Inter and intraspecific variability in strains of the ectomycorrhizal fungus Suillus as revealed by molecular techniques

Microbiol. Res. (1997) 152,287- 292 Microbiological Research

((j Gustav Fischer Verlag

Inter- and intraspecific variability in strains of the ecto­mycorrhizal fungus Suillus as revealed by molecular techniques

P. Bonfante, L. Lanfranco, V. Cometti, A. Genre

Dipartimento di Biologia Vegetale dell'Universita di Torino, Centro di Studio sulla Micologia del Terreno del CNR, Viale Mattioli 25, 101 25 Torino, Italy

Accepted: July 4, 1997

Abstract

The genome of 13 Suillus isolates, mostly originating from Mediterranean and Alpine regions was screened by using a range of PCR-based techniques. Amplification of the ITS re­gion led to fragments of the same length irrespective of the species, whereas RFLP revealed interspecific variability. Ran­dom oligonucleotides for RAPD amplification and primers for microsatellites led to polymorphic fingerprints revealing intra­specific differences. In addition, microsatellite fingerprinting allowed separation of strains with different symbiotic capabi­lities (for example: Suillus collinitus strains 24 and 31), as well as strains originating from the same zone.

The results suggest that a range of molecular probes used on the same isolates can provide both specific fingerprints for selected fungal strains and tools to investigate the physiologi­cal characteristics of ectomycorrhizal fungi.

Key words: Suillus - microsatellites - pCR techniques -RAPD-ribosomal genes - genetic variability

Introduction

The quality of the forest seedlings used in reforestation projects is closely dependent on their ability to establish symbiotic associations with ectomycorrhizal fungi. The Suillus genus is one of the most common fungal as­sociates of the Pinaceae. It comprises approximately 70-80 species that produce epigeous mushrooms with tubular hymenophores (Kretzer et al. 1996). They occur in NOIth European forests (Dahlberg 1997), the Medi­terranean area (Mousain et al. 1994) and many North American regions (Kretzer et at. 1996). General studies of the structure and dynamics of the fungal ectomycor-

Corresponding author:_R. Bonfante

rhizal communities have chosen Suillus isolates as ex­perimental model, due to their diffusion. Somatic in­compatibility tests and analysis of isozyme variation for the discrimination of genotypes in natural populations have been developed (Fried 1987; Dahlberg and Stenlid 1990; Sen 1990; Karkouri et al. 1996). Alternatively, randomly amplified polymorphic DNA (RAPD) mar­kers have been used to determine whether somatically compatible Suillus isolates are genetically identical (Ja­cobson et at. 1993). The level of resolution provided by RAPD markers is regarded as higher than · that of other discriminating tests.

As part of a European project to improve the quality of Mediterranean forest seedlings by using selected mycorrhizal fungi, Suillus collinitus (Fr.) O. Kuntze has been demonstrated to improve the growth of pines in greenhouses or field conditions (Mousain et al. 1994). It is therefore crucial to develop molecular probes for the genetical characterization of fungal isolates, and as use­ful tools to follow their fate in field experiments (Selosse et al. 1996)

Different regions of the fungal genome have already been investigated as source of easy, reliable and sensi­tive probes for ecto- and endomycorrhizal fungi by am­plification of ribosomal genes, restriction fragment length polymorphisms (RFLP) of PCR generated frag­ments, random amplification of polymorphic DNA (RAPD) and amplification of regions containing micro­satellites. RAPD has proved particularly powelful in revealing genetic differences between closely related or­ganisms (Hadrys et al. 1992). Amplification of regions containing micro satellites is currently seen as an impor­tant tool for examination of the relations between closely related species, and the subpopulation of a single species (Tautz 1993). All these protocols display vary-

Microbial. Res. 152 (1997) 3 287

ing degree of resolution on ecto-and endomycorrhizal fungi (Lanfranco et al. 1997).

