Interleukin 6 Supports the Maintenance of p53 Tumor Suppressor Gene Promoter Methylation

Interleukin 6 Supports the Maintenance of p53 Tumor Suppressor

Gene Promoter Methylation

David R. Hodge,1Benjamin Peng,

1James C. Cherry,

2Elaine M. Hurt,

4Stephen D. Fox,

5

James A. Kelley,3David J. Munroe,

2and William L. Farrar

1

1Laboratory of Molecular Immunoregulation, Cytokine Molecular Mechanisms Section and Laboratories of 2Molecular Technologyand 3Medicinal Chemistry, Center for Cancer Research, National Cancer Institute at Frederick; and 4Intramural Research SupportProgram-Basic Research Program and 5Separations Technology Group, Science Applications International Corporation-Frederick,Frederick, Maryland

Abstract

A strong association exists between states of chronicinflammation and cancer, and it is believed that mediatorsof inflammation may be responsible for this phenomenon.Interleukin 6 (IL-6) is an inflammatory cytokine known toplay a role in the growth and survival of many types oftumors, yet the mechanisms employed by this pleomorphiccytokine to accomplish this feat are still poorly understood.Another important factor in tumor development seems tobe the hypermethylation of CpG islands located within thepromoter regions of tumor suppressor genes. This commonepigenetic alteration enables tumor cells to reduce orinactivate the expression of important tumor suppressorand cell cycle regulatory genes. Here we show that in the IL-6–responsive human multiple myeloma cell line KAS 6/1,the promoter region of p53 is epigenetically modified bymethyltransferases, resulting in decreased levels of expres-sion. Furthermore, cells treated with IL-6 exhibit an increasein the expression of the DNA maintenance methylationenzyme, DNMT-1. The DNA methyltransferase inhibitorzebularine reverses the methylation of the p53 promoter,allowing the resumption of its expression. However, whenzebularine is withdrawn from the cells, the reestablishmentof the original CpG island methylation within the p53promoter does not occur in the absence of IL-6, and cellswhich do not receive IL-6 eventually die, as p53 expressioncontinues unchecked by remethylation. Interestingly, thisloss of viability seems to involve not the withdrawal ofcytokine, but the inability of the cell to resilence thepromoter. Consistent with this model, when cells thatexpress IL-6 in an autocrine fashion are subjected toidentical treatment, p53 expression is reduced shortly afterwithdrawal of zebularine. Therefore, it seems IL-6 is capableof maintaining promoter methylation thus representing oneof the possible mechanisms used by inflammatory mediatorsin the growth and survival of tumors. (Cancer Res 2005;65(11): 4673-82)

Introduction

Epigenetic alteration of DNA represents an important aspectof cell function and is responsible for significant changes that

can lead to tumorigenesis (1). The mammalian genome containsonly 20% of the predicted CpG dinucleotides with only 70% ofthis subset being found in a methylated state (2). However, CpGislands found associated with the promoters of many genesmaintain the expected frequency of this dinucleotide and remainunmethylated (3). Methylation of the cytosines found in CpGdinucleotides by DNA methyltransferases regulates transcription,ultimately affecting chromatin structure (4). This epigeneticprocess also serves to reduce the spread of retrotransposons andstabilizes the repetitive DNA elements in the genome (5). Finally,DNA methylation is highly specific throughout the mammaliangenome, such specificity being important for embryonic devel-opment and proper differentiation of cells (6). Inappropriatemethylation of CpG islands is associated with histone deacety-lation and gene silencing, and methylation of CpGs outside ofCpG islands is associated with significantly higher mutationrates (7, 8).Hypermethylation of CpG islands located in the promoter

regions of tumor suppressor genes has been described in almostall tumors (9). Many other important cellular functions are alsoaffected by this aberrant methyltransferase activity; for example,DNA repair enzymes, hMLH1 , MGMT (10); cell cycle check-point genes such as Rb (11), p16INK4a (12), p15INK4b (13), andp14ARF (14); apoptosis-related genes such as DAPK (15); andgenes involved in the removal and attenuation of oxidative-freeradicals, MnSOD (16) and GSTP-1 (17), are all inactivated bypromoter methylation. A likely cause of this inactivation is thebinding of 5-methylcytosine specific proteins to CpG sites, whichinterferes with the binding of transcription factors necessary forgene expression (18). However, little is known regarding thesignaling mechanisms that drive aberrant methylation and whyonly certain classes of genes are susceptible to epigeneticsilencing.The use of DNA methyltransferase inhibitor drugs to reduce or

block the ability of the DNA cytosine methyltransferases (DNMT)from methylating CpG islands allows the reexpression of previouslysilenced genes (19). Once reactivated by methyltransferaseinhibitors, these formerly silenced genes then carry out theirfunctions of cell cycle arrest, tumor suppression, DNA repair, etc.,all functions blocked previously by methylation (19). A problemencountered frequently with nucleotide analogue–based DNAmethyltransferase inhibitors is toxicity, as they covalently bindDNA cytosine methyltransferases following incorporation of thedrug into DNA (20, 21). It has been suggested that these drugsmimic DNA damage in neoplastic cells, triggering an apoptoticresponse (21). However, these drugs suffer reduced efficacy due totheir incorporation into the DNA of normal cells, resulting inundesired toxic and apoptotic effects (21).

Requests for reprints: David R. Hodge, Laboratory of Molecular Immuno-regulation, Cytokine Molecular Mechanisms Section, Center for Cancer Research, TheNational Cancer Institute at Frederick, Building 560, Room 31-76, 1050 Boyles Street,Frederick, MA 21702. Phone: 301-846-6865; E-mail: [email protected].

I2005 American Association for Cancer Research.

www.aacrjournals.org 4673 Cancer Res 2005; 65: (11). June 1, 2005

Research Article

Research. on February 23, 2016. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

Interleukin 6 (IL6) is an inflammatory cytokine with the abilityto induce tumor growth, metastasis, and resistance to chemo-therapy in a variety of tumor cells (22). IL-6 is known to activateseveral signaling pathways, including the Janus-activated kinase/signal transducer and activator of transcription 3 (JAK-STAT3),phosphoinositol-3 kinase (PI-3K), and mitogen-activated proteinkinase pathways (22–24). Multiple myeloma is a progressive,neoplastic disease characterized by the expansion of B-lympho-cyte clones, during progression to fully differentiated plasmacells (25). Almost all myeloma cells are responsive to IL-6, withmany requiring it for growth (22). Furthermore, IL-6 acts as anantiapoptotic mediator in myeloma cells, whereas in normalcells, its functions seem to involve mainly cell differentiation anddevelopment (24). Previously, we have described the ability of IL-6to induce the expression and activity of DNMT-1, the mainte-nance methylase, in the human erythroleukemia cell line K-562(26). This finding suggested that IL-6 may affect epigeneticmechanisms outside its previously described functions involvingthe mediation of inflammation and differentiation. For example,in K562 cells, IL-6 induces the expression of the Fli-1/ERG-Btranscription factor by direct activation of STAT3, a transcriptionfactor shown previously to possess oncogenic potential (27). Theactivation of STAT3 has been shown important in the oncogenesisof many types of cancer (28).Using the IL-6–responsive multiple myeloma KAS 6/1 and IL-6

