Inhibition of 19S proteasome deubiquitinating activity in ......HELMINTHOLOGY - ORIGINAL PAPER Inhibition of 19S proteasome deubiquitinating activity in Schistosoma mansoni affects

HELMINTHOLOGY - ORIGINAL PAPER

Inhibition of 19S proteasome deubiquitinating activityin Schistosoma mansoni affects viability, oviposition, and structuralchanges

Andressa Barban do Patrocinio1& Fernanda Janku Cabral2 & André Luiz Brandão Bitencourt1 & Olinda Mara Brigato1

&

Lizandra Guidi Magalhães3 & Lucas Antônio de Lima Paula3 & Larissa Franco2& Renata Guerra-Sá and4

&

Vanderlei Rodrigues1

Received: 29 September 2019 /Accepted: 7 April 2020# Springer-Verlag GmbH Germany, part of Springer Nature 2020

AbstractThe proteasome is the key player in the cellular protein degradation machinery and is pivotal for protein homeostasis andSchistosoma mansoni (S. mansoni) survival. Our group study provides insights into proteasome inhibitors and reveals thatselective schistosomiasis agents represent an interesting branch of proteasome research linked to the development of new drugsfor this neglected disease. Here, we explored the phenotypic response of S. mansoni to b-AP15, a bis-benzylidine piperidone thatinhibits 26S proteasome deubiquitinases (DUBs), ubiquitin-specific protease 14 (USP14), and ubiquitin carboxyl-terminalhydrolase 5 (UCHL5). b-AP15 induces a modest decrease in egg production in vitro and reduces viability, leading to the deathof parasite couples. This inhibitor also induces a twofold increase in the accumulation of polyubiquitinated proteins in S. mansoniadult worms and causes tegument changes such as disintegration, wrinkling, and bubble formation, both throughout the length ofthe parasite and in the oral sucker. b-AP15 alters the cell organelles of adult S. mansoni worms, and we specifically observedmitochondrial alterations, which are suggestive of proteotoxic stress leading to autophagy. Taken together, these results indicatethat the deubiquitinase function of the proteasome is essential for the parasite and support the hypothesis that the proteasomeconstitutes an interesting drug target for the treatment of schistosomiasis.

Keywords Schistosomamansoni . 26S proteasome . Deubiquitinating enzymes . b-AP15 inhibitor

Section Editor: Xing-Quan ZHU

Electronic supplementary material The online version of this article(https://doi.org/10.1007/s00436-020-06686-4) contains supplementarymaterial, which is available to authorized users.

* Andressa Barban do [email protected]

* Renata Guerra-Sá [email protected]

Fernanda Janku [email protected]

André Luiz Brandão [email protected]

Olinda Mara [email protected]

Lizandra Guidi Magalhã[email protected]

Lucas Antônio de Lima [email protected]

Larissa [email protected]

Vanderlei [email protected]

1 Departamento de Bioquímica e Imunologia, Faculdade de Medicinade Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SãoPaulo, Brasil

2 Departamento de Biologia Animal, Instituto de Biologia,Universidade de Campinas, Campinas, São Paulo, Brasil

3 Núcleo de Pesquisa em Ciências Exatas e Tecnológicas,Universidade de Franca, Franca, Brazil

4 Núcleo de Pesquisas em Ciências Biológicas, Universidade Federalde Ouro Preto, Morro do Cruzeiro, Ouro Preto, MG, Brasil

Parasitology Researchhttps://doi.org/10.1007/s00436-020-06686-4

Introduction

Schistosomiasis is the second most prevalent parasitic diseasein the world after malaria and is one of the 17 most importantneglected diseases. In fact, more than 220 million people inthe world are being treated for the disease, and over 700 mil-lion people live in the risk area, which covers 78 countriesfrom tropical and subtropical regions. According to theWorld Health Organization (WHO 2017), the transmissionof this disease in 52 countries is moderate (Lima et al.2019). This disease is caused by the Schistosoma parasiteparticularly Schistosoma mansoni, which is found in Brazil.This parasite has a complex life cycle with many stages thatinvolve structural and metabolic changes: (1) sporocyst; (2)miracidium stage, which consists of an egg containing oneciliated larva; (3) cercariae stage; (4) adult worm stage; and(5) schistosomula stage.

