investigation of breadfruit (artocarpus altilis) for use in the

INVESTIGATION OF BREADFRUIT (ARTOCARPUS ALTILIS) FOR USE IN THE

CONTROL OF THE YELLOW FEVER MOSQUITO AEDES AEGYPTI

by

Matthew Aaron Glover

B.Sc., The University of British Columbia, 2013

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF

THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

in

THE COLLEGE OF GRADUATE STUDIES

(Biology)

THE UNIVERSITY OF BRITISH COLUMBIA

(Okanagan)

August 2015

© Matthew Aaron Glover, 2015

ii

Abstract

Insect borne diseases such as malaria, yellow fever and Dengue fever are

among the most economically devastating diseases present on our planet. Traditional

knowledge from the Pacific islands suggests using the male inflorescences of

breadfruit (Artocarpus altilis) as a mosquito repellent. The cultivation of breadfruit as a

source of starch to bolster food sustainability in developing nations has grown in the

past ten years. Thus, the use of male inflorescences as a novel source of mosquito

repellents or insecticides presents a valuable secondary product from breadfruit that

could be made alongside its primary role as a food source. In order to investigate the

potential for biogenic amines such as serotonin and melatonin sourced from plants

such as breadfruit, an in depth investigation of the toxicity and its associated

underlying mechanism must be elucidated.

In Chapter 2, breadfruit male inflorescences were processed using two different

extraction methods. The first was a methanol extraction method and the second was a

cold-pentane extraction method. These extracts were tested in a larvicidal bioassay

with Aedes aegypti larvae. Methanol extracts showed significantly greater toxicity than

the pentane extracts and all future work in subsequent chapters was done on methanol

extracts.

In Chapter 3, methanol extracts of multiple varieties of breadfruit including two

Artocarpus altilis and Artocarpus mariannensis hybrids: ulu afa and Lipet, Artocarpus

camansi and a mixed Artocarpus sample were chemically characterized. It was

determined that all varieties of extract tested contained serotonin. As well, a wide

variety of compounds were putatively identified in the extracts with the majority being

fatty acids, phenols, and terpenes previously associated with biological activity

towards insects.

In Chapter 4, toxicity values for each variety of Artocarpus were assessed with

the mixed Artocarpus sample being the highest in insecticidal activity. Haemolymph

serotonin wasn shown to significantly decrease after breadfruit extract exposure, even

though the serotonin gene pathway transcripts were largely unaffected, suggesting that

this change is not transcriptionally regulated.

iii

Preface

The majority of the contents of Chapter 1 have been prepared as a manuscript

for review to be submitted for publication: Glover, M.A, Rheault, M.R., Saxena, P.K.,

and Murch. S.J. (2015) Phytochemicals that target serotonin receptors for insect

control. Manuscript prepared for the Journal of Pineal Research.

Chapters 2, 3 and 4 contain data made possible from the field collection of

breadfruit (Artocarpus altilis) and breadnut (Artocarpus camansi) from the National

Tropical Botanical Garden’s (NTBG) Kahanu Garden in Hana, Maui, USA with the

help of Ian Cole and Dr. Diane Ragone.

Chapter 2 contains data using methanol extracts prepared by Dr. Susan J.

Murch

Chapter 3 contains DPPH and GC-MS data run at the Natural Food And Health

Prodcuts Research Group (NRG) Lab at the British Columbia Institute for Technology

(BCIT) with the assistance of Michael Chan, James Findlay, and Xiaohui Zhang.

Chapter 3 and 4 also contain UPLC-MS data run at the Plant Metabolomics Lab

at the University of British Columbia Okanagan campus with the assistance of Teesha

Baker, Fiona Tymm and Dr. Susan Murch.

iv

Table of Contents

Abstract .................................................................................................................................... ii

Preface ..................................................................................................................................... iii

Table of Contents ................................................................................................................... iv

List of Tables ......................................................................................................................... vii

List of Figures ....................................................................................................................... viii

List of Abbreviations ............................................................................................................. xi

Acknowledgements ............................................................................................................... xii

Chapter 1 : Introduction ........................................................................................................ 1

1.1 Discovery of Serotonin and Melatonin in Plants ...................................................................... 1

1.2 Biosynthesis of Serotonin and Melatonin in Plants .................................................................. 1

1.3 The Roles of Serotonin and Melatonin in Plant Physiology ..................................................... 4

1.4 Breadfruit .................................................................................................................................. 4

1.5 Serotonin and Melatonin in Insects .......................................................................................... 7

1.6 Biosynthesis of Serotonin and Melatonin in Insects ................................................................. 7

1.7 5-HT Receptors in Vertebrates and Invertebrates ..................................................................... 8

1.8 Biogenic Amine Receptors as Targets for Insecticide Development ....................................... 9

1.9 Serotonin in Regulation of Digestion and Diuresis in Insects ................................................ 11

1.10 Model Systems to Investigate the Role of Serotonin in the Insect Gut ................................ 14

1.11 Plant Serotonin in Insect Physiology .................................................................................... 16

1.12 Plant Extract Activity on Insect Larva .................................................................................. 17

1.13 Insect Repellent Activity of Plant Extracts ........................................................................... 19

1.14 Insect Serotonin Metabolism as a Target for Insecticides .................................................... 19

1.15 Plant Serotonin for Insect Biocontrol ................................................................................... 20

1.16 Research Hypothesis and Objectives .................................................................................... 20

Chapter 2 : Investigation of Different Extraction Methods of Breadfruit

(Artocarpus altilis) on Insecticidal Activity of Yellow Fever Mosquito (Aedes

aegypti) larvae ........................................................................................................................ 22

2.1 Chapter Summary ................................................................................................................... 22

v

2.1.1 Insect Rearing .................................................................................................................. 22

2.1.2 Plant Tissue Collection .................................................................................................... 23

2.1.3 Methanol Tissue Extraction ............................................................................................. 23

2.1.4 Pentane Tissue Extraction ............................................................................................... 24

2.1.5 24-hour LC50 and LC90 Determination ............................................................................ 24

2.2 Results .................................................................................................................................... 25

2.3 Discussion ............................................................................................................................... 27

Chapter 3 : Chemical Characterization of Breadfruit Extracts ....................................... 28

3.1 Chapter Summary ................................................................................................................... 28

3.2 Materials and Methods ........................................................................................................... 28



3.2.3 Determination of Antioxidant Activity by DPPH ........................................................... 29

3.2.4 GC-MS of Breadfruit Extracts......................................................................................... 30

3.2.5 5-HT Detection in Breadfruit Extracts by UPLC-MS ..................................................... 30

3.2.6 Data Analysis and Statistics ............................................................................................ 31

3.3 Results .................................................................................................................................... 31

3.3.1 Antioxidant Activity by DPPH ........................................................................................ 31

3.3.2 GC-MS of Breadfruit Extracts......................................................................................... 32

3.3.3 5-HT Detection in Breadfruit Extracts by UPLC-MS ..................................................... 33

3.4 Discussion ............................................................................................................................... 38

3.4.1 DPPH Assay of Extracts .................................................................................................. 38

3.4.2 GC-MS Data of Extracts ................................................................................................. 38

3.4.3 UPLC-MS Data of Extracts ............................................................................................. 40

3.4.4 Concluding Remarks ....................................................................................................... 40

Chapter 4 : Examination of the 5-HT Pathway in Aedes aegypti ..................................... 41

4.1 Chapter summary .................................................................................................................... 41

4.2 Materials and Methods ........................................................................................................... 42

4.2.1 Insect Rearing .................................................................................................................. 42



4.2.4 Larvicidal Activity of Breadfruit Methanol Extracts ...................................................... 42

vi

4.2.5 Quantification of 5-HT in Larval Haemolymph after Breadfruit Exposure by

UPLC-MS…… ............................................................................................................................ 43

4.2.6 Real-time PCR Gene Expression of 5-HT Pathway ........................................................ 44

4.2.6.1 Larval Tissue Collection after Breadfruit Extract Exposure .................................... 44

4.2.6.2 Adult Tissue Collection after Blood/Sugar Feeding ................................................ 44

4.2.6.3 mRNA Extraction from Aedes aegypti tissues ......................................................... 45

4.2.6.4 cDNA Synthesis ....................................................................................................... 46

4.2.6.5 Primer Design .......................................................................................................... 46

4.2.6.6 Quantitative Real Time PCR .................................................................................... 49

4.2.7 Data Analysis and Statistics ............................................................................................ 50

4.3 Results .................................................................................................................................... 50

4.3.1 Larvicidal Toxicity of Breadfruit Extracts ...................................................................... 50

4.3.2 Serotonin Quantification in Larval Haemolymph after Breadfruit Extract

Exposure ...................................................................................................................................... 51

4.3.3 mRNA Extraction ............................................................................................................ 54

4.3.4 Primer Design .................................................................................................................. 56

4.3.5 qPCR Reference Gene Stability Analysis ....................................................................... 58

4.3.6 Quantitative Real Time PCR of Larval Heads after Breadfruit Extract Exposure .......... 60

4.3.7 Quantitative Real Time PCR of Adult Whole Body, Midgut and Malpighian

Tubules after 3 h, 12 h and 24 h post blood feeding .................................................................... 62

4.3.8 Quantitative Real Time PCR of Heads of Adults after 3h, 12h and 24h post blood

feeding. ........................................................................................................................................ 68

4.4 Discussion ............................................................................................................................... 70

4.4.1 Insecticidal Activity of Breadfruit Extract Varieties ....................................................... 70

4.4.2 5-HT and Melatonin in Haemolymph after Breadfruit Extract Variety Specific

Exposure.. .................................................................................................................................... 70

4.4.3 Effect of Breadfruit Extract Exposure on 5-HT Pathway Gene Regulation .................... 71

4.4.4 Effect of Adult Blood/Sugar Feeding on 5-HT Pathway Gene Regulation ..................... 72

4.4.5 Concluding Remarks ....................................................................................................... 73

Chapter 5 : Conclusion ......................................................................................................... 75

References .............................................................................................................................. 79

vii

List of Tables

Table 2.1 Larvicidal activity of pentane and methanol Artocarpus altilis extracts ............... 26

Table 3.1 UPLC-MS transitions and voltages ........................................................................ 31

Table 4.1 UPLC-MS transitions and voltages ........................................................................ 43

Table 4.2 qPCR primer sequences for 5-HT pathway genes and reference genes for

Aedes aegypti .......................................................................................................... 48

Table 4.3 RNA extraction yields, 260/280 and 260/230 ratios for female adult whole

body RNA samples ................................................................................................. 55

Table 4.4 qPCR primer efficiencies, R2, slope values and intercepts for Aedes aegypti

5-HT pathway genes and reference genes .............................................................. 57

Table 4.5 Stability analysis results of reference genes in breadfruit extract exposed 4th

instar larval head gene study .................................................................................. 58

Table 4.6 Stability analysis sesults of reference genes in adult blood fed/sugar fed

whole body, midgut and Malpighian tubule gene study ........................................ 58

Table 4.7 Stability analysis results of reference genes in adult blood fed/sugar fed head

gene study ............................................................................................................... 59

viii

List of Figures

Figure 1.1 Biosynthetic Pathway for serotonin and melatonin in both animals and

plants ...................................................................................................................... 3

Figure 1.2 Photographs of breadfruit (Artocarpus altilis) from the NTBG Kahanu

Garden site. Mature fruiting breadfruit tree (left). Immature fruit and male

inflorescence (top right). Artocarpus camansi (breadnut) fruit (bottom

right). Photo by Matthew Glover (June 19, 2014). ............................................... 6

Figure 1.3 Biosynthetic pathway for dopamine and octopamine and their intermediates

from tyrosine ........................................................................................................ 10

Figure 1.4 Diagram of the Aedes aegypti alimentary canal with major ion and water

movement in the major osmoregulatory tissues ................................................... 12

Figure 1.5 Photograph of female Aedes aegypti taken during a blood meal with the

formation of a urine droplet apparent only minutes after onset of blood

feeding. Photo credit: Jan Vozenilek ................................................................... 13

Figure 1.6 Schematic drawing of the Ramsay assay to test urine production of

extracted insect Malpighian tubules. .................................................................... 15

Figure 1.7 Schematic drawing of the principal and stellate cells of Aedes aegypti

Malpighian tubules indicating the effect of 5-HT excitation of the V-type

H+ ATPase leading to increased Na+/K+ transport from the haemolymph to

the tubule lumen. .................................................................................................. 15

Figure 1.8 Life cycle of Aedes aegypti .................................................................................. 17

Figure 3.1 Antioxidant activity displayed as μmol trolox equivalents (TE)/100 g in

three varieties of Artocarpus methanol extract. Bars represent mean ± 1

SEM (N=3). Bars with different letters indicate significantly different

antioxidant activity as determined by a one-way ANOVA with Tukey’s

HSD multiple comparisons test............................................................................ 32

Figure 3.2 Range of 5-HT (serotonin) detected in 3 varieties of Artocarpus extract

determined by UPLC-MS (N=3). Due to large range in data, statistics were

not run and data is shown to be purely representational of range as well as

positive 5-HT presence. ....................................................................................... 34

ix

Figure 3.3 Sample chromatogram of 5-HT (serotonin) detected in 3 varieties of

Artocarpus extract determined by UPLC-MS. Retention time (minutes) for

serotonin was the same for all samples and matched serotonin standards.

Panels indicate methanol extract samples from A) Artocarpus altilis ulu afa

B) Artocarpus altilis Lipet C) Artocarpus camansi. ............................................ 35

Figure 4.1 Representative image of a 3-hour blood fed female adult Aedes aegypti (A),

3-hour sugar fed female adult Aedes aegypti (B), and an unfed female adult

Aedes aegypti (C). ................................................................................................ 45

Figure 4.2 Serotonin (A) and melatonin (B) (pg/L) in the haemolymph of 4th instar

larval Aedes aegypti after exposure to 4 different Artocarpus methanol

extracts (black) compared to a 4% methanol control (white). Bars represent

mean ± 1 SEM (N=5). Bars with asterisks (*) indicate significantly

different gene expression from control (One-Way ANOVA with Dunnett’s

multiple comparisons test). .................................................................................. 52

Figure 4.3 Sample chromatogram of 5-HT (Serotonin) detected in haemolymph of 4th

instar Aedes aegypti after exposure to 4 varieties of Artocarpus extract

determined by UPLC-MS (N=5). Retention time (minutes) for serotonin

was the same for all samples and matched serotonin standards. Panels

indicate haemolymph samples from larvae exposed to A) 4% methanol B)

mixed Artocarpus extract C) Artocarpus altilis Lipet extract D) Artocarpus

camansi extract E) Artocarpus altilis ulu afa extract. .......................................... 53

Figure 4.4 Representative 1% agarose non-denatured RNA gel with 3 hour blood fed

and 3 hour sugar fed Female adult head mRNA. Lanes contain the

following: 1: 5 μL Quick-Load® 100 bp DNA ladder (New England

BioLabs), 2-7: 1 μL RNA, 4 μL ultra-pure water, 1 μL 6x Blue Gel

Loading Dye (New England BioLabs), 8: 5 μL Quick-Load® 1kb DNA

ladder (New England BioLabs)............................................................................ 56

Figure 4.5 Normalized mRNA expression of TRH (A), AAADC (B), SNAT288 (C),

SNAT222 (D), SNAT220 (E) and ASMT (F) in the head of 4th instar larval

Aedes aegypti after exposure to 4 different Artocarpus methanol extracts

(black) compared to a 4% methanol control (white). Bars represent mean ±

x

1 SEM (N=3). Bars with asterisks (*) indicate significantly different gene

expression from control (One-Way ANOVA with Dunnett’s multiple

comparisons test).................................................................................................. 61


SNAT222 (D), SNAT220 (E) and ASMT (F) in the whole body of female

adult Aedes aegypti after 3h, 12h, and 24h post blood feeding (black) and

sugar feeding (white). Bars represent mean ± 1 SEM (N=3). Bars within

the same time period or within the same feeding treatment with different

letters indicate significantly different gene expression (Two-Way ANOVA

with Holm-Sidak multiple comparisons test)....................................................... 63


SNAT222 (D), SNAT220 (E) and ASMT (F) in the midgut of female adult

Aedes aegypti after 3h, 12h, and 24h post blood feeding (black) and sugar

feeding (white). Bars represent mean ± 1 SEM (N=3). Bars within the same

time period or within the same feeding treatment with different letters

indicate significantly different gene expression (Two-Way ANOVA with

Holm-Sidak multiple comparisons test). .............................................................. 65


SNAT222 (D), SNAT220 (E) and ASMT (F) in the Malpighian tubule of

female adult Aedes aegypti after 3h, 12h, and 24h post blood feeding

(black) and sugar feeding (white). Bars represent mean ± 1 SEM (N=3).

Bars within the same time period or within the same feeding treatment with

different letters indicate significantly different gene expression (Two-Way

ANOVA with Holm-Sidak multiple comparisons test). ...................................... 67


SNAT222 (D), SNAT220 (E) and ASMT (F) in the head of female adult

Aedes aegypti after 3h, 12h, and 24h post blood feeding (black) and sugar

feeding (white). Bars represent mean ± 1 SEM (N=3). Bars within the same

time period or within the same feeding treatment with different letters

indicate significantly different gene expression (Two-Way ANOVA with

Holm-Sidak multiple comparisons test). .............................................................. 69

xi

List of Abbreviations

5-HT 5-hydroxytryptamine (serotonin)

AAADC Aromatic amino acid decarboxylase

ASMT Acetylserotonin methyl transferase

cDNA complimentary DNA

GC-MS Gas chromatography mass spectrometry

HG Hindgut

IAA indoleacetic acid

LC-MS Liquid chromatography mass spectrometry

LLOD Lower limit of detection

LLOQ Lower limit of quantification

MT Malpighian tubule

mRNA messenger RNA

Mel Melatonin

MG Midgut

PCR polymerase chain reaction

RT-PCR reverse transcriptase polymerase chain reaction

qPCR quantitative real time polymerase chain reaction

SNAT Serotonin-N-acetyl transferase

TPH Tryptophan hydroxylase (vertebrate)

TRH Tryptophan hydroxylase (insect)

WB whole body

xii

Acknowledgements

I would like to thank my supervisor Dr. Mark Rheault, I would never have been here

if he hadn’t taken me on as an undergraduate so many years ago. I’ve learned so much since

starting in the Rheault Lab. Thank you as well to Dr. Susan Murch for introducing me to the

breadfruit project and allowing me to visit the Kahanu Garden in Hana, Maui, Hawaii for an

amazing experience. A graduate student couldn’t ask for more than what you both have

offered. I would also like to thank my committee members throughout the past two years: Dr.

Paula Brown and Dr. Miranda Hart. I would also like to thank Dr. Diane Ragone, without her

this kind of research on breadfruit would not be possible. I am grateful to my friends and lab

mates Nicholas Chow and Paige Zeniuk for making many early mornings and late nights of

dissecting mosquitoes far more enjoyable than I thought possible and for both of your endless

help and support throughout this project, this thesis would never have been completed

without the two of you. I’d also like to thank all the other members of the Rheault Lab who

assisted me along the way: Ian Cole, Melissa Cruz, Zerihun Demissie, Molly-Rae Walker

and Emily Bernie. I’d also like to thank those from both the Murch Lab and the Brown Lab

who assisted me in the chemistry that was so far beyond me: Teesha Baker, Broc Glover,

Jensen Lund, Michael Chan, Jamie Findlay, and Xiaohui Zhang.