autocrine IM-9 cell lines, we show that p53 is epigeneticallysilenced, resulting in decreased levels of expression. The DNAmethyltransferase inhibitor zebularine reversed the methylationpresent in the promoter of p53, allowing a marked increase ingene expression (29). In addition, when compared with 5-aza-2V-deoxycytidine (decitabine), zebularine seemed less toxic asevidenced by its ability to derepress gene expression in tumorcells without concomitant normal cell death (30). Following drugtreatment, the methylation status of p53 seemed a function ofwhether or not IL-6 was present, because in KAS 6/1 cells thewithdrawal of zebularine alone was insufficient for thereestablishment of the original methylation patterns andrequired the addition of IL-6. This IL-6–mediated remethylationtakes place within 48 to 72 hours following the removal ofzebularine. Cells that did not receive IL-6 eventually died,presumably because p53 expression continued unabated byremethylation. Further evidence of the importance of IL-6 inmaintaining the methylation of p53, comes from using the IL-6autocrine cell line IM-9. When zebularine was withdrawn fromIM-9 cells, the p53 promoter remethylated and the cells survived,without the addition of IL-6. We also show that IL-6 induced theexpression of DNMT-1 in KAS 6/1 cells, an observationconsistent with our reports in other hematopoietic cell types(26). Our data suggests that the inflammatory cytokine IL-6 iscrucial to the establishment and maintenance of p53 promotermethylation, providing a model demonstrating how mediators ofinflammation contribute to epigenetic silencing of tumorsuppressor genes and tumor cell survival.

Materials and Methods

Quantitative determination of the ratio of 5-methyl-2V-deoxycyti-dine to total deoxycytidine residues in genomic DNA by microcolumnliquid chromatography. These studies were carried out using an Agilent

Technologies series 1100 Capillary Liquid Chromatograph equipped with

a binary pump, online degasser, diode array UV detector with 500 nL

flow cell, thermostated column compartment, and thermostated micro

autosampler. The mobile phase was composed of 50 Amol/L NaH2PO4

(pH 5.0) and methanol delivered at 15 Al/min. A gradient from 2%

methanol for 2 minutes, increasing to 8% over the next 13 minutes, and

increasing to 60% over the final 10 minutes of a total runtime of 25

minutes was employed. The detector was set to monitor 280 nm toprovide maximum sensitivity for 5-methyl-2V-deoxycytidine and peak apex

spectra were taken to confirm peak identity. Separation of free

deoxyribonucleosides was accomplished using a 150 � 0.5 mm ID

microcolumn packed with 5 um Luna C18(2) stationary phase obtainedfrom Phenomenex (Torrance, CA) thermostated at 35jC. Nuclease P1 and

bacterial alkaline phosphatase enzymatic digests, containing f10 Ag of

genomic DNA, were dried using vacuum centrifugation and reconstituted

in 20 AL of deionized water to yield a concentration of about 0.5 Ag/AL.The micro autosampler injected 2 AL onto the analytic column, which is

the equivalent of 1 Ag of DNA. Analytic reference standards of 5-methyl-

2V-deoxycytidine (m5dC) and 2V-deoxycytidine (dC) were obtained fromSigma (St. Louis, MO) and stock standard solutions were prepared in

deionized water at a concentration of 2 mmol/L each. Working standard

mixtures were prepared at the following concentrations of 2V-deoxycyti-

dine: 1,000, 500, 200, 100, 50, and 25 Amol/L with correspondingconcentrations for 5-methyl-2V-deoxycytidine of 50, 25, 10, 5, 2.5, and

1.25 Amol/L. Linear calibration curves (R2 > 0.9995) were constructed for

2V-deoxycytidine and 5-methyl-2V-deoxycytidine and used to determine

nucleoside concentrations in the DNA digests. The molar ratio as apercent was calculated as follows;

mol % m5dC ¼ ð½m5dC�=½dC� þ ½m5dC�Þ � 100

The mole percent of 5-methyl-2V-deoxycytidine could be determined in aslittle as 0.25 g of total DNA with an absolute error of less than F0.1% (31).

Cell lines and methyltransferase inhibitor drug treatment. The

human multiple myeloma cell lines KAS 6/1 and IM-9 were grown in

RPMI 1640 supplemented with 4 mmol/L glutamine, 10% heat-inactivatedfetal bovine serum (FBS), and 100 units each of streptomycin and

penicillin. KAS 6/1 cells were supplemented with IL-6 at a concentration

of 10 ng/mL. Cells were treated with zebularine at a concentration of250 Amol/L for 48 hours. An analogous 5 Amol/L dose of 5-aza-2V-

deoxycytidine (decitabine) was used in one experiment. For the reme-

thylation experiments, cells were washed twice with PBS followed by

growth for f120 hours in fresh medium with or without IL-6supplementation.

Genomic DNA isolation and chemical modification. Genomic DNA

was isolated from either KAS 6/1 or IM-9 cells using the QIAGEN DNA

isolation kit. Genomic DNA was digested with a restriction endonuclease,such as EcoRI, before chemical modification. Digested DNA (4 Ag/40 AL)

was denatured with 0.3 mol/L NaOH for 15 minutes at 37jC. The denaturedDNA was subsequently modified by 3.1 mol/L sodium bisulfite and 0.5

mmol/L hydroquinone in 480 AL under mineral oil for 16 hours at 55jC.Modified DNA was purified using the QIAquick DNA extraction kit,

according to the manufacturer’s instructions (Qiagen Inc., Valencia, CA).

The DNA was eluted with 50 AL of elution buffer (10 mmol/L Tris, pH 8.0).The modification was completed with 0.3 mol/L NaOH treatment for

15 minutes at 37jC. The modified DNA was precipitated by adding 3 mol/L

ammonium acetate (pH 7.0) and two volumes of ethanol. The precipitated

DNA was resuspended in 50 AL of water for PCR amplification.PCR of bisulfite-treated DNA. Two sequential PCRs were used to

amplify the modified DNA fragments of interest. Two microliters of

modified DNA template were used in the first PCR. Nested primers were

used in the subsequent PCR. The primers for the p53 gene promoter regionare (Genbank accession no. X54156) are (a) first PCR, 5V-TGCCCTCA-

CAGCTCTGGCTTGCAGAATTT-3V (sense, nucleotides 584-612) and 5V-

ACTGAACTTGATGAGTCCTCTCTGAGTCA-3V (antisense, nucleotides 961-989); (b) nested PCR, 5V-GCAGAATTTTCCACCCCAAAATGTTAGTATC-3V

(sense, nucleotides 604-634) and 5V-CTGGATTGGGTAAGCTCCT-GACT-

GAACTTG-3V (antisense, nucleotides 941-970). PCR conditions were as

follows: 95C for 30 seconds followed by 35 cycles of 95jC for 30 seconds,55jC for 30 seconds, 72jC for 2 minutes; and finally 10 minutes at 72jC.