The ubiquitin 26S proteasome system (UPS), which is alarge complex that is preserved among eukaryotes and formedby 19S (regulatory particle, RP) and 20S (catalytic particle,CP), is responsible for the degradation of numerous cellularproteins and thus for the maintenance of homeostasis and theregulation of many cellular processes and signaling pathways(Ciechanover and Stanhill 2014). Our research group has beenstudying the importance of this complex in the context ofS. mansoni biology. The 26S proteasome has functions duringthe life cycle of the parasite, and the constituents of the complexare expressed in all stages of the S. mansoni life cycle butexhibit differential expression and conservation relative to othereukaryotes (Pereira-Júnior et al. 2013). The eggs contain mira-cidia, which are present during different stages of development,and studies have shown that the UPS changes during egg de-velopment and that the UPS in the egg is essential for theturnover of vitelline cellular proteins (Mathieson et al. 2011).One of the approaches adopted for the study of the UPS hasbeen the use of a classic 26S proteasome inhibitor (MG132),and the results have shown the essential role of this system forthe viability of adult worms and cercariae. Mice infected withcercariae exposed to MG132 contain relatively fewerschistosomula in the lungs and fewer adult worms and eggs inthe stool. Cercariae exposed to MG132 in vitro exhibit an ac-cumulation of high molecular weight conjugates in an SDS-PAGE gel. The endogenous proteolytic and peptidase activitiesof the 20S catalytic particles in the cercariae and adult wormshave also been evaluated, and the results show that cercariaeexhibit decreased proteolytic (Roquis et al. 2015, 2018) andpeptidase activities, which suggests the existence of stage-specific variations in peptidase activities (Guerra-Sá et al.2005). The 20S particles of the S. mansoni parasite at this stageof the life cycle have been purified and analyzed using 2D gels,and mass spectrometry analyses revealed the presence of manyα andβ subunit isoforms and posttranslational modifications ofthe 20S particle proteins (Castro-Borges et al. 2007). A study

conducted by our group (Morais et al. 2017) analyzed the geneexpression profile in adult worms incubated in vitro withMG132 for 24 h using microarrays and found that 1130 geneswere upregulated and 790 genes were downregulated. Thesame study revealed that MG132 causes changes in the parasitetegument, including peeling, outbreaks, and swelling in thetegument tubercles, and this finding is consistent with the dis-ruption of ionic homeostasis in S. mansoni. These results showthat the 26S proteasome is essential for the regulation of geneexpression and might be a molecular target for new drugsagainst schistosomiasis.

As noted in this study, various drugs that act on the26S proteasome complex, which is involved in homeo-stasis and the control of various essential cellular pro-cesses (cell cycle control, p-53-mediated tumor suppres-sion, apoptosis, and regulation of transcription factors),of which are altered in cancer cells have been approvedfor cancer treatment and can potentially be repurposedfor the treatment of schistosomiasis (Roeten et al. 2018).Various clinical studies have shown that schistosomiasisis related to liver carcinogenesis because part of theparasite eggs are trapped in the liver of the host, leadingto the development if granulomatous reactions aroundthe eggs that are responsible for the pathology of thedisease (King 2009). Evidence obtained from Westernblotting, immunohistochemistry, and mobility-shift elec-trophoresis analyses using hamster and human liver bi-opsies have shown that S. mansoni activates c-Jun andSTAT3 are critical regulators in the development andprogression of liver cancer. The resulting changes in thispathway are induced by antigens such as IPS/alpha-1released by eggs (Roderfeld et al. 2019; Roderfeldet al. 2019). As a result, this study was based on b-AP15, an inhibitor that blocks the deubiquitinating en-zymes, USP14 and UCHL5, which are reversibly boundto 19S particles (Wang et al. 2014). b-AP15 is knownactivation caspase-dependent apoptosis, which is inducedby potent oxidative and proteotoxic stresses and autoph-agy, but apoptosis occurs in mammalian cells after au-tophagy. This evidence suggests that apoptosis mediatesthe killing of human cells as a compensatory mechanismin response to the stress generated by UPS (D’Arcyet al. 2011; Feng et al. 2014). The main purpose of thisstudy was to evaluate the importance of the inhibition ofthe deubiquitinases (DUBs) UCHL5 and USP14, whichwere previously found to be ligated to the 26S protea-some and how the level of this inhibition interferes withthe ubiquitination and deubiquitination cycles inS. mansoni by indirectly inducing the accumulation ofpolyubiquitinated proteins inside parasite cells. We alsoaimed to assess whether in vitro alterations in the para-site induced using this inhibitor can be applied for thein vivo treatment of schistosomiasis.