This paper describes the screening of the genome of 13 Suillus isolates, particularly of S. collinitus, with a range of PCR- based methods and evaluation of their ability to distinguish inter- and intra-specific variabili­ties between strains isolated from European forests.

Materials and methods

Fungal cultures. The origin and features of the Suillus strains are listed in Table I. Strains 1, 2, 3, 7, 9 were iso­lated from basidiocarps collected in French and Spanish Mediterranean regions, strains 4, 5, 6, 8, 10-13 in the

Table 1. List of the fungal strains, of the host plants, under which the basidiocarps were collected and origin places.

Fungal Strains Host Plants

1. Suillus collinitus Pinus halepensis (Fr.) Kuntze P2 (Bouches du Rhone)

Aix en Provence 2. Suillus collinitus Pinus halepensis

(Fr.) Kuntze P5 (Bouches du Rhone) Aix en Provence

3. Suillus collinitus Pinus pinea (Fr.) Kuntze J3-15-24 Grande Motte Herault

4. Suillus collinitus Pinus sylvestris and (Fr.) Kuntze J3-l5-25 P nigra v. austriaca

(Lozere) Col de Montmirat

5. Suillus collinitus Pinus sylvestris and (Fr.) Kuntze J3-15-30 P nigra v. austriaca

(Lozere) Col de Montmirat

6. Suillus collinitus Pimls sylvestris (Fr.) Kuntze J3-15-31 (Hautes-Alpes)

Les Jaussauds 7. Suillus bellinii J2-5-13 Pinus pinea

(Inz) Watling (Gard) Le Boucanet 8. Sui/Ius luteus Pinus sylvestris

(Fries) Gray 112-21-17 (Hautes Alpes) Les Jaussauds

9. Suillus Pinus halepensis medite rraneensis 113-4 Murcia (Spain) Jacquetant et Blun

10. Suillus grevillei Larch forest (Klotzsch) Singer 42 Piemonte (Italy)

ll. Suillus grevillei Larch forest (Klotzsch) Singer 43 Piemonte (Italy)

12. Sui/Ius bovinus Pine forest (L. ex Fr.) Kuntze Piemonte (Italy)

13. Sui/Ius granulatus Pine forest (Fries) Kuntze Piemonte (Italy)

14. Sui/Ius granulatus CBS 141.55 (Fries) Kuntze Hungary

288 Microbiol. Res. 152 (1997) 3

French and Piedmont Alps. The CBS 141.55 strain (n. 14) originated from Hungary. The cultures were maintained on the Melin-Norkrans medium (MMN), as described in Karkouri et al. (1996).

DNA extraction. DNA extraction was performed accor­ding to Henrion et al. (1994) with slight modifications. Total DNA was extracted from approximately 20 mg of freeze-dried mycelium. The sample was crushed in liquid nitrogen in a chilled (-20°) mortar and pestle. The powder was resuspended in a microcentrifuge tube in 600 ~l 100 mM Tris-HCl (pH 9.0), 20 mM EDT A (pH 8.0), 1.4 M NaCl, 2% cetyltrimethylammonium brom­ide (CTAB), 0.2% mercaptoethanol for 30-60 min at 65 cC, and centrifuged at 13.000 rpm for 5 min. The upper phase was then transferred to a new test-tube. Proteins were denatured and removed by sequential ex­tractions with 600 ~l Tris-saturated phenol/chloroform/ isoamyl alcohol (25/2411 ; v/v/v) and chloroform (Sam­brook et at. 1989) ; the aqueous phase was then taken off carefully. The solution was precipitated by adding 1.5 volume of isopropanol. DNA was pelleted by centri­fugation, washed with 70% ethanol, pelleted again, and dried at room temperature. Finally, the DNA pellet was solubilized in 40 to 50 ~l of 10 mM-Tris-HCI buffer (pH 8.0) containing 1 mM EDTA and stored at -20cC until use.