Cancer Research

Cancer Res 2005; 65: (11). June 1, 2005 4674 www.aacrjournals.org



The PCR mixture contained 1� buffer (Invitrogen, Carlsbad, CA) with2.5 units Taq polymerase, 3 mmol/L MgCl2, 1 Amol/L of each primer, and

0.2 mmol/L deoxynucleotide triphosphates. The amplified DNA fragment of

expected size was subjected to cloning, using the pCR4-TOPO TA cloning

vector (Invitrogen). Ten individual recombinant clones were sequenced foreach group.

Analysis of gene expression by quantitative PCR. Total RNA was

extracted from cells using TriZol Reagent (Life Technologies, Inc.,

Gaithersburg, MD), and cDNAs were prepared by reverse transcribing 1 Agof total RNA using the Single-Strand cDNA Synthesis Kit (Roche Diagnostics

Co., Indianapolis, IN) according to manufacturer’s protocol. Quantitative

PCR (Q-PCR) analysis was done using Taqman probes (Applied Biosystems,

Foster City, CA) according to the manufacturer’s instructions, in 10 AL finalvolumes, in 384-well microtiter plates (32). Thermocycling conditions using

an Applied Biosystems ABI-7900 SDS were as follows: 50jC for 2 minutes,

95jC for 10 minutes, and 40 cycles of 95jC for 10 seconds and 60jC for1 minute. Specific primers for Q-PCR of glyceraldehyde-3-phosphate

dehydrogenase (GAPDH), p53, and DNMT-1 were designed using Applied

Biosystems Assay-by-Design primer design software, and their sequences

are proprietary in nature. The target mRNA expression was normalized tothe GAPDH expression, and the relative expression was calculated back to

the untreated controls for each cell type.

Retrovirus constructs for short hairpin RNA knockdown andexpression of WT-p53. Phoenix-Amphotrophic Retroviral Packaging cellswere plated at 1.5 to 2 million cells per 60-mm plate in DMEM with 10%

FBS, 1% penicillin-streptomycin, 1% glutamine, 18 to 24 hours before

transfection. Approximately 2 Ag of each plasmid containing the desiredinserts (pLZRS-IRES-p53 or pRSMX) were prepared for transfection into

cells by using FuGene-6 Transfection Reagent (Roche Diagnostics)

according to the manufacturer’s instructions. After f16 hours, the

recombinant retrovirus containing media was filtered through a 0.22-Amdisposable filter. Infectious supernatants were supplemented with 5 Ag/mL

Polybrene to assist in virus attachment. Virus at a multiplicity of infection off10 particles per cell ratio was allowed to infect myeloma cells. Sequences

for pRSMX inserts used for p53 knockdown were as follows: (sense) 5V-GATCCCCGACTCCAGTGGTAATCTACTTCAAGAGAG-TAGATTACCACTG-

GAGTCTTTTTGGAAA-3V and (antisense) 5V-AGCTTTTCCAAAAAGACTC-

CAGTGGT-AATCTACTCTCTTGAAGTAGATTACCACTGGAGTCGGG-3V forinsert one; (sense) 5V-GATCCCCGTCTGT-GACTTGCACGTACTTCAAGA-

GAGTACGTGCAAGTCACAGACTTTTTGGAAC-3V and (antisense) 5V-

AGCTGTTCCAAAAAGTCTGTGACTTGCACGTACTCTCTTGAAGTACGTG-

CAAGTCACAGACGGG-3V, for insert two.Ribonuclease protection assays (RPA). Total RNA from untreated,

zebularine treated, and cells allowed to reestablish their methylation

patterns following withdrawal of zebularine, were extracted by TriZol

Reagent and quantified by spectrophotometer. RNase protection assays(RPA) were done according to the manufacturer’s protocol (BD

Biosciences, San Jose, CA) (RiboQuant RPA Kit). Briefly, 20 Ag of total

RNA were hybridized overnight at 56jC to 2 � 106 cpm of 33P-labeled

probe corresponding to the multiprobe template set hCC-2, Human CellCycle Regulators (BD Biosciences). Unhybridized RNA was digested first

with RNase T1 and RNase A for 45 minutes at 30jC and with Proteinase K

for 15 minutes at 37jC. After phenol/chloroform extraction and sodiumacetate/ethanol precipitation, hybridized RNA probes were denatured at

90jC for 3 minutes and electrophoresed on a 6% polyacrylamide gel. The

dried gels were exposed to X-ray film.

Results

Zebularine reduces the levels of 5-methyl-2V-deoxycytidinein KAS 6/1 multiple myeloma cells. Recently, a new DNAmethyltransferase inhibitor drug, zebularine, was shown to haveconsiderably reduced toxicity, whereas retaining the ability toreactivate genes silenced by methylation. Zebularine is markedlymore stable under physiologic and pharmaceutical conditions thanpreviously used nucleotide analogues thus making it more

attractive for clinical use (33). To show that zebularine functionedas a DNMT inhibitor in multiple myeloma cells, we analyzed thelevels of 5-methyl-2V-deoxycytidine versus unmethylated 2V-deoxy-cytidine, in genomic DNA. The myeloma cells were treated with250 Amol/L zebularine for 48 hours in the presence of 10 ng/mL IL-6 in complete RPMI 1640. DNA from control and zebularine-treatedcells was analyzed to determine the ratio of 5-methyl-2V-deoxycytidine to total deoxycytidine by high-performance liquidchromatography (HPLC). As seen in Fig. 1 and the accompanyingtable, control and remethylated samples are virtually identical withrespect to the 5-methyl-2V-deoxycytidine peak, but over one half ofthe 5-methyl-2V-deoxycytidine was converted to the unmethylatedform after treatment with zebularine for 48 hours. Remethylatedcells were allowed to recover methylation over f1 week’s time,their HPLC trace for 5-methyl-2V-deoxycytidine was identical to thecontrol cells (data not shown).Comparison of effects of decitabine and zebularine on KAS