Parasitol Res

Materials and methods

Collection of adult worms and in vitro cultureof parasites

The Luiz Evangelista (LE) strain of S. mansoni was obtainedvia liver perfusion of female BALB/c mice 50 days after in-fection. Couples were transferred to each well of a sterile 24-well plate containing 2 ml of RPMI 1640 medium with25 mM HEPES and L-glutamine (Gibco, Carlsbad, CA,USA) supplemented with the antibiotics penicillin (100 UI/mL) and streptomycin (100 μg/mL) (Gibco, Carlsbad, CA,USA) and 10% heat-inactivated fetal bovine serum (Gibco,Carlsbad, CA, USA). Changes in the motility of the wormsand their death were observed using standard procedures forthe screening of compounds issued by the WHO-TDR(Ramirez et al. 2007). The phenotypic changes were scoredbased on a viability scale of 0 to 3, where 3 is total activity,2 slow activity, 1 minimal activity, and 0 worm death. Deathwas defined as the absence of movement for at least 2 minduring an examination. The worms were subjected to differentconcentrations of the b-AP15 inhibitor (OnTarget Chemistry,Sweden) and monitored using an inverted microscope (Carl

Zeiss, Goettingen, DEU). The negative control groupconsisted of couples of adult worms incubated with RMPI1640 medium in the presence or absence of 0.1% DMSO.The experiment was repeated three times, and 12 adult wormcouples were evaluated in each experiment. The total eggproduction per couple was monitored during periods of 24,48, and 72 h using an inverted optical microscope.

Assay of parasite viability

An MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetra-zolium bromide) colorimetric assay was used to determinethe viability of the parasites as described by Comley et al.(1989). “The yellow MTT dye is reduced by dehydroge-nase in living cells to produce purple MTT formazan,which can be solubilized and read visually or quantifiedby spectrophotometry”(Foongladda et al. 2002). Adultworm couples were incubated with or without b-AP15for 24 h, and the absorbance at 550 nm was read using aspectrophotometer (BIO-RAD xMark microplate spectro-photometer). The experiment was repeated three times,and 12 adult worm couples were evaluated in eachexperiment.

Table 1 Amplified genes

Gene name Orthologs in S.mansoni

Oligonucleotides (forward e reverse) Probe Ampliconsize (nt)

Syber FAM/IOWA

Caspase-3 Smp_028500 5'- CTCTTCAGGCAGTTGGTTTATTC- 3'3'- CGTGCTAACACAAAGCGAGAA- 5'

No 121 Green

Smad 1 Smp_013060 5′- AATGTCTAGTTCCCGTTCAGC-3′3′- GGAAGAGACGGAGAATGACTG-5′

5′AACTCCATCACCGGGTTTATCACACTG 3′

104 Yes Yes

Smad 2 Smp_085910 5′- CGATTCTCAATGCCTAGGTCC -3′3′-CCAGGAGAGTTTATTGACGGG-5′

No 93 Yes

Smad 4 Smp_033950.1

5′- GTCCTAACTACACAACGTCCTC -3′3′- ATCCGTGTAACCGTCAACAG −5′

No 116 Yes

Smad 6 Smp_169780 5′- GACTAAACACGACTCTCCACC-3′3′- GTCCAATCCGTCTGAGGTAATC-5′

5′ CTTAAATCCTCCCACCTCCACGCTT 3′

197 – Yes

Receptor TGFbeta tipo 1

Smp_049760 5′-GCTATGACCATCACTAGTTCGG-3′3′- CAAACACCTCGCCATACAAC-5′

5′- ACGGTCGCTAGGCAAGTTCAGTT-3′

197 – Yes

USP9x Smp_153690 5′- TCTCGATGGCACATTAACTGG −3′3′- GACACATTTCTGCATAACCACG −5′

No 171 Yes

USP15 Smp_128770 5′- ATTAGAACAAGAGCGTCCACC -3′3′- CAGAGTACAGGAATCGGGAAAC -5′

No 213 Yes

USP 37/UCHL5

Smp_084740 5′-GTATCGCGCAGAAAACATTCG-3′3′- CGTTCTTGTGCAACCTTCTG-5′

No 92 Yes

Rpn11 Smp_213550 5′-CAATCAAATGCCCAGCCAAC-3′3′-CATAGCAAACACATCCACAACC-5′

No 79 Yes

Rpn13 Smp_080040 5′- ACCTTGTGGCGTTTTCAAATG-3′-CACACTTTGGGAGACATTTGAAC-5′

5′- CCGCTGTTATTTGAGGGTTGAGAGGT-3′.

92 Yes

Rpn10 Smp_000740 5′-CTCACCTCATATCTGTTGCCC-3′3′- TCCAAACTCCAAACCTAACCC-5′.