ITS peR assay. The primer pairs used to amplify the in­ternal transcribed spacers (ITS region) were ITS 1 (5'TCCGTAGGTGAACCTGCGG3' ) and ITS4 (5'TCCTCCGCTTATTGATATGC3') described by White et at. (1990). PCR amplifications of the ITS re­gion were performed as described in Henrion et at. (1994) and Mello et al. (1996). The reaction components for PCR were: 50 pmol of each primer, 0.2 mM dNTPs, 0.5 U SuperTaq-Polymerase (Stehelin, Basel, Switzer­land) and IX buffer (10 mM Tris-HCI at pH 9.0, 50 mM KCl, 1.5 mM MgC12, 0.1 % Triton X-lOO, 0.1 mg/ml BSA). For each reaction, 2 ~l of a 10 to 100-fold dilu­tion of extracted DNA were placed in a 0.5 ml polypro­pylene tube, to which 48 ~l of the mixture of all the other reaction components were then added. Negative controls (no DNA template) were included, to test for the presence of contaminant DNA. Cycling parameters were: an initial denaturation at 95 cc for 3 min, followed by 40 cycles of denaturation at 95 cc fbr 90 sec/annea­ling at 50 DC for 45 sec/extension at 72 DC for 90 sec, with a final extension at 72 DC for 5 min. The amplifica­tion reaction was performed in a Perkin Elmer thermal cycler.

The amplification products were fractionated using 1.7% agarose gel run in IX TBE buffer (Sambrook et at. 1989). Restriction reactions were performed according to Mello et al. 1996. The restriction fragments were se­parated using a 2% agarose gel. Agarose gels were stai-

ned with ethidium bromide and photographed under UV light.

RAPD assay. Seven primers of arbitrary sequences ob­tained from Operon Technologies, Inc. (Alameda, CA) (OPA, OPB) were used in single-primer reactions ac­cording to Wyss and Bonfante (1993).

Microsatellite assay. The microsatellite regions were amplified with the following primers: (5'CTCTCTCT­CTCTCTCT3'), (5'CACACACACACACACA3'), (5'GACAGACAGACAGACA3'), (5'TGTCTGTC­TGTCTGTC3'), and (5'GTGGTGGTGGTGGTG3') (Lieckfeldt et al. 1993; Buscot et al. 1996) obtained from Primm s.r.l. (Milan, Italy). The amplification ex­periments were performed as described in Longato and Bonfante (1997): the reaction mixture consisted of 50 III of diluted DNA extract (1/5, 1110, 1/50) and 50 III of re­action buffer (10 mM Tris-HCL pH 8.8,1.5 mM MgC12, 50 mM KCl, 0.1 Triton X-IOO), 200 11M each of dNTPs (Promega), 400-500 ng di primer and Taq DNA poly­merase (0.4-1 U, DynaZyme, Celbio). Primers (CT)g, (CA)8' (GACA)4' (TGTC)4' (GTG)s were used in reac­tions run in accordance with a "touchdown" PCR protocol (Don et ai. 1991). The amplification reaction with (GTGh was performed in a Perkin Elmer thermal cycler programmed as follows: starting at an annealing temperature of 70 DC, reduction by 1 DC at each subse­quent cycle to 55 DC, "20 cycles at 55 DC. Reactions with (CT)g, (CA)8' (GACA)4' (TGTC)4 were run with an an­nealing temperature of 48 DC. The amplification pro­ducts were analyzed by electrophoresis in 1.3-1.5% agarose gel.

Results

ITSIRFLP

ITS amplification from Suillus mycelia showed frag­ments of about 600-650 base pairs in length for all the tested strains (Fig. 1).

M 1 2 3 4 5 6 7 8 9 10 11 12 M' c

Digestion with EcoR I, Rsa I and Taq I did not reveal any specific fingerprint (not shown). Other enzymes re­vealed different patterns (Figs. 2-4). Hae III grouped the S. collinitus isolates with S. mediterranensis, S. lu­teus, S. bellini, while DNA from S. grevillei 42 and 43 and S. bovinus was not digested (Fig. 2). Sau3A I allo­wed a further separation among S. collinitus isolates, since it distinguished strains 24, P2 and P5 from the strains 25, 30, 31 (Fig. 3).

