Introduction to bioinformatics Lecture 2 Genes and Genomes C E N T R F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U E
Feb 25, 2016
Introduction to bioinformaticsLecture 2
Genes and Genomes
CENTR
FORINTEGRATIVE
BIOINFORMATICSVU
E
Organisational• Course website:
http://ibi.vu.nl/teaching/mnw_2year/mnw2_2007.phpor click on http://ibi.vu.nl (>teaching >Introduction to Bioinformatics)
• Course book: Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN (Pbk) 1-4051-0683-2
• Lots of information about Bioinformatics can be found on the web.
.....acctc ctgtgcaaga acatgaaaca nctgtggttc tcccagatgg gtcctgtccc aggtgcacct gcaggagtcg ggcccaggac tggggaagcc tccagagctc aaaaccccac ttggtgacac aactcacaca tgcccacggt gcccagagcc caaatcttgt gacacacctc ccccgtgccc acggtgccca gagcccaaat cttgtgacac acctccccca tgcccacggt gcccagagcc caaatcttgt gacacacctc ccccgtgccc ccggtgccca gcacctgaac tcttgggagg accgtcagtc ttcctcttcc ccccaaaacc caaggatacc cttatgattt cccggacccc tgaggtcacg tgcgtggtgg tggacgtgag ccacgaagac ccnnnngtcc agttcaagtg gtacgtggac ggcgtggagg tgcataatgc caagacaaag ctgcgggagg agcagtacaa cagcacgttc cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaacggcaa ggagtacaag tgcaaggtct ccaacaaagc aaccaagtca gcctgacctg cctggtcaaa ggcttctacc ccagcgacat cgccgtggag tgggagagca atgggcagcc ggagaacaac tacaacacca cgcctcccat gctggactcc gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg aacatcttct catgctccgt gatgcatgag gctctgcaca accgctacac gcagaagagc ctctc.....
DNA sequenceDNA sequence
Genome sizeGenome sizeOrganism Number of base
pairsX-174 virus 5,386Epstein Bar Virus 172,282Mycoplasma genitalium 580,000Hemophilus Influenza 1.8 106 Yeast (S. Cerevisiae) 12.1 106
Human Human 3.2 3.2 10 1099
Wheat 16 109
Lilium longiflorum 90 109
Salamander 100 109 Amoeba dubia 670 109
Four DNA nucleotide building blocks
G-C is more strongly hydrogen-bonded than A-T
A gene codes for a protein
Protein
mRNA
DNA
transcription
translation
CCTGAGCCAACTATTGATGAA
PEPTIDE
CCUGAGCCAACUAUUGAUGAA
Central Dogma of Molecular Biology
Replication DNATranscription
mRNATranslation
Protein
Transcription is carried out by RNA polymerase (II)Translation is performed on ribosomesReplication is carried out by DNA polymeraseReverse transcriptase copies RNA into DNA
Transcription + Translation = Expression
But DNA can also be transcribed into non-coding RNA …
tRNA (transfer): transfer of amino acids to theribosome during protein synthesis.
rRNA (ribosomal): essential component of the ribosomes (complex with rProteins).
snRNA (small nuclear): mainly involved in RNA-splicing(removal of introns). snRNPs.
snoRNA (small nucleolar): involved in chemical modifi-cations of ribosomal RNAs and other RNA genes. snoRNPs.
SRP RNA (signal recognition particle): form RNA-protein complex involved in mRNA secretion.
Further: microRNA, eRNA, gRNA, tmRNA etc.
Eukaryotes have spliced genes …
Promoter: involved in transcription initiation (TF/RNApol-binding sites) TSS: transcription start site UTRs: un-translated regions (important for translational control) Exons will be spliced together by removal of the Introns Poly-adenylation site important for transcription termination
(but also: mRNA stability, export mRNA from nucleus etc.)
DNA makes mRNA makes Protein
DNA makes RNA makes Protein
… yet another picture to appreciate the above statement
Some facts about human genes
There are about 20.000 – 25.000 genes in the human genome (~ 3% of the genome)
Average gene length is ~ 8.000 bp
Average of 5-6 exons per gene
Average exon length is ~ 200 bp
Average intron length is ~ 2000 bp
8% of the genes have a single exon
Some exons can be as small as 1 or 3 bp
DMD: the largest known human gene
The largest known human gene is DMD, the gene that encodes dystrophin: ~ 2.4 milion bp over 79 exons
X-linked recessive disease (affects boys)
Two variants: Duchenne-type (DMD) and becker-type (BMD)
Duchenne-type: more severe, frameshift-mutations
Becker-type: milder phenotype, “in frame”- mutations
Posture changes during progression of Duchenne muscular dystrophy
Nucleic acid basics
Nucleic acids are polymers
Each monomer consists of 3 moieties
nucleoside
nucleotide
Nucleic acid basics (2)
A base can be of 5 rings Purines and Pyrimidines can base-pair (Watson- Crick pairs)
Watson and Crick, 1953
Nucleic acid as hetero-polymers
Nucleosides, nucleotides
(Ribose sugar, RNA precursor)
(2’-deoxy ribose sugar, DNA precursor)
(2’-deoxy thymidine tri-phosphate, nucleotide)
DNA and RNA strands
REMEMBER:
DNA = deoxyribonucleotides;RNA = ribonucleotides (OH-groups at the 2’ position)
Note the directionality of DNA (5’-3’ & 3’-5’) or RNA (5’-3’)
DNA = A, G, C, T ; RNA = A, G, C, U
So …
DNA RNA
Stability of base-pairing
C-G base pairing is more stable than A-T (A-U) base pairing (why?)