5′CCATGCCAGAACCATCCTCACCA 3′

119 Yes

p14 / F10 J03982.1 5′-CTCCGAATCTTGGTTCCTTATG-3′3′- ACCTGGAGCGGATTTACTTG-5′

5′-CGAACTGCGGACAAACACTGTG-3′C

85 Yes

USP14/ Ubp6 Smp_084740 5′ATGGAAAGGGTTATGGCGG3′3′ CATAATGGCTGGGTTTGTAAGTG5′

5′TAAGGGTAAGGGTGGTGGCAAAGG 3′

92 Yes

GAPDH Smp_056970.1

5′- AGTCATTCCAGCACTAAACGG-3′3′-CCTTCCCTAACCTACATGTCAG −5′

5′- CTTTCCGCGTCCCAACACCAGA-3′

98 Yes Yes

Parasitol Res

Transmission and scanning electron microscopy

To verify the ultrastructural alterations induced by b-AP15,adult worm couples were incubated for 24 and 72 h with orwithout the inhibitor. The parasites were placed in 25-cm2

culture flasks (10 adult worm couples were placed in eachculture flask) as previously described. After incubation, thefemale and male S. mansoni worms (separated either by theaction of b-AP15 or manually after the treatment) werewashed three times with phosphate buffer and fixed in 2.5%glutaraldehyde-phosphate buffer (0.2 M at pH 7.4) at roomtemperature for 2 h.

For transmission electron microscopy (TEM) analysis, theworms were post fixed with 1% osmium tetroxide (Sigma-Aldrich) in the same buffer at 4 °C for 2 h. The worms weredehydrated through an ethanol gradient and embedded in

Araldite 6005 resin (EMS). Ultrathin schistosome sectionswere stained with 0.5% uranyl acetate (Sigma-Aldrich) and0.3% lead citrate (Sigma-Aldrich). Ultrastructural features ofthe schistosome sections were examined using a TEM micro-scope (JEOL Model JEM-100CXII equipped with aHamamatsu ORCA-HR digital camera, Tokyo, Japan). Theexperiment was repeated three times, and six adult worm cou-ples were evaluated in each experiment. For scanning electronmicroscopy (SEM) analysis, the worm couples were postfixed in phosphate buffer containing 1% osmium tetroxide(Sigma-Aldrich) at room temperature for 1 h. Subsequently,the couples were hydrated in 100% ethanol and dried in CO2.The male and female parasites were mounted separately onstubs coated with a thin layer of gold and examinedwith a JoelJSM-5200 scanning microscope operated at 25 KV. All mea-surements were obtained in micrometers (μm). The

Tota

lnum

bero

fegg

s/pa

irw

orm

s

b-AP15 concentration (µM)

CTRL 56°C DMSO O.2 0.4 0.8 1.6 3.2

0 0

.2 0

.4 0

.6 0

.8 1

.0

(d)

b-AP15 concentration (µM)

MTT

/For

maz

an(A

bsor

banc

e)

****

****

****

****

****

****

Fig. 1 Couples of adult wormswere exposed to b-AP15 for 24,48, and 72 h. The number of eggs(oviposition count) was moni-tored for 24 h (a), 48 h (b), and72 h (c) using an inverted micro-scope. d The parasite coupleswere incubated for 24 h, and theviability was measured using theMTT assay and reading the ab-sorbance at 550 nm. For the anal-ysis of viability, worm coupleswere used as positive controls andheat killed at 56 °C. For all theexperiments, worm couples incu-bated in RPMI 1640 medium inthe absence or presence of 0.1%DMSO were used as negativecontrols. The parasites were in-cubated with b-AP15 at concen-trations of 0.2, 0.4, 0.8, 1.6, and3.2 μM for the assessment of vi-ability. The analyses includedthree independent experiments(n = 12 was used for each con-centration in each experiment).The asterisks (*) indicate signifi-cant differences compared withthe CTR group (p < 0.0001confidence intervals that do notinclude the value 0 also indicatedifferences in SupplementaryTables 1 and 2). A mixed effectregression model was used for theanalysis. Confidence intervalsthat do not include the value 0show differences

Parasitol Res

experiment was repeated three times, and 10 female and 10male parasites from each sample were analyzed after eachincubation period.