Hinf I produced fingerprints which allowed to distin­guish all the species. In addition, it split S. collinitus iso­lates in two groups: i) strains 25 and 30 and ii) strains 24, 31, P2 and P5. The two S. grevillei isolates also re­vealed a different fingerprint (Fig. 4).

RAPD experiments

RAPD experiments performed on isolates belonging to the different species led to highly polymorphic finger­prints (not shown). The experiments were therefore fo­cused on the six S. collinitus and the two S. granulatus strains. The short random primers (OPA 16, 7, 13 and OPB 7) revealed differences in size and intensity of bands. Figure 5 shows an experiment where OPA 16 pro­duced bands specific for strains 24 (arrow) or 25 (arrow head). The S. granulatus strains also differed in some intense bands. In addition to the polymorphic bands, some bands were common to all the isolates.

Microsatellite primers

The primers (GACA)4; (GAC)s; (CT)gI(GAC)s; (GACV(GTG)s led to the amplification of the fungal DNA, whereas negative results were obtained with (GTG)s; (GCTC)4; (CT)8; (CA)g; (CT)g/(CA)8; (TGTCji(GACA)4' The successful primers led to fingerprints that revealed intraspecific differences. The amplification pattern from S. collinitus 24 from a Me­diterranean site was clearly different from those of strains 25, 30 and 31 collected in Alpine zones. By con­trast, no differences were seen between strains P2 and P5 collected in the same site (Fig. 6).

- 'i l! i' bp

Fig. 1. PCR amplified ITS regions from 12 Suillus strains. Lanes: 1. Sudlus mediterranensis: 2. S. luteus: 3. S. bovinus: 4. S. bellini: 5. S. grevillei 42; 6. S. grevillei 43: 7. S. collinitus J3-15-24: 8. S. collinitus J3-15-25: 9. S. collinitus J3-15-30; 10. S. collinitus J3-15-31: 11. S. collinitus P2: 12. S. collinitus P5. Lane M: lambda DNAd_igested with EcoR I-Hind III: lane M': pUC 18 digested withHae III; lane c: control reaction (no DNA).

Microbial. Res. 152 (1997) 3 289

~'iKbp­

lh7bp-

Ha e I [ I

M 1 2 3 4 5 6 7 8 9 10 11 12

Fig.2. PCR amplified ITS regions digested with Rae III. Lanes: 1. Suillus mediterranensis; 2. S. luteus; 3. S. bovinus; 4. S. bellini; 5. S. grevillei 42; 6. S. grevillei 43; 7. S. collin i­tus 13-15-24; 8. S. collinitus 13-15-25; 9. S. collinitus 13-15-30; 10. S. collinitus 13-15-31; 11. S. collinitus P2; 12. S. col­linitus P5. Lane M: pUC 18 digested with Rae III.

..t:); hp -

26" hp -

Sau 3A [ M 1 2 3 4 5 6 7 8 9 10 n 12

Fig.3. PCR amplified ITS regions digested with Sau3A I. Lanes: 1. Suillus mediterranensis; 2. S. luteus; 3. S. bovinus; 4. S. bellini; 5. S. grevillei 42; 6. S. grevillei 43; 7. S. collin i­tus 13-15-24; 8. S. collinitus 13-15-25; 9. S. collinitus 13-15-30; 10. S. collinitus 13-15-31; 11. S. collinitus P2; 12. S. col­linitus P5. Lane M: pUC 18 digested with Rae III.

-t'iH hp ­

_67 np -

au3

M 1 2 3 456 7 8 9]0]112

-.. • -.. . -= -11,1;11-· , ... -; ~ . .. ~ ":iJ . ' ii -

Fig. 4. PCR amplified ITS regions digested with Rinf I. Lanes: 1. Suillus mediterranensis; 2. S. luteus; 3. S. bovinus; 4. S. bellini; 5. S. grevillei 42; 6. S. grevillei 43; 7. S. collini­tus 13-15-24; 8. S. collinitus 13-15-25; 9. S. collinitus 13-15-30; 10. S. collinitus 13-15-31; 11. S. collinitus P2; 12. S. col­linitus P5. Lane M: pUC 18 digested with Rae III.