I also extend my thanks to the Breadfruit Institute, National Tropical Botanical

Garden, Canadian Foundation for Innovation (CFI), and the Natural Sciences and

Engineering Council of Canada (NSERC) for funding my research.

Finally I wish to thank my friends and family, especially my parents for all of their

support. And most of all, I’d like to thank Caitlyn for her never-ending support both

academically and non-academically across the last 4 years. I wouldn’t be here without you.

1

Chapter 1 : Introduction

1.1 Discovery of Serotonin and Melatonin in Plants

Serotonin (5-hydroxytryptamine, 5-HT), an amine most commonly known for its role

as a neurotransmitter in animals, was originally discovered in 1952 (Erspamer and Asero,

1952). Shortly thereafter, serotonin was also reported to be present in the legume Mucuna

pruriens in 1954 (Bowden et al., 1954), indicating that serotonin may not be limited to the

animal kingdom. Throughout the late 1960s and early 1970s numerous studies investigated

plant serotonin (Leete, 1967; Applewhite, 1972; 1973; Schneider and Wightman, 1973)

eventually lead to its detection in > 40 plant species from 20 plant families (Roshchina,

2001). High levels of serotonin have been detected in nuts, butternuts, walnuts and hickory

nuts (Feldman and Lee, 1985). Serotonin is also found in moderate quantities in fruits such as

plantain (30.3 µg/g); pineapple (17.0 µg/g); banana (15.0 µg/g); kiwi fruit (5.8 µg/g); plums

(4.7 µg/g) and tomatoes (3.2 µg/g) (Feldman and Lee, 1985). The concentration of serotonin

varies widely with 12.6 ng/100 g present in the sweet cherry cultivar ‘Van’ to 25–400 mg/ kg

in walnuts and hickory nuts (Juglans regia) (Ramakrishna, 2011). Immunolocalization in

rice shows that serotonin concentrations are highest in the vascular parenchyma cells (Kang

et al., 2007). Melatonin (N-acetyl-5-methoxytryptamine), a compound derived from

serotonin, has also since been shown to exist in plant species. It was first described in

harvested plant tissues in 1995 (Dubbels et al, 1995; Hattori et al, 1995) and in growing

plants in 1997 (Murch et al., 1997). Melatonin has now been detected in more than 150

plants including traditional Chinese medicinal herbs (Chen et al., 2000), seeds and fruit of the

edible plants (Manchester, 2000) and many other species (reviewed in Arno, 2014).

Concentrations of melatonin range from 6 pg•g−1 in the shoots of Ipomoea nil L. to 34 μg•g−1

in the root of Glycyrrhiza uralensis Fisch (Arnao, 2014).

1.2 Biosynthesis of Serotonin and Melatonin in Plants

Studies with in vitro-grown axenic plantlets of the medicinal species St. John’s wort

(Hypericum perforatum L.) demonstrated that serotonin and melatonin were synthesized by

2

plants and were therefore not simply an artifact of an associated microorganism (Murch et

al., 2001; 2002). Biosynthesis of serotonin and melatonin in plants has now been described

in both radioisotope tracer and molecular studies (Murch et al., 2001; Kang et al. 2007; 2011;

2012; Park et al. 2009; 2011; Figure 1.1). Both serotonin and melatonin are derived from

tryptophan and auxin (Murch et al., 2000), where tryptophan is metabolized to serotonin in

two steps: (a) tryptophan is converted into tryptamine and (b) tryptamine is metabolized to

serotonin (Murch et al., 2000). Serotonin is then acetylated followed by conversion of N-

acetyl serotonin into melatonin (Murch et al., 2000; Bajwa et al, 2014). Serotonin is

generally present in high levels in plants and is not a rate-limiting factor for melatonin

biosynthesis (Bajwa et al, 2014). Recently, the genes encoding four consecutive enzymes,

namely tryptophan decarboxylase (TDC), tryptamine 5-hydroxylase (T5H), serotonin N-

acetyl transferase (SNAT) and N-acetyl serotonin methyl transferase (ASMT), involved in

converting L-tryptophan into melatonin were characterized (Kang et al., 2007, 2011, 2012;

Park et al., 2011). Interestingly, it was found that the order of the reactions involved in

serotonin biosynthesis in plants appears to be different than the animal biosynthetic pathway.

Notably, the order of the hydroxylation and decarboxylation reactions is reversed (Figure 1;

Stehle, 2011).

3

Figure 1.1 Biosynthetic Pathway for serotonin and melatonin in both animals and plants

4

1.3 The Roles of Serotonin and Melatonin in Plant Physiology

Despite its established presence in plants, the role of serotonin in plant metabolism is

not fully understood; however, various mechanisms have been suggested including

maintenance of cellular integrity, plant morphogenesis, delaying senescence, and

cytoprotection (Murch et al., 2001; Kang et al., 2007, 2009; Ishihara et al., 2008; Lazar et al.,

2013). External application of serotonin has been shown to have an auxin-like effect on root

elongation (Csaba and Pal, 1982; Murch et al., 2001; Murch and Saxena, 2004), while

endogenous serotonin seems to accumulate in anthers at the critical stage of microspore

differentiation (Murch et al., 2002). In most instances, the role of serotonin is described in

relation to the closely related indoleamine, melatonin. The relative ratios of serotonin and

melatonin have several physiological functions in plants including regulation of photoperiod

responses and light/dark cycles, regulation of plant growth and developmental pathways, root

branching and secondary root growth, detoxification of reactive oxygen species and

reduction of the physiological impact of environmental stresses such as heavy metals, UV

radiation, temperature fluctuations and drought (reviewed in: Murch and Saxena, 2001;

Paredes et al., 2009; Posmyk and Janas, 2009; Zhang et al., 2013; Feng et al., 2014). Most

recently, melatonin was found to delay leaf senescence in an auxin-induced Arabidopsis

mutant (Shi et al., 2015). The possibility that serotonin or melatonin may be anti-herbivory

compounds in plants has not previously been considered.

1.4 Breadfruit

Breadfruit, Artocarpus altilis (Parkinson) Fosberg, is a traditional crop food source in

Melanesia, Micronesia and Polynesia. This Oceanic crop source provides large potential for

food production due to its high fruit yield and its geographical overlap with regions where

food is scarce (Navarro et al. 2007). When cooked, breadfruit flesh can be incorporated as a

dietary staple and is directly comparable to other starchy carbohydrate products such as

sweet potato and white rice. It is also an excellent source of dietary fiber (Ragone and

Cavaletto, 2006). The fruits themselves are oblong, being approximately 12–20 cm wide and

5

12 cm long, and have a color ranging from light green to yellow as maturity progresses

(Ragone, 1997). Fruit yields can differ significantly, ranging between 100 – 600+ fruits per

year per tree. The individual fruits range from 1–6 kg depending primarily on specific variety

and age (Fownes and Raynor, 1993; Ragone, 1997).

Artocarpus altilis is one of a number of tree species grown for their fruit within the

Genus Artocarpus (Moraceae) alongside jackfruit (Artocarpus heterophyllus Lamarck) and

champedak (Artocarpus integer (Thunberg) Merrill) (Purseglove, 1968). Two

morphologically distinct variants of breadfruit exist: Artocarpus altilis and Artocarpus

mariannensis Trécul (Trécul, 1847). These two species are involved in introgression

resulting in a large number of hybridized forms and a large variety of breadfruit that consists

of traits from both species. Morphological variations between fruits can include seedless to

seeded fruits, deeply lobed leaves to leaves lacking lobing, as well as variation in fruit

surface from relatively smooth to quite sharp and spiny (Fosberg, 1960; Coenan and Barrau,

1961; Ragone, 1991). Artocarpus altilis is often identified as having moderate lobing of the

leaves, reaching approximately 2/3 the distance to the midrib, and paler yellow/yellow-green

fruit that is rarely seeded. In contrast, Artocarpus mariannensis is more often associated with

leaf lobes reaching less than ½ way to the midrib and fruits with stronger green coloration

that are always seeded (Ragone, 1991). There is also a 3rd variety of breadfruit, which is

described as a separate species under the name Artocarpus camansi Blanco (breadnut) that

has very spiny fruit that are always seeded. Artocarpus camansi has historically been

associated as a subspecies within traditional Artocarpus altilis but is actually a valid species

due to its seeded nature separating it from modern Artocarpus altilis (Blanco, 1837;

Quisumbing, 1940; Coronel; 1983). Artocarpus altilis can be both diploid (2n=56) and

triploid (3n=84) whereas Artocarpus mariannensis and Artocarpus camansi are both diploid

(2n=56) (Barrau, 1976; Jarrett, 1959; Ragone, 1991).

In addition to its use as a food source, breadfruit can also produce a number of

secondary products such as timber and medicine (Ragone, 1997). The male inflorescences

alone have multiple uses including being pickled or candied and eaten, along with pain

reduction if toasted flowers are rubbed on aching gums (Massal and Barrau, 1954; Morton,

1987). The burning of male inflorescences has also been used in traditional Oceanic cultures

6

to produce a smoke that repels mosquitoes and reduces the likelihood of mosquito biting

(Olson, 1991; Jones et al. 2012). This observation suggests that breadfruit may be a novel

source for insect repellent and/or insecticide development. Recent work has also shown that

many tryptophan and tryptamine compounds such as 5-HT are in high abundance in

Artocarpus altilis extract derived from the male inflorescences (personal communication,

Murch and Turi). This thesis attempts to elucidate whether or not the 5-HT present in

breadfruit has a toxic and/or physiological effect on mosquitoes. The basis for this research

direction is presented in the following sections.

Figure 1.2 Photographs of breadfruit (Artocarpus altilis) from the NTBG Kahanu Garden

site. Mature fruiting breadfruit tree (left). Immature fruit and male inflorescence (top right).

Artocarpus camansi (breadnut) fruit (bottom right). Photo by Matthew Glover (June 19,

2014).

7

1.5 Serotonin and Melatonin in Insects

Serotonin is an important stimulating hormone for diuresis, or the production of urine,

in blood feeding insects. Early experiments showed that when a serotonin analogue, 5,7-

dihydroxytryptamine, was injected into the gut of Rhodnius prolixus 24 h prior to blood

feeding, the insects fed significantly less than normal, produced little to no immediate urine

and did not undergo typical cuticle plasticization (stretching of the cuticle to accommodate

increased volume) (Maddrell et al. 1993). While the role of the serotonin in diuresis has been

well described, the function of melatonin in insects is still poorly understood. As in

vertebrates, melatonin in invertebrates is associated with diurnal cycles and circadian

rhythms. In vertebrates, melatonin levels peak during the night (Hardeland et al. 1995).

Measurements of melatonin levels and the time of day at which they peak have varied

between species and within different tissues within a single species in the reported literature.

In the vinegar fly, Drosophila melanogaster, melatonin peaks during the day whereas in the

damselfly, Enallagma civile, there is no clear pattern and melatonin fluctuates drastically

(Hintermann et al. 1996; Tilden et al. 1994). Melatonin in the cricket (Gryllus bimaculatus)

peaked during the night in the compound eye, brain and palp whereas melatonin peaked

during the day in other tissues such as the cercus, ovipositor, hind leg, and ovary indicating a

difference in function of melatonin in differing tissues of the body (Itoh et al., 1995).

1.6 Biosynthesis of Serotonin and Melatonin in Insects

Serotonin and melatonin biosynthesis in insects is similar to the metabolic pathway

described for plants (Figure 1.1). The main precursor is also tryptophan, which is

hydroxylated by tryptophan hydroxylase (TRH) to form 5-hydroxytrytophan. Tryptophan

hydroxylation by TRH has been shown to be the rate-limiting step in production of serotonin

(Livingstone and Tempel, 1983; Neckameyer and White, 1992). In a subsequent reaction,

DOPA decarboxylase (DDC) converts 5-hydroxytryptophan to 5-hydroxytryptamine

(serotonin) (Vömel and Wegner, 2008; Reiter et al., 2010; Figure 1.1). Melatonin is then

synthesized by a similar process to that described in plants, and involves a reversible two-

8

step N-acetylation and methyl addition (Sugden, 1989; Slominksi et al., 2002; Dempsey et

al., 2014).

The biosynthetic pathway in animals leading to the production of the biogenic amines

octopamine, tyramine and dopamine from tyrosine has also been characterized (Figure 1.3).

It is interesting that while serotonin production is completed by a two-step reaction from

tryptophan with the first step of hydroxylation and the second being decarboxylation. Both

pathways produce octopamine and norepinephrine from tyrosine using a similar two-step

reaction occurs except that decarboxylation is the first step and hydroxylation is the second

step. It is worth noting that the DOPA decarboxylase involved in dopamine synthesis from

DOPA is the same DOPA decarboxylase from the decarboxylation of 5-hydroxytryptophan

to 5-hydroxytryptamine (Figure 1.1).

1.7 5-HT Receptors in Vertebrates and Invertebrates

The majority of our current knowledge of the 5-HT receptors present in insects is

based on homology with well-characterized vertebrate 5-HT receptors. Barring a few

exceptions, the following classifications are based primarily on sequence homology, second

messenger pathway association and pharmacology (Hannon and Hoyer, 2008; Nichols and

Nichols, 2008). The 5-HT1A, 5-HT1B and 5-HT5 receptors are associated with inhibiting

cAMP synthesis, 5-HT2α and 5-HT2β are associated with increasing cytosolic Ca2+ levels and

5-HT4, 5-HT6, and 5-HT7 are associated with promoting cAMP synthesis (ibid). All of the 5-

HT receptors are G-protein coupled receptors. In the honeybee brain, affinity of [3H]-

serotonin for 5-HT receptors is high (97% affinity) (Erber et al., 1993), however the addition

of the non-selective 5-HT1, 5-HT2 and 5-HT7 receptor blocker methysergide effectively

reduces the binding of [3H]-serotonin. In contrast, selective blockers such as ketanserin (5-

HT2), 8-OH-DPAT (5-HT1A, 5-HT7) and buspirone (5-HT1A) do not entirely reduce binding

of [3H]-serotonin indicating that [3H]-serotonin can be used to label a multiple 5-HT

receptors.

Expression patterns of the various 5-HT receptors differ heavily between different

insect species and even across short spans of developmental time in the same insect. For

example in Drosophila melanogaster, through both qPCR and in situ hybridization, the

9

transcripts for the 5-HT2α receptor can be seen as early as 3 hours after embryonic

development (Colas et al., 1995). It was also shown that the 5-HT2α receptor coexpresses

with the developmental pair-rule gene fushi-tarazu in even numbered segments during

development (ibid). Later in development, Nichols showed that expression of 5-HT2α in the

brain changes between regions of the brain during just the duration of 3rd instar larval

development (2007).

1.8 Biogenic Amine Receptors as Targets for Insecticide Development

Biogenic amines such as octopamine and tyramine can act as neuromodulators in

insects and invertebrates much like serotonin, melatonin and dopamine (Orchard, 1982).

Octopamine and tyramine act as invertebrate analogues to epinephrine and norepinephrine,

respectively (Lange, 2009). These compounds, along with other biogenic amines can act as

neuromodifier hormones that change the responsiveness of other nervous tissue to a stimulus

and produce a different response. For example, low levels of serotonin in vertebrates can lead

to behaviors such as aggression whereas increased levels of serotonin and octopamine

increase aggression in insects such as crickets (Collins and Miller, 1977). It has been shown

that octopamine does not initiate an aggression response, but acts as a neuromodulator to

enhance aggression by lowering the threshold of serotonin required to initiate an aggressive

response, thereby promoting that behavior indirectly (Adamo et al., 1995). Levels of biogenic

amine neuromodulators such as octopamine, dopamine and serotonin in the mushroom

bodies of the brain of worker honeybees increase with age (Alaux et al. 2009a) and

artificially raising levels of either octopamine or tyramine can cause premature advancement

or slower advancement towards mature adult foraging behavior (Alaux et al. 2009b).

Octopamine has also been extensively implicated in increasing heart rate during flight in

locusts (Orchard et al., 1993). In a similar fashion, octopamine also stimulates production of

adipokinetic hormone (the insect equivalent of glucagon) for mobilization of fat stores in

order to provide energy for flight (Yakovlev and Gordya, 2012). 5-HT can act in a similar

fashion where it can modify muscle responsiveness to excitatory neurotransmitters such as L-

glutamate in order to increase rates of muscle contraction (Tamashiro and Yoshino, 2014).

Tyramine however lacks a fully developed knowledge base, with primary knowledge

10

indicating that it acts in opposition to octopamine (similar to norepinephrine in vertebrates)

(Lange, 2009).

Figure 1.3 Biosynthetic pathway for dopamine and octopamine and their intermediates from

tyrosine

The biogenic amine L-DOPA is synthesized by a similar tyrosine hydroxylase in

plants and L-DOPA has been shown to act as a highly active allelochemical in the legume

Mucuna piriens (Pattison et al., 2002; Vadivel and Janardhanan, 2001).

Quite recently, work by Meyer et al. (2012) and Nuss et al. (2015) have shown

success in the testing of receptors of the biogenic amine neuromodulator dopamine as targets

11

for insecticide development. Notably, a number of dopamine receptor antagonists were

shown to act as successful insecticidal agents in initial studies using 3rd instar Aedes aegypti

and Culex quinquefasciatus. This recent research brings to light the potential for utilizing

biogenic amines such as dopamine, serotonin, and octopamine receptors and the associated

G-protein coupled receptor (GPCR) pathways as novel targets for insecticidal development

for control of insect vector diseases such as Dengue fever, yellow fever and Malaria.

1.9 Serotonin in Regulation of Digestion and Diuresis in Insects

The study of serotonin in insects has concentrated primarily around its association

with digestion and feeding. Serotonergic neurons from the mesothoracic ganglion innervate

the digestive tract and control gut contraction (Orchard, 2006). These neurons release

serotonin into the haemolymph (blood) of blood feeding insects such as Rhodnius prolixus

during feeding (Lange et al. 1989). In cockroaches, serotonin reduces feeding behavior when

artificially injected into the haemolymph (Cohen, 2001). However, French et al. later showed

that injection of 5-HT directly into the haemolymph causes no change in food intake whereas

direct injection into the brain resulted in a significant reduction of food intake (2014). It was

also shown that serotonin levels in the honeybee (Apis mellifera) vary across age with higher

serotonin levels later in life as well as differing serotonin levels in honeybees from different

levels of the social hierarchy (Wagener-Hulme et al. 1999; Schulz and Robinson, 1999). One

of the most important functions of serotonin in insects is its use in diuretic responses. There

are two primary diuretic hormones present that act synergistically in insects, the first being a

diuretic hormone, now referred to as cortico-tropin-releasing factor-related peptide (CRF) as

well as serotonin (Maddrell et al. 1991; Orchard, 2006; Te Brugge et al. 2011).

When an insect feeds, food is passed through the pre-oral cavity past the crop and

foregut and arrives at the midgut (Figure 1.4). The midgut is the primary site of digestion and

absorption of the insect digestive system. The highly alkaline environment (pH = 9 to 11) in

some Dipterans and Lepidopterans helps degrade food for digestion and allow nutrients to

move passively across the peritrophic membrane and then be absorbed across midgut

epithelial villar cells (House, 1974; Dadd, 1975). Nutrients and fluids are absorbed across the

midgut epithelium, analogous to the mammalian small intestine and are carried to tissues via

12

haemolymph (Moffett et al. 2012). The Malpighian (renal) tubules in insects arise at the

junction of the midgut and hindgut. The Malpighian tubules are blind-ended tubular

structures that are single cell thick (Phillips 1981; Figure 1.4). The number of Malpighian

tubules can vary from two in Coccids to >250 in Orthopterans (Phillips, 1981). These

structures perform the same functions of detoxification and filtration of blood and the

elimination of waste as the mammalian kidney, but utilize an ATP-driven ion transport

ultrafiltration process as opposed to pressure filtration found in mammalian kidneys. Ions are

actively transported from the haemolymph to the tubule lumen, generating an osmotic

pressure gradient, which drives water transport into the tubule. Subsequently in more

proximal regions of the tubules ions and nutrients may be selectively reabsorbed back into

the haemolymph with the remaining filtrate being left to pass from the tubules into the

hindgut (Figure 1.4). The hindgut is responsible for further modification of the ultrafiltrate

with additional selective ion and water reabsorption, a physiological function analogous to

the mammalian large intestine. Remaining undigested food and ultrafiltrate is then excreted

(Figure 1.4).