6/1 multiple myeloma cells. To compare the ability of decitabineversus zebularine to reverse epigenetic silencing of cell cycle andtumor suppressor genes, RPA using total RNAs harvested from KAS6/1 control cells and cells treated with either 5 Amol/L decitabineor 250 Amol/L zebularine for 48 hours were done. These dose levelsrepresent median levels of the inhibitors and were chosen toprovide a side-by-side comparison of their performance. Previous-ly, we determined that decitabine had a very narrow range ofefficacy in both myeloma cell lines we treated, doses of 1 Amol/Lproduced only marginally reduced levels of 5-methyl-2V-deoxycyti-dine and induced toxic effects if allowed to remained longer than48 to 72 hours in culture. A dose of 5 Amol/L decitabine producedslightly more reduction in 5-methyl-2V-deoxycytidine, but onceagain, problems with toxicity were encountered. As shown inFig. 2A , zebularine elevated p53 expression levels compared withcontrol cells, whereas an equivalent dose of decitabine actuallyreduced the expression of almost all genes in the group, includinga slight reduction in control gene expression. Microscopicexamination of the drug-treated cells revealed that significanttoxic effects (membrane disruptions, cell debris) were encounteredin decitabine-treated cells, whereas zebularine produced fewoutwardly visible effects. Cell death at the 48-hour time pointwas determined by trypan blue absorption assay and showedf30% to 35% of the decitabine-treated cells took up the dye,whereas zebularine treatment resulted in only 5% to 7%absorption. By comparison, the untreated control cells showedtrypan blue absorption levels of about 1% (data not shown). TheRPA results and trypan blue absorption assay data indicate thatzebularine was superior to decitabine for inducing the expressionof important tumor suppressor genes such as p53 , presumablyrepressed by methylation.Gene resilencing by removal of zebularine from KAS 6/1 and

IM-9 multiple myeloma cells.We next compared the expressionpatterns of the p53 tumor suppressor genes in KAS 6/1 and IM-9cells. The KAS 6/1 cells are IL-6 responsive multiple myelomacells, whereas IM-9 is an IL-6 autocrine, multiple myeloma cellline. KAS 6/1 cells grown in complete RPMI 1640 supplementedwith 10 ng/mL IL-6 and IM-9 cells grown in complete RPMI1640 without IL-6 added were both treated with 250 Amol/Lzebularine for 48 hours. Following drug treatment, a portion ofthe cells was rinsed with PBS to remove the drug andtransferred to a new flask to recover their methylation patterns.Next, RPAs were done using total RNAs extracted from control(NEG), drug-treated (ZEB), and remethylated (REMET) KAS 6/1

IL-6 Maintains p53 Promoter Methylation




and IM-9 multiple myeloma cells. In Fig. 2B , lane 1 showsexpression levels of cell cycle control and tumor suppressorgenes before treatment with 250 mol/L zebularine. Theexpression levels of p53 were greatly increased as a result ofzebularine treatment in both KAS 6/1 and IM-9 cell lines (lane 2),and following withdrawal of zebularine (lane 3), expressionreturned to pretreatment levels. This suggests that p53, animportant apoptotic mediator, was epigenetically silenced bymethylation, and that this silencing could be reversed by zebularine.Interestingly, during the course of these experiments we observedthat demethylated KAS 6/1 cells survived the remethylation periodonly when supplemented with IL-6, whereas the autocrine IL-6producer IM-9 encountered no difficulties. Therefore, we hypothe-sized that IL-6 was playing a role in mediating the remethylationprocess.Bisulfite sequencing analysis of the p53 promoter region.We

next examined the methylation status of the p53 promoter regionto directly assess the effects of zebularine. Genomic DNA fromKAS 6/1 and IM-9 control cells, zebularine-treated cells, and cellsallowed to remethylate was chemically modified to convertcytosines into uracils. Methylated cytosines are protected fromthis modification and thus remain as cytosines when sequenced.We considered a CpG motif to be regulated by methylation if itwas methylated in untreated DNA, demethylated when treatedwith zebularine, and shown to remethylate in a consistent fashion

when the drug was removed. The promoter region depicted inFig. 3, close to the first exon of p53, is shown to undergo bothCpG and CpA methylation. A consensus of the methylated sitesappears in bold font. The methylation of cytosines found inseveral CpA sites is a departure from the classic CpG motif, thepreferred substrate of DNMT-1. These less commonly seen CpAsites are instead usually modified by the DNMT-3A or DNMT-3Bde novo methylases (34). Furthermore, we observed that some ofthe CpA sites did not remethylate as quickly as the CpG sites, anda few remained unmethylated following drug withdrawal and IL-6addition. The different recovery kinetics suggest that the methyl-ated CpA sites could be targeted by the de novo DNMT-3A orDNMT-3B methyltransferases and not the DNMT-1 maintenancemethyltransferase that remethylates its CpG dinucleotides in amore consistent fashion (35). Based on the observations of the p53promoter region, it is likely that zebularine not only reversesmethylation in CpG sites but also reverses the methylation at CpAsites that are the probable targets of de novo DNMT-3A or DNMT-3Bmethylases. Also shown in Fig. 3 are the positions of transcriptionfactor binding sites known to be present in the p53 promoter, someof which could be affected by methylated CpG binding proteins.Remethylation expression time course analysis of p53. To

determine the influence of IL-6 on the kinetics of p53 expression inKAS 6/1 and IM-9 cells, a time course of remethylation was done.KAS 6/1 and IM-9 cells were treated with zebularine (day 1) to

Figure 1. Zebularine reduces the levels of 5-methyl-2V-deoxycytidine (m5dC) in KAS cells. Levels of methylated cytosine were determined by spectral peak analysisof completely digested DNAs. Totally digested DNAs from control, zebularine treated, and cells allowed to recover from zebularine, were analyzed to determine theratio of 5-methyl-2V-deoxycytidine to total deoxycytidine by HPLC. Control and remethylated samples (remethylated graphic not shown) are virtually identical with respectto the 5-methyl-2V-deoxycytidine peaks, but over one half of the 5-methyl-2V-deoxycytidine are converted to unmethylated form after treatment with zebularine.

Cancer Research




demethylate the promoters, and the cells were then washed andallowed to recover for 6 days. Levels of expression shown for day 2represent those following 48 hours treatment with zebularine. Wehad previously determined this to be the time when remethylationwas occurring. In the presence of IL-6, KAS 6/1 p53 expression levelsdecrease to below pretreatment levels and remain low (Fig. 4A).However, when IL-6 was withheld during the remethylation phase(Fig. 4B), the expression levels of p53 remained at their demethylatedlevels. Ultimately, these cell growths are arrested and graduallybegan to undergo apoptosis (data not shown). To assure that thisphenomenon was not due to cytokine deprivation inducedapoptosis, we also withheld IL-6 from untreated KAS 6/1 cells andobserved that the cells did not exhibit any significant increases inapoptosis as seen following drug treatment. Therefore, the observeddifferences between the results of Fig. 4A and B were not due tosimply withholding IL-6. Instead, we suggest a more complex model

whereby IL-6mediates the reestablishment of promoter methylationdensity that existed before drug treatment. It should be further notedthat we determined by sequence analysis that the p53 gene fromboth KAS 6/1 and IM-9 cells was intact and without mutations (datanot shown). Other evidence of intact p53 genes in some multiplemyelomas comes from the use of the proteosome inhibitor PS-341 inmultiple myeloma cells. PS-341 has previously been shown to induceapoptosis in multiple myeloma by preventing the proteolyticdegradation of p53 thus allowing it to function (36). To determineif IL-6 was playing a role in the remethylation process, we extendedthis analysis to the IM-9 cell line, an autocrine IL-6 producer.Figure 4C shows results very similar to those observed in KAS 6/1cells following post-drug IL-6 supplementation (Fig. 4A). The IM-9cells seemed to recover their original methylation levels, as theexpression of p53 once again was reduced to slightly belowpretreatment levels.Effects of interleukin 6 stimulation on the expression of the