Detection of ubiquitinated proteins and the caspase-3enzyme

Briefly, total protein extracts from adult worms incubated with orwithout b-AP15were prepared by sonication in 25mMTris-HClat pH 7.5, 0.5% glycerol, 1 mM DTT, and 1× protease inhibitorcocktail (Sigma-P834). After centrifugation at 20,800 ×g and4 °C for 60 min, the soluble protein concentration was deter-mined using a QuantiPro™ BCA Assay Kit (Sigma-Aldrich,Sao Paulo, Brazil). This extract was used for the analysis ofubiquitinated conjugates. Total protein extracts from the adultworms incubated with or without b-AP15 were prepared by son-ication in 5 mM EDTA, 150 mMNaCl, 20 mM Tris 7.5, 1 mM,1% Triton X-100, and 1× protease inhibitor cocktail (Sigma-P834). After centrifugation at 5000 ×g and then at 15500 ×gand 4 °C for 15 min, this extract was used for the detection ofactive caspase-3. Twenty-fivemicrograms of total soluble proteinwere separated by 12% SDS-PAGE FastCast (Bio-Rad) electro-phoresis and transferred to nitrocellulose membranes using asemitransparent system (Trans-Blot Turbo, Bio-Rad). The mem-branes were incubated with rabbit polyclonal anti-ubiquitin pri-mary antibody (Invitrogen—PA517067) and rabbit-active anti-caspase 3 antibody (Millipore-04-4391:1000 dilution). Rabbitanti-rabbit IgG antibody (GE Healthcare, 1:5000 dilution) was

used as the secondary antibody, and the results were visualizedusing an ECL Prime kit (GE Healthcare). The experiment wasrepeated three times, and biological triplicates of the extractswere obtained.

Assay of 20S complex activity

The protocol for protein extract enriched with S. mansoni 26Sproteasome purification wasmodified fromCastro-Borges et al.(2007). The samples consisted of approximately 350 adultworm pairs that had been homogenized by sonication(461 min/burst, 21 kHz at 7 mm amplitude) in 5 mM Tris-HCl pH 8.0, 1% glycerol, 1 mM EDTA, 1 mM EGTA,50 μM leupeptin (Cayman Chemical Company), and 1 mMβ-mercaptoethanol. After centrifugation at 10.000 ×g for30 min (Centrifuge Model 5417R, Eppendorf), the supernatantwas centrifuged at 30.000 ×g and 4 °C for 20min (Optima TLXUltracentrifuge, Beckman) and frozen at − 70 °C. The solubleprotein concentration was determined using a QuantiPro™BCA Assay Kit (Sigma-Aldrich, Sao Paulo, Brazil).Proteasome activity was assayed with the AMC fluorophoreSuc-Leu-Leu-Al-Tyr-AMC (Enzo Life Sciences), which is spe-cific to chymotrypsin-like activity, at a concentration of 50 μM,50 μg of enriched S. mansoni 26S proteasome extract, 5 mMATP and MG132 or b-AP15 at the tested concentration, 1 mMDTT, and buffer solution (50 mM Tris-HCl pH 8.0 and 10 mMMgCl2), as previously described by (Mathieson et al. 2011).The activity of the 20S complex was analyzed using extracts

b-AP15 concentration (mM )/ time (hour)

Mot

orac

tivity

RPMI 160DMSO 0,2 0,40,8 1,63.2 6.412

.8 25 50

RPMI 160DMSO 0,2 0,40,8 1,63.2 6.412

.8 25 50

RPMI 160DMSO 0,2 0,40,8 1,63.2 6.412

.8 25 500

1

2

3

4 24h48h 72h

******** ****

****

Fig. 2 In vitro effect of b-AP15 on the viability of adult S. mansoniworms based on changes in motor activity. Adult worm couples wereincubated with different concentrations of b-AP15 for 24, 48, and 72 h,and the viability of S. mansoni worms was monitored using a viabilityscale of 0 ± 3 (3, totally vital, normally active; 2, slowed activity; 1,minimal activity; 0, worm death (death was defined as no movementfor at least 2 min of examination). Adult worm couples incubated with

RMPI 1640 medium in the absence and presence of 0.1% DMSO wereused as the negative control groups. The asterisks (*) indicate significantdifferences compared with the CTR group (p < 0.0001). The analyseswere made using three independent experiments (n = 12 was used foreach concentration in each experiment). One-way ANOVA andDunnett’s posttest were used in the analysis

Parasitol Res

incubated with b-AP15 at a concentration of 0.8, 1.6, 3.2, or50 μM. As positive controls, 50 μM MG132 and negativecontrols in the presence or absence of 0.1% DMSO were used.The activity was evaluated after incubation for 0, 30, 60, 90, or120 min. The fluorescence was read using a multiplate reader(Perkin Elmer-EnSpire Multimode Plate Reader) at wave-lengths of 380 nm (excitation) and 440 nm (emission). Threeindependent experiments were performed, and the results areexpressed as relative fluorescence units (RFUs).