Figure 1.4 Diagram of the Aedes aegypti alimentary canal with major ion and water

movement in the major osmoregulatory tissues

13

The small size of insects and their high surface area to volume ratio increases their

susceptibility to desiccation, thus requiring insects to have tight control and regulation of

mechanisms responsible for ion and water homeostasis (Maddrell et al., 1991). Insects that

imbibe periodic blood meals have an urgent need to effectively absorb nutrients while

quickly eliminating excess fluid obtained during feeding (Figure 1.5). The kissing bug

Rhodnius prolixus can ingest up to 10 times its’ unfed weight during a blood meal (Lange et

al. 1989). Female mosquitoes can take up a similar relative volume during a blood meal as

well (Figure 1.5). This results in a marked increase in mass and volume of the organism, the

excess water volume, ions and toxins present in the blood can pose a major threat to

homeostasis, additionally impeding the insect’s capability to avoid capture by predators

(O’Donnell, 2009; Figure 1.5).

Figure 1.5 Photograph of female Aedes aegypti taken during a blood meal with the formation

of a urine droplet apparent only minutes after onset of blood feeding. Photo credit: Jan

Vozenilek

14

1.10 Model Systems to Investigate the Role of Serotonin in the Insect Gut

The importance of serotonin in the regulation of gut function and urination in insects

has been investigated with several model systems. In Rhodnius prolixus, serotonin was

shown to increase 14-fold in the haemolymph in response to feeding (Lange et al. 1989).

Further details of the physiological mechanisms of serotonin responses in the insect gut can

be made by isolating the Malpighian tubules and exposing the tissues to individual

compounds or crude extracts in order to determine if the rate of fluid secretion and ion

concentrations of urine and haemolymph can be determined by the Ramsay assay (Maddrell

et al. 1998). Isolated Malpighian tubules treated with serotonin in a Ramsay assays (Figure

1.6) showed increased secretion rates, which could be completely blocked by serotonin

receptor antagonists ketanserin and spiperone (Maddrell et al. 1991). Feeding stimulates the

release of serotonin into the haemolymph by the abdominal neurons and the serotonin binds

to receptors on the basolateral membrane of the Malpighian tubules causing an increase in

cyclic AMP (adenosine 3',5'-cyclic monophosphoric acid) in the Malpighian tubule principal

cells (Lange et al. 1989; Figure 1.7). Cyclic AMP stimulates the activity of an apical

membrane bound H+ V-type ATPase, increasing the rate of proton transport across the apical

membrane (Maddrell et al., 1969; Barrett and Orchard, 1990, Montoreano et al. 1990;

Maddrell et al., 1993; Figure 1.7). This protomotive force drives cation transporters

exchanging Na+/K+ for H+ (Weng et al. 2003, Rheault et al. 2007). The increase in ion

concentration in the lumen of the tubule drives passive water transport through aquaporins

across both membranes from the haemolymph into the tubule. The location of the H+ V-type

ATPase and the Na+ and K+/H+ exchange transporter is reversed to the basolateral membrane

in the proximal tubule causing active ion transport to occur out of the tubule lumen and into

the haemolymph to recover K+, Cl- and water (Patrick et al. 2006; Figure 1.7). In insects, the

H+ V-type ATPase and its associated cation/H+ exchange transporter provide the vast

majority of ion transport (Weng et al. 2003; Figure 1.7).

15

Figure 1.6 Schematic drawing of the Ramsay assay to test urine production of extracted

insect Malpighian tubules.

Figure 1.7 Schematic drawing of the principal and stellate cells of Aedes aegypti Malpighian

tubules indicating the effect of 5-HT excitation of the V-type H+ ATPase leading to increased

Na+/K+ transport from the haemolymph to the tubule lumen.

16

1.11 Plant Serotonin in Insect Physiology

The presence of high levels of serotonin in plant tissues, especially in the outer cells

of the vasculature, may indicate a new role for serotonin as an anti-herbivory compound. It

is likely that insects consuming high levels of serotonin in plant tissues would experience

significant physiological symptoms including an inability to regulate fluids leading to

desiccation or bloating. As a result, serotonin and related compounds produced by plants

may find interesting new applications as natural larvicidal, insecticidal and deterrent

applications. The potential for insect control varies depending on the stage of the insect life

cycle (Figure 1.8).

17

Figure 1.8 Life cycle of Aedes aegypti

1.12 Plant Extract Activity on Insect Larva

The majority of data currently available has targeted the larval stage of the insect life

cycle in aquatic systems (Figure 1.8) and most are oil-soluble extracts that float on the water

surface. Several effective plant extracts have been identified including: camphor

(Cinnamonum camphora), lemon (Citrus lemon), frankincense (Boswellia carteri), dill

(Anethum graveolens), myrtle (Myrtus communis), juniper (Juniperus communis), black

pepper (Piper nigrum), verbena (Lippia citridora), sandalwood (Santalum album), thyme

18

(Thymus serpyllum), amyris (Amyris balsamifera), cedar (Juniperus virginiana), and

helichrysum (Helichrysum italicum) (Amer and Melhorn, 2006). Park et al. (2011)

demonstrated that oil extracts of Eucalyptus globulus, Melaleuca dissitiflora, Melaleuca

quinquenervia and Melaleuca linariifolia had significant larvicidal activity with greater than

80% mortality of 3rd instar Aedes aegypti. Composition analysis revealed that the essential

oils were composed primarily of allyisothiocyante, p-cymene, (-)-limonene, (+)-limonene, γ-

terpenene, α-terpenene and (E)-nerolidol (Park et al. 2011). In a similar study, a variety of

essential oils including Cinnamomum zeylanicum, Cuminum cyminum, Curcuma longa,

Cyperus scariosus, Juniperus macropoda, Ocimum basilicum, Nigella sativa, Pimpinella

anisum, Rosmarinus officinalis, and Zingiber officinale were tested against 4th instars of three

mosquito species, Aedes aegypti, Anopheles gambiae, and Culex quinquefasciatus with all

but Rosmarinus officinalis yielding LC50 values ranging between 50 ppb and 325 ppb

(Prajapati et al. 2005). Treatments of Hypericum polyanthemum on larval Aedes aegypti

yielded not only 24 hour larval mortality of 43.1% at an oil exposure of 100 ppb but also

determined that the major components (benzopyrans and precocenes) prevented pupation in

4th instars and adult emergence in pupa (da Silva et al. 2013). In 2008, Hyptis fruticosa,

Hyptis petinata and Lippia gracillis essential oil showed LC50 values for Aedes aegypti

larvae of 502, 366 and 98 ppm, respectively (Silva et al. 2008). It was then shown that the

three oils contained primarily thymol, 1,8-cineole, γ-terpenene, carvacrol, β-caryophyllene,

caryophyllene oxide, and R-limonene. Of these isolated terpenes, 1,8 cineole and β-

caryophyllene had the lowest mortality with LC50 values of 1381 and 1202 ppm respectively,

whereas R-limonene, carvacrol, and thymol displayed significantly more mortality with LC50

values of 37, 70, and 79 ppm respectively (Silva et al. 2008). A separate study determined

that the primary constituent of steam distilled essential oil derived from Trachyspernum

ammi seeds were composed predominantly of thymol (66.96%) and several other terpenoids,

p-cymene (17.39%), γ-terpenene (10.12%) and β-pinene (2.26%) (Pandey et al. 2009).

Together these studies suggest that plants produce a range of compounds with serotonin-like

structures that have larvicidal activity. One advantage to such plant-based serotonin mimics

is the capacity to produce a water-soluble, indoleamine-rich plant extract. Such products are

increasingly desirable as a recent study in West Africa indicated that the use of typical

organophosphate- and pyrethroid-based chemical insecticides on the cotton agricultural pest

19

Bemisia tabaci was inadvertently increasing resistance in the malaria vector Anopheles

gambiae (Gnankiné et al. 2013). Therefore, there is a need for a treatment that is easily

dissolved in water, effective at low doses, with few applications and targets a specific core

physiological response to prevent the development of resistance and to mitigate damage to

non-target species (Gnankiné et al. 2013).

1.13 Insect Repellent Activity of Plant Extracts

The use of plant extracts in insect repellent and insecticide use in insect pests such as

adult mosquitoes has been widely practiced by many indigenous cultures around the planet

for thousands of years. This can be accomplished by volatilizing plant essential oil or by

burning plant tissue to yield smoke. A recent study demonstrated that smoke generated from

Corymbia citriodora, Ocimum suave, Otostegia integrifolia, Ocimum lamiifolium and Olea

europaea were all effective at preventing landings of both Aedes aegypti and Anopheles

gambiae with Corymbia citriodora being comparable to commercially available 10% N,N-

diethyl-meta-toluamide (DEET) (Dube et al., 2011). The same plants also showed repellent

effects by release of volatile compounds alone without burning (ibid). It was also shown that

the essential oil of Juniperus macropoda, Pimpinella officinalis and Zingiber officinale have

strong ovicidal effects whereas Cinnamomum zelyanicum, Cuminum cyminum, and

Rosmarinus officinalis possess strong repellent effects against adults of Aedes aegypti,

Anopheles stephensi and Culex quinquefasciatus (Prajapati et al., 2005). Traditional

indigenous knowledge was used to identify the male inflorescences of Artocarpus altilis as a

potential source of insect repellent phytochemistry and both smoke and ethanol extracts

effectively repelled mosquitoes in a bioassay (Jones et al., 2012).

1.14 Insect Serotonin Metabolism as a Target for Insecticides

Esquivel et al. (2014) recently suggested the Malpighian tubules, and more

specifically, the V-type H+-ATPase response post blood feeding as a likely candidate for

novel insecticide development after seeing transcriptomic changes in the tubules within 24

hours of taking a blood meal. By targeting this system in blood feeding insects, it is possible

20

that new insecticides and insect repellents may be developed that reduces widespread toxic

effects in non-target organisms.

1.15 Plant Serotonin for Insect Biocontrol

Insects such as Rhodnius prolixus, Aedes aegypti and Anopheles gambiae are vectors

for some of the most economically damaging diseases to humankind including Chagas’

Disease, yellow fever Dengue fever, and malaria, respectively. There are approximately 225

million cases and 1 million deaths per year due to malaria (Murray et al. 2012). Mosquitoes

belonging to the genus Aedes alone are responsible for 50 to 100 million infections per year,

primarily in the form of Dengue fever (Halstead, 2007). The serotonin receptors in the

Malpighian tubules are a novel target for development of natural insecticide for biological

control. The isolated Malpighian tubule bioassay (Figure 1.6) is an ideal system for

screening plant extracts for specific activity on insect renal function, as it can be used to

measure indicators of overall renal function such as fluid secretion and urine solute

concentration. It may even be used to measure specific targeted roles of the tubules such as

drug detoxification from the haemolymph. Alternatively, or in conjunction, systems typically

used for heterologous protein expression such as Xenopus laevis oocytes or mammalian cell

lines that express one or more 5-HT receptors could be used for a larger scale approach to

test 5-HT receptor activity from biofractionated extract components from a multitude of plant

species. Further studies have the potential to confirm plant-based serotonin as an important

regulator of insect physiology and insecticidal plant extracts.

1.16 Research Hypothesis and Objectives

This thesis investigated two hypotheses. The first hypothesis was that extracts of male

inflorescences of breadfruit (Artocarpus altilis) and related species are toxic to mosquito

larva. To determine the relative levels of toxicity of breadfruit inflorescence extracts, I

designed the following research objectives:

a) To optimize the method of extraction of breadfruit male inflorescences

21

b) To determine the phytochemical profile of breadfruit male inflorescence extracts

c) To optimize the methods for application of breadfruit extracts to insect larva.

The second hypothesis of the thesis was that breadfruit male inflorescence extracts are toxic

to insect larva through mediation of 5-HT metabolism in the gut. This hypothesis was

investigated with the following objectives:

a) To identify and quantify 5-HT and melatonin in the haemolymph of mosquitoes after

extract exposure

b) To determine the expression patterns of 5-HT synthesis enzymes in the tissues of

larval Aedes aegypti before and after exposure.

This research will enable the development of an optimized breadfruit extract for use

as an insect repellent/insecticide.

22

Chapter 2 : Investigation of Different Extraction Methods of Breadfruit

(Artocarpus altilis) on Insecticidal Activity of Yellow Fever Mosquito

(Aedes aegypti) larvae

2.1 Chapter Summary

The burning of breadfruit male inflorescences has been used in traditional Oceanic

cultures to produce a smoke that repels mosquitoes and reduces the likelihood of mosquito

biting (Olson, 1991; Jones et al. 2012). To optimize chemical extracts of male inflorescences,

I compared two different extraction methods, methanol and pentane, and determined

insecticidal activities. Methanol extracts were significantly more toxic toward mosquito

larvae than the pentane extracts. This difference indicates that a compound, or likely a family

of compounds, has been extracted with methanol but not extracted by pentane. I hypothesize

that these compounds are polar in nature based on the extraction method and the properties of

the methanol.

2.1.1 Insect Rearing

Aedes aegypti were obtained from a colony reared at the University of British

Columbia Okanagan. Larvae were hatched in 9"x13" polypropylene hatching trays in

ultrapure water in an incubator maintained at 27°C, 80% relative humidity, and on a 12:12 hr

light:dark cycle. Larval mosquitoes were fed ad libitum a 3:1 mixture of Tetramin© fish

flakes (Tetramin©, Blacksburg, Virginia, USA) and dry active yeast (MP Biomedicals,

Solon, Ohio, USA), respectively. Rearing water was changed once every 2 days until larva

underwent metamorphosis into the non-feeding pupal stage. Emergent adults were collected

by gentle vacuum into 12"x12" mesh cages. Cages were kept at ambient room temperature

(22-25°C) and humidity on a 12:12 hr light:dark cycle. Adults were fed a 10% (w/v) sugar

water solution. In addition, adults were fed sterilized sheep’s blood once per week

(Cedarlane Laboratories, Burlington, Ontario, Canada). Three days post blood meal an egg-

laying dish containing P5 Filter paper (Fisher Scientific, Pittsburgh, Pennsylvania, USA)

23

saturated with distilled water was placed in the cages containing adults. Adults were allowed

to lay eggs for 5 days before the filter paper and eggs were collected.

2.1.2 Plant Tissue Collection

The Breadfruit Institute manages the world’s largest curated collection of breadfruit

cultivars representing 34 Pacific Island groups, the Philippines, Indonesia, Honduras and the

Seychelles. The germplasm collection is comprised of 326 well-documented trees

representing the breadfruit complex of Artocarpus altilis, Artocarpus camansi, A.

mariannensis, and A. altilis x A. mariannensis hybrids (Jones et al. 2011). The trees were

collected from 1978–2004 and are conserved at Kahanu Garden in Maui (20°47’57.07” N,

156°02’18.42” W). The orchard occupies a single 12 acre site at an elevation of about 15 m

with a mean maximum temperature of 27.1 ºC, mean minimum temperature of 19.7 ºC, an

average of 2051 mm of rain each year (Western Regional Climate Center;

http://wrcc.dri.edu/), in a soil that is described as ‘‘Hana Very Stony Silt Clay Loam’’

(http://websoilsurvey.nrcs.usda.gov) derived from volcanic ash, it is typically well draining,

slightly/moderately acidic and contains approximately 8% organic matter in the surface layer.

A base of deep lava subtends the soil surface layer. Soil nutrient analysis of this location was

previously published (Jones et al. 2011). The mature trees produce male inflorescences at

regular intervals as described in Jones et al., (2010). To get sufficient tissue for preliminary

studies, inflorescences were collected from many trees and pooled into a bulk sample. The

inflorescences were dried in the sun for approximately 4 days and shipped to UBC Okanagan

for further processing. Samples visibly contaminated with fungus were not used for

experiments and discarded.

2.1.3 Methanol Tissue Extraction

Methanol extractions for the insect larvicidal bioassay consisted of dried ground

Artocarpus altilis male inflorescence material that was added to 500 mL of reagent grade

methanol (Fisher Scientific, Toronto, Ontario) in a 1 L glass bottle and shaken at 50 rpm at

room temperature for 24 hours. The methanol extract was vacuum filtered prior to drying.

http://wrcc.dri.edu/

24

Methanol was removed by rotovap (Buchi Rotovap, VWR, Mississauga, ON) and the

residual extracts were stored at –20 ºC until further analysis. Dried extract was re-suspended

in DMSO prior to larval exposures. Recovery of extract from breadfruit inflorescences

averaged 1.38 ± 0.05 grams (N=2) per 15.00 g or ~9% of plant material by methanol

extraction.

2.1.4 Pentane Tissue Extraction

A 1:2 ratio (w/v) of plant material to pentane was premixed in an Erlenmeyer flask

and dispensed into a custom built apparatus for pressurized solvent extraction. Water at 80

ºC – 90 ºC was pumped through a circulating water jacket to warm the metal cylinder until

the internal temperature was sufficient to generate pentane steam. Heating continued until an

internal pressure of 75–80 psi was achieved and the extraction was held at these conditions

for one hour. The system was then cooled to reduce the pressure and a ball valve at the base

of the cylinder was opened and the pentane extract was collected into a 1000 mL round

bottom flask. Pentane was removed by rotovap (Buchi Rotovap, VWR, Mississauga, ON)

and the residual extracts were stored at –20 ºC until further analysis. Dried extract was re-

suspended in DMSO prior to larval exposures. Recovery of extract from breadfruit

inflorescences averaged 38 grams per kg or ~ 4 % from starting plant material.

2.1.5 24-hour LC50 and LC90 Determination

One milliliter of the DMSO extract mixture was added to 100 mL polyethylene

beakers containing 99 mL of ultra-pure water. The final concentration of DMSO in all

samples was 1%. A minimum of seven concentrations were used for final analysis. Solutions

were stirred with a glass rod and twenty 4th instar larvae were added to each polyethylene

beaker containing 100 mL of exposure fluid. Both female and male 4th instars were used for

larvicidal experiments. Beakers were covered with petri dishes to minimize evaporation and

mortality was assessed after 24 hours. Five replicates were used for each experiment.

Controls contained 100 mL ultrapure water or 99 mL ultrapure water and 1 mL DMSO. The

25

24-hour LC50 and LC90 values were calculated by probit analysis using IBM SPSS Statistics

v20 (International Business Machines Corps, Armonk, New York, USA)

2.2 Results

Two different extraction methods, namely methanol and pentane, were used on

pooled variety male inflorescence samples of Artocarpus altilis. The pentane extract yielded

extremely low mortality, regardless of the concentration used during the larvicidal assay. A

maximum mortality value of 2.00 ± 1.22% was obtained with the pentane extract of

Artocarpus altilis at a maximum concentration of 5000 mg/L of extract. No mortality was

observed between 0 and 1000 mg/L whereas the same mortality of 2.00 ± 1.22% was

observed at both 2000 mg/L and 5000 mg/L. In comparison, the methanol extract yielded no

mortality between 0 and 50 mg/L, but increased to 4.00 ± 1.87% death at 191 mg/L, and

21.00 ± 4.85% death at 381 mg/L. The methanol extract achieved a maximum observed

mortality value of 70.00 ± 1.22% at a concentration of 964 mg/L. The low solubility of both

the methanol and pentane extracts in the 1% DMSO water solution prevented higher

concentrations than those listed above from being tested.