DNMT-1 enzyme. Previously, we reported that IL-6 induced theexpression and activity of DNMT-1 in K-562 erythroleukemia cells(26). To determine if a similar mechanism might also be involved inmediating the remethylation phenomenon observed in KAS 6/1cells, we did real-time PCR analysis. KAS 6/1 cells were rested in lowserum (1% FBS) medium forf20 hours. The quieted cells were thenstimulated with IL-6 at a final cytokine concentration of 100 ng/mL.A fraction of cells were removed before cytokine treatment to serveas a control, and samples were withdrawn for RNA extraction at 2, 4,6, 8, and 12 hours following IL-6 treatment. A significant increase inDNMT-1 mRNA expression was observed following IL-6 treatment(Fig. 5), beginning at 2 hours post-stimulation, and increasing to apeak level at 6 hours post-stimulation. Thus, IL-6 plays a crucial rolein the remethylation process by altering the expression of theDNMT-1 enzyme. Activation of DNMT-1 expression seems respon-sible for the remethylation of the p53 promoter region.Role of p53 on apoptosis in KAS 6/1 cells. We next sought to

determine the role p53 was playing in KAS 6/1 cells followingdemethylation and whether or not the induction of apoptosis wasindeed mediated by p53. We created three KAS 6/1–based celllines using the pRSMX retroviral vector, which produces shorthairpin RNA products under the control of the H1 promoter.Figure 6A shows the expression levels of p53 protein in each of thethree stable cell lines, with an apparent reduction of at least 5-foldexpression of p53 in the two knockdown lines. Thus characterized,we next demethylated these three cell lines for 48 hours in250 Amol/L zebularine, then shifted them into drug-free medium.After 72 hours, the cells were harvested and stained with AnnexinV-PE and 7-AAD to determine if reductions in p53 expressioncorrelated with changes in the levels of apoptosis. As shown inFig. 6B , significantly higher levels of apoptotic cells (lower rightquadrant) were observed (47.66%) in the control vector cellscompared with the two p53 knockdown cell lines (14.68 and14.94%, respectively.) The trend was repeated in cells that took up7-AAD dye and were also labeled with Annexin V-PE (upper rightquadrant), representing cells that have lost membrane integrity,probably in late stages of apoptosis. This result shows thatfollowing demethylation, the release of p53 from epigeneticsilencing seems sufficient to induce apoptosis, which is minimizedin both p53 knockdown cell lines. We further examined thissystem by infecting KAS 6/1 with a retrovirus expressing wild-typep53. Using the actual reverse transcription-PCR generated p53coding sequence created from KAS 6/1 RNA, we infected cells withintact methylation patterns (no exposure to zebularine) to

Figure 2. A, RPA of 5-Aza-deoxycytidine and zebularine-treated KAS 6/1myeloma cells. RPA of total cellular RNA harvested from control cells and cellstreated with either 5 Amol/L decitabine or 250 Amol/L zebularine for 48 hours.Control RNAs for GAPDH and L32 (bottom ). The comparison of expressionprofiles for each RNA set reveals that zebularine elevates p53 expression levels,whereas an equivalent dose of decitabine actually seems to reduce theexpression of most genes, including a slight reduction in control geneexpression. The identity and position of each protected probe (side ). B, RPA ofzebularine-treated KAS 6/1 and IM-9 myeloma cells to assess remethylationpatterns. KAS cells grown in complete RPMI 1640 supplemented with 10 ng/mLIL-6 and IM-9 cells grown in complete RPMI 1640 without IL-6 added were bothtreated with 250 Amol/L zebularine for 48 hours. Lane 1, expression levels beforetreatment with 250 Amol/L zebularine. Lane 2, levels of expression following a48-hour treatment with drug. Note that p53 expression levels are increased as aresult of zebularine treatment in both cell lines. Lane 3, expression levels f5days after drug removal, with the expression of p53 returning to its original levels.





determine if this was sufficient to induce apoptosis. Approximately24 hours post-infection, we analyzed the cells using Annexin V-PEand 7-AAD staining to determine levels of apoptosis. Figure 6Cshows that retrovirally delivered wild-type p53 induced apoptosis in74.91% of KAS 6/1 cells compared with only 10.77% in cellstransduced with control vector alone thus indicating that supplyingp53 in trans is sufficient to induce apoptosis. Furthermore, thisresult suggests that the other apoptotic mediators are intact inthese cells and that methylation-mediated epigenetic silencing ofthe p53 gene plays a critical role in cell survival.Analysis of p53 expression in human multiple myeloma

cell lines and patient samples. Although mutations within theDNA and tetrameric binding domains of the p53 gene represent acommon mode of inactivation, the presence of such mutations inhuman multiple myeloma is rare (37). Furthermore, in the celllines used for this report, we found no mutations in the codingregions of any p53 cDNAs we isolated (data not shown). Geneexpression profiling has already been done on many multiplemyeloma cell lines and patient samples (38, 39). To extend ourstudies beyond KAS 6/1 and IM-9, we analyzed RNA expressionlevels in multiple myeloma cell lines profiled by Hurt et al. (39).Figure 7A shows a strong correlation among IL-6, DNMT-1, andp53 expression levels. In other words, high IL-6 expression isconcordant with high DNMT-1 expression and low levels of p53,possibly due to methylated p53 promoters. To determine if p53expression is altered in multiple myeloma patients, we looked atits expression in patient samples profiled by Zhan et al. (40).Figure 7B shows the broad expression range of p53. Over one halfof the patients show significantly reduced expression of p53, withthe extremes representing an 11-fold difference in expressionlevels. Moreover, these findings are consistent with the data weobtained with KAS-6/1 and IM-9 suggesting that the epigeneticsilencing of p53 is a common feature among myeloma patients.