290 Microbiol. Res. 152 (1997) 3

Discussion

The position of Suillus in the phylogenetic trees and the distribution of genotypes in populations of fungi belong­ing to this complex genus have been the subject of se­veral studies, which have considered a range of mole­cular characters. Isozyme variations and RAPD markers have been mostly used to reveal intraspecific variations, while sequences of conserved genome regions have pro­vided tools to identify the ectomycOlThizal fungi and build up refined phy logenetics trees (Kretzer et al. 1996, Mousain et aZ. 1994, Dahlberg and Stenlid 1990).

The present experiments on Suillus isolates mostly coming from Meditenanean and Alps sites confirm some of the previous knowledge. They also offer new information on the possibility of linking intra- and interspecific vmiability with the geographical origin of the isolates and their physiological characteristics. This is mostly because a better idea of the merits or draw­backs of each approach was obtained by using three PeR-based protocols on the same isolates.

Genome analysis of Suillus strains shows that our molecular probes possess different resolution level. Ac­cording to Bruns and Gardes (1993), ITS 1 and 4 am­plify highly conserved regions of the ribosomal gene, producing fingerprints which are constant inside the ge­nus. RFLP improved the resolution and sometimes led to a good inter-specific differentiation. In addition, the intra-specific differentiation of the S. collinitus isolates observed with Sau3A I and Hinf I suggests the presence of a good level of ITS variability, differently from the situation observed in truffles (Mello et aZ. 1996).

The sequence analysis ofthe ITS region pelformed by Kretzer et al. (1996) on 38 recognized Suillus species led the authors to suggest a relationship between the spe­cies and their plant host. Myconhizal associations with Larix are hypothesized to be primitive, and host changes to Pinus and Pseudotsuga seem to have occuned only once. By contrast, changes among host species of the same genus appear to be more frequent. Our six isolates of S. collinitus were collected when associated with Pi­nus haZepensis, P. syZvestris, P. pinea and P. nigra v. aus­triaca: RFLP analysis with 6 enzymes led to finger­prints, which were constant and only in two cases (Sau3A I and Hinf I) grouped isolates, inespectively of their hosts. This might suggest that there is not a clear conelation between ITS sequence and association with a plant host.

As well established for other ectomyconhizal fungi (Lanfranco et al.. 1995; Longato and Bonfante 1997), RAPD and microsatellite primers are more convenient tools to reveal intraspecific differences. RAPD easily al­lowed to distinguish between two isolates of S. granula­tus and led to a polymorphic pattern among the S. colli­nitus strains. The highest similarity was found between

947 bp -

564 bp--

M 1 2 ----

A16

3 4 c

Fig. 5. RAPD amplification performed with the primer OPA 16 strain 24 on DNA from S. collinitus strain 13-15-24 (lane group 1), S. col­linitus strain 13-15-25 (lane group 2), S. granu­latus strain CBS 14l.55 (lane group 3) S. gra­nulatus strain Piemonte (lane group 4). Each reaction was repeated twice and with two dilu­tions (undiluted, 1: 10 diluted).

M1234S67 8 9 10111213

21 .226 bp-

56"\ bp--

Fig. 6. Amplification with (GACA)4 microsatellite primer of 12 S. collinitus isolates: strain 13-15-24 (lanes 1, 8); strain 13-15-25 (lanes 2, 9); strain 13-15-30 (lanes 3,10); strain 13-15-31 (lanes 4,11); strain P2 (lanes 5, 6,12); strain P5 (lanes 7, 13). Undiluted samples: lanes 1-4, 6, 7; 1 : 10 diluted samples: lanes 8-13; 1 : 100 diluted sample: lane 5. Lane M: Lambda DNA digested with EcoR I-Hind III.