Due to a lack of mortality, it was not possible to determine a 24-hour LC50 and LC90

for the pentane extract of Artocarpus altilis. However, despite the lack of a complete

mortality curve including both 0% and 100% mortality with the methanol extract of

Artocarpus altilis, a 24-hour LC50 and LC90 could be determined. This mortality curve,

provided an LC50 of 752 mg/L and an LC90 of 1158 mg/L for the methanol extract. Due to

the lack of flanking points on either side of the probit analysis, the error for both values is

quite large (Table 2.1). Taken together, the lack of a 24-hour LC50 and LC90 for the pentane

extract and the high values for the methanol extract 24-hour LC50 and LC90 imply very low

toxicity relative to values obtained for other plant extracts in the literature (Table 2.1).

26

Table 2.1 Larvicidal activity of pentane and methanol Artocarpus altilis extracts

Plant Essential Extract LC50

(mg/L) LC

50 Lower CI LC

50 Upper CI LC

90

(mg/L) LC

90 Lower CI LC

90 Upper CI Publication

Artocarpus altilis

(methanol) 752 641 906 1158 987 1441

Artocarpus altilis

(pentane) Max mortality of 2.0% obtained at 5000 mg/L

Hyptis fruticosa 502 499 505 n/a n/a n/a Silva et al. 2008 Hyptis petinata 366 363 369 n/a n/a n/a Silva et al. 2008 Lippia gracillis 98 96 100 n/a n/a n/a Silva et al. 2008

Citrillus colocynthis 75 63 86 538 390 687 Rahuman & Venkatesan 2008

Trichosanthes anguina 554 482 626 2235 1742 2728 Rahuman & Venkatesan 2008

Coccinia indica 309 267 351 1339 1024 1637 Rahuman & Venkatesan 2008

Momordica charantia 199 173 225 780 605 955 Rahuman & Venkatesan 2008

Eucalyptus citriodora 58 53 63 88 78 104 Zhu et al. 2006

Cinnamomum cassia 80 70 88 123 109 151 Zhu et al. 2006

Nepeta cataria (catnip

oil) 70 65 76 97 88 112 Zhu et al. 2006

27

2.3 Discussion

The toxicity of breadfruit inflorescence extracts in Aedes aegypti larvae was analyzed

and the methanol breadfruit extract was significantly more toxic than the pentane extract.

The apparent difference in toxicity level of the methanol versus pentane breadfruit extracts

may be attributed to the different chemical properties of the two solvents, and by extension

their ability to preferentially extract certain compounds.

Methanol is a universal extraction solvent and can extract both non-polar organic

compounds and polar organic molecules. It is commonly used a solvent in the manufacturing

of vitamins, hormones and pharmaceuticals and is miscible with water, ethanol, ketones and

organic solvents (MERCK Online Index). In contrast, pentane is only able to extract non-

polar organic compounds from the plant material. The extracted non-polar organic

compounds are expected to be similar and/or the same as those extracted with methanol.

Both extracts are also unlikely to include terpenes and other volatile compounds typically

associated with insect toxicity due to the high temperature rotoevaporation step during their

preparation. As such, the observed toxicity difference between the two extraction methods is

likely due to the presence of one or more polar compounds in the methanol extract, which are

inherently absent in the pentane extract. The possibility that additional polar compounds exist

in the methanol extract warrants further investigation. Interestingly, the results thus far do not

preclude a role for serotonin or other biogenic amines in the observed toxicity of the

methanol extract. Serotonin is a relatively polar organic compound and would therefore, if

present, be expected to appear among the compounds extracted by methanol.

28

Chapter 3 : Chemical Characterization of Breadfruit Extracts

3.1 Chapter Summary

In the original breadfruit male inflorescence extracts described in Chapter 2, the

specific variety of breadfruit was not identified. One objective of this chapter was to

determine whether different cultivars have different insecticidal activity using 2 hybrids, ‘ulu

afa’ and ‘Lipet’ (Artocarpus altilis x Artocarpus marianensis) and Dugdug (Artocarpus

camansi) in comparison to the previous mixed Artocarpus altilis sample. Phytochemical

characterization included identification of volatiles, potential to detoxify reactive oxygen

species (ROS) and neurological indoleamines.

3.2 Materials and Methods


The Breadfruit Institute manages the world’s only curated collection of breadfruit

cultivars representing 34 Pacific Island groups, the Philippines, Indonesia, Honduras and the

Seychelles. The germplasm collection is comprised of 326 well documented trees

representing the breadfruit complex of Artocarpus altilis, Artocarpus camansi, A.

mariannensis, and A. altilis x A. mariannensis hybrids (Jones et al. 2011; Chapter 2).

Inflorescences were harvested from the trees in Hana in June of 2014 at different stages of

ripeness and shipped to Canada. Upon arrival it was determined that many of the shipped

samples had been contaminated by unidentified fungi. Samples which were not visually

contaminated were isolated and used in all subsequent studies.


Methanol extractions for the insect larvicidal bioassay consisted of dried ground

Artocarpus altilis male inflorescences material that was added to 500 mL of reagent grade

methanol (Fisher Scientific, Toronto, Ontario) in a 1 L glass bottle and shaken at 50 rpm at

29

room temperature for 24 hours. Methanol was removed by rotovap (Buchi Rotovap, VWR,

Mississauga, ON) and the residual extracts were stored at -20 ◦C until further analysis. Dried

extract was re-suspended in methanol prior to analysis. Samples representing Artocarpus

altilis ulu afa, Artocarpus altilis Lipet, and Artocarpus camansi were dried and resuspended

twice in order to further fractionate known quantities for multiple samplings. The mixed

sample was processed as in Chapter 2 with only one drying and resuspension in methanol.

3.2.3 Determination of Antioxidant Activity by DPPH

Radical scavenging activity (antioxidant activity) was determined using a

colorimetric assay using 2,2-diphenyl-1-picrylhydrazyl (DPPH). Methanolic extracts of each

of the 3 varieties of Artocarpus (Artocarpus altilis ulu afa, Artocarpus altilis Lipet, and

Artocarpus camansi) were prepared by adding 1.64 mg of dried methanol extract to 10 mL of

HPLC-grade methanol. A DPPH solution was made by dissolving 40 mg DPPH and 1L

HPLC-grade methanol. A trolox solution was made by dissolving 25 mg trolox in 50 mL

HPLC-grade methanol. Both DPPH and trolox solutions were stored at 4°C and were

wrapped in aluminum foil until use.

Experimental samples were prepared by adding 0.1 mL, 0.2 mL, 0.3 mL, and 0.4 mL

Artocarpus altilis methanol extracts to 4 falcon tubes in triplicate. 10 mL of DPPH solution

was added to each tube. These 12 tubes were prepared for each of the 3 varieties of

Artocarpus altilis extracts. Trolox standards consisted of adding 0.1 mL, 0.2 mL, 0.3 mL,

and 0.4 mL trolox standard with 10 mL DPPH solution each run with 3 technical replicates.

All falcon tubes were then placed on a wrist shaker at 100 rpm for 1 hour at 22°C.

Absorbance values for trolox standards were then measured at 517 nm on a

spectrophotometer.

The mass of extract added to each falcon tube was plotted against the absorbance at

517 nm. The trolox standard formed a standard curve that allowed the determination of

DPPH degradation in the breadfruit extract samples. The determination of antioxidant

activity was measured as μmol trolox equivalents (TE)/100 g.

30

3.2.4 GC-MS of Breadfruit Extracts

Breadfruit methanol extracts were analyzed by capillary gas chromatography mass

spectrometry (GC-MS) to identify potential metabolites present in the 4 varieties of

Artocarpus. A 1 µL aliquot of sample was injected (splitless) into an Agilent 7890A GC

(Agilent , Mississauga, ON, Canada) coupled to an Agilent 5975C inert MSD (Agilent) and

equipped with an J&W DB-5ms Ultra Inert capillary column, 20 m x 0.180 mm i.d. with 0.18

µm film (Agilent). The instrument was operating with the following parameters: oven

conditions, initial temperature of 80°C for 1 min, increased by 2°C/min to 114°C, and held

for 1 min., then increased by 0.5°C/min to 118°C and held for 1 min. then increased by

2°C/min to 185°C, then finally increased to 310°C at a rate of 5°C/min and held for 2 min.

(total run time 88.5 min.); initial injection inlet temperature was set at 250°C; under constant

flow at 0.4 ml/min of helium carrier gas; mass spectrometer detector low/high mass ranges

set at 40/550; mass spectrometer ion source temperature set at 280°C; mass spectrometer

source temperature set at 230°C. Identity of compounds was determined/putatively

determined on the basis of their match spectra against the NIST Mass spectral Search

Program for the NIST/EPA/NIH Mass Spectral Library Version 2.0g. build, May 19, 2011

(NIST, Gaithersbury, MD, USA).

3.2.5 5-HT Detection in Breadfruit Extracts by UPLC-MS

A previously optimized method for detection and quantification was used for the

analysis of serotonin (5-HT) (Turi et al., 2014) with minor revision. In brief, a series of

dilutions of each breadfruit methanol extract was made with acidified methanol (80:20

methanol:0.1N trichloroacetic acid). Indoleamines were separated and identified from a 10

µL injection on a reverse phase column (150 x 2.1 mm, 1.7 μm C18 BEH; Waters,

Mississauga, ON) using an Acquity Ultra Performance Liquid Chromatograph (I-Class

UPLC; Waters). A gradient of 0.1% formic acid (Eluent A) and acetonitrile (Eluent B)

[(A%:B%): 0.0 min, 90:10; 0.5 min, 90:10; 3.5 min, 40:60; 4.2 min, 5:95; 6.5 min, 5:95; 7.0

min, 90:10; 10.0 min, 90:10] was used for elution of 5-HT with a flow rate of 0.300 mL/min.

5-HT was detected and quantified with a tandem mass spectrometer (Xevo TQ-S triple

31

quadrupole mass spectrometer, Waters, Mississauga, ON) using the MRM transitions in

Table 3.1. The capillary voltage was 3500 V, desolvation gas rate was 800 L/hr, cone gas rate

was 150 L/hr, desolvation temperature was 550°C and the source temperature was 150°C for

all analyses. The linear range for 5-HT was 25-200 ng/L. The lower limits of detection

(LLOD) and quantification (LLOQ) were 1.56 and 6.25 ng/mL, respectively. 5-HT was

quantified in samples using the 273 m/z daughter ion.

Table 3.1 UPLC-MS transitions and voltages

Cone voltage (V) Collision voltage (V) MRM Transition

5-HT 45 27 177 > 115

5-HT 45 10 177 > 160

3.2.6 Data Analysis and Statistics

Final statistical analysis of all data was performed and final graphical output was

prepared using GraphPad™ Prism v6 for Mac OSX (GraphPad Software Inc., San Diego,

California, USA). DPPH analyzed using One-Way ANOVA with a Tukey’s HSD post-hoc

test (p<0.05). DPPH data was expressed as mean ± standard error of the mean (SEM) with a

p<0.05 considered significant unless corrected for multiple comparisons with a preferred

correction method of Holm-Sidak.

3.3 Results

3.3.1 Antioxidant Activity by DPPH

Radical scavenging activity, as determined through a DPPH assay, differed

significantly between the 3 varieties of Artocarpus methanol extract tested. As shown in

Figure 3.1, Artocarpus camansi (breadnut) exhibited the lowest radical scavenging activity.

In comparison, Artocarpus altilis ulu afa exhibited 41% higher activity relative to Ar.

32

camansi, while Artocarpus altilis Lipet showed 140% higher activity than Artocarpus

camansi, and Artocarpus altilis Lipet was 70% higher activity than Artocarpus altilis ulu afa.

Figure 3.1 Antioxidant activity displayed as μmol trolox equivalents (TE)/100 g in three

varieties of Artocarpus methanol extract. Bars represent mean ± 1 SEM (N=3). Bars with

different letters indicate significantly different antioxidant activity as determined by a one-

way ANOVA with Tukey’s HSD multiple comparisons test.

3.3.2 GC-MS of Breadfruit Extracts

Exploratory GC-MS profiling of the extracts from the 4 varieties of Artocarpus

methanol extracts described previously were performed. Comparisons to the NIST database

of MS data allowed putative identification of a large number of compounds as seen in Table

33

3.3 that include a number of compounds within the triterpenoids, sterols and fatty acids

previously associated with insecticidal or insect repellent activity (Jones et al., 2012).

3.3.3 5-HT Detection in Breadfruit Extracts by UPLC-MS

UPLC-MS analysis was used to determine the presence/quantity of serotonin in three

different breadfruit extracts (Figure 3.2). All 3 extracts contained 5-HT with large ranges in

values with Artocarpus altilis Lipet having the lowest between 91.78 – 872.89 ng 5-HT/g,

and Artocarpus altilis Lipet and Artocarpus camansi having ranges of serotonin between

649.55 – 3250.39 and 541.97 – 3843.32 ng 5-HT/g respectively. A sample gram of UPLC-

MS detection of 5-HT from a breadfruit extract is shown in Figure 3.3.

34

Figure 3.2 Range of 5-HT (serotonin) detected in 3 varieties of Artocarpus extract

determined by UPLC-MS (N=3). Due to large range in data, statistics were not run and data

is shown to be purely representational of range as well as positive 5-HT presence.

35

Figure 3.3 Sample chromatogram of 5-HT (serotonin) detected in 3 varieties of Artocarpus extract determined by UPLC-MS.

Retention time (minutes) for serotonin was the same for all samples and matched serotonin standards. Panels indicate methanol extract

samples from A) Artocarpus altilis ulu afa B) Artocarpus altilis Lipet C) Artocarpus camansi.

36

Table 3.3 GC-MS Profiling Data

A.camansi Lipet ulu afa Mixed

RT (min)

Putative Compound Assignment

% Identity Match

Compound Class/Use

14.0-14.3 Resorcinol 74.4 75.8 52.9 0 Phenol

19.5 3,7-Nonadienoic acid, 4,8-dimethyl-, methyl ester, (E)- 68.4 0 0 0 Fatty acid ester

31.746 Phenol, 5-methoxy-2-(methoxymethyl)- 89.3 0 0 0 Phenol

38.2-38.6 α-Cadinol 0 61.1 67.3 64.7 Sesquiterpenoid alcohol

39.24 Azulene, 1,4-dimethyl-7-(1-methylethyl)-; vetivazulene 0 0 0 52.8 Flavour/perfume, cosmetics

40 Guanine 63.3 0 90 0 Nucleobase

41 Blumenol C; Vomifoliol 0 0 0 68.8 Glycoside often found in mangos and grapes

41.8 Cyclopentaneundecanoic acid, methyl ester 53.3 0 0 0 Fatty acid ester

43.1 Ambucetamide 68.8 51 0 0 Antispasmodic drug…

44.1 Methyl tetradecanoate 69.6 72.9 0 0 Fatty acid ester

0

2-Cyclohexen-1-one, 4-hydroxy-3,5,5-trimethyl-4-(3-

oxo-1-butenyl)- 0 0 0 63.8 (+/-)-6-Hydroxy-3-oxo-alpha-ionone; related to vomifoliol

49.9 Pentadecanoic acid, methyl ester 69.3 73.7 75.8 0 Fatty acid ester

51.5 Pentadecanoic acid 0 0 0 73.2 Fatty acid

53.2-53.9 Hexadecanoic acid, methyl ester 55 0 56.1 0 Fatty acid ester

54.7-55.2 Hexadecanoic acid, methyl ester 81.4 84.8 76 69.5 Fatty acid ester

57.1 n-Hexadecanoic acid 0 0 0 78.8 Fatty acid

60.1 Heptadecanoic acid, methyl ester 72.5 66.2 0 0 Fatty acid ester

63.1 9,12,15-Octadecatrienoic acid, methyl ester, (Z,Z,Z)- 57.4 53.5 0 0 Fatty acid ester

64.3 Methyl stearate 85.4 79.6 81 0 Fatty acid ester

67.8 5,8,11,14-Eicosatetraenoic acid, methyl ester, (all-Z)- 0 53.1 0 0 Fatty acid ester

69.6 Eicosanoic acid, methyl ester 54.4 74.6 63.5 0 Fatty acid ester

70.1 9-Octadecenamide, (Z)-l oleamide 88.6 92.5 87.8 0 Fatty acid amide

72.4

11-(3,4-Dimethyl-5-pentyl-2-furyl)-dodecanoic acid,

methyl ester 91.4 96.8 0 0 Fatty acid ester

73

Hexadecanoic acid, 2-hydroxy-1-(hydroxymethyl)ethyl

ester 0 0 62.3 0 Monoglyceride

73.5 Docosanoic acid, methyl ester 53.3 65.1 0 0 Fatty acid ester

75.1 Tricosanoic acid, methyl ester 77.1 0 0 0 Fatty acid ester

37

Table 3.3 GC-MS Profiling Data

76.7 Tetracosanoic acid, methyl ester 84.6 83.7 0 0 Fatty acid ester

77.8-78 Squalene 53 61.8 0 64.3 Triterpene

80 9(11)-Dehydroergosteryl benzoate 0 62 0 0 Triterpenoid

81.3 Stigmastan-3,5-diene 69.7 0 0 0 Triterpenoid

82.8 Ergosterol 75.5 80.5 83.6 0 Sterol

89.9-83.1 Campesterol 63.8 0 60 58.1 Sterol

83.2-83.4 Stigmasterol 73.8 74.5 73.2 70.4 Sterol

84

4α,14-Dimethyl-5α-ergosta-8,24(28)-dien-3β-ol ;

Obtusifoliol 0 53.2 0 0 Sterol

84.1 Lup-20(29)-en-3-one 0 70.7 71.3 0 Triterpene

84.2 γ-Sitosterol 74.6 74.9 78.1 74.5 Sterol

84.3-84.5 Stigmasta-5,24(28)-dien-3-ol, (3β,24Z)-; Avenasterol 55.6 50.5 57.6 58.7 Sterol

84.7 Ursa-9(11), 12-dien-3-yl acetate 0 0 80.1 77.3 Triterpene ester

85-85.2 9,19-Cyclolanost-24-en-3-ol, (3β)-; Cycloartenol 65.6 0 0 56.1 Sterol

85.3-85.6

Lanosta-8,24-dien-3-ol, acetate, (3β)-; Lanosterol

acetate 73.6 65.1 65.1 57.2 Sterol acetate

85.7-86.3 12-Oleanen-3-yl acetate, (3α)- 70 52.2 66.1 0 Triterpenoid

86.4 9,19-Cyclolanost-24-en-3-ol, acetate 70.8 0 0 0 Sterol acetate

86.6 D:A-Friedooleanan-3-ol, (3α)- 0 64.1 0 0 Triterpenoid

86.7 Friedelan-3-one 81 0 0 0 Triterpenoid

86.8-87 9,19-Cyclolanostan-3-ol, 24-methylene-, acetate, (3β)- 79.5 74.8 76.1 72.2 Sterol

38

3.4 Discussion

3.4.1 DPPH Assay of Extracts

It was determined that the three specific varieties of Artocarpus extract differed

significantly in their levels of radical scavenging activity by DPPH assay with Lipet being

the highest and A. camansi being the lowest. It was hypothesized that radical scavenging

activity and serotonin and melatonin levels may increase in a linear fashion as both these

compounds can act as effective radical scavenging molecules (Gülçin et al., 2002; Gülçin et

al., 2003). This is in part attributed to the phenol ring component of the indole-ring backbone

as well as the hydroxyl on the serotonin (Gülçin, 2007).