Preparation of RNA and analysis of RNA expressionby quantitative RT-PCR

Adult worm couples were incubated with or without b-AP15for 24 h. Total RNA from parasite couples incubated with or

without b-AP15 was extracted using the RNeasy Mini Kit(Qiagen), and the expression of various genes (Table 1) wasanalyzed by qRT-PCR. The preparation was treated threetimes with RNase-free DNase I at decreasing enzyme concen-trations (Sigma-Aldrich). The RNA was quantified using aspectrophotometer with an aliquot containing 1 μg of totalRNA that was reverse transcribed using a Script cDNASynthesis Kit (Bio-Rad). Specific forward/reverse oligonucle-otide sequences and FAM Iowa probes (IDT, Integrated DNATechnologies) were used for some genes, and the other geneswere detected by SYBR Green (Table 1). The GAPDH genewas used as a constitutive control. The TaqMan real-timePCRs included 300 nM primer, 5 μl of iTaq UniversalProbes Supermix (1725131 Bio-Rad) and 100 ng of cDNA.The 5’FAM/3’Iowa black and oligonucleotide probes were

24 h 72 h

Fig. 3 Scanning microscopy analysis of female S. mansoni incubatedwith and without b-AP15 for 24 and 72 h. Parasite couples were incubat-ed in RPMI 1640 medium in the absence and presence of 0.1% DMSO(negative controls) or with 1.6, 3.2, and 50 μMb-AP15. After incubation,the male and female worms of S. mansoni were separated and processedfor microscopy analysis. Control female parasites showed normal tegu-ments without changes in fissures (fi), the ventral (V) and dorsal (D)

surfaces, the oral sucker (SC), the tail (T), and the spines (S). Femaleparasites incubated with the inhibitor at 1.6 μM presented tegumentalalterations such as disintegration (di), wrinkling (W), and bubbles (B)and suction extension. The female parasites died after incubation withthe inhibitor at a concentration of 50 μM for 72 h. The experiment wasperformed twice, and six female parasites from each sample wereanalyzed

Parasitol Res

standardized by RTD, and the following conditions were usedfor cDNA amplification: initial denaturation at 95 °C for 30 sand 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The exper-imental reactions contained the forward and reverse oligonu-cleotides at 500 nM, 250 nM probes, iTaq Universal ProbesSupermix (Bio-Rad), and 100 ng of cDNA. The experimentalcontrols contained water instead of cDNA, and another con-trol reaction contained RNA treated with DNase I. The reac-tions using SYBR Green Supermix (170888-2- Bio-Rad)contained 500 nM primers and 100 ng of cDNA. cDNA am-plification was performed under the following conditions: ini-tial denaturation at 95 °C for 10min and 40 cycles of 95 °C for15 s and 60 °C for 1 min. Three biological replicates of allinvestigated transcripts were analyzed. The gene expression

levels were calculated using the comparative Ct method(2-ΔΔCT method) (Livak and Schmittgen 2001; de Paulaet al. 2015), and the data obtained using a StepOnePlus real-time PCR system (Applied Biosystem) were normalized rela-tive to an endogenous standard gene (SmGAPDH) and arepresented as fold changes, which reflect the levels of expres-sion relative to those found in the control group (adult wormsin RPMI 1640 medium with 0.1% DMSO).

Activity of caspase 3

Briefly, total protein extracts from adult worms incubatedwith or without b-AP15 were prepared as described for theWestern blotting analysis. The acetyl-Asp-Glu-Val-Asp-p-

24 h 72 h

Fig. 4 Scanning microscopy of male parasites incubated with andwithout b-AP15 for 24 and 72 h. Parasite couples were incubated inRPMI 1640 medium in the absence and presence of 0.1% DMSO (neg-ative controls) or with 1.6, 3.2 and 50 μM b-AP15. After incubation, themale and female worms of S. mansoni were separated and processed formicroscopy analysis. The control groups showed no changes in the teg-ument: tubercles (T), typical spines (S), gynaecophoric canal (GC), andoral sucker (SC). The male parasites incubated with the inhibitor at a

concentration of 1.6 μM showed changes in the gynaecophoric canal;tegumental changes such as peeling (P), bubble formation (B), tuberclespacing, and tegmental disintegration (di); the disappearance of tubersand spines; and basement membrane exposure (bm). No major changeswere detected in the male parasites incubated with 1.6 and 3.2 μM b-AP15. The male parasites died after incubation with the inhibitor at50 μM for 72 h. The experiment was performed twice, and six femaleparasites from each sample were analyzed