P2 and P5 strains, which were demonstrated to be com­patible in growth tests (Karkouri et al. 1996) and possess a similar RFLP pattern. The major merit of RAPD is therefore to produce DNA fingerprint which are spe­cies-specific with a single PCR-amplification and to distinguish isolates more efficiently than RFLP.

The micro satellite primers also led to interesting re­sults: the positive amplification obtained with some pri­mers demonstrated that repeated sequences are present in the genome of Basidiomycetous ectomycorrhizal fungi, in addition to the Ascomycetous tmffles (Longato and Bonfante 1997). They produced fingerprints that are species-specific with a single amplification experiment and revealed interesting intraspecific variability. They seem, in fact, to provide evidence of the geographical origin of a strain. This is of particular interest for S. colli­nitus strains 24, 25, 30 and 31: the first one (from a Mediterranean region) has a very different pattern from the other three (from an Alpine zone). All the strains are very similar morphologically (unpublished observa­tions), but they revealed different symbiotic properties when associated with a pine species (Pinus nigra varietas corsicana), which is not a typical Mediterranean tree. Strain 31 produced a good number of typical mycorrhizal tips (rounded apex surrounded by the hyphal mantle),

while strain 24 produced only a few (Bonfante, Martino, Mousain and Plassard, in preparation). By contrast, the fingerprints from strains P2 and P5, which have the same geographical origin, were very similar.

In conclusion, these results demonstrate that new in­formation may be acquired with the use of different PCR-based techniques: while ITS-RFLP offers some basic information on the relationships existing between the species, RAPD and microsatellites reveal intra-spe­cific variability between isolates and enable their DNA fingerprints to be compared with their physiological dif­ferences.

Acknowledgements

This work was supported by ECC Project Contract N. AIR2-CT94-1149-MYCOMED. We thank Dr. Daniel Mousain and Dr. Claude Plassard (INRA-Montpellier) for providing the Suillus strains.

References

Bruns, T. D., Gardes, M. (1993): Molecular tools for the iden­tification of ectomycorrhizal fungi- taxon-specific oligo­nucleotide probes for suilloid fungi. Molecular Ecology 2, 233-242.

Microbiol. Res. 152 (1997) 3 291

Buscot, F. , Wipp, D., Di Battista, c., Munch, J. c., Botton B. , Mrutin, F. (1996): DNA polymorphism in morels : PCRfRFLP rulalysis of the ribosomal DNA spacers and microsatellite-primed PCR. Mycol. Res. 100,63-7l.

Dahlberg, A. (1997): Population ecology of Suillus variegatus in old Swedish Scots pine forests . Mycol. Res. 101,47-54.

Dahlberg, A., Stenlid, 1. (1994): Size, distribution and biomass of ,genets in populations of Suillus bovinus (L.Fr) Roussel revealed by somatic incompatibility. New Phytol. 128, 225-234.

Don, R. H., Cox, P. T., Wainright, B. 1., Baker, K., Mattick, J. S. (1991): "Touchdown" PCR to circumvent spUlius priming dUling gene amplification". Nucl. Acids Res. 79, 4008.

EI Karkouri, K., Cleyet-Marel, J. c., Mousain, D. (1996) : Iso­zyme variation and somatic incompatibility in populations of the ectomyconhizal fungus Suillus collinitus. New Phytol. 134, 143-153.

Fries, N. (1994): Sexual incompatibility in Sui/lus variegatus. Mycol. Res. 98, 545-546.

Haydris, H., Balick, M., Schierwater, B. (1992): Applications of random amplified polymorphic DNA (RAPD) in mole­cular ecology. Molecular Ecology 1, 55-63.

Henrion, B., Di Battista, c., Bouchard, D. , Vairelles, D., Thompson, B. D., Le Tacon, F., Martin, F. (1994): Moni­toring the persistance of Laccaria bicolor as an endo­myconhizal symbiont of nursery-grown douglas fir by PCR of the rDNA intergenic spacer. Molecular Ecology 3, 571-580.