Alternatively, Artocarpus extracts that possess more or less free radical activity could

potential disrupt the delicate equilibrium that is established between tryptophan, serotonin

and melatonin and their intermediates, thus significantly altering relative indoleamine levels.

This could be linked to future data regarding other components present in the extract that

may have free radical producing or scavenging activity.

3.4.2 GC-MS Data of Extracts

Exploratory GC-MS profiling of compounds in the 3 varieties of Artocarpus

methanol extract yielded interesting results. The mixed sample was quite different than the

other three extracts, which were all relatively similar in compounds detected. Some of this

difference may be accounted for by the unintentional extra handling and processing by the

addition of an extra drying and resuspension step that the ulu afa, Lipet and A. camansi

samples underwent, whereas the mixed extract was dried and resuspended only once. This

second drying may account for why the mixed sample has an abundance of perfume

compounds (such as azulene and vomifoliol). Azulene is another compound used in the

beauty and cosmetic industry as well as having anti-spasmodic, anti-microbial, and anti-

inflammatory properties (Andersen and Teufel, 1999); USFDA, 1996). Azulene is also a

structural isomer of naphthalene, which is the primary ingredient in mothballs, where

naphthalene vapors can build up and become toxic to both larval and adult forms of many

39

Lepidopterans (Jo and Lee, 2011). The presence of these compounds may offer insight to

explain potential differences in toxicity between the different variety extracts.

Resorcinol (1,3-dihydroxybenzene) is a phenol identified in the three specific variety

extracts (ulu afa, Lipet and A. camansi) but not in the mixed sample. Phenolic compounds

have been shown to possess highly toxic effects to aquatic organisms and many have been

shown to have carcinogenic effects (do Ceu Silva et al., 2003). Resorcinol specifically has

little data related to its toxicology (Kahru et al., 2000). Resorcinol however has been used in

the cosmetic field as both a disinfectant and an exfoliating agent and in acne treatment

(Guedes et al., 2011). Phenol and resorcinol have been shown to display acute toxicity in

brine shrimp larvae (Artemia franciscana) (Guedes et al., 2011).

Fatty acids and fatty acid esters have been linked in previous studies such as Jones et

al. (2012) to biting deterrent effects in adult female mosquitoes such as Aedes aegypti.

Compounds identified in extracts tested for biting deterrent effects included a variety of

terpenes and fatty acids such as pentadecanoic acid and naphthalene related derivatives

(Jones et al. 2012). It is likely that some of these fatty acids could contribute to the innate

ability of breadfruit male inflorescence smoke to deter mosquito biting (Olson, 1991).

A number of triterpenes were also identified by GC-MS, and this offers possibilities to match

to the literature where a tripterpene oleanolic acid derivative was extracted with methanol

from a number of Cucurbitaceae plants (such as Citrullus colocynthis and Coccinia indica)

and showed very effective LC50 values against Culex quinquefasciatus, Aedes aegypti and

Anopheles stephensi (5.6 mg/L, 5.0 mg/L and 4.8 mg/L) (Senthilkumar et al., 2012). Due to

the basic oleanolic acid triterpene backbone being associated with effective larvicidal activity

in mosquitoes, it would be expected that since several of these Artocarpus extracts contain

these compounds, the various variety specific extracts may possess significant larvicidal

activity. It is however possible that these compounds are present in doses capable of

detection and putative identification by GC-MS but not to significantly increase larvicidal

activity of the extracts.

40

3.4.3 UPLC-MS Data of Extracts

Utilization of methanol extracts of Artocarpus tissue was considered to be sub-

optimal for precise quantification of 5-HT. Variations between technical replicates varied

greatly, resulting in 5-HT data being expressed as a range, primarily indicating the presence

of 5-HT to confirm previous unpublished results. In order to achieve a more precise measure

of 5-HT within dried Artocarpus male inflorescence tissue, fresh tissue would be required to

perform a more suitable extraction method to allow better separation and quantification using

UPLC-MS.

3.4.4 Concluding Remarks

In summary, we have further characterized methanol extracts from four varieties of

Artocarpus, Artocarpus altilis ulu afa, Artocarpus altilis Lipet, Artocarpus camansi as well

as a mixed Artocarpus methanol extract. The information determined here can be utilized to

better understand the biological effects of these extracts on mosquitoes, both adults and

larvae. The GC-MS data provides multiple paths for continuing research. The first to

biofractionate and identify individual compounds present in Artocarpus methanol extracts

and start single component analysis with regards to biological effects such as larvicidal

activity. The second to further examine if serotonin and melatonin or associated compounds

are present and in what levels in the extract as well as their effect on biological tissue. Our

data suggests that there are compounds present in methanol extracts of previously established

importance in the literature towards insect-repellent or insecticidal activity.

41

Chapter 4 : Examination of the 5-HT Pathway in Aedes aegypti

4.1 Chapter summary

Insects and other arthropods serve as vectors for 6 of the 17 neglected tropical

diseases, as reported by the World Health Organization (WHO). Mosquitoes such as Aedes

aegypti and Anopheles gambiae are responsible for carrying some of the most economically

damaging diseases including Dengue fever, yellow fever and malaria. It is therefore

imperative that research efforts be funneled into the development of newer and more

effective methods of control of the insect vectors for these diseases. The research contained

herein aims to elucidate a new biological pathway with which to target insecticide or insect

repellent development. Furthermore, by investigating breadfruit (Artocarpus altilis) and its

closely associated varieties, this research explores the possibility of isolating secondary

products from breadfruit with insecticidal or insect repellent properties for commercial

production.

The objective of this investigation was to determine whether the chemical extracts of

breadfruit male inflorescences have a physiological effect on specific tissues of both larval

and adult Aedes aegypti. It was determined that the methanol extract of a mixed variety

sample of Artocarpus held more insecticidal activity in larvae water-borne assays than the

single varieties studied here. It was determined that the majority of these extracts resulted in

a decreased concentration of serotonin in the haemolymph of 4th instar Aedes aegypti larvae.

These extracts caused little change on the 5-HT synthetic pathway gene transcription in

larval head samples.

After blood feeding, adult tissues showed the most significant changes in gene

expression in the midgut, but surprisingly not the Malpighian tubules, even though serotonin

is well described to interact with the tubules in blood feeding insects.

42

4.2 Materials and Methods

4.2.1 Insect Rearing

Rearing of Aedes aegypti larvae and adults was as described in section 2.1.1.


Plant tissue collect was as described in section 3.2.1.


Methanol extractions for the insect larvicidal bioassay was as described in section

3.2.2.

4.2.4 Larvicidal Activity of Breadfruit Methanol Extracts

One milliliter of the methanol/extract mixture was added to 100 mL polyethylene

beakers containing 24 mL of ultra-pure water. The final concentration of methanol in all

samples was 4%. A minimum of six concentrations was used for final analysis. All four

varieties of breadfruit extract were tested. Solutions were stirred with a glass rod and twenty

4th instar larvae were added to each polyethylene beaker containing 25 mL of exposure fluid.

Both female and male 4th instars were used for larvicidal experiments. Beakers were loosely

covered with plastic wrap and mortality was assessed after 24 hours. Mortality was assessed

by a complete lack of motile response to touching with a glass probe. Five replicates were

used for each experiment. Negative controls contained 25 mL ultrapure water or 24 mL

ultrapure water and 1 mL methanol.

43

4.2.5 Quantification of 5-HT in Larval Haemolymph after Breadfruit Exposure by

UPLC-MS

Haemolymph was collected from 4th instar larval Aedes aegypti after exposure to all 4

breadfruit extracts as well as from control exposed larvae (4% methanol). Aedes aegypti

larvae were blotted on VWR Light-Duty Tissue Wipers (VWR International, Radnor, PA,

USA) and then placed under mineral oil and the head was removed with fine forceps. The

resulting aqueous bubble of haemolymph was collected and pooled with other larvae until at

least 0.5 μL was present. 0.5 μL of haemolymph was then pipetted into a clean PCR tube and

capped and immediately flash frozen in liquid nitrogen. Five biological replicates were

collected for each of the four breadfruit extract exposures and one control exposure (4%

methanol). Frozen haemolymph samples were transferred to the -80°C for storage until

analysis. At each step, care was taken to minimize the exposure of haemolymph samples to

the presence of light to prevent degradation of indoleamines prior to analysis.

A previously optimized LC-MS method was used for the analysis of 5-HT and

melatonin (Turi et al., 2014) with minor modifications. A 5 µL injection was made on a

reverse phase column (30 x 3.0 mm, 2.6 μm C18 Kinetex; Phenomenex, Torrance, CA) using

the same instrumentation previously described (see section 3.2.5). The linear range for 5-HT

and MEL was 25-200 ng/L. The lower limits of detection (LLOD) and quantification

(LLOQ) for 5-HT were both 1.57 ng/mL, respectively. The lower limits of detection (LLOD)

and quantification (LLOQ) for MEL were 0.89 and 3.55 ng/mL, respectively. 5-HT was

quantified in samples using the 273 m/z daughter ion. MEL was quantified in samples using

the 159 m/z daughter ion.

Table 4.1 UPLC-MS transitions and voltages

Cone voltage (V) Collision voltage (V) MRM Transition

5-HT 45 27 177 > 115

5-HT 45 10 177 > 160

MEL 30 23 233 > 159

MEL 30 15 233 > 174

44

4.2.6 Real-time PCR Gene Expression of 5-HT Pathway

4.2.6.1 Larval Tissue Collection after Breadfruit Extract Exposure

Fourth instar larvae were exposed to concentrations of methanol Artocarpus extract at

concentrations of approximately 24-hour LC25 for all four Artocarpus extract varieties.

Tissues were collected from 4th instar larval Aedes aegypti following exposure to Artocarpus

methanol extract for 24 hours. For each exposure, three biological samples, each consisting

of 25 heads were isolated in liquid nitrogen in a 1.5 mL tube and then stored at -80°C.

Extract exposure concentrations chosen for qPCR analysis were the highest possible dosage

before reaching 25% mortality as at least 75 larvae were needed. These concentrations were

128.2 mg/L Artocarpus altilis ulu afa, 195.2 mg/L for Artocarpus altilis Lipet, 127.9 mg/L

for Artocarpus camansi (breadnut) and 162.6 mg/L for the mixed sample.

4.2.6.2 Adult Tissue Collection after Blood/Sugar Feeding

5-15 day old female mosquitoes were fed either a 10% (w/v) sugar solution or sheep

(Ovis aries) blood (Cedarlane Laboratories, Burlington, Ontario, Canada; CL2581), both

heated in a jacketed glass beaker with 37°C water. Mosquitoes were allowed to feed for 20

minutes. Mosquitoes were removed at 3 hours, 12 hours and 24 hours post blood feeding and

sacrificed by freezing at -20°C for 30 minutes before beginning dissection and isolation of

tissues. Only adult female mosquitoes that had clearly fed were used for tissue dissection and

collection (see Figure 4.1). Dissections were performed in Aedes aegypti saline that consisted

of 2.25 g NaCl, 0.246 g KCl, 0.809 g CaCl2, 0.0842 g MgSO4, 0.645 g Arginine, 2.072 g

Leucine, 0.633 g Proline, 1.49 g Histidine and 6.553 g HEPES in 1 L DEPC-treated Milli-

Q® water. For each exposure, three biological samples, each consisting of a pool of 5 whole

bodies, 25 heads, 50 midguts, or 250 Malpighian tubules were isolated in liquid nitrogen in a

1.5 mL tube and then stored at -80°C (Clark and Bradley, 1997; Rheault et al., 2006).

45

Figure 4.1 Representative image of a 3-hour blood fed female adult Aedes aegypti (A), 3-

hour sugar fed female adult Aedes aegypti (B), and an unfed female adult Aedes aegypti (C).

4.2.6.3 mRNA Extraction from Aedes aegypti tissues

Total RNA was extracted using the BioRad Aurum Total RNA mini Kit as per

instructions for spin columns with animal tissues (BioRad, Hercules, California, USA). Each

sample was ground with an RNA free pestle before adding 700 μL lysis buffer and

homogenized using a roto-stat homogenizer (Polytron 1200 E, Kinematica, Bohemia, New

York, USA). Samples were then spun at 13000 g for 3 minutes at 4°C. The lysate was then

46

added to 700 μL of 60% ethanol and mixed. The solution was then added onto a RNA

binding column and spun at 13000 g for 60 seconds at 4°C. The RNA binding column was

then washed with 700 μL of low stringency wash solution and spun at 13000 g for 30

seconds at 4°C. 80 μL DNAse was then added to each column and incubated at room

temperature for 25 minutes. The RNA binding column was then washed with 700 μL of high

stringency wash solution and spun at 13000 g for 30 seconds at 4°C. The RNA binding

column was then washed with 700 μL of low stringency wash solution and spun at 13000 g

for 30 seconds at 4°C. The RNA binding column was then dried by spinning at 13000 g for 2

minutes at 4°C. Total RNA was then eluted off the column by adding 40 μL of elution

solution preheated to 70°C and incubated on the column for 60 seconds. RNA was eluted

into a fresh 1.5 mL tube by spinning at 13000 g for 2 minutes at 4°C. RNA purity and

quantity was assessed using a Biophotometer Plus with Hellma® TrayCell (Eppendorf,

Hamburg, Germany) and RNA integrity was verified using electrophoresis on a 1% non

denaturing agarose gel stained with SYBR® Safe (Invitrogen). Isolated total RNA was

stored at -80°C until further use.

4.2.6.4 cDNA Synthesis

Samples containing 1 μg of total RNA with an optical density (OD) absorption ratio

(OD260 nm/OD280 nm) between 1.5 and 2.5 were selected to synthesize cDNA using

iScript™ cDNA synthesis kit (Bio-Rad, Mississauga, ON, Canada). cDNA was stored at -

20°C for subsequent analysis. cDNA was diluted 20-fold in ultra-pure water prior to use for

qPCR analysis.

4.2.6.5 Primer Design

Gene candidates for serotonin pathway genes were identified in the Aedes aegypti

genome by querying the NCBI database based on identified 5-HT pathway enzymes present

in the fellow Dipteran Drosophila melanogaster and orthologues in humans. Primers were

designed using Geneious R7 (BioMatters, Auckland, New Zealand) to span intron/exon

junctions. Reverse transcription polymerase chain reaction (RT-PCR) was used to confirm

47

correct amplicon size and specificity. In addition, a BLAST search of the primers was

performed to ensure specific binding. Primers for the reference genes actin (actin), 60S

ribosomal protein L24 (60Srpl24) and RPS6 (AaegRPS6) were obtained from previously

published data (Marusalin et al., 2012; Figueira-Mansur et al., 2013). Primer sequences,

amplicon lengths and gene accession numbers are listed in Table 4.2. It should be noted that

for the serotonin-N-acetyltransferase (SNAT) genes that there were three putative genes

identified in the Aedes genome which share no more than 25% amino acid sequence identity

to each other. In order to test all three putative genes, rrimers were designed for all 3 variants.

48

Table 4.2 qPCR primer sequences for 5-HT pathway genes and reference genes for Aedes aegypti

Gene Name Forward Primer

(5’->3’) Reverse Primer

(5’->3’) Forward

Primer Size (bp)

Reverse Primer Size

(bp) Forward Primer Sequence Reverse Primer Sequence Amplicon Size (bp) Accession Number Source

TRH aaTPHqF1045 aaTPHqR1140 20 20 ATGTACGGAAGGCAGGATTC GCTGACATTCTTCGCTTCGG 95 XM_011495372

(NCBI) custom

AAADC aaAAADCqF326 aaAAADCqR444 20 20 AGCGTACCCAGGAAGAACAC AACTCCTCCAAGCAAACCTG 118 XM_001648214

(NCBI) custom

SNAT288 aaSNAT288qF215 aaSNAT288qR340 22 23 ATGAGGTTGACACGAACATTTC ACTCTCCTAGGTTGACAAAAGTG 125 XM_001661350

(NCBI) custom

SNAT222 aaSNAT222qF372 aaSNAT222qR485 23 21 GTTCGATGTGGACAAAATTTTCG CGATCCAAAGCAAGTTCTTCG 113 XM_001663072

(NCBI) custom

SNAT220 aaSNAT220qF388 aaSNAT220qR487 19 20 CACTTGCACTTCTTGGCGG TCGTTCCACATTTCACAGCG 99 XM_001661123

(NCBI) custom

ASMT aaASMT404qF aaASMT503qR 20 20 TGAAGTTCACAGAAGCTTGC CCACCGGCCTTATCTAATGG 99 XM_001660361

(NCBI) custom

Actin aaactinqF1 aaactinqR1 20 20 TCCCATACCGTCCCAATCTA TCTCCTTGATGTCACGAACG 166 XM_0016590

(NCBI) Marusalin et al.

2012

RPL24 aarpl24qF1 aarpl24qR1 19 18 AATGAAGATCGGCCTTTGC AGGACGGTCCACTTCACC 162 AAEL01951

(Vectorbase) Marusalin et al.

2012

RPS6 AaegRPS6-F AaegRPS6-R 23 20 TAAAATGAAGTTGAACGTATCGT AGATGGTCAGCGGTGATTTC 126 XM_001647882

(NCBI) Figueira-Mansur

et al. 2013

49

4.2.6.6 Quantitative Real Time PCR

Quantitative real-time PCR (qPCR) was performed to assess the relative expression

of putative 5-HT pathway enzyme gene mRNA within the whole body, head, midgut and

Malpighian tubules in A. aegypti larvae. Primer efficiencies were calculated using six, 5-fold

serial dilutions of whole body cDNA to create a standard curve of relative fluorescence.

Efficiencies, R2 values, slopes and y-intercepts of the standard curves were calculated by

CFX96™ Manager Software (Bio-Rad). Optimum primer annealing temperatures were

determined by a thermal gradient that was used to choose a single annealing temperature that

was used in all further analysis. Each reaction was performed in two technical replicates and

no template and no reverse transcription controls were included for each primer. Inter run

calibrators for each primer set (Hellemans et al., 2007), using 3 hour sugar fed whole body

cDNA as a template, were performed on each experimental plate (Vermeulen et al., 2009) to

account for instrument variation. Each 20 μL reaction contained 10 μL SsoFast™

EvaGreen®Supermix (Bio-Rad), 2 μL of 1:20 dilution of cDNA template that was

synthesized from 1 μg of RNA, and 500 nmol l-1 each of forward and reverse primer in

nuclease free water. Reactions were performed using the CFX96™ Real-Time Detection

system (Bio-Rad) on a C1000™ Thermal Cycler (Bio-Rad) at the following cycling

conditions: 30 s enzyme activation step at 95°C, followed by 39 cycles of 5 s denaturing at

95°C and 5 s annealing/extension at 57°C (determined by thermal gradient to be optimal for

all primer sets). Following 40 cycles for amplification, a melt curve analysis was conducted

to confirm the presence of a single specific amplicon in the absence of non specific products

by incrementally increasing the block temperature from 65-95°C in steps of 0.5°C for 5 s

after an initial denaturing at 95°C for 10 s. mRNA expression was normalized to 2 reference

genes, Actin and 60Srpl24; whose coefficients of variance (CV) (synonymous with % RSD)

and M values (the difference of reference gene expression between samples) of which were

found to be within the acceptable range for heterogeneous samples (Hellemans et al., 2007).