3rd codon position has freedom to evolve (synonymous mutations)
Species can therefore optimise their G-C content (e.g. thermophiles are GC rich) (consequences for codon use?)
Thermocrinis ruber, heat-loving bacteria
TAA, TAG, TGA Stop Stop codons
CGT, CGC, CGA, CGG, AGA, AGGRArginine
AAA, AAGKLysine
GAT, GACDAspartic acid
GAA, GAGEGlutamic acid
CAT, CACHHistidine
AAT, AACNAsparagine
CAA, CAGQGlutamine
TGGWTryptophan
TAT, TACYTyrosine
TCT, TCC, TCA, TCG, AGT, AGCSSerine
ACT, ACC, ACA, ACGTThreonine
CCT, CCC, CCA, CCGPProline
GGT, GGC, GGA, GGG GGlycine
GCT, GCC, GCA, GCG AAlanine
TGT, TGCc Cysteine
ATGM, StartMethionine
TTT, TTCFPhenylalanine
GTT, GTC, GTA, GTGVValine
CTT, CTC, CTA, CTG, TTA, TTGLLeucine
ATT, ATC, ATA IIsoleucine
DNA codonsSingle Letter Code
Amino Acid
DNA compositional biases
Base compositions of genomes: G+C (and therefore also A+T) content varies between different genomes
The GC-content is sometimes used to classify organism in taxonomy
High G+C content bacteria: Actinobacteriae.g. in Streptomyces coelicolor it is 72%
Low G+C content: Plasmodium falciparum (~20%)
Other examples:Saccharomyces cerevisiae (yeast) 38%Arabidopsis thaliana (plant) 36%Escherichia coli (bacteria) 50%
Genetic diseases: cystic fibrosis
Known since very early on (“Celtic gene”)
Autosomal, recessive, hereditary disease (Chr. 7)
Symptoms: Exocrine glands (which produce
sweat and mucus) Abnormal secretions Respiratory problems Reduced fertility and (male)
anatomical anomalies
30,0003,000 20,000
cystic fibrosis (2)
Gene product: CFTR (cystic fibrosis transmembrane conductance regulator)
CFTR is an ABC (ATP-binding cassette) transporter or traffic ATPase.
These proteins transport molecules such as sugars, peptides, inorganic phosphate, chloride, and metal cations across the cellular membrane.
CFTR transports chloride ions (Cl-) ions across the membranes of cells in the lungs, liver, pancreas, digestive tract, reproductive tract, and skin.
cystic fibrosis (3)
CF gene CFTR has 3-bp deletion leading to Del508 (Phe) in 1480 aa protein (epithelial Cl- channel)
Protein degraded in Endoplasmatic Reticulum (ER) instead of inserted into cell membrane
The deltaF508 deletion is the most common cause of cystic fibrosis. The isoleucine (Ile) at amino acid position 507 remains unchanged because both ATC and ATT code for isoleucine
Diagram depicting the five domains of the CFTR membrane protein (Sheppard 1999).
Theoretical Model of NBD1. PDB identifier 1NBD as viewed in Protein Explorer http://proteinexplorer.org
Let’s return to DNA and RNA structure …
Unlike three dimensional structures of proteins, DNA molecules assume simple double helical structures independent of their sequences.
There are three kinds of double helices that have been observed in DNA: type A, type B, and type Z, which differ in their geometries.
RNA on the other hand, can have as diverse structures as proteins, as well as simple double helix of type A.
The ability of being both informational and diverse in structure suggests that RNA was the prebiotic molecule that could function in both replication and catalysis (The RNA World Hypothesis).
In fact, some viruses encode their genetic materials by RNA (retrovirus)
Three dimensional structures of double helices
Side view: A-DNA, B-DNA, Z-DNA
Top view: A-DNA, B-DNA, Z-DNA
Space-filling models of A, B and Z- DNA
Major and minor grooves
Forces that stabilize nucleic acid double helix
There are two major forces that contribute to stability of helix formation: Hydrogen bonding in base-pairing Hydrophobic interactions in base stacking
5’
5’
3’
3’
Same strand stackingcross-strand stacking
Types of DNA double helix
Type Amajor conformation RNAminor conformation DNA
Right-handed helixShort and broad
Type Bmajor conformation DNA
Right-handed helixLong and thin
Type Zminor conformation DNA
Left-handed helixLonger and thinner
Secondary structures of Nucleic acids
DNA is primarily in duplex form
RNA is normally single stranded which can have a diverse form of secondary structures other than duplex.