Jacobson, K. M., Miller, O. K., Turner, B. J. (1993): Random­ly amplified polymorphic DNA markers are superior to somatic incompatibility tests for discliminating genotypes in natural populations of the ectomycOlThizal fungus Suillus granulatus. Proc. Natl. Acad. Sci.USA, 90,9159-9163.

Kretzer, A., Li Y. N. , Szaro, T. , Bruns, T. D. (1996): Internal transcribed spacer sequences from 38 recognized of Suillus sensu lato-Phylogenetic and taxonomic implications. My­cologia. 88, 776-785.

Lanfranco, L., Arlorio, M., Matteucci, A., Bonfante, P. (1995): Truffles-Their life cycle and molecular characterization. In : Biotechnology of ectomyconhizae (Eds: Stocchi, v., Bon­fante, P., Nuti, M.). Plenum Press, New York, 139-149.

Lanfranco, L., Perotto, S., Longato, S., Mello, A., Bonfante, P. (1997): Molecular Approaches to Investigate Biodiversity

292 Microbiol. Res. 152 (1997) 3

in Myconhizal Fungi. In : A Mru1Ual for Myconhizae, (Ed: Vru'ma, A. 1.) Splinger Verlag, In press.

Lieckfeldt, E., Meyer, w., Borner, T. (1993): Rapid identifica­tion and differentation of yeasts by DNA and PCR finger­plinting. 1. Basic Microbiol. 33, 413-426.

Longato, S., Bonfante, P. (1997): Molecular identification of myconhizal fungi by direct amplification of microsatellite regions. Mycol. Res. 101,425-432.

Mello, A. , Nosenzo, c., Meotto, F., Bonfante, P. (1996) : Rapid typing of truffle myconhizal roots by PCR amplification of the ribosomal DNA spacers. Myconhiza 6: 417 -422.

Mousain, D., Plassard, c., Argillier, c. , Sardin, T. , Leprince, F., EI Karkouri, K.,Arvieu, 1. c., Cleyet-Mru-el, J. C. (1994) : Strategie d ' amelioration de la qualite des plants forestiers et des reboisements meditenanees par utilisation de la mycor­hization controle en pepiniere. Acta Botanica Gallica 141, 571-580.

Sambrook, J. , Hitsch, E. F. , Maniatis, T. (1989) : Molecular cloning: A laborato/y Manual, 2nd. edn. Cold Spring Har­bor Laboratory, Cold Spring Harbor, NY.

Selosse, M. A., Jacquot, D., Martin, F. and Le Tacon, F. (1996): Genetic structure of Laccaria spp. populations: ten-years persistence without introgression of an introduced strain in natural populations. Abstracts of First International Confe­rence Myconhizae, Berkeley, August 4-9, 1996, p. 108.

Sen, R. 1 (990): Intraspecific variation in two species of Suil­Ius from Scots pine (Pinus sylvestris L.) forests based on so­matic incompatibility and isozyme analyses. New Phytol 114,607-616.

Tautz, D. (1993): Notes on the definition and nomenclature of tandemly repetitive DNA sequences. In DNA Finger­printing: State of Science, (Eds: Pena S. D. 1., Chakra­borty R., Epplen 1. T., Jeffreys, A. 1.), Birkhiiuser, Basel, pp.21-28.

White, T. J., Bruns, T. , Lee, S. , Taylor, 1. (1990): Amplifica­tion and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: peR Protocols. A Guide to Methods and Applications (Eds: Innis, M. A., Gelfand, D. H., Sninsky, J. J. and White, T. J.), Academic Press, San Diego, pp.315-322.

Wyss, P., Bonfante, P. (1993): Amplification of genomic DNA of arbuscular-myconhizal (AM) fungi by PCR using short arbitrary plimers. Mycological Research 97, 1351-1357.