Parameters of stability (CV and M value) were calculated using BioRad CFX Manager

Software (BioRad, Hercules, California, USA) through a Target Stability Analysis. Results

of these analyses indicated the two most stable reference genes that yielded a mean CV < 0.5

50

and a mean M < 1.0. Normalized expression values were calculated using CFX96™

Manager Software (Bio-Rad), which uses the geometric mean of the relative quantities of the

reference genes to derive a normalization factor that was then applied to the genes of interest

(Hellemans et al., 2007).

4.2.7 Data Analysis and Statistics

When possible LC50 and LC90 values were calculated by Probit analysis using IBM

SPSS Statistics (International Business Machines Corps, Armonk, New York, USA). UPLC-

MS analysis of serotonin and melatonin larval haemolymph after exposure to breadfruit

methanol extracts was analyzed using One-Way ANOVA with a Dunnett’s post hoc test and

corrected for multiple comparisons. Larval head qPCR mRNA expression data was analyzed

using One-Way ANOVA with a Dunnett’s post hoc test and corrected for multiple

comparisons. Adult whole body, head, midgut and Malpighian tubule mRNA expression data

was analyzed using a Two-Way ANOVA with a Holm-Sidak multiple comparisons post hoc

test. To determine if differences in gene expression were significantly different, two

successive criteria had to be met. First, relative fold differences between mean expression

values had to have greater than a 2-fold change (Bubner et al., 2004). Second, fold

differences in expression had to be determined to be mathematically significant by the

applied statistical test. Final statistical analysis of mRNA expression and UPLC-MS data

was performed and final graphical output was prepared using GraphPad™ Prism v6 for Mac

OSX (GraphPad Software Inc., San Diego, California, USA). All data was expressed as mean

± standard error of the mean (SEM).

4.3 Results

4.3.1 Larvicidal Toxicity of Breadfruit Extracts

LC50 values for ulu afa, Lipet and A. camansi were unable to be determined as a result

of a limited quantity of male inflorescence. However, dose dependent responses were seen up

51

to a maximum of 22.0%, 25.0% and 31.0% mortality at the maximum concentrations tested

of 513 mg/L, 1562 mg/L, and 1023 mg/L for ulu afa, Lipet and A. camansi, respectively.

For the mixed variety sample, where there were not limited quantities of extract, an

LC50 of 652 mg/L (95% Confidence Interval: 557 – 771 mg/L) and an LC90 of 3950 mg/L

(95% Confidence Interval: 2957 – 5705 mg/L).

4.3.2 Serotonin Quantification in Larval Haemolymph after Breadfruit Extract

Exposure

After extraction of haemolymph from 4th instar Aedes aegypti larvae after a 24 hour

exposure to three known Artocarpus methanol extracts and a mixed sample, serotonin and

melatonin concentrations could be determined by UPLC-MS analysis (Figure 4.2). Serotonin

in the control treatment of 4% methanol had serotonin concentrations of 116.4 pg/L. The

larval haemolymph did not change significantly when larvae were exposed to Artocarpus

altilis Lipet extracts but decreased significantly when exposed to Artocarpus altilis ulu afa,

Artocarpus camansi, and the mixed Artocarpus sample by 2.7, 4.0 and 2.7 fold, respectively.

Melatonin was detected in control at 1.47 fg/L, with no significant change after exposure to

any Artocarpus extract. A sample chromatogram of UPLC-MS detection of 5-HT from a

breadfruit extract is shown in Figure 4.3.

52

Figure 4.2 Serotonin (A) and melatonin (B) (pg/L) in the haemolymph of 4th instar larval

Aedes aegypti after exposure to 4 different Artocarpus methanol extracts (black) compared to

a 4% methanol control (white). Bars represent mean ± 1 SEM (N=5). Bars with asterisks (*)

indicate significantly different gene expression from control (One-Way ANOVA with

Dunnett’s multiple comparisons test).

53

Figure 4.3 Sample chromatogram of 5-HT (Serotonin) detected in haemolymph of 4th instar Aedes aegypti after exposure to 4

varieties of Artocarpus extract determined by UPLC-MS (N=5). Retention time (minutes) for serotonin was the same for all samples

and matched serotonin standards. Panels indicate haemolymph samples from larvae exposed to A) 4% methanol B) mixed Artocarpus

extract C) Artocarpus altilis Lipet extract D) Artocarpus camansi extract E) Artocarpus altilis ulu afa extract.

54

4.3.3 mRNA Extraction

A demonstration of RNA extraction yields, 260/280 and 260/230 ratios for the whole

body adult female blood fed/sugar fed samples used for gene expression analysis of 5-HT

pathway genes is shown in Table 4.3.

55

Table 4.3 RNA extraction yields, 260/280 and 260/230 ratios for female adult whole body

RNA samples

Sample Name Concentration (ng/μL) 260/280 260/230

3hrBF WB1 174.90 2.27 2.38

3hrBF WB2 127.20 2.39 N/A

3hrBF WB3 211.30 2.18 2.62

3hrSF WB1 207.50 2.15 2.20

3hrSF WB2 88.50 2.40 2.37

3hrSF WB3 349.10 2.13 1.80

12hrBF WB1 328.00 2.18 2.18

12hrBF WB2 294.60 2.15 2.04

12hrBF WB3 177.00 2.27 1.70

12hrSF WB1 95.00 2.13 1.65

12hrSF WB2 162.30 2.07 1.62

12hrSF WB3 199.40 2.10 1.88

24hrBF WB1 323.20 2.30 2.40

24hrBF WB2 384.90 2.21 2.01

24hrBF WB3 342.40 2.24 2.28

24hrSF WB1 101.10 2.00 1.78

24hrSF WB2 89.50 1.82 1.44

24hrSF WB3 163.80 1.99 1.67

Abbreviations: SF: sugar fed BF: blood fed 3h, 12h, 24h indicate hours post sugar/blood feeding

An example of the RNA agarose gel results indicating presence of single 18s and 28s

bands and lack of degraded RNA is displayed in Figure 4.3. Invertebrate 28s ribosomal

subunit RNA contains a cryptic nick that results in cleavage of the 28s subunit and therefore

this band may be absent when visualized through agarose gel electrophoresis. Note the

presence of a single 18s/28s rRNA band at approximately 1 kb. This is due to the presence of

56

a “cryptic nick” in insect rRNA, where hydrogen bonds connecting two fragments of the 28s

rRNA are denatured and split, leaving two individual fragments that migrate through an

agarose gel at approximately the same rate as the 18s rRNA.

Figure 4.4 Representative 1% agarose non-denatured RNA gel with 3 hour blood fed

and 3 hour sugar fed Female adult head mRNA. Lanes contain the following: 1: 5 μL

Quick-Load® 100 bp DNA ladder (New England BioLabs), 2-7: 1 μL RNA, 4 μL ultra-pure

water, 1 μL 6x Blue Gel Loading Dye (New England BioLabs), 8: 5 μL Quick-Load® 1kb

DNA ladder (New England BioLabs).

4.3.4 Primer Design

Efficiencies, R2 values, slopes and y-intercepts of the standard curves were calculated

by CFX96™ Manager Software (Bio-Rad) and are presented in Table 4.4.

57

Table 4.4 qPCR primer efficiencies, R2, slope values and intercepts for Aedes aegypti 5-HT

pathway genes and reference genes

Gene Name Forward Primer Reverse Primer Efficiency (%) Slope Y Intercept R2

TRH aaTPHqF1045 aaTPHqR1140 100.9 % -3.301 18.964 0.988

AAADC aaAAADCqF326 aaAAADCqR444 108.7 % -3.129 21.825 0.989

SNAT288 aaSNAT288qF215 aaSNAT288qR340 103.1 % -3.250 22.070 0.989



ASMT aaASMT404qF aaASMT503qR 101.7 % -3.282 22.174 0.995

Actin aaactinqF1 aaactinqR1 106.5 % -3.167 15.748 0.997

RPL24 aarpl24qF1 aarpl24qR1 100.0 % -3.321 13.812 0.999

RPS6 AaegRPS6-F AaegRPS6-R 106.3 % -3.180 15.676 0.990

58

4.3.5 qPCR Reference Gene Stability Analysis

Stability analyses of reference genes used in all gene studies are presented in Tables

4.5, 4.6 and 4.7.

Table 4.5 Stability analysis results of reference genes in breadfruit extract exposed 4th instar

larval head gene study

Gene Coefficient of Variance M Value

Rpl24 0.1179 0.3179

RPS6 0.1028 0.3179

Mean 0.1104 0.3179

Table 4.6 Stability analysis sesults of reference genes in adult blood fed/sugar fed whole

body, midgut and Malpighian tubule gene study


Rpl24 0.3379 0.9617

RPS6 0.3594 0.9617

Mean 0.3486 0.9617

59

Table 4.7 Stability analysis results of reference genes in adult blood fed/sugar fed head gene

study


Rpl24 0.4569 2.6369

RPS6 1.5155 2.6369

Mean 0.9862 2.6369

60

4.3.6 Quantitative Real Time PCR of Larval Heads after Breadfruit Extract

Exposure

After exposure to four different varieties of breadfruit methanol extract for 24 hours,

there was no significant change in expression in TRH, AAADC, SNAT288, SNAT220, and

ASMT in larval heads relative to control (4% methanol). Whereas SNAT222 expression was

2.0 fold and 4.0 fold lower than control in Artocarpus camansi exposed and mixed

Artocarpus exposed larval heads, respectively.

61


SNAT222 (D), SNAT220 (E) and ASMT (F) in the head of 4th instar larval Aedes aegypti

after exposure to 4 different Artocarpus methanol extracts (black) compared to a 4%

methanol control (white). Bars represent mean ± 1 SEM (N=3). Bars with asterisks (*)

indicate significantly different gene expression from control (One-Way ANOVA with

Dunnett’s multiple comparisons test).

62

4.3.7 Quantitative Real Time PCR of Adult Whole Body, Midgut and Malpighian

Tubules after 3 h, 12 h and 24 h post blood feeding

TRH in the whole body does not significantly change at any time point after sugar

feeding. After blood feeding, TRH expression was 5.6 fold higher at 3 hours and 4.2 fold at

24 hours. Blood fed TRH increased 65% from 3 to 24 hours. AAADC also showed no

difference in expression at any time after sugar feeding. AAADC increased at 12 and 24

hours post blood feeding by 4.6 and 5.6 fold higher than 3 hours post blood feeding. Like the

previous genes, SNAT288 also showed no change in transcript levels at any time after sugar

feeding. Blood feeding however increased 3.3 fold from 3 to 12 hours and then dropped back

down at 24 hours post feeding. Transcript levels of both SNAT222 and SNAT220 were

unaffected by blood feeding but were higher at 3 hours post feeding than either 12 or 24

hours. ASMT transcript showed a similar trend to SNAT222 and SNAT220 with higher

expression at 3 hours than 12 and 24 hours.

63


SNAT222 (D), SNAT220 (E) and ASMT (F) in the whole body of female adult Aedes

aegypti after 3h, 12h, and 24h post blood feeding (black) and sugar feeding (white). Bars

represent mean ± 1 SEM (N=3). Bars within the same time period or within the same feeding

treatment with different letters indicate significantly different gene expression (Two-Way

ANOVA with Holm-Sidak multiple comparisons test).

64

TRH did not change over time in either blood fed or sugar fed midguts. At 12 hours

however, blood fed TRH levels were 14.1 fold higher than sugar fed, with no significant

different at 3 or 24 hours. There was no significant difference in expression of AAADC,

SNAT222 and SNAT220 at any time with sugar or blood feeding. SNAT288 was 5.6 fold

higher at 3 hours, 5.2 fold higher at 12 hours in blood fed midguts than sugar fed midguts

with no different at 24 hours. ASMT expression was only different between blood and sugar

fed midguts at 3 hours with 12.1 fold higher expression. Expression of ASMT dropped at 12

and 24 hours to no difference between blood and sugar fed.

65


SNAT222 (D), SNAT220 (E) and ASMT (F) in the midgut of female adult Aedes aegypti

after 3h, 12h, and 24h post blood feeding (black) and sugar feeding (white). Bars




66

There was no significant difference in expression in TRH, AAADC, SNAT288 and

ASMT at any time point after sugar feeding or blood feeding. With SNAT222 expression,

there was no change in sugar fed expression or in blood fed expression over time but at 3 h,

12 h and 24 h sugar fed was always significantly higher than blood fed. SNAT220 expression

after sugar feeding decreased from 3 to 24 hours by 2.5 fold.

67


SNAT222 (D), SNAT220 (E) and ASMT (F) in the Malpighian tubule of female adult

Aedes aegypti after 3h, 12h, and 24h post blood feeding (black) and sugar feeding

(white). Bars represent mean ± 1 SEM (N=3). Bars within the same time period or within the

same feeding treatment with different letters indicate significantly different gene expression

(Two-Way ANOVA with Holm-Sidak multiple comparisons test).

68

4.3.8 Quantitative Real Time PCR of Heads of Adults after 3h, 12h and 24h post

blood feeding

There were no significant changes in the head of adult female gene expression across

time after blood or sugar feeding or between sugar and blood fed treatment groups for

AAADC, SNAT222, SNAT220 or ASMT. There was however an effect on TRH where the

24-hour post blood feeding expression levels were significantly higher by 3.5 fold however

there was no significant difference between either 3 hour and 12 hour post blood feeding or

12 hour and 24 hour post blood feeding. There was no significant change in TRH expression

across any time point when female mosquitoes were fed sugar water. SNAT288 expression

also changed in response to blood feeding with transcripts levels being 3.1 fold higher in

blood fed than sugar fed female heads. Expression of SNAT288 was also higher at 3 hours

post blood feeding than 12 and 24 hours post feeding by 4.0 and 4.9 fold respectively.

69


SNAT222 (D), SNAT220 (E) and ASMT (F) in the head of female adult Aedes aegypti

after 3h, 12h, and 24h post blood feeding (black) and sugar feeding (white). Bars




70

4.4 Discussion

4.4.1 Insecticidal Activity of Breadfruit Extract Varieties

Between the four samples of Artocarpus extracts tested, it was determined that the

mixed sample was considered to be the most potent as a waterborne insecticide. However, in

order to truly assess the potential of these extracts as an insecticide, drastically larger

quantities of extract would need to be acquired for future studies as well as improved

methods for collecting, extracting and storing extracts to increase accuracy of

experimentation. The 24 hr LC50 value obtained here for the mixed sample after methanol

extraction not only agrees with the 24 hr LC50 value (Ch.2 LC50 = 752 mg/L, Ch.4 LC50 =

652 mg/L) determined during earlier in Chapter 2 but also increases the precision of the LC50

and LC90 model for better comparison to literature data (Ch.2 Confidence Range = 641-906

mg/L, Ch.4 Confidence Range = 557-771 mg/L).

4.4.2 5-HT and Melatonin in Haemolymph after Breadfruit Extract Variety Specific

Exposure

The results from the breadfruit exposure on 5-HT and melatonin in the haemolymph

of larvae were unexpected. We hypothesized that there would likely be an increase in 5-HT

and/or melatonin after exposure due to previous results indicating that 5-HT was high in

Artocarpus altilis. Instead, Artocarpus altilis ulu afa, Artocarpus camansi and the

unidentified mixed Artocarpus extract all caused a significant decrease in serotonin but no

change in melatonin was detected. We expect that this is a compound other than serotonin in

the extract having a direct effect on reducing serotonin by potentially either degrading

serotonin back to one of its precursors, 5-hydroxytryptophan or tryptophan, or stimulating

some biological mechanism with larval Aedes aegypti tissues to reduce 5-HT content such as

increasing excretion and removal of serotonin. As the quantitative real time PCR results

suggest that there is little transcriptional regulatory effect on the pathway, it is most likely

that the serotonin is excreted rather than metabolized. Due to serotonin’s small molecular

weight (172 g/mol) and monovalent positive charge at physiological pH, serotonin would

71

likely be categorized as a Type I organic cation. This would indicate that serotonin would

likely be transported through the same organic cation transporters (ORCTs) as drugs such as

tetraethylammonium (TEA), cimetidine, etc. Future studies could also examine if the effect

of breadfruit extract exposure on mosquito tissues alters organic cation transporter activity at

the protein level or at the transcriptional regulation level.

Also of note was that the concentration of serotonin in the haemolymph determined

for control 4th instar larvae in this study differs from previous reported values (Clark and

Bradley, 1987). Few studies have directly tried to quantify serotonin within haemolymph,

with most studies creating saline artificially altered concentrations of serotonin in order to

determine direct effect of Malpighian tubule secretion rate via a Ramsay assay. Clark and

Bradley saw that the threshold concentration to significantly increase tubule secretion rate in

Ramsay assays was 10 nmol/L 5-HT and that the tubule’s 5-HT mediated secretion increase

was saturated at 10 μmol/L (1995). Clark and Bradley’s study on larval 5-HT activity in

higher salinity water is the only study that has ever directly quantified the concentration of 5-

HT in Aedes aegypti larvae (1997). They determined a 5-HT concentration under control

conditions to be approximately 50 nmol/L by HPLC. Whereas our UPLC-MS technique with

a value of approximately 0.59 pmol/L, indicating a discrepancy between the value Clark and

Bradley determined and the value determined here by nearly 10000 fold.

4.4.3 Effect of Breadfruit Extract Exposure on 5-HT Pathway Gene Regulation

It was noted that there was little to no difference in expression between a control

methanol exposure and the 4 varieties of Artocarpus extract tested. The only significant

differences were in SNAT222, with decreased transcript levels in Artocarpus camansi and

the mixed Artocarpus extract. Two possible conclusions may be drawn from this result:

either that the extract concentrations in order to cause significant shifts in this gene pathway

expression are simply higher than possible within this experiment or the second, and more

likely, that there is simply little effect on the 5-HT pathway by the chemical components

within these methanol extracts of Artocarpus. This is interesting due to the result seen above

where serotonin values in larval haemolymph decreased in the majority of Artocarpus extract

variety exposures.

72

4.4.4 Effect of Adult Blood/Sugar Feeding on 5-HT Pathway Gene Regulation

Upon initial examination of the whole body, midgut and Malpighian tubule, large

relative differences on the effect of feeding on the 5-HT pathway genes were identified. The

whole body showed significant changes in gene expression between blood and sugar fed

conditions but for each gene this changed primarily between 3 hours and 12 hours post

feeding, wth 24 hours post feeding rarely causing a change. This is likely due to the time it

takes a female to process a blood meal, with the 3 hour and 12 hour post feeding representing

time points where the female is still processing the blood meal whereas by 24 hours, the

majority of the meal has likely been processed.

The midgut however showed a more consistent change primarily at 3 hours between

blood fed and sugar fed conditions, whereas the Malpighian tubule showed relatively little

difference across time or feeding treatment. As both the midgut and Malpighian tubules act

as sites for detoxification and digestion, and osmoregulation respectively, with serotonin

playing a role on both tissues, this was surprising. Based on viewing of the female mosquito

midgut under a light microscope, it can be clearly seen that the midgut is surrounded by

neurons responsible for innervating the gut. It was initially believed that these neurons

associated with the midgut but absent with the Malpighian tubules were primarily responsible

for the difference in changes in 5-HT pathway gene expression between the midgut and

Malpighian tubules. The head was then processed for gene expression analysis in order to

examine nervous tissue more directly for changes in 5-HT pathway gene regulation. As noted

above, there was little to no difference present in the head across both treatment groups and

time points as well.

