Li Z. Medium optimization for the high yield
production of single (+)-terrein by Aspergillus terreus strain PF26 derived from
marine sponge Phakellia fusca. Process Biochemistry. 2012;47(5):887-91.
156. Liang X, Zhang X-Y, Nong X-H, Wang J, Huang Z-H, Qi S-H. Eight linear
peptides from the deep-sea-derived fungus Simplicillium obclavatum EIODSF 020.
Tetrahedron. 2016;72(22):3092-7.
157. Yan B-F, Fang S-T, Li W-Z, Liu S-J, Wang J-H, Xia C-H. A new minor
diketopiperazine from the sponge-derived fungus Simplicillium sp. YZ-11. Natural
product research. 2015;29(21):2013-7.
158. Fukuda T, Sudoh Y, Tsuchiya Y, Okuda T, Igarashi Y. Isolation and
biosynthesis of preussin B, a pyrrolidine alkaloid from Simplicillium lanosoniveum.
Journal of natural products. 2014;77(4):813-7.
Page 117
References
98
159. Takata K, Iwatsuki M, Yamamoto T, Shirahata T, Nonaka K, Masuma R, et
al. Aogacillins A and B produced by Simplicillium sp. FKI-5985: new circumventors
of arbekacin resistance in MRSA. Organic Letters. 2013;15(18):4678-81.
160. Chen Z, Song Y, Chen Y, Huang H, Zhang W, Ju J. Cyclic Heptapeptides,
Cordyheptapeptides C–E, from the Marine-Derived Fungus Acremonium persicinum
SCSIO 115 and Their Cytotoxic Activities. Journal of natural products.
2012;75(6):1215-9.
161. Bharti P, Anand V, Chander J, Singh IP, Singh TV, Tewari R. Heat stable
antimicrobial activity of Burkholderia gladioli OR1 against clinical drug resistant
isolates. The Indian Journal of Medical Research. 2012;135(5):666.
162. Khurram M, Khan MA, Hameed A, Abbas N, Qayum A, Inayat H.
Antibacterial activities of Dodonaea viscosa using contact bioautography technique.
Molecules. 2009;14(3):1332-41.