Discussion

Recent reports have suggested a connection between inflamma-tion and cancer, showing that many different types of tumor cells

proliferate in response to the proinflammatory cytokine IL-6.Whereas the exact nature of the effects of IL-6 on a particular celltype varies depending upon the model, it is well documented thatIL-6 can activate at least three major pathways of cell proliferation.Furthermore, the ability of IL-6 to serve as an antiapoptotic factor byactivating the PI-3K/AKT pathway also provides myeloma cells withthe capability of resisting chemotherapeutic intervention. However,little is known of how inflammation induces or initiates tumors, or ifcytokines such as IL-6 serve only to promote the growth of alreadyestablished tumors. In this report, we have shown an important linkbetween IL-6 signaling and methylation. The epigenetic silencing ofimportant cell cycle, tumor suppressor, and inhibitor genes has beenreported previously in multiple myeloma cells (41). The p16INK4

gene is epigenetically regulated in many tumors, and we observedthis in our screening of multiple myeloma cell lines as well (41). Inaddition, we have reported that the expression of several membersof the Bcl-2 family (BAD, BAK, BIK, and BAX) are also affected bymethylation-induced silencing (41). Also interesting is the findingthat the suppressor of cytokine signaling-1 (SOCS-1), an inhibitorprotein that negatively regulates signaling from the IL-6–mediatedJAK-STAT pathway, is silenced by virtue of its hypermethylatedpromoter in some autocrine IL-6 multiple myeloma cells (38–40).As shown by the microarray data (38–40), the reduced expression

of p53 is a common theme among isolates from myeloma patientsand cell lines. Over one half of all myeloma cell lines and patientshave significantly reduced expression levels of p53. Moreover thecoordinated expression of IL-6 and DNMT-1, which inverselycorrelate to p53 expression levels, suggests that the ability of IL-6to induce methylation of the p53 promoter through up-regulation ofDNMT-1, is a common mechanism of p53 inactivation in multiplemyeloma cells (42). Clearly, loss of p53 expression is a critical eventin these cells, as shown by our knockdown and reconstitutionexperiments. The combined action of IL-6 tomediate both promotermethylation and escape from apoptosis (43), provides an attractivemodel of how chronic inflammation could lead to cancer. As acentral mediator in the initiation of apoptosis, p53 is often mutatedin tumors, and loss of p53 function is an important prognostic

Figure 3. Bisulfite sequencing analysis of the p53 promoter region. DNA bisulfite sequences for the promoter regions of p53 exon 1 region. A cytosinedinucleotide motif (CpG or CpA) was considered regulated by methylation if it was methylated in untreated DNA, demethylated when treated with zebularine, andshown to remethylate in a consistent fashion when the drug was removed. Transcription factor binding sites known to transactivate p53 expression are under eachrespective DNA sequence and referenced in the text.

Cancer Research




indicator. When examined in the context of our findings, along withthe fact that mutations in p53 are indeed rare in this particularmalignancy (37), the data strongly suggest that inflammation, in theform of IL-6, could function to gradually alter the epigeneticprogramming of the developing B lymphocyte, resulting in thereduced expression of p53 seen in many multiple myeloma cells.Cytosine methylation is an epigenetic modification that alters the

normal gene expression of cells, reducing the expression of p53below functional levels. This loss of p53 expression was reversed bytreating the cells with zebularine, a known cytidine deaminaseinhibitor recently described to possess DNA methyltransferaseinhibitor properties (44). However, the reversal of cytosinemethylation is not absolute, as in order for the drug to function itmust be incorporated into DNA, where it can covalently bind themethyltransferase enzymes (44). Because DNMT-1 preferentiallytargets CpG sites containing one methylated cytosine (hemi-methylated), other Cp‘‘X’’ sites, such as CpA, may be targeted bythe de novo DNMT-3A and DNMT-3B methylases (35). By comparingthe status of promoter methylation with the expression levels of thep53mRNA, wewere able to show a clear, inverse correlation between

expression and increased methylation. Moreover, when the drug wasremoved, in the presence of IL-6 many of the methylation sitesreturned to their original state, and repression of p53 mRNAexpression occurred. Clearly, zebularine inhibited the actions of themethyltransferases but did so against the background of constantmethyltransferase expression and activity, which likely maintains atleast some minimal level of methylation of CpG and CpA sites.The binding of methylcytosine specific proteins to various

promoter and enhancer sequences is known to interfere with thebinding of transcription factors, especially SP-1, whose DNA bindingsites contains a G/C-rich motif (45). Whereas the CpG density of thep53 promoter region is less than what has been observed in otherpromoter regions, it has been shown that merely one methylatedresidue was sufficient to repress expression of p53 (46). The ETSfamily of transcription factors is known to transactivate p53 (47),and several ETS binding sites are presentwithin the promoter regionwe analyzed. Also in close proximity to these ETS sites are multiplemethylated cytosines, which could interfere directly by stericcompetition for the site, as the ‘‘footprint’’ for the ETS familyproteins extends beyond the core binding element (47). The YY-1transcription factor also transactivates the p53 promoter (48).However, it has been shown that cytosine methylation does notblock the DNA binding and function of YY-1, whereas at the sametime, is sufficient to prevent ETS factor binding, abolishing its abilityto drive expression (49). Other crucial transcription factor bindingsites for activator protein (AP-1) and NF-6B are also present, with theAP-1 site found within the region containing the highest density ofmethylation sites. The close proximity of the methylated cytosinemotifs and the transcription factor binding sites adjacent to them,likely leads to the reduced expression of p53 because of methylationinduced changes in chromatin structure and accessibility (4).Previously, we have shown the effects of IL-6 on DNMT-1

regulation in other cell models (26), and our present data onceagain confirm the ability of IL-6 to induce the expression of DNMT-1in hematopoietic cells. The requirement for IL-6 in the methylationFigure 4. Remethylation time course analysis of p53 expression. Taqman

real-time PCR analysis of remethylation time course experiments, showing thedifferences in expression levels of p53. A, KAS 6/1 plus IL-6; B, KAS 6/1 noIL-6 added; C, IM-9 autocrine multiple myeloma cell line. Expression of p53 wasreduced in the presence of IL-6 (A and C ), whereas withholding of IL-6 allowsexpression to continue (B). Analyzed results in a format (both numericallyand graphically) showing their expression relative to not only an endogenouscontrol but also to an untreated reference sample. Bars, SE.

Figure 5. IL-6 induction of DNMT-1 expression. IL-6 induction of DNMT-1expression as determined by Taqman real-time PCR. KAS 6/1 cells (a giftfrom Dr. D.F. Jelinek, Department of Immunology, Mayo Graduate and MedicalSchools, Mayo Clinic, Rochester, MN 55905) were rested overnight in 1%FBS supplemented complete RPMI 1640. Cells were stimulated with 100 ng/mLIL6, with samples withdrawn for mRNA extraction at the intervals shown(i.e., 2, 4, 6, 8, and 12 hours after IL-6 treatment). IL-6 increased DNMT-1expression. Bars, SE.





Figure 7. Analysis of p53 expression in human multiple myeloma patients samples and cell lines. A, expression patterns of IL-6, DNMT-1, and p53 in multiplemyeloma cell lines. B, expression pattern of p53 in myeloma patient samples (40). The color scale indicates relative gene expression levels where shades of redindicate higher expression and shades of green indicate lower expression. Gray indicates missing data.

