-
Plant Health and Environment Laboratory Investigation and
Diagnostic Centres and Response
PO Box 2095, 231 Morrin Road, Saint Johns, Auckland 1140, New
Zealand
Telephone: +64-9-909 3015, Facsimile: +64-9-909 5739
www.mpi.govt.nz
Ipomoea (Sweetpotato/Kumara)
Post-Entry Quarantine Testing Manual
November 2012
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
ii
Ipomoea Post-Entry Quarantine Testing Manual
Contents 1. SCOPE
.......................................................................................................................................................
1 2. INTRODUCTION
.....................................................................................................................................
1 3. IMPORT
REQUIREMENTS...................................................................................................................
3 4. PESTS
........................................................................................................................................................
3
4.1 Regulated pests for which generic measures are required
........................................................... 3 4.2
Regulated pests for which specific tests are required
...................................................................
4
5. PROPAGATION, CARE AND MAINTENANCE IN POST-ENTRY QUARANTINE
.................... 4 5.1 Whole
plants.....................................................................................................................................
4 5.2 Plants in tissue culture
....................................................................................................................
5 5.3 Pollen
................................................................................................................................................
5
6. INSPECTION
............................................................................................................................................
5 7. TESTING
...................................................................................................................................................
6
7.1 Specific tests for nursery stock
.......................................................................................................
7 7.1.1 Graft inoculation
.........................................................................................................................
8 7.1.2 Herbaceous
indexing.................................................................................................................
10 7.1.3 Serological and molecular assays
............................................................................................
11
7.1.3.1 Enzyme-linked immunosorbent assay (ELISA)
.......................................................... 11
7.1.3.2 Polymerase chain reaction
(PCR).................................................................................
12
7.1.3.2.1 Virus reverse transcription-PCR
..............................................................................
14 7.1.3.2.1.1 Sweet potato chlorotic stunt virus
........................................................................
18 7.1.3.2.1.2 Sweetpotato leaf curl virus
...................................................................................
18 7.1.3.2.1.3 Sweetpotato mild speckling virus
.........................................................................
18 7.1.3.2.1.4 Sweetpotato vein mosaic virus
..............................................................................
18 7.1.3.2.1.5 Tobacco streak virus
.............................................................................................
18
7.1.3.2.2 Phytoplasma PCR
.......................................................................................................
19 7.1.3.2.2.2 Sweetpotato little leaf phytoplasma
...................................................................
21
7.1.3.2.3 Bacteria PCR
..............................................................................................................
21 7.1.3.2.3.1 Dickeya chrysanthemi
..........................................................................................
21
7.1.4 Bacterial isolation on media
.....................................................................................................
22 7.1.4.1 Dickeya chrysanthemi (basonym. Erwinia chrysanthemi)
........................................... 22
7.1.5 Microscopic inspection for mites
.............................................................................................
23 7.1.5.1 Tetranychus evansi
.........................................................................................................
23
8. CONTACT POINT
.................................................................................................................................
24 9. ACKNOWLEDGEMENTS
....................................................................................................................
24 10. REFERENCES
........................................................................................................................................
24 Appendix 1. Symptoms of significant regulated pests of Ipomoea
batatas .................................................. 27
1.1 Meliodogyne incognita
...................................................................................................................
27 1.2 Rotylenchulus reniformis
...............................................................................................................
27 1.3 Tetranychus evansi
.........................................................................................................................
27 1.4 Plant damage caused by mites
......................................................................................................
27 1.5 Streptomyces ipomoea
....................................................................................................................
28 1.6 Elsino batatas
................................................................................................................................
28
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
iii
1.7 Dickeya chrysanthemi
....................................................................................................................
28 1.8 Ipomoea batatas infected with a mixture of viruses
....................................................................
29 1.9 Sweetpotato chlorotic stunt virus
...................................................................................................
29 1.10 Sweetpotato leaf curl virus
.............................................................................................................
29 1.11 Sweetpotato little leaf phytoplasma
.............................................................................................
29
Appendix 2. Virus symptoms on graft inoculated Ipomoea setosa
............................................................... 30
2.1 Sweetpotato chlorotic stunt virus + Sweetpotato feathery mottle
virus ......................................... 30 2.2 Sweetpotato
virus 2
.........................................................................................................................
30 2.3 Sweetpotato virus
C6.......................................................................................................................
30 2.4 Sweetpotato leaf curl virus
.............................................................................................................
31 2.5 Sweetpotato leaf curl virus + Sweetpotato virus 2
.........................................................................
31 2.6 Sweetpotato leaf curl virus + Sweetpotato feathery mottle
virus ................................................... 31
Appendix 3. Protocols referenced in manual
.................................................................................................
32 3.1 Silica-milk RNA extraction protocol
............................................................................................
32 3.2 Phytoplasma DNA enrichment CTAB extraction protocol
........................................................ 32
Ministry for Primary Industries, November, 2012
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
1
1. SCOPE The scope of this manual is limited to Ipomoea batatas
and Ipomoea setosa nursery stock (whole plants and plants in tissue
culture), seed for sowing and pollen of Ipomoea species permitted
entry into New Zealand as listed in the Ministry for Primary
Industries (MPI) Plants Biosecurity Index
(http://www.maf.govt.nz/cgi-bin/bioindex/bioindex.pl). At the date
of publication of this manual, these species were as follows:
Ipomoea alba Ipomoea aquatica Ipomoea arborescens Ipomoea batatas
Ipomoea brasiliensis Ipomoea cairica Ipomoea carnea Ipomoea
horsfalliae Ipomoea imperialis Ipomoea lobata Ipomoea minuta
Ipomoea nil
Ipomoea noctiflora Ipomoea palmata (syn. Ipomoea cairica)
Ipomoea pes-caprae Ipomoea platensis Ipomoea purpurea Ipomoea
quamoclit Ipomoea sepacuitensis Ipomoea setosa Ipomoea sloteri
Ipomoea tricolor Ipomoea tuberosa (syn. Merremia tuberosa)
Note: The importation of Ipomoea caerulea, Ipomoea hederacea,
Ipomoea indica, Ipomoea learii (syn. Ipomoea indica), Ipomoea
plebeia and Ipomoea triloba is prohibited. This manual describes
the testing requirements specified in the import health standards
for Ipomoea. The manual also provides an introduction to the crop
and guidance on the establishment and maintenance of healthy plants
in quarantine. 2. INTRODUCTION
Sweetpotato (Ipomoea batatas (L.) Lam.), a member of the family
Convolvulaceae, probably originated in Central or South America,
where it has been a food source for over 55,000 years. Sweetpotato
was taken to Spain and early Spanish explorers are believed to have
taken it to the Philippines and East Indies; from there it was soon
carried to India, China, and Malaysia by Portuguese voyagers. It is
not fully known how sweetpotato arrived in Polynesia, but it has
been used on many of the islands in the South Pacific Ocean for at
least 2000 years (Clark & Moyer, 1988).
Sweetpotato is grown in a wide range of environments under a
range of farming systems, from the humid tropics to mild temperate
zones, and from sea level to 2700 m altitude. Annual global
production of sweetpotato currently exceeds 124 million tonnes.
More than 95% of the global sweetpotato crop is grown in developing
countries. China is the world's largest producer, accounting for
more than 90%. Vietnam, Indonesia, and Uganda all grow more than
two million tonnes per year. India and Rwanda each harvest more
than a million tonnes annually. Of the 82 developing countries
where sweetpotatoes grow, 36 are in Africa, 22 in Asia, and 24 in
Latin America. Around 40 countries count sweetpotato among the five
most important food crops produced on an annual basis.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
2
The per capita income provided by sweetpotato is one of the
lowest among the major food crops. Its potential benefit to poor
farm households and urban consumers is only now being considered.
Sweetpotato actually produces more edible energy per hectare per
day than any other major food crop.
Sweetpotato is a perennial plant cultivated as an annual crop
and propagated vegetatively. The sweetpotato plant is a prostrate
vine system that expands horizontally and develops a shallow
canopy. The sweetpotato plant produces several different types of
thick and thin roots. Thick roots can differentiate into either
pencil roots or storage roots, the latter being used for human
consumption. Sweetpotatoes are not tubers as they are initiated at
the first stem node below the soil line, to which they are attached
by a stalk of thinner root (Clark & Moyer, 1988).
Although known for its tolerance to drought and its sensitivity
to saturated soil condition, sweetpotato requires sufficient water
and nutrients to produce good yield. Non-rooted stem cuttings
(20-40 cm) with 5-8 nodes are harvested from storage roots laid out
in nursery beds, and transplanted into the field. Sweetpotato can
be cultivated continuously throughout the year in tropical regions,
but in temperate regions the crop is planted in spring when the
risk of frost is reduced. The crop requires a minimum frost-free
period of 120-150 days and average daily temperatures of 22-24C
along with good rainfall and good drainage (Clark & Moyer,
1988).
The flesh of sweetpotato can be white, purple, orange or yellow.
Yellow and orange-fleshed varieties are valuable for their carotene
(provitamin A) content. Skin colour ranges from nearly white
through shades of buff to brown, or through pink to copper, even
magenta and purple.
In New Zealand, sweetpotato (known as kumara) is a crop of
cultural importance and an important food source. Kumara was
introduced by Maori when they settled in New Zealand from
Polynesia. Cultivation of this crop was undertaken on a large scale
because of its importance as a food source. With the arrival of
European settlers, other carbohydrate crops such as potato, wheat,
and corn displaced sweetpotato in dietary importance but not the
crops place in Maori culture. Since the 1950s, after efforts to
select improved clones, production has steadily increased along
with consumption as people rediscover kumara.