Non B-DNA Secondary structures
Cruciform DNA
Triple helical DNA
Slipped DNA
Hoogsteen basepairs
Source: Van Dongen et al. (1999) , Nature Structural Biology 6, 854 - 859
More Secondary structures
RNA pseudoknots Cloverleaf rRNA structure
Source: Cornelis W. A. Pleij in Gesteland, R. F. and Atkins, J. F. (1993) THE RNA WORLD. Cold Spring Harbor Laboratory Press.
16S rRNA Secondary Structure Based onPhylogenetic Data
3D structures of RNA :transfer-RNA structures
Secondary structure of tRNA (cloverleaf)
Tertiary structure of tRNA
3D structures of RNA :ribosomal-RNA structures
Secondary structure of large rRNA (16S)
Tertiary structure of large rRNA subunit
Ban et al., Science 289 (905-920), 2000
3D structures of RNA :Catalytic RNA
Secondary structure of self-splicing RNA
Tertiary structure of self-splicing RNA
Some structural rules …
Base-pairing is stabilizing
Un-paired sections (loops) destabilize
3D conformation with interactions makes up for this
Three main principles
• DNA makes RNA makes Protein
• Structure more conserved than sequence
• Sequence Structure Function
How to go from DNA to protein sequence
A piece of double stranded DNA:
5’ attcgttggcaaatcgcccctatccggc 3’3’ taagcaaccgtttagcggggataggccg 5’
DNA direction is from 5’ to 3’
How to go from DNA to protein sequence6-frame conceptual translation using the codon table:
5’ attcgttggcaaatcgcccctatccggc 3’
3’ taagcaaccgtttagcggggataggccg 5’
So, there are six possibilities to make a protein from an unknown piece of DNA, only one of which might be a natural protein
Remark
• Identifying (annotating) human genes, i.e. finding what they are and what they do, is a difficult problem– First, the gene should be delineated on the genome
• Gene finding methods should be able to tell a gene region from a non-gene region
• Start, stop codons, further compositional differences– Then, a putative function should be found for the gene located
Dean, A. M. and G. B. Golding: Pacific Symposium on Bioinformatics 2000
Evolution and three-dimensional protein structure information
Isocitratedehydrogenase:
The distance fromthe active site(in yellow) determinesthe rate of evolution(red = fast evolution, blue = slow evolution)
Genomic Data Sources• DNA/protein sequence • Expression (microarray)• Proteome (xray, NMR,
mass spectrometry)• Metabolome• Physiome (spatial,
temporal)
Integrative bioinformatics
Dinner discussion: Integrative Bioinformatics & Genomics VUDinner discussion: Integrative Bioinformatics & Genomics VU
metabolomemetabolome
proteomeproteome
genomegenome
transcriptometranscriptome
physiomephysiome
Genomic Data SourcesVertical Genomics
DNA makes RNA makes Protein(reminder)
DNA makes RNA makes Protein:Expression data
• More copies of mRNA for a gene leads to more protein
• mRNA can now be measured for all the genes in a cell at ones through microarray technology
• Can have 60,000 spots (genes) on a single gene chip
• Colour change gives intensity of gene expression (over- or under-expression)
Proteomics
• Elucidating all 3D structures of proteins in the cell
• This is also called Structural Genomics• Finding out what these proteins do • This is also called Functional Genomics
Protein-protein interaction networks
Metabolic networks
Glycolysis and
Gluconeogenesis
Kegg database (Japan)
High-throughput Biological Data
• Enormous amounts of biological data are being generated by high-throughput capabilities; even more are coming– genomic sequences– arrayCGH (Comparative Genomic Hybridization)
data, gene expression data– mass spectrometry data– protein-protein interaction data– protein structures– ......
Protein structural data explosionProtein Data Bank (PDB): 14500 Structures (6 March 2001)10900 x-ray crystallography, 1810 NMR, 278 theoretical models, others...
Dickerson’s formula: equivalent to Moore’s law
On 27 March 2001 there were 12,123 3D protein structures in the PDB: Dickerson’s formula predicts 12,066 (within 0.5%)!
n = e0.19(y-1960) with y the year.
Sequence versus structural data• Structural genomics initiatives are now in full
swing and growth is still exponential.
• However, growth of sequence data is even more rapidly. There are now more than 500 completely sequenced genomes publicly available.
Increasing gap between structural and sequence data (“Mind the gap”)
BioinformaticsLarge - external(integrative) Science Human
Planetary Science Cultural Anthropology
Population Biology Sociology Sociobiology Psychology Systems Biology Biology Medicine
Molecular Biology Chemistry Physics
Small – internal (individual)
Bioinformatics
Bioinformatics• Offers an ever more essential input to
– Molecular Biology– Pharmacology (drug design)– Agriculture– Biotechnology– Clinical medicine– Anthropology– Forensic science– Chemical industries (detergent industries, etc.)