Introduction to Molecular Biology. G-C and A-T pairing.

Introduction to Molecular Biology

G-C and A-T pairing.

A & G =

Purines

C & T = Pyrimidines

Important terms:

• Nucleotide Pair = Base pair (bp)

• 1000 base pairs = 1 kilobase pairs (kb)

• 1,000,000 base pairs = 1 megabase pairs (Mb)

• 1,000,000,000 base pairs = Gb?

Double-stranded DNA is peeled apart to replicate DNA

• The 2 daughter molecules are identical to each other and exact duplicates of the original (assuming error-free replication).

• One chromosome is one long, twisted, dramatically compacted DNA molecule.

• The average length of a human chromosome is 130 million b.p.

Genes are defined segments of DNA

•The information content of the DNA molecule consists of the order of bases (A, C, G, and T) along the length of the molecule.

Nucleic Acids

DNA

vs.

RNA

• RNA is quite similar to DNA, but usually single-stranded. Both are nucleic acids

In RNA, “U” replaces

“T “

Important Concepts

• DNA and RNA have polarity- each strand has a 5’ and a 3’ end. (The 2 strands of DNA are anti-parallel)

• The common convention is to list only one strand of DNA, in a 5’ to 3’ direction:

5’ AGTCGTAGTCGTAGTCGTAGTCTG3’

(3’TCAGCATCAGCATCAGCATCAGAC 5’)

How Genes are Expressed- the Central

Dogma.

Transcription=

RNA synthesis

Translation

=

Protein synthesis

Eukaryotic transcription operates ‘gene by gene’.

One strand of DNA is copied (sense strand); the antisense strand is never

transcribed.

Transcription produces an RNA ‘copy’ of a gene (DNA)

• animation

Important Term:

• Transcription = RNA synthesis

• Quiz question- how does sequence of mRNA compare to sequence of noncoding strand of DNA?

The mRNA are translated in the cytoplasm

Three consecutive bases in the mRNA form one codon

No exceptions- the genetic code is a triplet code.

tRNA are the ‘bilingual’ molecules

The genetic code is the codon-amino acid conversion table

http://academy.d20.co.edu/kadets/lundberg/DNA_animations/protein.mov

The immediate product of translation is the primary protein

structure

The primary sequence dictates the secondary and tertiary structure of the protein

Important Term:

• Translation = Protein synthesis

There are 2 basic types of genes:

• Protein-coding genes:

(DNA mRNA protein)

• RNA-specifying genes:

(DNA tRNA) (DNA rRNA)

(DNA small RNA)

Genetic information, stored in DNA, is conveyed as proteins

Protein sequences are also represented linearly.

• Each of the 20 amino acid is can be represented by a 3 letter code:

Ser Tyr Met Glu His

In bioinformatics, each of the 20 amino acid is commonly represented by a 1 letter code:

MDETSGHLKPWECVGH . . . . .•

Genetic information, stored in DNA, is conveyed as proteins

In sickle-cell anemia, one nucleotide change is responsible for the one amino acid change.

Sickle-cell anemia is caused by one amino acid change.

A single base-pair mutation is often the cause of a human

genetic disease.

How to find a gene?*

• One way is too search for an open reading frame (ORF).

• An ORF is a sequence of codons in DNA that starts with a Start codon, ends with a Stop codon, and has no other Stop codons inside.

* = inexact science

Each strand has 3 possible ORFs.

5'                                3’ atgcccaagctgaatagcgtagaggggttttcatcatttgagtaa

1 atg ccc aag ctg aat agc gta gag ggg ttt tca tca ttt gag taa M   P   K   L   N   S   V   E   G   F   S   S   F   E   * 

2  tgc cca agc tga ata gcg tag agg ggt ttt cat cat ttg agt  C   P   S   *   I   A   *   R   G   F   H   H   L   S   

3   gcc caa gct gaa tag cgt aga ggg gtt ttc atc att tga gta   A   Q   A   E   *   R   R   G   V   F   I   I   *   V     

Eukaryotic Genomes

• Finding a gene is much more difficult in eukaryotic genomes than in prokaryotic genomes. WHY??

Prokaryotic (bacterial) genomes:

• Are much smaller than eukaryotic genomes

E. coli = 4,639,221 bp, 4.6 Mb

Human = ~~ 3,300 Mb

• Contain a small amount of noncoding DNA

E. coli= ~ 11%

Human = > 95%

Eukaryotic transcripts (mRNA) are processed and

leave the nucleus

Exon

=

Genetic code

Intron

=

Non-essential DNA ? ?

• The mechanism of splicing is not well understood.

Alternate Splice sites generate various proteins isoforms (HGP estimate = 35%)

Variable mutation rate?

• Most mutations in introns and intergenic DNA are (apparently) harmless

• Consequently, intron and intergenic DNA sequences diverge much quicker than exons.

Bacteria cells are different:

• Prokaryotic cells- No splicing (i.e. – no split genes)

• Eukaryotic cells- Intronless genes are rare (avg. # of introns in HG is 3-7, highest # is 234); dystrophin gene is > 2.4 Mb.

How to confirm the identification of a gene?

• Possible answer- Identify the gene by identifying its promoter.

Promoters are DNA regions that control when genes are activated.

Promoter

[ ]

Exons encode the information that determines what product will be produced.

Promoters encode the information that determines when the protein will be produced.

Nucleotides of a particular gene are often numbered:

Demonstration of a consensus sequence.

• De

How to find a gene?

• Look for a substantial ORF and associated ‘features’.

• Two nucleic acids, that are exact complements of each other will hybridize.

• Two nucleic acids that are mostly complementary (some mismatchs) will . . .

. . . hybridize under the right conditions.

Recombinant DNA techniques?

• Many popular tools of recDNA rely on the principle of DNA hybridization.

• In large mixes of DNA molecules, complementary sequences will pair.

Hybridization ‘in silico’

• Algorithms have been written that will compare two nucleic acid sequences. Two similar DNA sequences (they would hybridize in solution) are said ‘to match’ when software determines that they are of significant similarity.

Protein- Protein similarity searches?

• Many algorithms have been designed to compare strings of amino acids (single letter amino acid code) and find those of a defined degree of similarity.

Significance of sequence similarity

• DNA similarity suggests:

• Similar function

• Similar structure

• Evolutionary relationship

The End