The local cultivar Owairaka Red, released in 1954, comprises 80%
of the crop. Other cultivars include Toka Toka Gold, selected in
1972 (14%) and Beauregard (introduced in 1993). A range of other
local varieties are also grown, usually in garden plots.
The area around Dargaville in the Kaipara district produces 85%
of the national crop. Smaller plantings of approximately 5% are
found around Auckland and Bay of Plenty. The area planted annually
is approximately 1,100 hectares producing about 26,500 tonnes, with
yields averaging 20 t/ha. Plantings range in area from garden plots
to 30 ha, averaging 10 ha. Most of New Zealands production is for
local fresh consumption although increasing amounts are processed
and/or exported. A thorough review of this crop and its place in
New Zealand agriculture is presented by Lewthwaite (1997).
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
3
3. IMPORT REQUIREMENTS The import requirements for I. batatas
and I. setosa nursery stock (whole plant and plants in tissue
culture) are set out in MPIs import health standard Importation of
Nursery Stock
(http://www.biosecurity.govt.nz/files/ihs/155-02-06.pdf). Imported
nursery stock must meet the general requirements (sections 1-2) and
the specific requirements detailed in the Ipomoea batatas schedule.
On arrival in New Zealand, the nursery stock must be grown for a
minimum period of 3 months in a Level 3 post-entry quarantine
facility where it will be inspected, treated and/or tested for
regulated pests. The import requirements for Ipomoea seed for
sowing are set out in MPIs import health standard Importation of
Seed for Sowing
(http://www.biosecurity.govt.nz/files/ihs/155-02-05.pdf). Imported
seed is only required to meet the general requirements (sections
1-2) and there are no specific requirements for the genus. An
import permit is not required and seed meeting the import
requirements is given biosecurity clearance at the border without
the need for post-entry quarantine. The import requirements for
pollen are stated in section 2.2.3 in MPIs import health standard
Importation of Nursery Stock
(http://www.biosecurity.govt.nz/files/ihs/155-02-06.pdf ) and
further details can be found in section 5.3 of this manual. 4.
PESTS The following section lists regulated pests of I. batatas and
I. setosa nursery stock that require generic or specific measures.
4.1 Regulated pests for which generic measures are required
Insects: Cylas formicarius Cylas puncticollis Euscepes
postfasciatus Nematodes: Meliodogyne incognita [Fig. 1.1]
Rotylenchulus reniformis [Fig. 1.2] Pratylenchus coffeae
Pratylenchus brachyurus Fungi: Elsino batatas [Fig. 1.6]
Helicobasidium mompa Bacteria: Pseudomonas batatas Streptomyces
ipomoea [Fig. 1.5] Xanthomonas batatae Xylella fastidiosa
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
4
Viruses: Sweetpotato chlorotic fleck virus [Fig. 1.8]
Sweetpotato latent virus Sweetpotato ringspot virus Sweetpotato
virus C6 [Fig. 1.8, 2.3] 4.2 Regulated pests for which specific
tests are required Mites: Tetranychus evansi [Fig. 1.3, 1.4]
Bacteria: Dickeya chrysanthemi [Fig. 1.7] Phytoplasma: Sweetpotato
little leaf phytoplasma [Fig. 1.11] Viruses: Sweetpotato
caulimo-like virus Sweetpotato chlorotic stunt virus [Fig. 1.9,
2.1] Sweetpotato leaf curl virus [Fig. 1.10, 2.4, 2.5, 2.6]
Sweetpotato leaf speckling virus Sweetpotato mild speckling virus
Sweetpotato vein mosaic virus Sweetpotato yellow dwarf virus
Tobacco streak virus 5. PROPAGATION, CARE AND MAINTENANCE IN
POST-ENTRY
QUARANTINE 5.1 Whole plants Sweetpotato plants can be grown in
the glasshouse all year round as long as a day-time temperature
between 18-26C is maintained. Night-time temperatures should not
fall below 12C to avoid chilling injury. Supplementary lighting may
be required in winter. Sweetpotatoes require free-draining planting
which is initially only moistened to avoid development of rots in
quiescent storage roots. The plants can be watered more freely when
the canopy has established and the plants are actively growing. The
sweetpotato is a perennial plant and harvesting takes place when
storage roots reach the desired size. Harvesting may be plant
destructive, but if larger storage roots are removed with minimal
plant disturbance, the remaining storage roots will continue to
grow and new plants will form. Harvested roots should be stored in
the dark at 13C. Storage temperatures should not fall below 12C
which can cause chilling injury. Relative humidity during storage
should be maintained at 80 to 90%. Roots stored in multi-walled
paper bags can respire and maintain their own humid environment.
Hessian or net bags should be avoided as they can cause abrasive
injury and allow moisture and pathogen entry.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
5
Whole plants should be planted into sufficiently sized pots (eg
3 L minimum) containing 50:50 (v/v) pasteurised peat:pumice
planting media and a few grams of slow-release fertiliser with
trace elements (e.g. Osmocote). Nodal cuttings should be taken from
growing vines to maintain the clone and facilitate quarantine
examination and testing. Cuttings with one or two leaves and at
least two nodes can be rooted directly in pasteurised pumice sand
or perlite before transferring to planting media. It would be worth
preserving clonal material in tissue culture as a back-up resource,
and to preserve any established virus-free status. Plants in tissue
culture Tissue culture plantlets can be sub-cultured after arrival
by cutting into nodal sections and placing into new tissue culture
vessels with fresh nutrient media (e.g. Murashige and Skoog media).
Plantlets to be tested are carefully excised from the tissue
culture vessel and washed to remove any remaining agar and planted
into pots of planting media containing 50:50 (v/v) pasturised
peat:perlite or 50:50 (v/v) peat:vermiculite. The plantlets must be
protected from desiccation for approximately three weeks by
covering initially with a vented plastic tub or bag. Alternatively,
the plants can be misted regularly to keep the planting media
moist, and to maintain a high relative humidity. Pots should be
placed in bright light, but not direct sunlight during the three
weeks. After this period, any coverings should be removed and the
plants moved to higher light intensity. 5.3 Pollen Anthers can be
collected from mature but unopened flowers and dried in warm, light
conditions. Following this drying period, pollen should be
collected into a centrifuge vial or into gel capsules and stored at
4C in a sealed container in the presence of a strong desiccant such
as calcium chloride. 6. INSPECTION The inspection requirements for
the operator of the facility are set out in the MPI Biosecurity
Authority Standard PBC-NZ-TRA-PQCON
(http://www.biosecurity.govt.nz/files/regs/stds/pbc-nz-tra-pqcon.pdf
) Photographs of symptoms caused by significant regulated diseases
can be found in Appendix 1. However, please note that pot-grown
sweetpotato plants can be prone to nutrient deficiencies if not
adequately fertilised and nutrient deficiencies can resemble virus
infection, e.g. chlorosis and necrosis. Symptoms related to
nutrient deficiencies can be found in Appendix 2. Further
information on nutrient deficiencies is described in Clark &
Moyer (1988).
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
6
7. TESTING Each of the specific tests required in the import
health standard (as described in section 4 and summarised in Table
1) must be done irrespective of whether plants exhibit symptoms.
This testing is required to detect latent infections. Samples
should be tested as soon as possible after removal from the plant.
If samples have to be stored before testing, the plant material
must be kept whole, all surface water must be removed, and the
material stored in a plastic bag at 4oC. Samples that become
partially decayed or mouldy must not be tested, and further samples
should be collected. Inspection for mites Inspection for mites is
performed once whole plants or tissue culture plants have
established successfully in planting media and have produced stems
with at least 10-15 nodes. Inspection should take place before
samples are taken for other testing methods. Using a hand lens, the
underside of all leaves must be inspected for mite eggs, nymphs,
adults and symptoms of mite presence. Following this, the 3
youngest leaves of each plant, plus any suspect leaves showing the
presence of mites must be collected for further examination under a
binocular microscope. See section 7.1.5 for further details.
Indexing tests Graft inoculation: Grafting can begin when the whole
plants or tissue culture plants have established successfully in
planting media and have produced stems with at least 10-15 nodes.
Grafting should take place before leaf samples are collected for
other testing methods. See section 7.1.1 for further details. Each
plant in the glasshouse must be tested individually by graft
indexing Herbaceous indexing: Virus testing should be done in
spring (or under spring-like conditions) when new growth has
occurred. At least two fully expanded leaves must be sampled from
each of two different branches of the main stem, one a younger leaf
and one an older leaf from a mid-way position. Each plant in the
glasshouse must be tested individually by herbaceous indexing. See
section 7.1.2 for further details PCR and ELISA testing Viruses:
For virus-testing of I. batatas by PCR and ELISA, it is recommended
to test the graft-inoculated indicator plants rather than the
original test plants. However, original I. setosa plants can be
tested directly. Virus testing should be done in spring (or under
spring-like conditions) when new growth has occurred. At least two
fully expanded leaves must be sampled from each of two different
branches of the main stem, one a younger leaf and one an older leaf
from a mid-way position. The sampled leaves from each plant must be
bulked together and tested as soon as possible after removal from
the host. See section 7.1.3 for further details. Bacteria and
phytoplasma: Bacteria and phytoplasma testing must be carried out
using the original I. batatas and I. setosa plants and should be
done in summer (or under summer-like conditions). For each plant,
at least two fully expanded leaves must be sampled from each of two
different branches of the main stem, one a younger leaf and one an
older leaf from a mid-way position. Detection of both bacteria and
phytoplasma requires testing of leaf petioles and mid-veins. The
sampled leaves from each plant must be bulked together and tested
as soon as possible after removal from the host. See section 7.1.3
for further details
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
7
Bacterial isolation on media Isolation of regulated bacteria
testing must be carried out using the original I. batatas and I.
setosa plants and should be done in summer (or under summer-like
conditions). For each plant, at least two fully expanded leaves
must be sampled from each of two different branches of the main
stem, one a younger leaf and one an older leaf from a mid-way
position. Detection of bacteria requires plating vascular tissue
from petioles mid-veins. Each plant in the glasshouse must be
tested individually. See section 7.1.4 for further details.