Figure 6. Role of p53 on apoptosis inKAS 6/1 cells. A, expression of p53 in threestable KAS 6/1cell lines infected with emptypRSMX virus and vector containing two shorthairpin RNAs for p53 knockdown (seeMaterials and Methods for short hairpin RNAinsert sequence). Western blots of equalizedcell lysates probed with a-p53 and a-Actinmonoclonal antibodies are shown to showdegrees of reduction in p53 expression. B,stable empty vector (pRSMX) and the twop53 knockdown cell lines were treated for48 hours in 250 Amol/L zebularine and shiftedinto drug-free medium and analyzed 72 hourslater by Annexin V-PE and 7-AAD apoptosisanalysis. Empty vector cells undergoapoptosis at significantly higher levels(47.66%) compared with the two p53knockdown cell lines (14.68% and 14.94%,respectively.) C, infection of multiple myelomacells with p53 expressing recombinantretrovirus induces apoptosis (74.91%)compared with control vector alone (10.77%).Distribution of cells is summarized in therelevant quadrants for (B) and (C).

Cancer Research




recovery step broadens the range of effects for this central mediatorof inflammation and suggests that this could be one of the reasonstumors, or cells progressing along neoplastic pathways develop adependence upon IL-6. Moreover, because deprivation of IL-6resulted in continued expression of p53 and cell death in KAS 6/1cells and supplementation with IL-6 leads to the remethylation ofthe p53 promoter, this strongly implicates IL-6 as a contributor tothe maintenance of promoter methylation. This observation isfurther supported by our use of the autocrine IL-6 cell line IM-9,whose p53 gene expression is increased following demethylation butis quickly down-regulated following removal of zebularine.Here we show that IL-6 facilitates the remethylation patterning

and epigenetic gene silencing of p53 , an important cell cyclecontrol and tumor suppressor gene, in part by modulating theexpression levels of DNA methyltransferase, DNMT-1. The notionthat chronic inflammation is an important factor in thedevelopment of neoplasia has been shown previously by seminalwork on the generation of plasmacytomas in the murine model

(50). Moreover, the induction of such tumors in animals in whichthe IL-6 gene was disrupted, was greatly reduced, suggesting animportant role for IL-6 in tumor development (51). Therefore, it ispossible that an unintended consequence of increased IL-6 activitymay in fact be its ability to induce epigenetic gene silencing by thealteration of DNMT-1 expression patterns, resulting in thedisruption of epigenetic programming. Our data shows a clearassociation between mediators of inflammation and DNA methyl-ation in the epigenetic control of tumor cell functions, andprovides one possible pathway regarding the inflammatorymediated initiation of neoplastic growth.

Acknowledgments

Received 10/6/2004; revised 2/15/2005; accepted 3/26/2005.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

References1. Nephew KP, Huang TH. Epigenetic gene silencing incancer initiation and progression. Cancer Lett 2003;190:125–33.

2. Antequera F, Bird A. CpG islands as genomic foot-prints of promoters that are associated with replicationorigins. Curr Biol 1999;9:R661–7.

3. Shimizu TS, Takahashi K, Tomita M. CpG distributionpatterns in methylated and non-methylated species.Gene 1997;205:103–7.

4. Antequera F, Boyes J, Bird A. High levels of de novomethylation and altered chromatin structure at CpGislands in cell lines. Cell 1990;62:503–14.

5. Jones PA, Takai D. The role of DNA methylation inmammalian epigenetics. Science 2001;293:1068–70.

6. Singal R, Ferris R, Little JA, Wang SZ, Ginder GD.Methylation of the minimal promoter of an embryonicglobin gene silences transcription in primary erythroidcells. Proc Natl Acad Sci U S A 1997;94:13724–9.

7. Thiagalingam S, Cheng KH, Lee HJ, Mineva N,Thiagalingam A, Ponte JF. Histone deacetylases: uniqueplayers in shaping the epigenetic histone code. Ann N YAcad Sci 2003;983:84–100.

8. Ollila J, Lappalainen I, Vihinen M. Sequence specificityin CpG mutation hotspots. FEBS Lett 1996;396:119–22.

9. Herman JG. Hypermethylation of tumor suppressorgenes in cancer. Semin Cancer Biol 1999;9:359–67.

10. Matsukura S, Soejima H, Nakagawachi T, et al. CpGmethylation of MGMT and hMLH1 promoter inhepatocellular carcinoma associated with hepatitis viralinfection. Br J Cancer 2003;88:521–9.

11. Gonzalez-Gomez P, Bello MJ, Alonso ME, et al. CpGisland methylation status and mutation analysis of theRB1 gene essential promoter region and protein-binding pocket domain in nervous system tumours.Br J Cancer 2003;88:109–14.

12. Chen W, Zhu J, Liu J, Tan S. Methylation of p16 genein hematological malignancies. Chin Med J (Engl) 1998;111:1028–30.

13. Cameron EE, Baylin SB, Herman JG. p15(INK4B) CpGisland methylation in primary acute leukemia isheterogeneous and suggests density as a critical factorfor transcriptional silencing. Blood 1999;94:2445–51.

14. Silva J, Dominguez G, Silva JM, et al. Analysis ofgenetic and epigenetic processes that influence p14ARFexpression in breast cancer. Oncogene 2001;20:4586–90.

15. Narayan G, Arias-Pulido H, Koul S, et al. Frequentpromoter methylation of CDH1, DAPK, RARB, and HIC1genes in carcinoma of cervix uteri: its relationship toclinical outcome. Mol Cancer 2003;2:24.

16. Huang Y, He T, Domann FE. Decreased expression ofmanganese superoxide dismutase in transformed cells

is associated with increased cytosine methylation of theSOD2 gene. DNA Cell Biol 1999;18:643–52.

17. Harden SV, Guo Z, Epstein JI, Sidransky D. Quanti-tative GSTP1 methylation clearly distinguishes benignprostatic tissue and limited prostate adenocarcinoma.J Urol 2003;169:1138–42.

18. Nan X, Ng HH, Johnson CA, et al. Transcriptionalrepression by the methyl-CpG-binding protein MeCP2involves a histone deacetylase complex. Nature 1998;393:386–9.

19. Lin X, Asgari K, Putzi MJ, et al. Reversal of GSTP1CpG island hypermethylation and reactivation of pi-class glutathione S -transferase (GSTP1) expression inhuman prostate cancer cells by treatment withprocainamide. Cancer Res 2001;61:8611–6.

20. Christman JK. 5-Azacytidine and 5-aza-2V-deoxycyti-dine as inhibitors of DNA methylation: mechanisticstudies and their implications for cancer therapy.Oncogene 2002;21:5483–95.

21. Karpf AR, Moore BC, Ririe TO, Jones DA. Activationof the p53 DNA damage response pathway afterinhibition of DNA methyltransferase by 5-aza-2V-deoxycytidine. Mol Pharmacol 2001;59:751–7.

22. Ogata A, Chauhan D, Teoh G, et al. IL-6 triggers cellgrowth via the Ras-dependent mitogen-activated pro-tein kinase cascade. J Immunol 1997;159:2212–21.

23. Barton BE, Murphy TF, Adem P, Watson RA, Irwin RJ,Huang HF. IL-6 signaling by STAT3 participates in thechange from hyperplasia to neoplasia in NRP-152 andNRP-154 rat prostatic epithelial cells. BMC Cancer 2001;1:1–9.