Parasitol Res

Parasitol Res

nitroaniline (p-Na) substrate (Sigma-Aldrich) was used todetermine the enzymatic activity of caspase-3 present inthe adult worms. For these assays, 25 μg of total proteinwas incubated with 2 mM substrate in 120 mM HEPES(pH 7.4), 0.1% CHAPS, 5 mM DTT, and 2 mM EDTA in afinal volume of 200 μL for 90 min at 37 °C, and theresulting absorbance was read using Bio-Rad xMark mi-croplate spectrophotometer at 405 nm. The results areexpressed as absorbance units, and technical and biologi-cal triplicates were performed for each experiment.

Statistical analyses

Theoviposition and viability results obtained from the experimentsusing the parasite couple cultures with the b-AP15 inhibitor andRPMI 1640 in the presence and absence of 0.1% DMSO weregenerated with the following statistical programs: R Core Team(2016), a language and environment for statistical computing fromthe R Foundation for Statistical Computing (Vienna, Austria,URL: https://www.R-project.org), and SAS Statistical Software(version 9.3; SAS Institute, Inc. Cary, NC, USA). For theanalysis, a regression model with mixed effects was generatedusing these two programs. The Western blotting results of theubiquitinated conjugates and the quantitative RT-PCR analyseswere analyzed using Prism 6.0 software. The data were testedfor significance by one-way ANOVA and Tukey’s posttest.

Results

Effects of the b-AP15 inhibitor on S. mansoni dailyegg production

The cultures with parasite couples were analyzed after 24, 48,and 72 h of incubation b-AP15 at a concentration rangingfrom 0.2 μM to 1.6 μM. The cultures incubated with1.6 μM b-AP15 showed enhanced inhibition of total egg pro-duction at all tested periods compared with that found in thecontrol groups (Fig. 1 a, b, and c and Supplementary Table 1).

This difference in total egg production increased with thein vitro culture time. For the assessment of viability, the par-asite couples were exposed to b-AP15 at a concentration from0.2 to 3.2 μM for 24 h, and the viability was measured usingan MTT/formazan assay. Adult worm couples incubated with3.2 μM b-AP15 exhibited altered viability, and some coupleshad separated; however, the other concentrations analyzed didnot alter the viability of the worms. The adult worm couples inthe negative control groups exhibited normal viability, where-as the adult worm couples in the positive control group (heatkilled) were not viable (Fig. 1d and Supplementary Table 2).The largest protein in the eggshell of S. mansoni is Smp14, andits gene is expressed only in vitelline cells, eggs, and ootypesof sexually mature female parasites (Carneiro et al. 2014). TheSmp14 expression level in the worm couples incubated with0.8 and 1.6 μM b-AP15 for 24 h was decreased comparedwith that in the worms in the negative control group(ESM_1). For all the experiments, the adult worm couples inthe negative control groups were incubated with RPMI 1640medium alone or in the presence 0.1% DMSO. Taken togeth-er, these results show that exposure to 1.6μMb-AP15 for 24 hreduced the total number of eggs produced by femaleS. mansoni but did not change the viability of the adult wormcouples. The analysis of motor activity revealed that incuba-tion with b-AP15 at concentrations between 0.2 and 1.6 μMfor 24 h did not induce alterations compared with the negativecontrols. However, the same changes were induced by b-AP15 at concentrations from 3.2 to 25 μM, and minimal mo-tor activity was obtained after incubation with the inhibitor at50 μM. Incubation with b-AP15 at a concentration of 1.6 μMfor 48 h induced a slight change compared with the negativecontrols, but incubation with the other tested concentrationsfor 48 h did not show alterations compared with those obtain-ed after 24 h period, and the same findings were obtained afterincubation for 72 h. However, at a concentration of 50μM, theinhibitor induced the parasite death (Fig. 2).

b-AP15 induces alterations in the tegument, tissues,and cells of S. mansoni adult worms

SEM and TEM analyses were performed to analyze themorphological alterations and ultrastructural alterations infemale and male parasites after exposure to 1.6, 3.2 and50 μM b-AP15 for 24 and 72 h. The microscopic obser-vations of S. mansoni couple worms provided evidence ofdifferent motor activity after exposure, and incubationwith a concentration of 50 μM for 72 h was found to belethal (Fig. 2). The viability of the parasites was assessedbased on changes in the motor activity of the worms andinstances of death according to the standard procedures forthe screening of compounds defined by the WHO-TDR.As shown in Fig. 3, the tegument of the control femaleparasites was intact after 24 h of incubation in RPMI