Table 1: Summary of the regulated pests for I. batatas and I.
setosa indicating the specific tests that are required (),
alternative () or optional ()
Organism Type Graft Inoculation1
Herbaceous Indexing
ELISA PCR
Isolation on media
Inspection
Mites Tetranychus evansi Bacterium Dickeya chrysanthemi
Phytoplasma Sweetpotato little leaf phytoplasma
Viruses Sweetpotato caulimo-like virus Sweetpotato chlorotic
stunt virus
Sweetpotato leaf curl virus2 Sweetpotato leaf speckling
virus
Sweetpotato mild speckling virus
Sweetpotato vein mosaic virus Sweetpotato yellow dwarf virus
Tobacco streak virus
1Not required for I. setosa; 2ssDNA Geminivirus 7.1 Specific
tests for nursery stock Each plant must be tested separately with
the following exceptions, samples from up to 5 plants may be bulked
for testing provided that either:
(a) the plants are derived from a single imported plant or plant
established from a storage root from which separate cuttings have
been taken upon arrival in New Zealand, in the presence of a MPI
inspector; or
(b) in the case of tissue culture where plants are clonal, and
this is confirmed by evidence from the national plant protection
organisation in the exporting country.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
8
7.1.1 Graft inoculation Each I. batatas plant must be tested by
graft inoculation using a minimum of 3 replicate indicator plants
of either I. setosa or I. nil Scarlet O Hara. Indicator plants must
be maintained in a healthy, vigorous state, as symptoms associated
with abiotic stresses, such as water and nutrient deficiencies, may
mask and interfere with observations of disease symptoms. The
indicator plants can be grown from seed or from young cuttings. If
using seed, sow 3-4 weeks before grafting. Sweetpotato seed
requires scarification prior to germination. Indicator seeds are
soaked in concentrated sulphuric acid (98%) for 20 minutes (I. nil)
or 60 minutes (I. batatas). Seeds are then rinsed in running tap
water 3-4 times prior to planting in moist planting media. The
method for propagating sweetpotato plants from seed is described in
full by Saladaga et al. (1991). The indicator plants are ready for
grafting when they have two or more fully expanded leaves. To avoid
cross-contamination of plants during the grafting process, use a
sterile scalpel for each sweetpotato plant to be tested.
Recommended method 1. Begin grafting by cutting indicator plants
back to 2 true leaves. 2. Sweetpotato plants are tested by
wedge-grafting. Each sweetpotato plant that is to be
used for indexing should be established with a minimum of five
nodes. Remove a branch from the sweetpotato plant to be indexed and
cut the branch into 5 sections, each containing a node with a fully
expanded leaf attached.
3. Wedge-graft each node section onto a separate indicator
plant. 4. To prevent desiccation, wrap the graft with parafilm, or
similar. 5. Cover the whole plant with a plastic bag to reduce
airflow around the graft. 6. Remove the plastic bag 5-7 days after
grafting. 7. Fertilise the indicator plant with a slow-release
fertiliser (e.g. Osmocote) and insert a
bamboo-stake into the pot to support the growth of the plant. 8.
Grow the indicator plants to at least 10-15 nodes; this will take
approximately 3-5 weeks.
During the growth period, monitor the indicator plants daily for
virus symptoms which may only show for a short period of time.
9. Some sweetpotato grafts may grow faster than the indicator
plant, cut any sweetpotato growth back to ensure the indicator
plant grows well.
10. At the end of the 3-5 week growth period, cut the indicator
plants back to 1-2 buds and re-grow for 3-5 weeks. Re-growth should
again be closely monitored daily for virus symptoms.
11. A positive control must be included with each batch of
inoculations. For the positive control, graft a sweetpotato plant
known to be infected with a non-regulated virus, e.g. Sweetpotato
feathery mottle virus (SPFMV).
12. It is recommended to include a negative control with each
batch of inoculations. For the negative indicator, cut back to 2
true leaves, as for grafted plants, but do not graft.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
9
Note: Sweetpotato plants are sensitive to some pesticides and
spray damage can induce mosaic-like symptoms. In addition, plants
suffering from nutrient deficiencies can show leaf chlorosis and
necrosis.
Interpretation of results Symptoms on I. setosa usually appear
within 2-4 weeks, and on I. nil around one week. However, the
severity of virus symptoms and length of time before they appear on
the indicator plants depends upon the virus and the amount of virus
inoculum present in the scion. The graft inoculation results will
only be considered valid if:
(a) no symptoms are produced on the negative control
(non-grafted) indicator plant; and (b) the expected symptoms are
produced on the indicator hosts with the positive control
(non-regulated virus). If SPFMV was used as the positive
control, the following symptoms will be produced on the indicator
plants:
I. setosa vein clearing followed by remission. I. nil systemic
vein clearing, vein banding, ringspots. The symptoms produced by
each of the regulated viruses on the indicator species I. setosa
and I. nil are described below. Sweetpotato caulimo-like virus: I.
setosa chlorotic flecks along the secondary veins and interveinal
chlorotic spots on
leaves.
Sweetpotato chlorotic stunt virus: I. setosa stunting, yellowing
and leaf deformation, although symptoms maybe mild
depending on isolate. I. nil stunting, yellowing and leaf
deformation, although symptoms maybe mild
depending on isolate. Sweetpotato leaf curl virus: I. setosa
curling of young leaves. I. nil curling of young leaves.
Sweetpotato leaf speckling virus: I. setosa chlorotic and necrotic
spotting, dwarfing and leaf curling. I. nil chlorotic and necrotic
spotting, dwarfing and leaf curling.
Sweetpotato mild speckling virus: I. setosa mild mosaic
sometimes observed in first two true leaves.
Sweetpotato vein mosaic virus: I. setosa systemic vein-clearing
and mosaic. I. nil systemic vein-clearing and mosaic. Sweetpotato
yellow dwarf virus: I. setosa chlorotic leaf mottling.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
10
7.1.2 Herbaceous indexing Each I. batatas and I. setosa plant
must be tested for mechanically-transmitted regulated viruses using
herbaceous indicators, this is in addition to graft inoculation.
Sap must be inoculated onto two plants of each herbaceous species
as follows: Chenopodium quinoa, Nicotiana benthamiana, N.
clevelandii and N. tabacum. It is important that the pre- and
post-inoculation growing conditions of the herbaceous indicator
plants promote their susceptibility. Plants must be grown at
18-25oC. The stage of development to ideally inoculate the
indicator plants is 4-6 fully expanded true leaves for Chenopodium
spp., and 4 fully expanded leaves for Nicotiana spp. Recommended
method 1. Place indicator plants in dark for 16-24 hours prior to
inoculation to increase
susceptibility. 2. Grind leaf tissue (approximately 1/4; w/v) in
0.1 M sodium phosphate buffer (pH 7.5),
containing 5% (w/v) polyvinylpyrrolidone (PVP-40) and 0.12%
(w/v) sodium sulphite (Na2SO3). A negative (inoculation buffer
only) and a positive control must be included in each batch of
inoculations. The positive control is a non-regulated virus which
is moderately transmissible and produces clear symptoms on the
herbaceous indicators, (e.g. Arabis mosaic virus). The plants must
be inoculated in the following order: (a) inoculation buffer only;
then (b) imported plants to be tested; then (c) positive control
(non-regulated virus).
3. Select two young fully expanded leaves preferably opposite
leaves, to be inoculated on each plant and mark them by piercing
holes with a pipette tip.
4. Lightly dust the leaves with Celite or carborundum powder.
Alternatively, a small amount of Celite or carborundum powder may
be mixed with the sap extract.
5. Using a gloved finger gently apply the sap to the marked
leaves of the indicator plants, stroking from the petiole towards
the leaf tip while supporting the leaf below with the other
hand.
6. After 3-5 minutes rinse inoculated leaves with water. 7. Grow
inoculated plants for a minimum of 4 weeks. Inspect and record
plants twice per
week for symptoms of virus infection. The Arabis mosaic virus
positive control may be obtained from: 1. ATCC Cat. No. PV-192,
PV-589, PV-590 (http://www.atcc.org). 2. DSMZ Cat. No. PV-0045,
PV-0046, PV-0215, PV-0216, PV-0217, PV-0230, PV-0232
(http://www.dsmz.de). 3. The MPI (see the Contact Point, section
8) (available as freeze-dried leaf material or
nucleic acid). A charge may be imposed to recover costs.
Interpretation of results The herbaceous indexing results will only
be considered valid if:
(a) no symptoms are produced on the indicator hosts with the
negative control (inoculation buffer only); and
(b) the correct symptoms are produced on the indicator hosts
with the positive control (non-regulated virus). If Arabis mosaic
virus was used as the positive control, the following symptoms will
be produced on the herbaceous indicators: C. quinoa local lesions,
and systemic chlorotic mottling.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
11
N. benthamiana not susceptible. N. clevelandii local lesions,
systemic chlorotic spots, rings and lines. N. tabacum local
lesions, systemic chlorotic spots, rings and lines.
The virus symptoms produced on herbaceous indicators are
described below. Sweetpotato yellow dwarf virus: C. quinoa
susceptible, but no information is available on symptoms.