This leads to an interesting result as two possibilities can be proposed: the first that

the neurons present that are associated with the midgut have a different or addition role(s) on

5-HT pathway regulation and therefore 5-HT and melatonin metabolism, or the second, that

the neurons are in fact not involved in transcriptional regulation of 5-HT and melatonin

metabolism and the midgut cells themselves are at least partially responsible for this

regulation. These possibilities introduce new research directions to continue forward with

73

investigation of the 5-HT and melatonin pathway and its control by feeding. It would not be

possible to collect the midgut-associated neurons directly due to their small size and inability

to isolate this tissue from associated midgut tissue in the required quantities to achieve

sufficient RNA extraction and test for transcriptional regulation of these pathway genes.

It is to be noted that the heads of Aedes aegypti were considered to be less than

optimal for examination of CNS tissue directly. This is due to the fact that there is a

noticeable discoloration present from the eye pigment that is carried through the RNA

extraction process and carried into the subsequent cDNA RT-PCR and final qPCR reactions.

Boncristiani et al. noticed the presence of PCR inhibitors in the compound eyes of the

honeybee Apis mellifera (2011); they found it was possible to remove this contamination

with the use of an RNA clean-and-concentrate kit manufactured by Qiagen. When the same

procedure was applied on the Aedes aegypti female head RNA samples the contaminating

presence was still present. In future studies, to obtain a truly more accurate result, the brain

itself would need to be isolated without the presence of the eye tissue and related pigment

during the RNA extraction process to avoid the presence of mature eye pigments leading to

downstream contamination.

4.4.5 Concluding Remarks

In summary, we have contributed to the overall knowledge base surrounding the

potential use for serotonin and other biogenic amines and their associated biological response

pathways as targets for insecticidal development. We have confirmed our previous results

that a methanol extract of Artocarpus is indeed toxic but have yet to elucidate the exact

compound, or number of compounds, that contributes to this toxicity. It was shown that

Artocarpus extracts significantly reduce the serotonin in larval haemolymph, leading to

potential disruption of its wide variety of downstream roles. Interestingly however, there was

little effect of Artocarpus extracts on the mRNA transcript levels of the genes responsible for

the flux between tryptophan, serotonin and melatonin in larvae. This however does not

eliminate the possibility that the 5-HT pathway is regulated at the protein level. qPCR only

determines changes in transcriptional regulation. In order to assess the effects of breadfruit

extracts on protein expression it would be necessary to perform Western blot experiments to

74

determine effcts on protein expression. In addition experiments examining the activity of

functionally isolated protein could also be performed.

In the adults however, it was shown that the Malpighian tubules, a major site within

blood feeding insects due to its role in post-prandial diuresis have no change in the 5-HT

pathway transcription. Our data suggests that the change is likely associated with either the

midgut tissue itself, or is caused by associated neuronal tissue that lies alongside and

innervates the gut.

75

Chapter 5 : Conclusion

This research was designed to explore a new avenue of research, the potential for

plant sourced biogenic amines, serotonin and melatonin to be utilized as insecticidal or insect

repellent agents against the blood feeding disease vector Aedes aegypti. We attempted to

partially elucidate the mechanism of action of the traditional cultural use of the smoke from

the male inflorescence of breadfruit (Artocarpus altilis) as an adult mosquito repellent. This

research could potentially lead to the development of a novel secondary product from

breadfruit growth across the world in areas where insect borne diseases are most prevalent

and overlap heavily with world hunger.

The neuromodulating biogenic amines serotonin and melatonin were chosen due to

their frequent presence in many plant species such as breadfruit, but also because these

compounds, specifically serotonin, play a very special role in blood feeding insect

physiology. Serotonin acts as a second diuretic hormone in blood feeding insect disease

vectors such as Rhodnius prolixus, Aedes aegypti and Anopheles gambiae. A brief review of

the roles of serotonin and melatonin in both plants and animals, with a focus on insects can

be found in Chapter 1.

In this thesis we sought to utilize an insect bioassay, looking for insecticidal activity

in larvae, for candidate extraction methods and breadfruit varieties to examine in further

depth. In Chapter 2, an extraction method was chosen for future studies due to differences in

mortality between methanol and pentane extraction methods, with pentane extracts yielding

nearly no toxicity while methanol extracts were moderately toxic. In Chapter 3, we would to

investigate the chemical characteristics of methanol extracts from a number of different

breadfruit varieties to determine if there was a difference in chemicals extracted between

varieties. We also confirmed the presence of serotonin in the extract using UPLC-MS and

identified that there were significantly different levels of antioxidant activity between three

varieties of breadfruit including two Artocarpus altilis and Artocarpus mariannensis hybrids,

ulu afa and Lipet as well as breadnut, Artocarpus camansi. These same extracts as well as an

mixed Artocarpus variety sample, were tested for compounds detectable by GC-MS. Many

compounds were putatively identified as fatty acids or terpene based compounds that have

76

both been implicated in numerous studies with insecticidal and insect repellent activity. The

putative identity of these compounds provides potential targets for future studies of insect

bioassay activity.

In Chapter 4, we tested insecticidal activity of multiple breadfruit extracts, and found

insecticidal activity across all varieties with higher insecticidal activity in the mixed

Artocarpus variety methanol extract. Further investigation and repeated studies to verify

these results are needed and were not possible to complete within the scope of this thesis due

to extremely limited breadfruit male inflorescence tissue available. In order to further

examine the biological effect of these extracts on Aedes aegypti we also examined 5-HT and

melatonin content in the haemolymph of larval mosquitoes, where we found that while

melatonin concentration remained unchanged, three of the four extracts significantly reduced

5-HT content within the haemolymph. We also examined mRNA transcript levels of the four

5-HT pathway genes in larval Aedes aegypti after breadfruit exposure and found there was

little change in 5-HT pathway gene transcriptional regulation.

In order to better understand the 5-HT pathway as a target for insecticide

development, we also examined the effect of blood and sugar feeding on the mRNA

transcripts of this pathway as 5-HT changes rapidly in blood feeding insects during times of

feeding. We found that the whole body and the midgut responded with significant changes in

5-HT pathway gene transcription but no significant changes were detected in either the head

of Malpighian tubules. This implies that either the midgut epithelial tissue itself or the

associated neuronal tissue that innervates the gut are the sites for alterations in 5-HT pathway

regulation. This implies new significance that despite the Malpighian tubules being the

primary site of 5-HT diuretic activity in blood feeding insects, the midgut may potentially be

a new tissue to target for pesticide development.

In future studies, a number of issues encountered during this thesis need to be

addressed. The largest problem encountered was the incredibly limited amount of starting

tissue material of the individual three Artocarpus extracts. An abundance of tissue was

collected at the Kahanu Garden site in Hana, Maui but samples were not sufficiently dried

before shipping back to research facilities at BCIT and UBC Okanagan, leading to a vast

77

majority of our collected sample being unusable for experimentation, including the loss of a

number of other varieties of Artocarpus samples. After this loss, the flowering seasons of

most of the trees collected from was over and new male inflorescences could not be collected

within that season. For future studies, breadfruit male inflorescences collected in Maui will

be more thoroughly dried before shipping back to research labs in Canada and the number of

varieties available for examination will be far greater. Our larvicidal information as well as

the 5-HT haemolymph data and the GC-MS profiling indicates that our mixed Artocarpus

sample has potentially more biological activity than other varieties, necessitating further

research to better elucidate chemical profiles between varieties as well as their individual

potential for insecticide development and testing. Another potential issue that can be resolved

in future studies is the inconsistency of extraction and sample processing before chemical or

biological experimentation, where in this thesis, some extracts were dried and resuspended

multiple times and some were only dried and resuspended once, potentially drastically

changing their chemical profiles with regards to the presence of terpenes and other volatiles.

It is also expected that by removing the drying step of the extraction method a far greater

quantity and variety of volatiles will be present.

This thesis did however indicate the possibility for the use of breadfruit as an

insecticidal agent against mosquitoes such as Aedes aegypti. The reduction of serotonin in the

haemolymph after exposure to Artocarpus extracts contradicts the initial hypothesis of this

thesis. However, this opens up new possibilities for mechanisms of toxicity since lower

serotonin concentrations within the haemolymph could also have detrimental effects on the

animal’s health. Mosquito larvae reside in freshwater environments and therefore have tissue

fluid that is hyperosmotic relative to their environment, resulting in a constant influx of water

into the organism’s tissues. Hence, fluid secretion is critical in removing water passively

taken up from the environment. Reduction of serotonin concentration in the haemolymph

after Artocarpus extract exposure would lead to decreased fluid secretion rates, leading to

potentially dangerous accumulation of water within tissues. Whereas in both larvae and

adults, secretion of ions into the tubules to drive fluid secretion and diuresis are critical in

order to excrete metabolic waste products and environmentally accumulated drugs. By

limiting the potential for fluid secretion, the ability of the animal to excrete harmful drugs

could be significantly reduced, offering potential for Artocarpus extracts (or its isolated

78

chemical components) to be used as a synergistic additive to be used alongside traditional

pesticide drugs to increase toxicity without increasing dosage or by allowing the reduction of

externally applied dosage without reducing the toxic effect on the organism.

79

References

Adamo, S.A., Linn, C.E., Hoy, R.R. 1995. The role of neurohormonal octopamine during

“fight or flight” behavior in the field cricket Gryllus bimaculatus. J. Exp. Biol. 198: 1691-

1700.

Alaux, C., Le Conte, Y., Adams, H.A., et al. 2009a. Regulation of brain gene expression in

honey bees by brood pheromone. Genes Brain Behav. 8: 309-319.

Alaux, C., Sinha, S., Hasadsri, L., et al. 2009b. Honey bee aggression supports a link

between gene regulation and behavioral evolution. Proc. Natl. Acad. Sci. USA. 106: 15400-

15405.

Amer, A., Mehlhorn, H., 2006. Larvicidal effects of various essential oils against Aedes,

Anopheles, and Culex larvae (Diptera, Culicidae). Parasitol. Res. 99: 466-472.

Arnao, M.B., Hernández-Ruiz, J.,2006. The physiological function of melatonin in plants.

Plant Signal Behav. 1:89–95

Arnao, M.B., 2014. Phytomelatonin: Discovery, Content, and Role in Plants. Advances in

Botany. Volume 2014, Article ID 815769, http://dx.doi.org/10.1155/2014/815769.

Bajwa, V.S., Murch, S.J., Saxena, P.K., 2014. Melatonin Rich Plants: Production,

Significance in Agriculture and Human Health In Production of Biomass and Bioactive

Compounds Using Bioreactor Technology, Springer, pp 445-468.

Barrau, J. 1796. Breadfruit and relatives. Pp. 201-202 in Evolution of Crop Plants (N.W.

Simmonds, ed.). Longman, London.

Barrett, M., Orchard, I., 1990. Serotonin-induced elevation of cAMP levels in the epidermis

of the blood sucking bug, Rhodnius prolixus. J. Insect Physiol. 36, 625-633.

Berlin, J., Rogenhagen, C., Peter, D., Fecker, L.F., Goddijn, O.J.M., Hoge, J.H.C. 1993.

Increased production of serotonin by suspension and root cultures of Peganum harmala

transformed with a tryptophan decarboxylase cDNA clone from Catharanthus roseus.

Transgenic Research 2:336-344.

Blanco, M. 1837. Flora de Filipinas. C. Lopez, Manila.

Boncristiani, H., Li, J., Evans, J., Pettis, J., Chen, Y. 2011. Scientific note on PCR inhibitors

in the compound eyes of honey bees Apis mellifera. Apidologie, 42(4): 457-460.

Bowden, K., Brown, B.G., Batty, J.E., 1954. 5-hydroxytryptamine: Its occurrence in

cowhage (Mucuna pruriens). Nature. 174:925-6.

do Ceu Silva, M., Gaspar, J., Silva, I.D., Leao, D., Rueff, J. 2003. Induction of chromosomal

80

aberrations by phenolic compounds: possible role of reactive oxygen species. Mutat. Res.

540: 29–42

Chen, G., Huo, Y., Tan, D.X., Liang, Z., Zhang, W., Zhang, Y., 2003. Melatonin in Chinese

medicinal herbs. Life. Sci. 73:19–26

Clark, T.M., Bradley, T.J. 1995. Stimulation of Malpighian tubules from larval Aedes

aegypti by secretagogues. J. Insect. Physiol. 42(6): 593-602.

Clark, T.M., Bradley, T.J. 1997. Malpighian Tubules of Larval Aedes aegypti Are

Hormonally Stimulated by 5-Hydroxytryptamine in Response to Increased Salinity. Archives

of Insect Biochemistry and Physiology 34:123–141

Colas, J.F., Launay, J.M., Kellermann, O., Rosay, P., Maroteaux, L., 1995. Drosophila 5-

HT2 serotonin receptor: coexpression with fushi-tarazu during segmentation. Proceedings of

the National Academy of Sciences U S A 92, 5441e5445.

Collins, C., Miller, T. 1977. Studies on the action of biogenic amines on cockroach heart. 67:

1-15.

Coenan, J. and Barrau, J. 1961. The breadfruit tree in Micronesia. South Pacific Commossion

Bull. 11(4): 37-39, 65-67.

Cohen, R.W., 2001. Diet balancing in the cockroach Rhyparobia madera: does serotonin

regulate this behavior? J. Insect. Behav. 14, 361-367.

Cook, H., Orchard, I., 1990. Effects of 5,7-DHT upon feeding and serotonin content of

various tissues in Rhodnius prolixus. J. Insect. Physiol. 5: 361-367.

Coronel, R.E. 1983. Rimas and kamansi. Promising fruits of the Philippines. Pp. 379-396.

College of Agriculture, University of the Philippines at Los Banos.

Csaba, G., Pál, K., 1982. Effects of insulin, triiodothyronine, and serotonin on plant seed

development. Protoplasma. 110:1, 20-22

Dadd, R.H., 1975. Alkalinity within the midgut of mosquito larvae with a1kaline active

digestive enzymes. J. Insect Physiol. 21, 1847-53

Dempsey, D.R., Jeffries, K.A., Anderson, R.L., Carpenter, A.M., Opsina, S.R., Merkler, D.J.

2014. Identification of an arylalkylamine N-acetyltransferase from Drosophila melanogaster

that catalyzes the formation of long chain N-acylserotonins. FEBS Letters 588, 594-599.

Dube, F.F., Tadesse, K., Birgersson, G., Seyoum, E., Tekie, H., Ignell, R., Hill, S.R., 2011.

Fresh, dried or smoked? Repellent properties of volatiles emitted from ethnomedicinal plant

leaves against malaria and yellow fever vectors in Ethiopia. Malaria Journal 10, 375

81

Erber, J., Kloppenburg, P., Scheidler, A., 1993. Neuromodulation by serotonin and

octopamine in the honeybee: behaviour, neuroanatomy and electrophysiology. Experientia

49, 1073e1083.

Erspamer V., Asero B., 1952. Identification of enteramine, specific hormone of

enterochromaffine cell, as 5-hydroxytryptamine. Nature 169: 800–801

Esquivel, C.J., Cassone, B.J. and Piermarani., P.M., 2014. Transcriptomic evidence for a

dramatic functional transition of the Malpighian tubules after a blood meal in the Asian tiger

mosquito Aedes albopictus. PLoS Negl. Trop. Dis. 8(6): e2929.

Feldman, J.M., Lee, E.M., 1985. Serotonin content of foods: Effect on urinary excretion of 5-

hydroxy indoleacetic acid. Am. J. Clin. Nutr. 42:639-43.

Figueira-Mansur, J., Ferreira-Pereira, A., Mansur, J.F., Franco, T.A., Alvarenga, E.S.L.,

Sorgine, M.H.F., Neves, B.C., Melo, A.C.A., Leal, W.S., Masuda, H., Moreira, M.F. 2013.

Silencing of P-glycoprotein increases mortality in temephos-treated Aedes aegypti larvae.

Insect Molecular Biology 22(6): 648-658.

Fosberg, F.R. 1960. Introgression in Artocarpus in Micronesia. Brittonia 12: 101-113.

Fownes, J.H. and Raynor, W.C. 1993. Seasonality and yield of breadfruit cultivars in the

indigenous agroforestry system of Pohnpei, Federated States of Micronesia. Trop. Agric.

(Trinidad) 70: 103-109.

French, A.S., Simcock, K.L., Rolke, D., Gartside, S.E., Blenau, W., Wright, G.A., 2014. The

role of serotonin in feeding and gut contractions in the honeybee. J. Insect Phys. 61, 8-15.

Gnankiné, O., Bassolé, I.H.N., Chandre, F., Glitho, I., Akogbeto M., Dabiré, R.K. and

Martin, T., 2013. Insecticide resistance in Bemisia tabaci Gennadius (Homoptera:

Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the

sustainability of malaria vector strategies in West Africa. Acta Tropica 128: 7-17.

Guedes, S.F., Mendes, B., Leitão, A.L. 2011. Resorcinol degradation by a Penicillium

chrysogenum strain under osmotic stress: mono and binary substrate matrices with phenol.

Biodegradation. 22: 409–419

Gülçin, İ., Büyünkokuroğlu, M.E., Oktay, M., Küfrevioğlu, Ö.İ. 2002. On the in vitro

antioxidant properties of melatonin. J Pineal Res. 33: 167-171

Gülçin, İ., Büyünkokuroğlu, M.E., Küfrevioğlu, Ö.İ. 2003. Metal chelating and hydrogen

peroxide scavenging effects of melatonin. J Pineal Res. 34: 278-281.

82

Gülçin, İ. 2007. Measurement of antioxidant ability of melatonin and serotonin by the DMPD

and CUPRAC methods as trolox equivalent. Journal of Enzyme Inhibition and Medicinal

Chemistry, 23(6): 871–876.Halstead, S.B., 2007. Dengue. Lancet 370: 1644–1652.

Hannon, J., Hoyer, D., 2008. Molecular biology of 5-HT receptors. Behavioural Brain

Research 195, 198e213.

Hardeland, R., Balzer, I., Poeggeler, B., Fuhrberg, B. and Uria, H.G., 1995. On the primary

functions of melatonin in evolution: mediation of photoperiodic signals in a unicell,

photooxidation, and scavenging of free radicals. J. Pineal Res. 18, 104–111.

Hattori, A., Migitaka, H., Iigo, M., Itoh, M., Yamamoto, K., Ohtani-Kaneko, R., Hara, M.,

Suzuki, T., Reiter, R.J., 1995. Identification of melatonin in plants and its effects on plasma

melatonin levels and binding to melatonin receptors in vertebrates. Biochem. Mol. Biol. Int.

35:627

Hedlund, P.B., Sutcliffe, J.G., 2004. Functional, molecular and pharmacological advances in

5-HT7 receptor research. TRENDS in Pharmacological Sciences. 25(9): 481-486.

Hellemans, J., Mortier, G., De Paepe, A., Speleman, F. and Vandesompele, J. (2007). qBase

relative quantification framework and software for management and automated analysis of

real‐ time quantitative PCR data. Genome Biology 8, R19.

Hintermann, E., Grieder, N.C., Amherd, R., Brodbeck, D., Mayer, U.A., 1996. Cloning of an

arylalkylamine N-acetyltransferase (aaNAT1) from Drosophila melanogaster expressed in

the nervous system and gut. Proc. Natl. Acad. Sci. U.S.A. 93, 12315–12320.