24. Zhang J, Li Y, Shen B. PI3-K/Akt pathway contributesto IL-6-dependent growth of 7TD1 cells. Cancer Cell Int2003;3:1–4.

25. Biggs DD, Kraj P, Goldman J, et al. Immunoglobulingene sequence analysis to further assess B-cell originof multiple myeloma. Clin Diagn Lab Immunol 1995;2:44–52.

26. Hodge DR, Xiao W, Clausen PA, Heidecker G, Szyf M,Farrar WL. Interleukin-6 regulation of the human DNAmethyltransferase (HDNMT) gene in human erythro-leukemia cells. J Biol Chem 2001;276:39508–11.

27. Hodge DR, Li D, Qi SM, Farrar WL. IL-6 inducesexpression of the Fli-1 proto-oncogene via STAT3.Biochem Biophys Res Commun 2002;292:287–91.

28. Bowman T, Garcia R, Turkson J, Jove R. STATs inoncogenesis. Oncogene 2000;19:2474–88.

29. Cheng JC, Matsen CB, Gonzales FA, et al. Inhibitionof DNA methylation and reactivation of silenced genesby zebularine. J Natl Cancer Inst 2003;95:399–409.

30. Cheng JC, Yoo CB, Weisenberger DJ, et al. Preferentialresponse of cancer cells to zebularine. Cancer Cell 2004;6:151–8.

31. Kuo KC, McCune RA, Gehrke CW, Midgett R,Ehrlich M. Quantitative reversed-phase high perfor-mance liquid chromatographic determination of majorand modified deoxyribonucleosides in DNA. NucleicAcids Res 1980;8:4763–76.

32. Overbergh L, Giulietti A, Valckx D, Decallonne R,Bouillon R, Mathieu C. The use of real-time reversetranscriptase PCR for the quantification of cytokinegene expression. J Biomol Tech 2003;14:33–43.

33. Cheng JC, Weisenberger DJ, Gonzales FA, et al.Continuous zebularine treatment effectively sustainsdemethylation in human bladder cancer cells. Mol CellBiol 2004;24:1270–8.

34. Dodge JE, Ramsahoye BH, Wo ZG, Okano M, Li E.De novo methylation of MMLV provirus in embryonicstem cells: CpG versus non-CpG methylation. Gene2002;289:41–8.

35. Ramsahoye BH, Biniszkiewicz D, Lyko F, Clark V,Bird AP, Jaenisch R. Non-CpG methylation is prevalentin embryonic stem cells and may be mediated by DNAmethyltransferase 3a. Proc Natl Acad Sci U S A 2000;97:5237–42.

36. Hideshima T, Richardson P, Chauhan D, et al. Theproteasome inhibitor PS-341 inhibits growth, inducesapoptosis, and overcomes drug resistance in humanmultiple myeloma cells. Cancer Res 2001;61:3071–6.

37. Preudhomme C, Facon T, Zandecki M, et al. Rareoccurrence of P53 gene mutations in multiple myeloma.Br J Haematol 1992;81:440–3.

38. Shaughnessy JD Jr. Global gene expression profilingin the study of multiple myeloma. Int J Hematol 2003;77:213–25.

39. Hurt EM, Wiestner A, Rosenwald A, et al. Over-expression of c-maf is a frequent oncogenic event inmultiple myeloma that promotes proliferation andpathological interactions with bone marrow stroma.Cancer Cell 2004;5:191–9.

40. Zhan F, Hardin J, Kordsmeier B, et al. Global geneexpression profiling of multiple myeloma, monoclonalgammopathy of undetermined significance, and normalbone marrow plasma cells. Blood 2002;99:1745–57.

41. Pompeia C, Hodge DR, Plass C, et al. Microarrayanalysis of epigenetic silencing of gene expression inthe KAS-6/1 multiple myeloma cell line. Cancer Res2004;64:3465–73.

42. Finlay CA. p53 loss of function: implications for theprocesses of immortalization and tumorigenesis. Bio-Essays 1992;14:557–60.

43. Xu FH, Sharma S, Gardner A, et al. Interleukin-6-induced inhibition of multiple myeloma cell apopto-sis: support for the hypothesis that protection ismediated via inhibition of the JNK/SAPK pathway. Blood1998;92:241–51.





44. Zhou L, Cheng X, Connolly BA, Dickman MJ, Hurd PJ,Hornby DP. Zebularine: a novel DNA methylationinhibitor that forms a covalent complex with DNAmethyltransferases. J Mol Biol 2002;321:591–9.

45. Jarrard DF, Paul R, van Bokhoven A, et al. P-Cadherinis a basal cell-specific epithelial marker that is notexpressed in prostate cancer. Clin Cancer Res 1997;3:2121–8.

46. Pogribny IP, Pogribna M, Christman JK, James SJ.Single-site methylation within the p53 promoter regionreduces gene expression in a reporter gene construct:

possible in vivo relevance during tumorigenesis. CancerRes 2000;60:588–94.

47. Venanzoni MC, Robinson LR, Hodge DR, Kola I,Seth A. ETS1 and ETS2 in p53 regulation: spatialseparation of ETS binding sites (EBS) modulate protein:DNA interaction. Oncogene 1996;12:1199–204.

48. Furlong EE, Rein T, Martin F. YY1 and NF1 bothactivate the human p53 promoter by alternativelybinding to a composite element, and YY1 and E1Acooperate to amplify p53 promoter activity. Mol CellBiol 1996;16:5933–45.

49. Gaston K, Fried M. CpG methylation and the bindingof YY1 and ETS proteins to the Surf-1/Surf-2 bidirec-tional promoter. Gene 1995;157:257–9.

50. Potter M, Pumphrey JG, Walters JL. Growth ofprimary plasmacytomas in the mineral oil-conditionedperitoneal environment. J Natl Cancer Inst 1972;49:305–8.

51. Hilbert DM, Kopf M, Mock BA, Kohler G,Rudikoff S. Interleukin 6 is essential for in vivo develop-ment of B lineage neoplasms. J Exp Med 1995;182:243–8.

Cancer Research




2005;65:4673-4682. Cancer Res David R. Hodge, Benjamin Peng, James C. Cherry, et al. Suppressor Gene Promoter MethylationInterleukin 6 Supports the Maintenance of p53 Tumor

Updated version

http://cancerres.aacrjournals.org/content/65/11/4673

Access the most recent version of this article at:

Cited articles

http://cancerres.aacrjournals.org/content/65/11/4673.full.html#ref-list-1

This article cites 49 articles, 20 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/65/11/4673.full.html#related-urls

This article has been cited by 22 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

[email protected] at

To request permission to re-use all or part of this article, contact the AACR Publications


http://cancerres.aacrjournals.org/content/65/11/4673

http://cancerres.aacrjournals.org/content/65/11/4673.full.html#ref-list-1

http://cancerres.aacrjournals.org/content/65/11/4673.full.html#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

mailto:[email protected]


Interleukin 6 Supports the Maintenance of p53 Tumor Suppressor Gene Promoter Methylation

Documents