Tobacco streak virus: N. tabacum systemic vein clearing, then
downward curling of the leaf and its margins. 7.1.3 Serological and
molecular assays ELISA OR PCR MUST be carried out for the following
viruses:
Sweetpotato vein mosaic virus Tobacco streak virus
ELISA OR PCR is OPTIONAL for the following virus:
Sweetpotato mild speckling virus
PCR MUST be carried out for the following organisms: Sweetpotato
chlorotic stunt virus Sweetpotato leaf curl virus Sweetpotato
little leaf phytoplasma
PCR OR selective media MUST be carried out for the following
bacterium:
Dickeya chrysanthemi
7.1.3.1 Enzyme-linked immunosorbent assay (ELISA) Recommended
method 1. Perform the ELISA according to the manufacturers
instructions. The following controls
must be included on each ELISA plate: (a) positive control:
infected leaf tissue or equivalent (Table 2); and (b) negative
control: sweetpotato tissue that is known to be healthy; and (c)
buffer control: extraction buffer only.
2. Add each of the samples and controls to the ELISA plate as
duplicate wells. It is not recommended to perform ELISA with plant
samples or sap that has been frozen.
3. Measure the optical density 60 minutes after addition of the
substrate (or as per manufacturers instructions).
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
12
Table 2: Source of antisera and positive controls for ELISA
Pathogen Antisera Positive/negative control2
Sweetpotato vein mosaic virus and Sweetpotato mild speckling
virus
Agdia Cat No. PSA27200 (Potyvirus group: Pathoscreen kit)
1,2
Agdia Cat No. LNC 27200 Agdia Cat No. LNP 27200
Tobacco streak virus Agdia Cat No. PSA25500 (Pathoscreen kit)
1,2
Agdia Cat No. LPC25500
1Catalogue numbers for the complete reagent sets are given, the
antisera and reagents can also be purchased separately.
2The positive control is included if the Pathoscreen set is
purchased. Further information about the kits and the supplier
listed in Table 2 can be found at the following website:
Agdia Incorporated, USA (http://www.agdia.com). Interpretation
of results A result is considered positive if the mean absorbance
of the two replicate wells is greater than 2 times the mean
absorbance of the negative control. The test will only be
considered valid if:
(a) the absorbance for the positive and negative controls are
within the acceptable range specified by the manufacturer; and
(b) the coefficient of variation (standard deviation / mean
100), between the duplicate wells is less than 20%.
If the test is invalid, it must be repeated with
freshly-extracted sample. Samples that are close to the cut-off
must be retested or tested using an alternative method recommended
in the import health standard (see Table 1). 7.1.3.2 Polymerase
chain reaction (PCR) The following section describes the molecular
tests required for regulated pests listed on the import health
standard for I. batatas and I. setosa. The recommended published
PCR primers for these tests are listed in Table 3 along with plant
internal control primers for RNA and DNA. The inclusion of an
internal control assay is recommended to eliminate the possibility
of PCR false negatives due to extraction failure, nucleic acid
degradation or the presence of PCR inhibitors. It is strongly
recommended to extract nucleic acid from indicator plants (I.
setosa or I. nil), 3 to 5 weeks after grafting rather than
extracting directly from I. batatas test plants. Viruses present in
I. batatas can be unevenly distributed in the plant and virus titre
can fluctuate over time. Virus levels in grafted indicator plants
have been found to be higher in comparison with I. batatas
(Kokkinos & Clark, 2006). The PCR reagents listed for the
methods described in this section have been tested by the Plant
Health & Environment Laboratory, MPI. Alternative reagents may
give similar results but will require validation.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
13
Table 3: PCR primers used for the detection of regulated pests
of I. batatas and I. setosa, and plant internal controls
Target organism
Primer name
Sequence (5-3) TM (C)
Band (bp)
Reference
Bacterium Dickeya chrysanthemi (Use both assays to detect all
pathovars)
ADE1 ADE2
GATCAGAAAGCCCGCAGCCAGAT CTGTGGCCGATCAGGATGGTTTTGTCGTGC
72 420 Nassar et al., 1996
recAF recAR
GGTAAAGGGTCTATCATGCG CCTTCACCATACATAATTTGGA
47 760 Waleron et al., 2002
Phytoplasma Sweetpotato little leaf phytoplasma
P1 P7
AAGAGTTTGATCCTGGCTCAGGATT CGTCCTTCATCGGCTCTT
53 1800 Deng & Hiruki, 1991; Schneider et al., 1995
R16F2 R16R2
ACGACTGCTAAGACTGG TGACGGGCGGTGTGTACAAACCCCG
50 1248 Lee et al., 1993
Phyto-F Phyto-R Phyto-P2
CGTACGCAAGTATGAAACTTAAAGGA TCTTCGAATTAAACAACATGATCCA
FAM-TGACGGGACTCCGCACAAGCG -NFQ3
60 75 Christensen et al., 2004
Viruses Sweetpotato chlorotic stunt virus (Use both assays to
detect East & West African strains)
SPCSV-F SPCSV-R SPCSV-P2
CGAATCAACGGATCGGAATT CCACCGACTATTACATCACCACTCT
(MGB)FAM-ATCCCAACGTGTTTATCT A-NFQ3
60 71 Kokkinos & Clark, 2006
EASPCSV-38F EASPCSV-126R EASPCSV-67P2
GGAGTTTATTCCCACCTGTYTATCT GTAATTGCGAAGAATCYAAAACCT
FAM-CGGCTACAGGCGACGTGGTTG TTG-NFQ3
60 90 N. Boonham (Unpublished)
Sweetpotato leaf curl virus1
SPG1 SPG2
ATCCVAAYWTYCAGGGAGCTAA CCCCKGTGCGWRAATCCAT
58 934 Li et al., 2004
SPLCV-F SPLCV-R SPLCV-P2
GGCGCCTAAGTATGGCTGAA AACCGTATAAAGTATCTGGGAGT GGT
(MGB)FAM-GTGGGACCCTTTGC-NFQ3
66 60 Kokkinos & Clark, 2006
Sweetpotato mild speckling virus and Sweetpotato vein mosaic
virus
Oligo1n Oligo2n
ATGGTHTGGTGYATHGARAAYGG TGCTGCKGCYTTCATYTG
50 327 Marie-Jeanne et al., 2000
Tobacco streak virus IlarlF5 IlarlR7
GCNGGWTGYGGDAARWCNAC AMDGGWAYYTGYTYNGTRTCACC
48 300 Untiveros et al., 2010
Internal Control Plant DNA control Gd1
Berg54 ACGGAGAGTTTGATCCTG AAAGGAGGTGATCCAGCCGCACCTTC
50-62 1500 Andersen et al., 1998
Plant RNA control Nad5-s Nad5-as
GATGCTTCTTGGGGCTTCTTGTT CTCCAGTCACCAACATTGGCATAA
50-60 180 Menzel et al., 2002
Plant NA control COX-F COX-R COX- P2
CGTCGCATTCCAGATTATCCA CAACTACGGATATATAAGAGCCAAAACTG
FAM-TGCTTACGCTGGATGGAATG CCCT- NFQ3
60 74 Weller et al., 2000
1Single stranded DNA virus; 2Real-time probe; 3NFQ =
Non-fluorescent quencher.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
14
7.1.3.2.1 Virus reverse transcription-PCR Recommended method for
RNA viruses: conventional RT-PCR 1. Extract total RNA from leaf
tissue according to a standard protocol. Successful RT-PCR
amplification can be achieved using the following RNA extraction
procedures: (a) Qiagen RNeasy Plant Mini Kit (Qiagen Cat. No.
74904); or (b) a silica-based method as described by Menzel et al.
(2002); or (c) InviMag Plant Mini Kit (Invitek Cat. No. 243711300)
used in a Kingfisher mL
workstation. Commercial kits are used as described by the
manufacturer. See Appendix 3 for details of other extraction
methods. Alternative methods may also be used after validation.
2. Optional: Perform a one-step RT-PCR on the RNA with the Nad5
internal control primers (Table 3) using the components and
concentrations listed in Table 4 and cycle under the conditions
listed in Table 6. The Nad5 primers amplify mRNA from plant
mitochondria.
3. Perform a one-step RT-PCR on the RNA with the
pathogen-specific primers (Table 3) using the components and
concentrations listed in Table 4 and cycle under the conditions
listed in Table 6. The following controls must be included for each
set of RT-PCR reactions: (a) positive control: RNA extracted from
virus-infected leaf tissue or equivalent; and (b) no template
control: water is added instead of RNA template. When setting up
the test initially, it is advised that a negative control (RNA
extracted from healthy Ipomoea leaf tissue) is included. Please
note that the Nad5 internal control primers do not reliably amplify
a product from RNA extracted from freeze-dried material. We
therefore recommend mixing fresh healthy Ipomoea leaf material with
freeze-dried positive control material (3:1 w/w) prior to carrying
out the extraction.
4. Analyse the PCR products by agarose gel electrophoresis.
Recommended method for DNA viruses: conventional PCR 1. Extract
total DNA from leaf tissue according to a standard protocol.
Successful PCR
amplification can be achieved using (a) Qiagen DNeasy Plant Mini
Kit (Qiagen Cat. No. 69104); or (b) InviMag Plant Mini Kit (Invitek
Cat. No. 243711300) used in a Kingfisher mL
workstation. Commercial kits are used as described by the
manufacturer. Alternative methods may also be used after
validation.
2. Optional: Perform a PCR on the DNA with the Gd1/Berg54
internal control primers (Table 3) using the components and
concentrations listed in Table 5 and cycle under the conditions
listed in Table 6. The Gd1/Berg54 primers amplify the 16S rRNA gene
from most prokaryotes as well as from chloroplasts.
3. Perform a PCR on the DNA with the pathogen-specific primers
(Table 3) using the components and concentrations listed in Table 5
and cycle under the conditions listed in Table 6. The following
controls must be included for each set of PCR reactions: (a)
positive control: DNA extracted from virus-infected leaf tissue or
equivalent; and (b) no template control: water is added instead of
DNA template. When setting up the test initially, it is advised
that a negative control (DNA extracted from healthy Ipomoea leaf
tissue) is included.