Hiripi, L., Downer, R.G.H., 1993. Characterization of serotonin binding sites in Insect

(Locusta migratoria) Brain. Insect. Biochem. Molec. Biol. 23 (2):303-307.

House, H. L., 1974. Digestion. In: The Physiology of Insecta , ed . M. Rock stein, 5:63- 1

17. New York: Academic. 2nd ed.

Ishihara, A., Hashimoto, Y., Miyagawa, H., Wakasa, K., 2008. Induction of serotonin

accumulation by feeding of rice striped stem borer in rice leaves. Plant Signal Behav. 3:714-

6.

Itoh, M.T., Hattori, A., Sumi, Y., Suzuki, T., 1995. Day-night changes in melatonin levels in

different organs of the cricket (Gryllus bimaculatus). J. Pineal. Res. 18, 165-169.

Jarrett, F.M. 1959. Studies in Artocarpus and allied genera, III. A revision of Artocarpus

subgenus Artocarpus. J. Arnold Arboretum 15:298-326.

83

Jo, W.K., Lee, J.H. .2011. Naphthalene and benzene levels in microenvironments associated

with potential exposure: new and old apartments with moth repellents, and cabins of

passenger cars. International Journal of Environmental Analytical Chemistry, 91:15, 1412-

1424

Jones, A.M., Klun, J.A., Cantrell, C.L., Ragone, D., Chauhan, K.R., Brown, P.N., Murch,

S.J., 2012. Isolation and identification of mosquito (Aedes aegypti) biting deterrent fatty

acids from male inflorescences of breadfruit (Artocarpus altilis) (Parkinson) Fosberg). J. Ag.

Food Chem. 60: 3867-3873.

Kahru, A., Pollumaa, L., Reiman, R., Ratsep, A., Liiders, M., Maloveryan, A. 2000. The

toxicity and biodegradability of eight main phenolic compounds characteristic to the oil-shale

industry wastewaters: a test battery approach. Environ. Toxicol. 15: 431–442

Kang, S., Kang, K., Lee, K., Back, K., 2007. Characterization of rice tryptophan

decarboxylases and their direct involvement in serotonin biosynthesis in transgenic rice.

Planta 227:263–272.

Kang, K., Kim, Y.S., Park, S., Back, K., 2009. Senescence-induced serotonin biosynthesis

and its role in delaying senescence in rice leaves. Plant Physiol. 150:1380-1393.

Kang, K., Kong, K., Park, S., Natsagdorj, U., Kim, Y.S., Back, K., 2011. Molecular cloning

of a plant N-acetylserotonin methyltransferase and its expression characteristics in rice. J.

Pineal. Res. 50:304–309.

Kang, K., Lee, K., Park, S., Byeon, Y., Back, K., 2012. Molecular cloning of rice serotonin

N‐ acetyltransferase, the penultimate gene in plant melatonin biosynthesis. J. Pineal. Res.

55:7–13

Lange, A. 2009. Tyramine: From octopamine precursor to neuroactive chemical in insects.

General and Comparative Endocrinology 162: 18–26

Lange, A.B., Orchard, I., Barrett, M.F., 1989. Changes in haemolymph serotonin levels

associated with feeding in the blood-sucking bug Rhodnius prolixus. J. Insect. Physiol. 35(5):

393-399.

Livingstone, M.S., Tempel, B.L., 1983. Genetic dissection of monoamine neurotransmitter

synthesis in Drosophila. Nature 303, 67e70.

Lucas, M.P., Ragone, D., 2012. National Tropical Botanical Garden, “Will Breadfruit Solve

the World Hunger Crisis?,” ArcNews, pgs. 6 and 7

(http://www.esri.com/news/arcnews/summer12articles/will-breadfruit-solve-the-world-

hunger-crisis.html)

http://www.esri.com/news/arcnews/summer12articles/will-breadfruit-solve-the-world-hunger-crisis.html

http://www.esri.com/news/arcnews/summer12articles/will-breadfruit-solve-the-world-hunger-crisis.html

84

Maddrell, S.H.P., Pilcher, D.E.M., Gardiner, B.O.C., 1969. Stimulatory effect of 5-

hydroxytryptamine (serotonin) on the secretion by Malpighian tubules of insects. Nature 222,

784-785.

Maddrell, S.H.P., Pilcher, D.E.M., Gardiner, B.O.C., 1971. Pharmacology of the Malpighian

tubules of Rhodnius and Carausius: the structure-activity relationship of tryptamine

analogues and the role of cyclic AMP. J. Exp. Biol. 54: 779-804.

Maddrell, S.H.P., Lane, N. J., Harrison, J. B., Overton, J.A., Moreton, R.B., 1988. The initial

stages in the action of an insecticidal δ-endotoxin of Bacillus thuringiensis var. israelensis on

the epithelial cells of the Malpighian tubules of the insect Rhodnius prolixus. J. Cell Sci. 90,

131–144.

Maddrell, S.H.P., Herman, W.S., Mooney, R.L., Overton, J.A., 1991. 5-hydroxytryptamine: a

second diuretic hormone in Rhodnius prolixus. J. Exp. Biol. 156: 557-566.

Maddrell, S.H.P., Herman, W.S., Farndale, R.W., Riegel, J.A., 1993. Synergism of hormones

controlling epithelial transport in an insect. J. Exp. Biol. 174: 65-80.

Marusalin, J., Matier, B.J., Rheault, M.R. and Donini, A. (2012). Aquaporin homologs and

water transport in the anal papillae of the larval mosquito, Aedes aegypti. Journal of

Comparative Physiology B. DOI:10.1007/S00360-012-0679-2.

Manchester, L.C., Tan, D.X., Reiter, R.J., Park, W., Monis, K., Qi, W., 2000. High levels of

melatonin in the seeds of edible plants: possible function in germ tissue protection. Life. Sci.

67:3023–3029.

Massal, E. and Barrau, J. 1954. Pacific subsistence crops: breadfruit. South pacific Bull 4(4):

24-26.

McCann, F.V., Reece, R.W., 1967. Neuromuscular transmission in insects: effect of injected

chemical agents. Comp. Biochem. Physiol. 21:115-24.

Meyer, J.M., Ejendal, K.F.K., Avramova, L.V., Garland-Kuntz, E.E., Giraldo-Caldero ́n,

G.I., et al. .2012. A ‘‘Genome-to-Lead’’ Approach for Insecticide Discovery:

Pharmacological Characterization and Screening of Aedes aegypti D1-like Dopamine

Receptors. PLoS Negl Trop Dis 6(1): e1478. doi:10.1371/journal.pntd.0001478

Moffet, D.F., Jagadeshwaran, U., Wang, Z., Davis, H.M., Onken, H., Goss, G.G., 2012.

Signaling by intracellular Ca2+ and H+ in larval mosquito (Aedes aegypti) midgut epithelium

in response to serosal serotonin and lumen pH. J. Insect. Phys. 58, 506-512.

Montoreano, R., Triana, F., Abate, T., Rangal-Aldao, R., 1990. Cyclic AMP in the

Malpighian tubule fluid and in the urine of Rhodnius prolixus. Gen. Comp. Endocrinol. 77,

136-142.

85

Morton, J. 1987. Breadfruit. Pp. 50-58 in Fruits in Warm Climates. Morton Collectanea.

University of Miami, Coral Gables, Florida.

Murch, S.J., Simmons, C.B., Saxena, P.K., 1997. Melatonin in feverfew and other medicinal

plants. Lancet 350:1598–1599.

Murch, S.J., KrishnaRaj, S., Saxena, P.K., 2000. Tryptophan is a precursor for melatonin and

serotonin biosynthesis in in vitro regenerated St. John’s wort (Hypericum perforatum L.

cv.Anthos) plants. Plant. Cell. Rep. 19:698–704.

Murch, S.J., Campbell, S.S.B., Saxena, P.K., 2001. The role of serotonin and melatonin in

plant morphogenesis: Regulation of auxin induced root organogenesis in in vitro-cultured

explants of St. John’s wort (Hypericum perforatum L.). In Vitro Cell Dev. Biol. Plant.

37:786-93.

Murray, C.J., Rosenfeld, L.C., Lim, S.S., Andrews, K.G., Foreman, K.J., et al., 2012. Global

malaria mortality between 1980 and 2010: a systematic analysis. Lancet 379: 413–31

Navarro, M., Malres, S., Labouisse, J.P., and Roupsard, O. 2007. Vanuatu breadfruit project:

Survey on Botanical Diversity and Traditional Uses of Artocarpus altilis. Acta Hortic.

757:81-88.

Neckameyer, W.S., White, K., 1992. A single locus encodes both phenylalanine hydroxylase

and tryptophan hydroxylase activities in Drosophila. Journal of Biological Chemistry 267,

4199e4206.

Nichols, C.D., 2007. 5-HT2 receptors in Drosophila are expressed in the brain and modulate

aspects of circadian behaviors. Developmental Neurobiology 67, 752e763.

Nichols, D.E., Nichols, C.D., 2008. Serotonin receptors. Chemical Reviews 108, 1614e1641.

Nishida, R., 2002. Sequestration of defense substances from plants by Lepidoptera. Annu.

Rev. Entomol. 47: 57-92.

Nuss AB, Ejendal KFK, Doyle TB, Meyer JM, Lang EG, Watts VJ, et al. (2015) Dopamine

Receptor Antagonists as New Mode-of-Action Insecticide Leads for Control of Aedes and

Culex Mosquito Vectors. PLoS Negl Trop Dis 9(3): e0003515.

doi:10.1371/journal.pntd.0003515

Olsson, G. 1991. The socio-economic importance of non-timber products in the South

Pacific: focus on Vanuatu. Unasylva 165(42): 24-30.

Orchard, I., 2006. Serotonin: a coordinator of feeding-related physiological events in the

blood-gorging bug, Rhodnius prolixus. Comp. Biochem. Physiol. A Mol. Integr. Physiol.

144, 316-324.

86

Orchard, I.1982. Octopamine in insects: neurotransmitter, neurohormone, and

neuromodulator. Can. J.Zool. 60: 659-669.

Orchard, I., Ramirez, J.M., Lange, A. 1993. A multifunctional role for octopamine in locust

flight. Annu. Rev. Entomol. 1993.38:227-49

O’Donnell, M.J., 2009. Too much of a good thing: how insects cope with excess ions or

toxins in the diet. J. Exp. Biol. 212, 363-372.

Pandey, S.K., Upadhyay, S. and Tripathi, A.K. 2009. Insecticidal and repellent activities

from the essential oil of Trachyspermum ammi (Linn) Sprague seeds against Anopheles

stephensi. Parasitol Res. 105: 507-512.

Park, H.M., Kim, J., Chang, K.S., Kim, B.S., Yang, Y.J., Kim, G.H., Shin, S.C., Park, I.K.,

2009. Larvicidal activity of Myrtaceae essential oils and their components against Aedes

aegypti, acute toxicity on Daphnia magna, and aqueous residue. J. Med. Entomol. 48(2):

405-410.

Park, S., Lee, K., Kim, Y.S., Back, K., 2011. Tryptamine 5‐ hydroxylase‐ deficient

Sekiguchi rice induces synthesis of 5‐ hydroxytryptophan and N‐ acetyltryptamine but

decreases melatonin biosynthesis during senescence process of detached leaves. J. Pineal.

Res. 52:211–216.

Pattison, D.I., Dean, R.T., & Davis, M.J. (2002). Oxidation of DNA, proteins and lipids by

DOPA, protein-bound DOPA, and related catechol (amine)s. Toxicology, 177, 23–37.

Patrick, M.L., Aimanova, K., Sanders, H.R., Gill, S.S., 2006. P-type Na+/K+-ATPase and V-

type H+-ATPase expression patterns in the osmoregulatory organs of larval and adult

mosquito Aedes aegypti. J. Exp. Biol 209: 4638-4651.

Phillips, J., 1981. Comparative physiology of insect renal function. American Physiological

Society R241-R257.

Posmyk, M.M., Janas, K.M., 2009. Melatonin in plants. Acta. Physiol. Plant. 31:1–11

Prajapati, V., Tripathi, A.K., Aggarwal, K.K., Khanuja, S.P.S., 2005. Insecticidal, repellent

and oviposition-deterrent activity of selected essential oils against Anopeoles stephensi,

Aedes aegypti and Culex quinquefasciatus. Bioresrouce Technology 96: 1749-1757.

Purseglove, J.W. 1968. Artocarpus altilis. Pp. 379-384. In Tropical Crops. Dicotyledons.

Longman. London.

Quisumbing, E. 1940. The validity of Artocarpus camansi Blanco.Philippine J. Sci. 72(2):

86-89.

Ragone, D. 1991. Collection, Establishment, and Evaluation of a Germplasm Collection of

Pacific Island Breadfruit. PhD Dissertation. University of Hawaii, Honolulu.

87

Ragone, D. 1997. Breadfruit. Artocarpus altilis (Parkinson) Fosberg. Promoting the

conservation and use of underutilized and neglected crops. 10. Intl. Plant Genetic Reseources

Inst., Rome.

Ragone, D. and Cavaletto, C.G., 2006. Sensory evaluation of fruit quality and nutritional

composition of 20 breadfruit (Artocarpus, Moraceae) cultivars. Econ. Bot. 60:335-346.

Reiter, R.J., Tan, D.X., Fuentes-Broto, L., 2010. Melatonin: a multitasking molecule.

Progress in Brain Research 181: 127-151.

Regnault-Roger, C., Vincent, C., Arnason J.T., 2012. Essential oils in insect control: Low-

Risk Products in a High Stakes World. Annu. Rev. Entomol 57: 405-424.

Rheault, M.R., Okech, B.A., Kee, S.B.W., Miller, M.M., Meleshkevitch, E.A., Linser, P.J.,

Doudko, D.Y., Harvey, W.R., 2007. Molecular cloning, Phylogeny and localization of

AgNHA1: the first Na+/H+ antiporter (NHA) from a metazoan, Anopheles gambiae. J. Exp.

Biol. 210, 3848-3861.

Roshchina, V.V., 2001. Neurotransmitters in plant life. Science Publishers, Enfield; 4-81.

Runge, F.F., 1820. Neueste phytochemische entdeckungen zur begründung einer

wissenschaftlichen phytochemie. 1:144-159.

Schulz, D.J., Robinson, G.E., 1999. Biogenic amines and division of labor in honey bee

colonies: behaviorally related changes in the antennal lobes and age-related changes in the

mushroom bodies. J. Comp. Physiol. 184, 481–488.

Senthilkumar, A., Tikar, S.N., Gopalan, N., Sundaramoorthy, P., Venkatesalu, V. 2012.

Larvicidal potential of different solvent extracts and oleanolic acid derivative from Coccinia

indica against vector mosquitoes, Toxicological & Environmental Chemistry, 94:7, 1342-

1349, DOI: 10.1080/02772248.2012.705288

Silva, W.J., Dória, G.A.A., Maia, R.T., Nunes, R.S., Carvalho, G.A., Blank, A.F., ALves,

P.B., Marçal, R.M., Cavalcanti, S.C.H., 2008. Effects of essential oils on Aedes aegypti

larvae: Alternatives to environmentally safe insecticides. Bioresource Technology 99: 3251-

3255.

da Silva, O.S., da Silva, F.C., de Barros, F. M.C., da Silva, J.L.R., de Loreto Bordignon,

S.A., Eifler-Lima, V.L., von Poser, G.L., Prophiro, J.S., 2013. Larvicidal activity and growth

inhibiting activites of extract and benzopyrans from Hypericum polyanthemum (Guttiferae)

against Aedes aegypti (Diptera: Culicidae). Industrial Crops and Products. 45: 236-239.

Slominski, A., Semak, I., Pisarchik, A., Sweatman, T., Szczesniewski, A., Wortsman, J.,

2002. Conversion of L-tryptophan to serotonin and melatonin in human melanoma cells.

FEBS Lett 511:102–106.

88

Stehle, J.H., Saade, A., Rawashdeh, O., Ackermann, K., Jilg, A., Sebestény, T., Maronde, E.,

2011. A survey of molecular details in the human pineal gland in the light of phylogeny,

structure, function and chronobiological diseases. J. Pineal. Res. 51:17–43

Sugden, D., 1989. Melatonin biosynthesis in the mammalian pineal gland. Cell Mol Life Sci

45:922–932.

Tamashiro, H., Yoshino, M. 2014. Signaling pathway underlying the octopaminergic

modulation of myogenic contraction in the cricket lateral oviduct. Journal of Insect

Physiology 71: 30–36

Te Brugge, V., Paluzzi, J.P., Schooley, D.A., Orchard, I., 2011. Identification of the elusive

peptidergic diuretic hormone in the blood-feeding bug Rhodnius prolixus: a CRF-related

peptide. J. Exp. Biol. 214, 371–381.

Teufel, D.R. 1999. Final report on safety assessment of Azulene. Int. J. Toxicol. 18: 27–32.

Theobald, F.V., 1901. Monog. of the Culicidae. 1, 21.

Tilden, A.R., Anderson, W.J. and Hutchison, V.H., 1994. Melatonin in two species of

damselfly, Ischnura verticalis and Enallagma civile. J. Insect Physiol. 40, 775–780.

Trécul, A. 1847. Mémoire sur la Famille des Artocarpées. Ann. Sci. Nat. Bot. Sect. III. 8:38-

64.

Turi, C.E., Axwik, K.E., Smith, A., Jones, A.M.P., Saxena, P.K., Murch, S.J. 2014.

Galanthamine, an anti-cholinesterase drug, effects plant growth and development in

Artemisia tridentata Nutt. via modulation of auxin and neurotransmitter signaling. Plant

Signaling & Behavior. 9:e28645; PMID: 24690897; http://dx.doi.org/10.4161/psb.28645

USFDA Frequency of Use of Cosmetic Gradients, FDA Data Base, United States Food and

Drug Administration, Washington, DC, 1996.

Vadivel, V., Janardhanan, K. 2001. Nutritional and anti-nutritional attributes of the under-

utilized legume. Cassia floribunda Cav. Food Chemistry, 73, 209–215.

Vermeulen, J., Pattyn, F., De Preter, K., Vercruysse, L., Derveaux, S., Mestdagh, P., Lefever,

S., Hellemans, J., Speleman, F. and Vandesompele, J. (2009). External oligonucleotide

standards enable cross laboratory comparison and exchange of real time quantitative PCR

data. Nucleic Acids Research 37(21), e138.

Vömel, M., Wegener, C., 2008. Neuroarchitecture of aminergic systems in the larval ventral

ganglion of Drosophila melanogaster. PLoS ONE 3(3): e1848.

Doi:10.1371/journal.pone.0001848

Wagener-Hulme, C., Kuehn, J.C., Schulz, D.J., Robinson, G.E. 1999. Biogenic amines and

division of labor in honey bee colonies. J. Comp. Physiol. 184, 471–479.

89

Weng, X.H., Huss, M., Wieczorek, H., Beyenbach, K.W., 2003. The V-type H+-type ATPase

in Malpighian tubules of Aedes aegypti: localization and activity. J. Exp. Biol. 206: 2211-

2219.

World Health Organization. 2014. Factsheet N°387: Vector-borne diseases.

Woskresensky, A., 1842. "Über das Theobromin". Liebigs Annalen der Chemie und

Pharmacie 41: 125–127.

Yakovlev, A.Y., Gordya, N.A. 2012. Hormonal influence on antimicrobial peptide

biosynthesis by a blowfly Calliphora vicina R.-D. (Diptera, Calliphoridae) fat body cells.

Entomologicheskoe Obozrenie. 91(3): 498-505.

investigation of breadfruit (artocarpus altilis) for use in the

Documents