4. Analyse the PCR products by agarose gel electrophoresis.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
15
Interpretation of results for conventional (RT) PCR The RT-PCR
or PCR test will only be considered valid if:
(a) the positive control produces the correct size product as
indicated in Table 3; and (b) no bands are produced in the negative
control (if used) and the no template control.
If the Nad5 or Gd1/Berg54 internal control primers are also
used, then the negative control (if used), positive control and
each of the test samples must produce a 181 bp (Nad5) or 1500 bp
(Gd1/Berg54) band. Failure of the samples to amplify with the
internal control primers suggests that the nucleic acid extraction
has failed or compounds inhibitory to PCR are present in the
nucleic acid extract, or the nucleic acid has degraded.
Table 4: RT-PCR reaction components for RNA templates using
Invitrogen SuperScript III One-step RT-PCR System with Platinum Taq
DNA polymerase
Reagent Volume per reaction (l) Nuclease-free water 4.2 10
Reaction mix (Invitrogen 12574-026) 10.0 5 M Forward primer (250
nM) 1.0 5 M Reverse primer (250 nM) 1.0 SuperScript III/ RT/
Platinum Taq Mix 0.8 10 mg/ml Bovine Serum Albumin (BSA) (Sigma
A7888) 1.0 RNA template 2.0 Total volume 20.0
Table 5: PCR reaction components for DNA templates using Promega
GoTaq Green Master Mix
Reagent Volume per reaction (l) Nuclease-free water 4.0 GoTaq
Green Master Mix (Promega M7122) 10.0 50 mM MgSO4 (4 mM final)*
1.0* 5 M Forward primer (250 nM) 1.0 5 M Reverse primer (250 nM)
1.0 10 mg/ml Bovine Serum Albumin (BSA) (Sigma A7888) 1.0 DNA
template 2.0 Total volume 20.0
*Li et al. (2004) PCR only, for all other primers, adjust water
volume accordingly
Table 6: Generic PCR cycling conditions
Step Temperature Time No. of cycles RT step only 50oC 30 min 1
Initial denaturation 94oC 2 min 1 Denaturation 94oC 30 sec
40 Annealing See Table 3 30 sec
Elongation 72oC 30 to 45 sec (virus/bacteria) 1 min
(phytoplasma) Final elongation 72oC 7 min 1
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
16
Recommended method for RNA viruses: real-time RT-PCR 1. Extract
total RNA from leaf tissue according to a standard protocol (as
described above). 2. Set-up a one-step RT-PCR using
pathogen-specific primers (Table 3) and the components
and concentrations listed in Table 7 and cycle under the
conditions listed in Table 8. Please note that reaction and cycling
conditions can be changed depending on the real-time machine used,
but this would require validation.
3. Optional: Perform a one-step RT-PCR on the nucleic acid using
the COX internal control primers (Table 3) and the components and
concentrations listed in Table 7 and cycle under the conditions
listed in Table 8. The COX primers amplify the constitutive
cytochrome oxidase 1 gene found in plant mitochondria (note: this
assay is not RNA specific).
4. The following controls must be included for each set of
reactions: (a) positive control: RNA extracted from virus-infected
leaf tissue or equivalent; and (b) no template control: water is
added instead of RNA template.
5. When setting up the test initially, it is advised that a
negative control (RNA extracted from healthy Ipomoea leaf tissue)
is included.
6. Analyse real-time amplification data according to the
manufacturers instructions accompanying the real-time PCR
machine.
Recommended method for DNA viruses: real-time PCR 1. Extract
total DNA from leaf tissue according to a standard protocol (as
described above). 2. Set-up the PCR using pathogen-specific primers
(Table 3) and the components and
concentrations listed in Table 9 and cycle under the conditions
listed in Table 10. Please note that reaction and cycling
conditions can be changed depending on the real-time machine used,
but this would require validation.
3. Optional: Perform PCR on the nucleic acid using the COX
internal control primers (Table 3), and using the components and
concentrations listed in Table 9 and cycle under the conditions
listed in Table 10.
4. The following controls must be included for each set of
reactions: (a) positive control: DNA extracted from virus-infected
leaf tissue or equivalent; and (b) no template control: water is
added instead of DNA template
5. When setting up the test initially, it is advised that a
negative control (DNA extracted from healthy Ipomoea leaf tissue)
is included.
6. Analyse real-time amplifcation data according to the
manufacturers instructions accompanying the real-time PCR
machine.
Table 7: Real-time RT-PCR reaction components for RNA templates
using Invitrogen Superscript III One-step qRT PCR system
Reagent Volume per reaction (l) Nuclease-free water 4.3 2
Reaction Mix (Invitrogen 11730-017) 10.0 10 g/l Bovine Serum
Albumin (BSA) (Sigma A7888) 0.5 5 M Forward primer (300 nM) 1.2 5 M
Reverse primer (300 nM) 1.2 5 M Dual-labelled fluorogenic probe
(100 nM) 0.4 Superscript III RT/Platinum Taq Mix 0.4 RNA 2.0 Total
volume 20.0
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
17
Table 8: Generic cycling conditions for RNA real-time RT-PCR
Step Temperature Time No. of cycles RT-Step 50C 30 min 1 Initial
denaturation 95oC 2 min 1 Denaturation 95oC 10 sec 40 Annealing
& elongation See Table 3 40 sec
Table 9: Real-time PCR reaction componnets for DNA templates
using Invitrogen Platinum qPCR SuperMix-UDG
Reagent Volume per reaction (l) Nuclease-free water 4.6 Platinum
Quantitative PCR Supermix-UDG (Invitrogen 11730-017) 10.0 10 g/l
Bovine Serum Albumin (BSA) (Sigma A7888) 0.6 5 M Forward primer
(300 nM) 1.2 5 M Reverse primer (300 nM) 1.2 5 M Dual-labelled
fluorogenic probe (100 nM) 0.4 DNA 2.0 Total volume 20.0
Table 10: Generic cycling conditions for DNA real-time PCR
Step Temperature Time No. of cycles UDG incubation hold
(Invitrogen only)
50C 2 min 1
Initial denaturation 95C 2 min (Invitrogen) 5 min (Roche)
1
Denaturation 95C 10 sec 40 Annealing & elongation See Table
3 40 sec
Interpretation of results for real-time PCR The real-time PCR or
RT-PCR test will only be considered valid if:
(a) the positive control produces an amplification curve with
the pathogen-specific primers; and
(b) no amplification curve is seen (i.e. cycle threshold [CT]
value is 40) with the negative control (if used) and the no
template control.
If the COX internal control primers are also used, then the
negative control (if used), positive control and each of the test
samples must produce an amplification curve. Failure of the samples
to produce an amplification plot with the internal control primers
suggests that the nucleic acid extraction has failed or compounds
inhibitory to PCR are present in the nucleic acid extract, or the
nucleic acid has degraded. Virus positive controls for PCR Tobacco
streak virus positive control controls may be obtained from the
following sources: 1. American Type Culture Collection (ATCC;
http://www.atcc.org): No. PV-276, PV-31,
PV-352, PV-353, PV-360. 2. DSMZ Culture Collection
(http://www.dsmz.de): PV-0309, PV-0612, PV-0738. 3. The commercial
source listed in Table 2.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
18
Positive control material, in the form of nucleic acid, for
Sweetpotato chlorotic stunt virus and Sweetpotato leaf curl virus
and Tobacco streak virus may be obtained from MPI (see the Contact
Point, section 8). Positive control material for Sweetpotato vein
mosaic virus and Sweetpotato mild speckling virus is currently
unobtainable; however, an alternative Potyvirus may be used for the
PCR. Potyvirus positive controls in the form of nucleic acid may
also be obtained from the MPI. A charge may be imposed to recover
costs. 7.1.3.2.1.1 Sweet potato chlorotic stunt virus Plants must
be tested for Sweetpotato chlorotic stunt virus by real-time PCR
using the primer pairs listed in Table 3. See section 7.1.3.2.1 for
details of test methods and interpretation of results. Please note
that SPCSV should be tested with both sets of primers listed in
Table 3 in order to detect both East and West African strains.
7.1.3.2.1.2 Sweetpotato leaf curl virus Plants must be tested for
Sweetpotato leaf curl virus by PCR or real-time PCR using the
primer pairs listed in Table 3. See section 7.1.3.2.1 for details
of test methods and interpretation of results. Please note the Li
et al., (2004) PCR should be cycled as shown in Table 11
Table 11: Cycling conditions for SPLCV PCR
Step Temperature Time No. of Cycles Initial denaturation 94oC 2
min 1 Denaturation 94oC 30 sec
40 Annealing 58C 30 sec Elongation 68oC 90 sec Final elongation
68oC 3 min 1
7.1.3.2.1.3 Sweetpotato mild speckling virus Plants can be
tested for Sweetpotato mild speckling virus by RT-PCR using the
primer pairs listed in Table 3. Please note that a suitable
positive control is not available for Sweetpotato mild speckling
virus, however, the PCR has been validated with other potyviruses.
See section 7.1.3.2.1 for details of test methods and
interpretation of results. 7.1.3.2.1.4 Sweetpotato vein mosaic
virus Plants must be tested for Sweetpotato vein mosaic virus by
RT-PCR using the primer pairs listed in Table 3. Please note that a
suitable positive control is not available for Sweetpotato vein
mosaic virus, however, the PCR has been validated with other
potyviruses. See section 7.1.3.2.1 for details of test methods and
interpretation of results. 7.1.3.2.1.5 Tobacco streak virus Plants
must be tested for Tobacco streak virus by RT-PCR using the primer
pair listed in Table 3. See section 7.1.3.2.1 for details of test
methods and interpretation of results.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
19
7.1.3.2.2 Phytoplasma PCR Recommended method phytoplasma:
conventional PCR 1. Extract total DNA from leaf petioles and
mid-veins according to a standard protocol.
Successful PCR amplification can be achieved using the following
DNA extraction procedures: (a) Qiagen DNeasy Plant Mini Kit (Qiagen
Cat. No. 69104); or (b) phytoplasma enrichment procedure as
described by Kirkpatrick et al. (1987) and
modified by Ahrens & Seemller (1992); or (c) InviMag Plant
Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL
workstation. Commercial kits are used as described by the
manufacturer. See Appendix 3 for details of other extraction
methods. Alternative methods may also be used after validation.
2. Optional: Perform a PCR with the Gd1/Berg54 internal control
primers (Table 3) using the components and concentrations listed in
Table 5 (section 7.1.3.2.1) and cycle under the conditions listed
in Table 6 (section 7.1.3.2.1). The Gd1/Berg54 primers amplify the
16S rRNA gene from most prokaryotes as well as from
chloroplasts.
3. Perform a nested PCR on the purified DNA using the universal
phytoplasma primer pair P1/P7 (Table 3), for the first-stage PCR,
followed by the R16F2/R16R2 primer pair (Table 3) for the
second-stage PCR.
4. Set-up the first-stage and second-stage PCR reactions using
the components and concentrations listed in Table 5 (section
7.1.3.2.1) and cycle under the conditions listed in Table 6
(section 7.1.3.2.1). The first-stage PCR products are diluted 1:25
(v/v) in water prior to re-amplification using the second-stage PCR
primers.
5. The following controls must be included for each set of PCR
reactions: (a) positive control: total DNA or a cloned fragment
from the appropriate organism may
be used. If the internal control primers are not used, then the
DNA must be mixed with healthy Ipomoea DNA to rule out the presence
of PCR inhibitors; and
(b) no template control: water is added instead of DNA template.
When setting up the test initially, it is advised that a negative
control (DNA extracted from healthy Ipomoea leaf tissue) is
included.
6. Analyse the PCR products (second-stage PCR products only) by
agarose gel electrophoresis.
Interpretation of results The pathogen-specific PCR test will
only be considered valid if:
(a) the positive control produces the correct size product as
indicated in Table 3; and (b) no bands are produced in the negative
control (if used) and the no template control.
If the Gd1/Berg54 internal control primers are also used, then
the negative control (if used), positive control and each of the
test samples must produce a 1500 bp band. Failure of the samples to
amplify with the control primers suggests that either the DNA
extraction has failed or compounds inhibitory to PCR are present in
the DNA or the DNA has degraded. An effective method to further
purify the DNA is by using MicroSpin S-300 HR columns (GE
Healthcare Cat. No. 27-5130-01). Recommended method for
phytoplasma: Real-time PCR 1. Extract total DNA from leaf petioles
and mid-veins according to a standard protocol (as
described above). 2. Set-up the real-time PCR using
pathogen-specific primers (Table 3) and the components
and concentrations listed in Table 12 and cycle under the
conditions listed in Table 10.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
20
The reaction and cycling conditions can be changed depending on
the real-time reagents and machine used, but this would require
validation.
3. Optional: Perform PCR on the nucleic acid using the COX
internal control primers (Table 3), and using the components and
concentrations listed in Table 12 and cycle under the conditions
listed in Table 10.
4. The following controls must be included for each set of
reactions: (a) Positive control: total DNA or a cloned fragment
from the appropriate organism
may be used. If the internal control primers are not used, then
the DNA must be mixed with healthy Ipomoea DNA to rule out the
presence of PCR inhibitors; and
(b) no template control: water is added instead of DNA template
5. When setting up the test initially, it is advised that a
negative control (DNA extracted
from healthy Ipomoea leaf tissue) is included. 6. Analyse
real-time amplification data according to the real-time
thermocycler
manufacturers instructions.
Table 12: Real-time PCR reaction components for phytoplasma
using Roche LightCycler 480 Probes Mastermix
Reagent Volume per reaction (l) Nuclease-free water 4.3 2
Reaction Mix (Roche 04707494001) 10.0 10 g/l Bovine Serum Albumin
(BSA) (Sigma A7888) 0.8 5 M Forward primer (300 nM) 1.2 5 M Reverse
primer (300 nM) 1.2 5 M Dual-labelled fluorogenic probe (100 nM)
0.5 DNA 2.0 Total volume 20.0
Interpretation of results for real-time PCR The real-time PCR
test will only be considered valid if:
(a) the positive control produces an amplification curve with
the pathogen-specific primers; and
(b) no amplification curve is seen (i.e. cycle threshold [CT]
value is 40) with the negative control (if used) and the no
template control.
If the COX internal control primers are also used, then the
negative control (if used), positive control and each of the test
samples must produce an amplification curve. Failure of the samples
to produce an amplification plot with the internal control primers
suggests that the DNA extraction has failed or compounds inhibitory
to PCR are present in the DNA extract or the DNA has degraded. The
effect of inhibitors may be overcome by adding Bovine Serum Albumin
(BSA) to a final concentration of 0.5g/l. Alternatively, DNA may be
further purified using MicroSpin S-300 HR columns (GE Healthcare
Cat. No. 27-5130-01). Phytoplasma positive controls for PCR
Positive control material for Sweetpotato little leaf phytoplasma
(available as DNA) may be obtained from MPI (see the Contact Point,
section 8). A charge may be imposed to recover costs.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
21
7.1.3.2.2.2 Sweetpotato little leaf phytoplasma Plants must be
tested for Sweetpotato little leaf phytoplasma using the universal
primers listed in Table 3. See section 7.1.3.2.2 for details of
test methods and interpretation of results. 7.1.3.2.3 Bacteria PCR
Recommended method bacteria: conventional PCR 1. Extract total DNA
from leaf petioles and mid-veins according to a standard
protocol.
Successful PCR amplification can be achieved using the following
DNA extraction procedures: (a) Qiagen DNeasy Plant Mini Kit (Qiagen
Cat. No. 69104); or (b) InviMag Plant Mini Kit (Invitek Cat. No.
243711300) used in a Kingfisher mL
workstation. 2. Optional: Perform a PCR with the Gd1/Berg54
internal control primers listed in Table 3
using the components and concentrations listed in Table 5 and
cycled as shown in table 6. 3. Perform a PCR with bacteria-specific
primers on the purified DNA using the components
and concentrations listed in Table 5. See Table 13, section
7.1.3.2.3.1 for details of PCR cycling conditions. The following
controls must be included for each set of PCR reactions: (a)
positive control: total DNA or a cloned fragment from the
appropriate organism may
be used. If the internal control primers are not used, then the
DNA must be mixed with healthy Ipomoea DNA to rule out the presence
of PCR inhibitors;
(b) no template control: water is added instead of DNA template.
When setting up the test initially, it is advised that a negative
control (DNA extracted from healthy Ipomoea tissue) is
included.
4. Analyse the PCR products by agarose gel electrophoresis.
Interpretation of results The pathogen-specific PCR test will only
be considered valid if:
(a) the positive control produces the correct size product as
indicated in Table 3; and (b) no bands are produced in the negative
control (if used) and the no template control.
If the Gd1/Berg54 internal control primers are also used, then
the negative control (if used), positive control and each of the
test samples must produce a 1500 bp band. Failure of the samples to
amplify with the control primers suggests that either the DNA
extraction has failed or compounds inhibitory to PCR are present in
the DNA or the DNA has degraded. An effective method to further
purify the DNA is by using MicroSpin S-300 HR columns (GE
Healthcare Cat. No. 27-5130-01). Bacterial positive controls for
PCR Positive control material for Dickeya chrysanthemi (available
as DNA) may be obtained from MPI (see the Contact Point, section
8). A charge may be imposed to recover costs.
7.1.3.2.3.1 Dickeya chrysanthemi Plants must be tested for
Dickeya chrysanthemi using the primer pairs ADE1/ADE2 and
recAF/recAR (Table 3). See section 7.1.3.2.3 for details of test
methods and interpretation of results. Please note that PCRs are
cycled as shown in Tables 13 and 14.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
22
(a) Primers recAF/recAR (Waleron et al., 2002) detects bacteria
at the generic level belonging to the former Erwinia genus;
however, sequencing of the resulting recA PCR product will provide
resolution to the sub-species level.
(b) Primers ADE1/ADE2 (Nassar et al., 1996) will detect
pectinolytic strains of Dickeya spp.
Table 13: Cycling conditions for Waleron et al., 2002 PCR
Step Temperature Time No. of cycles Initial denaturation 94oC 3
min 1 Denaturation 94oC 1 min
35 Annealing 47C 1 min Elongation 72oC 2 min Final elongation
72oC 5 min 1
Table 14: Cycling conditions for Nassar et al., 1996 PCR
Step Temperature Time No. of cycles Initial denaturation 94oC 3
min 1 Denaturation 94oC 1 min
25 Annealing 72C 1 min Elongation 72oC 2 min Final elongation
72oC 5 min 1
7.1.4 Bacterial isolation on media Isolation of regulated
bacteria from plants is a required test on the Ipomoea IHS. Plants
should be tested separately. Aseptic techniques should be used
throughout the test procedure. 7.1.4.1 Dickeya chrysanthemi
(basonym. Erwinia chrysanthemi) Dickeya chrysanthemi primarily
occurs on storage roots but the bacteria can also move into the
vascular tissues of the aerial parts of the plant and become
systemic. For testing the aerial parts of sweetpotato plants, leaf
petioles and mid-veins (vascular strands) should be tested in
summer or under summer-like conditions. At least two fully expanded
leaves must be sampled from the indicator plant, one young leaf
from the top of the plant and one older leaf from a mid-way
position. Leaves should be tested as soon as possible after removal
from the plant. Recommended method Macerate a small amount of
tissue in 500 l of sterile distilled water. Pipette 100 l of
macerate into 5 ml of PT (pectate tergitol) broth and incubate
anaerobically at 27C for 48 h. Undiluted broth (100 l) and a
10-fold serial dilution of broth are spread onto crystal violet
pectate agar plates and incubated at 27C for 3 days. Suspected
pectolytic Dickeya can be transferred to Potato Dextrose Agar (PDA)
and colony morphology examined. Interpretation of results D.
chrysanthemi bacteria are mottled, gram-negative, non-sporing,
straight rods with rounded ends. The bacteria can occur as single
cells or in pairs. The average cell size is 1.8 0.6 m
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
23
and the average number of peritichous flagellae is 8-11. On PDA
media, depending on the moisture content, young colonies can be
circular, convex, smooth and entire, or sculptured with irregular
margins. After 4-5 days, both types of colonies resemble a fried
egg, with a pinkish, round, raised centre and a lobed periphery,
which later becomes feathery. 7.1.5 Microscopic inspection for
mites Microscopic examination of plants for regulated mites is a
required test on the Ipomoea IHS. 7.1.5.1 Tetranychus evansi
Recommended method For each plant, use a hand lens to inspect the
underside of all leaves for mite eggs, nymphs, adults and symptoms
of mite presence. Following this, for each plant, the 3 youngest
leaves of each plant plus any suspect leaves showing the presence
of mites must be collected for further examination using a
binocular microscope. For species identification, both male and
female mites must be collected. Male mites should be mounted
laterally onto a microscope slide and female mites should be
mounted dorsally to expose the diagnostic characters. To improve
transparency, the mites can be cleared in lactic acid under a table
lamp prior to mounting. Interpretation of results If mites are
present the following symptoms may be observed on the underside of
leaves; webbing, distinct small yellow spots (which get larger over
time), leaf browning and in extreme cases the leaves may shrivel up
and die. Overall, plant vigour and growth may be affected (Fig.
1.4). Mites of the Tetranychus genus can be green, yellow, orange
or red in colour. Adult males are smaller than the females for all
Tetranychus spp. T. evansi female mites are reddish in colour and
the males are straw-coloured with a more pointed abdomen (Fig.
1.3). Species level identification requires examination of the male
aedeagus (i.e. the male genitalia). For T. evansi, the male adeagus
will appear upright at a 90C angle.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
24
8. CONTACT POINT This manual was developed by: Dr Lisa Ward
Plant Health & Environment Laboratory, Investigation and
Diagnostic Centres and Response, Ministry for Primary Industries
(MPI), 231 Morrin Road, St Johns, PO Box 2095, Auckland 1140 Tel:
+64 9 909 3015 Fax: +64 9 909 5739 Email: [email protected]
Website:
http://www.biosecurity.govt.nz/regs/imports/plants/high-value-crops
9. ACKNOWLEDGEMENTS We would like to acknowledge the following
people who contributed to the preparation of this manual: Mr John
Fletcher (The New Zealand Institute for Plant & Food Research
Ltd, Lincoln,
New Zealand) for drafting the introduction and propagation
sections of the manual, for valuable discussion and advice on
sweetpotato viruses, and for providing photographs of
virus-infected sweetpotato.
Dr Chris Clark and Ms Mary Hoy (Louisiana State University, USA)
for valuable discussion on sweetpotato viruses, for supplying
isolates of SPV2 and SPLCV, and for supplying several photographs
of virus-infected I. batatas and I. setosa.
Dr Steve Lewthwaite (The New Zealand Institute for Plant &
Food Research Ltd, Pukekohe, New Zealand) for providing the front
cover image of the sweetpotato cultivar 'Radical' (the first New
Zealand sweetpotato cultivar to receive plant variety rights) and
for providing information on seed propagation.
Dr Segundo Fuentes (International Potato Centre (CIP), Peru) for
valuable discussion on sweetpotato viruses.
Ms Susan Sim (Foundation Plant Services, University of
California, Davis, USA) for valuable advice on graft
inoculation.
Dr Karen Gibb (Charles Darwin University, Australia) for
supplying phytoplasma DNA and the photograph of the Sweetpotato
little leaf phytoplasma.
The American Phytopathological Society (APS) for permission to
use images from the Diseases of Root and Tuber Crops CD-Rom, 2000,
St Paul, MN, USA.
10. REFERENCES Ahrens, U; Seemller, E (1992) Detection of DNA of
plant pathogenic mycoplasma-like organisms by a polymerase chain
reaction that amplifies a sequence of the 16S rRNA gene.
Phytopathology 82: 828-832.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
25
Andersen, M T; Beever, R E; Gilman, A C; Liefting, L W; Balmori,
E; Beck, D L; Sutherland, P W; Bryan, G T; Gardner, R C Forster, R
L S (1998) Detection of Phormium yellow leaf phytoplasma in New
Zealand flax (Phormium tenax) using nested PCRs. Plant Pathology
47: 188-196. Chen, J; Chen, J; Adams, M J (2001) A universal PCR
primer to detect members of the Potyviridae, and its use to examine
the taxonomic status of several members of the family. Archives of
Virology 146: 757-766. Christensen, N M; Nicolaisen, M; Hansen, M;
Schulz, A (2004) Distribution of phytoplasmas in infected plants as
revealed by real-time PCR and bioimaging. Molecular Plant Microbe
Interactions 17: 1175-1184. Clark, C A; Moyer, J W (1988)
Compendium of sweetpotato diseases. The American Phytopathological
Society Press. Deng, S; Hiruki, D (1991) Amplification of 16S rRNA
genes from culturable and nonculturable mollicutes. Journal of
Microbiological Methods 14: 53-61. Fletcher, J D; Lewthwaite, S L;
Fletcher, P J; Dannock, J (2000) Sweetpotato (Kumara) virus disease
surveys in New Zealand. International Workshop on Sweetpotato
Cultivar Decline Study, Miyakonojo, Japan. Kirkpatrick, B C;
Stenger, D C; Morris, T J; Purcell, A H (1987) Cloning and
detection of DNA from a nonculturable plant pathogenic
mycoplasma-like organism. Science 238: 197-200. Kokkinos, C D;
Clark, C A (2006) Real-time PCR assays for detection and
quantification of sweetpotato viruses. Plant Disease 90:783-788.
Lee, I M; Hammond, R W; Davis, R E; Gundersen, D E (1993) Universal
amplification and analysis of pathogen 16S rDNA for classification
and identification of mycoplasmalike organisms. Phytopathology 83:
834-842. Lewthwaite, S L (1997) Commercial sweetpotato production
in New Zealand: foundations for the future. In: Proceedings of the
International Workshop on Sweetpotato production System toward the
21st Century, Miyakonojo, Miyazaki, Japan, (eds, D R La Bonte;
Yamashita, M; Mochida, H), Kyushu National Agricultural Experiment
Station, Japan. p. 33-50. Li, R; Salih, S; Hurtt, S (2004)
Detection of geminiviruses in sweetpotato by polymerase chain
reaction. Plant Disease 88: 1347-1351. Marie-Jeanne, V; Ioos, R;
Peyre, J; Alliot, B; Signoret, P (2000) Differentiation of Poaceae
Potyviruses by reverse transcription-polymerase chain reaction and
restriction analysis. Journal of Phytopthaology 148: 141-151.
Menzel, W; Jelkmann, W; Maiss, E (2002) Detection of four apple
viruses by multiplex RT-PCR assays with coamplification of plant
mRNA as internal control. Journal of Virological Methods 99:
81-92.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
26
Nassar, A; Darrasse, A; Lemattre, M; Kotoujansky, M;. Dervin, A;
Vedel, R; Bertheau, Y (1996) Characterisation of Erwinia
chrysanthemi by pectinolytic isozyme polymorphism and restriction
fragment length polymorphism analysis of PCR-amplification
fragments of pel genes. Applied and Environmental Microbiology 62:
2228-2235. Saladaga, F A; Takagi, H; Cherng, S J; Opena, R T (1991)
Handling and selecting improved clones from true seed populations
of sweetpotato. Asian Vegetable Research and Development Centre
International Cooperator Guide 91: 384. Schneider, B; Seemller, E;
Smart, C D; Kirkpatrick, B C (1995) Phylogenetic classification of
plant pathogenic mycoplasma-like organisms or phytoplasmas. In
Razin, S & Tully, J G (eds) Molecular and Diagnostic Procedures
in Mycoplasmology, Vol. 1. Academic Press, San Diego, CA; p.
369-380. Univertos, M; Perez-Egusquiza, Z; Clover, G R (2010) PCR
assays for the detection of members of the genus Ilarvirus and
family Bromoviridae. Journal of Virological Methods 165: 97-104
Waleron, M; Waleron, K; Podhajska, A.J; Kojkowska, E (2002)
Genotyping of bacteria belonging to the former Erwinia genus by
PCR-RFLP analysis of a recA gene fragment. Microbiology 148:
583-595. Weller, S A; Elphinstone, J G; Smith, N C; Boonham, N;
Stead, D E (2000) Detection of Ralstonia solanacearum strains with
a quantitative multiplex real-time, fluorogenic PCR (TaqMan) assay.
Applied and Environmental Microbiology 66: 2853-2858.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
27
Appendix 1. Symptoms of significant regulated pests of Ipomoea
batatas
1.1 Meliodogyne incognita (a) (b)
(a) Galls and egg masses produced by M. incognita on fibrous
roots; (b) cracking of fleshy storage roots associated with injury
by M. incognita. (Courtesy W.J. Martin (a) & G.W. Lawrence (b)
reproduced with permission from the Diseases of Root and Tuber
Crops CD-ROM, 2002, APS, St Paul, MN, USA).
1.2 Rotylenchulus reniformis
Cracking of fleshy storage roots associated with injury by R.
reniformis (Courtesy C.A. Clark reproduced with
permission from the Diseases of Root and Tuber Crops CD-ROM,
2002, APS, St Paul, MN, USA). 1.3 Tetranychus evansi
T. evansi mites, male (left) and female (right). (Courtesy
EcoPort http://www.ecoport.org
: image 13039, E.A. Ueckerman).
1.4 Plant damage caused by mites
Plant damage caused by feeding Tetranychus evansi (Courtesy
EcoPort http://www.ecoport.org
: image 13043, ARC-PPRI)
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
28
.
1.5 Streptomyces ipomoea (a) (b)
(a) Soil pox lesions caused by S. ipomoea on storage roots of I.
batatas clone L4-89 (b) I. batatas rootlet rot on sweetpotato
fibrous roots, caused by S. ipomoea. (Courtesy W.J. Martin (a)
& (b) reproduced with permission from the Diseases of Root and
Tuber Crops CD-ROM, 2002, APS, St Paul, MN, USA). 1.6 Elsino
batatas
Petiole and stem lesions on I. batatas caused by Elsino batatas.
(Courtesy R. Gapsin reproduced with permission from the Diseases of
Root and Tuber Crops CD-ROM, 2002, APS, St Paul, MN, USA).
1.7 Dickeya chrysanthemi
Bacterial rot on I. batatas Jewel storage root caused by Dickeya
chrysanthemi. (Courtesy C. A. Clark reproduced with permission from
the Diseases of Root and Tuber Crops CD-ROM, 2002, APS, St Paul,
MN, USA).
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
29
1.8 Ipomoea batatas infected with a mixture of viruses
Leaf symptoms on I. batatas Toka Toka Gold infected with
Sweetpotato feathery mottle virus, Sweetpotato chlorotic fleck
virus, and Sweetpotato virus C6. (Courtesy J. Fletcher, The New
Zealand Institute for Plant & Food Research Ltd, Lincoln, New
Zealand). 1.9 Sweetpotato chlorotic stunt virus
Interveinal purpling on Regal sweetpotato infected with the
White Bunch or US strain of Sweetpotato chlorotic stunt virus
(Courtesy C. Clark, Louisiana State University., USA).
1.10 Sweetpotato leaf curl virus
Sweetpotato leaf curl virus symptoms in plant bed on sweetpotato
line W-359 (Courtesy C. Clark, Louisiana State University,
USA).
1.11 Sweetpotato little leaf phytoplasma
Sweetpotato little leaf phytoplasma infecting I. batatas LO323.
(Courtesy K. Gibb, Charles Darwin University, Australia).
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
30
Appendix 2. Virus symptoms on graft inoculated Ipomoea setosa
2.1 Sweetpotato chlorotic stunt virus +
Sweetpotato feathery mottle virus
Symptoms on Ipomoea setosa inoculated with the White Bunch or US
strain of Sweetpotato chlorotic stunt virus and the russet crack
strain of Sweetpotato feathery mottle virus (Courtesy C. Clark,
Louisiana State University, USA).
2.2 Sweetpotato virus 2
Initial symptoms of Sweetpotato virus 2 in Ipomoea setosa
(Courtesy C. Clark, Louisiana State University, USA).
2.3 Sweetpotato virus C6
Symptoms induced in Ipomoea setosa by C6 virus (Courtesy C.
Clark, Louisiana State University, USA).
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
31
2.4 Sweetpotato leaf curl virus
Ipomoea setosa infected with SWFT-1 showing leaf curling
(Courtesy C. Clark, Louisiana State University, USA).
2.5 Sweetpotato leaf curl virus + Sweetpotato virus 2
Ipomoea setosa infected with SPLCV (SWFT-1) and SPV-2 (LSU-2)
showing prominent leaf curling (Courtesy C. Clark, Louisiana State
University, USA).
2.6 Sweetpotato leaf curl virus + Sweetpotato feathery mottle
virus
Ipomoea setosa showing leaf rolling, chlorosis and interveinal
necrosis after being grafted with a sweetpotato, infected
with SPLCV and SPFMV-Russet Crack (Courtesy C. Clark, Louisiana
State University, USA).
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
32
Appendix 3. Protocols referenced in manual 3.1 Silica-milk RNA
extraction protocol (Menzel et al., 2002)
1. Grind 0.2-0.5 g leaf tissue (1/10; w/v) in RNA extraction
buffer (6 M guanidine hydrochloride, 0.2 M sodium acetate, 25 mM
EDTA, 2.5% [w/v] PVP-40 adjusted to pH 5 with acetic acid).
2. Transfer 500 l of the homogenised extract to a
micro-centrifuge tube containing 100 l of 10% (w/v) SDS.
3. Incubate at 70oC for 10 minutes with intermittent shaking,
and then place on ice for 5 minutes.
4. Centrifuge at 13,000 rpm for 10 minutes. 5. Transfer 300 l
supernatant to a new micro-centrifuge tube and add 300 l high salt
buffer
(6 M sodium iodide, 0.15 M sodium sulphite), 150 l absolute
ethanol and 25 l silica milk (1 g/ml silicon dioxide, 1-5 M size
particles, suspended in 100 mM glycine, 100 mM NaCl, 100 mM HCl, pH
2).
6. Incubate at room temperature for 10 minutes with intermittent
shaking. 7. Centrifuge at 3,000 rpm for 1 minute and discard the
supernatant. 8. Resuspend the pellet in 500 l of wash buffer (10 mM
Tris-HCl pH 7.5, 0.05 mM EDTA, 50
mM NaCl, 50% [v/v] absolute ethanol), centrifuge at 3,000 rpm
for 1 minute and discard the supernatant. Repeat this wash
step.
9. Centrifuge at 3,000 rpm for 1 minute and remove any remaining
wash buffer from the pellet. 10. Resuspend the pellet in TE buffer
(10mM Tris-HCl pH 7.5, 0.05 mM EDTA). 11. Incubate at 70oC for 4
minutes then centrifuge at 13,000 rpm for 5 minutes. 12. Transfer
100 l of the supernatant to a sterile nuclease-free
micro-centrifuge tube, being
careful not to disturb the pellet. Store at -80oC.
3.2 Phytoplasma DNA enrichment CTAB extraction protocol
(Kirkpatrick et al., 1987 and modified by Ahrens & Seemller,
1992)
1. Grind approximately 0.3 g tissue (petioles, veins) in 3 ml
ice-cold isolation buffer (0.1 M
Na2HPO4, 0.03 M NaH2PO4, 10 mM EDTA (pH 8.0), 10% (w/v) sucrose,
2% (w/v) PVP-40; Adjust pH to 7.6 and filter sterilise. Just prior
to use add 0.15% (w/v) Bovine Serum Albumin (BSA) and 1 mM ascorbic
acid).
2. Transfer crude sap to a cold 2 ml micro-centrifuge tube. 3.
Centrifuge at 4C for 5 min at 4500 rpm. 4. Transfer supernatant
into a clean 2 ml micro-centrifuge tube. 5. Centrifuge at 4C for 15
min at 13000 rpm. 6. Discard the supernatant. 7. Resuspend the
pellet in 750 l of hot (55 C) CTAB buffer (2% (w/v) CTAB, 100 mM
Tris-
HCl [pH 8.0], 20 mM EDTA [pH 8.0], 1.4 M NaCl, 1% (w/v) PVP-40).
The pellet is easier to resuspend in a smaller volume of CTAB
buffer (e.g. 100 l) then the remaining volume of CTAB buffer is
added (e.g. 650 l).
8. Incubate tubes at 55 C for 30 min with intermittent shaking.
9. Cool the tubes on ice for 30 sec. 10. Add 750 l
chloroform:octanol (24:1 v/v) and vortex thoroughly. 11. Centrifuge
at 4C or at room temperature for 4 min at 13000 rpm. 12. Carefully
remove upper aqueous layer into a clean 1.5 ml micro-centrifuge
tube. 13. Add 1 volume ice-cold isopropanol and vortex thoroughly.
14. Incubate on ice for 4 min. 15. Centrifuge at 4C or at room
temperature for 10 min at 13000 rpm. 16. Discard supernatant.
-
Ipomoea Post-Entry Quarantine Testing Manual November 2012
33
17. Wash DNA pellets with 500 l ice-cold 70% (v/v) ethanol,
centrifuge at 4oC or at room temperature for 10 min at 13000
rpm.
18. Dry DNA pellets in the DNA concentrator or air-dry. 19.
Resuspend in 20 l sterile distilled water. Incubating the tubes at
55oC for 10 min can aid
DNA resuspension. 20. Store DNA at -20C for short-term storage
or -80C for long-term storage.
Contents1. SCOPE 2. INTRODUCTION3. IMPORT REQUIREMENTS4.
PESTS4.1 Regulated pests for which generic measures are required4.2
Regulated pests for which specific tests are required
5. PROPAGATION, CARE AND MAINTENANCE IN POST-ENTRY QUARANTINE5.1
Whole plants5.2 Plants in tissue culture5.3 Pollen
6. INSPECTION7. TESTING7.1 Specific tests for nursery stock
8. CONTACT POINT9. ACKNOWLEDGEMENTS10. REFERENCESAppendix 1.
Symptoms of significant regulated pests of Ipomoea batatasAppendix
2. Virus symptoms on graft inoculated Ipomoea setosaAppendix 3.
Protocols referenced in manual