�Fig. 5 Transmission microscopy of female S. mansoni incubated with b-AP15 for 24 h. Parasite pairs were incubated in RPMI 1640 medium inthe absence and presence of 0.1% DMSO (negative controls) or with b-AP15 at concentrations of 1.6, 3.2, and 50μM.After incubation, the maleand female S. mansoni were separated and processed for microscopy(TEM) analysis. Tegument (T), muscle fiber (MF), lipid (L), vitellin cell(VC), vitelline droplets (VD), vacuoles (V), autophagic vacuole (AV),degradative autophagic vacuole (dAV), necrosis (N), and mitochondria(M). Tegumental changes, the presence of vacuoles, and other ultrastruc-tural alterations in the parasite started to be observed with a concentrationof 1.6 μM. The experimental controls did not show structural changes incellular organelles. The experiment was performed twice, and six femaleparasites from each sample were analyzed

Parasitol Res

1640 culture medium in the presence or absence of 0.1%DMSO, as demonstrated by normal fissures without alter-ations in the ventral and dorsal parts or the tail. However,

the same outcome was not obtained with the female para-sites exposed to the inhibitor. After incubation with1.6 μM b-AP15, the S. mansoni females presented with

Parasitol Res

tegument changes such as disintegration, wrinkling, andbubble formation throughout their extended body and oralsucker. After 72 h of exposure to 1.6 μM b-AP15, theparasites did not exhibit integumentary alterations, but a

concentration of 3.2 μM increased the level of tegumentdisintegration, and a concentration of 50 μM induced teg-ument wrinkling. An analysis of the morphology of thetegument of the control male parasites revealed the pres-ence of a large number of tubercles and spines and a nor-mal oral sucker and gynaecophoric canal. At b-AP15 con-centration of 1.6 μM induced alterations in the tegumentand the gynaecophoric canal, and these included peeling,bubble formation, tubercle spacing, and tegument disinte-gration as well as the disappearance of tubercles andspines and exposure of the basement membrane. Thesechanges obtained with all the tested inhibitor concentra-tions increased after exposure for 72 h (Fig. 4). TEM anal-yses were performed to assess the tissues and cell organ-elles of the parasite couples after exposure to b-AP15. Asshown in Figs. 5 and 6, the control S. mansoni females and

Fold

chan

ge

b-AP15 concentration (µM)

Fig. 7 Quantitative expression ofthe 26S proteasome andSmUbiquitin mRNA. Theexpression levels of the mRNAsin adult worm couples incubatedin the presence and absence of b-AP15 for 24 h were analyzed byquantitative PCR. The concentra-tions of b-AP15 used in this studywere 0.8 and 1.6 μM. Parasitesincubated in RPMI 1640 mediumin the presence of 0.1% DMSOwere used as a negative control.The expression was calculatedaccording to the 2-ΔΔCTmethodand normalized to that of the en-dogenous SmGAPDH standard.The asterisks (*) indicate signifi-cant differences compared withthe CTR group (p < 0.05). Theexperiment was performed usingtechnical and biological tripli-cates, and one-way ANOVA andTukey’s posttest were uses in theanalyses

�Fig. 6 Transmission microscopy of male S. mansoni incubated with b-AP15 for 24 h. Parasite worm couples were incubated in RPMI 1640medium in the absence and presence of 0.1% DMSO (negative controls)or with b-AP15 at concentrations of 1.6, 3.2, and 50 μM. After incuba-tion, the male and female S. mansoni were separated and processed formicroscopy analysis (TEM). Tegument (T), muscle fiber (MF), lipids (L),degradative autophagic vacuole (dAV), and mitochondria (M).Tegumental changes, the presence of vacuoles, and other ultrastructuralalterations in the parasite started to be observed at a concentration of1.6 μM. The experimental controls did not show structural changes incellular organelles. The experiment was performed twice, and six maleparasites from each sample were analyzed

Parasitol Res

males, respectively, did not appear to exhibit any alter-ations in their tissues or cells. However, the evaluation ofthe parasites with 1.6 μM b-AP15, which was a concen-tration that inhibits oviposition, revealed the following ob-servations: some turgid mitochondria, fragmented nuclei,and degenerative autophagic vacuoles. The male parasitesexhibited tegument lesions and spine alterations.Specifically, alterations in the vitelline cells of the femaleparasites were observed as alterations in vitelline droplets.b-AP15 concentrations of 1.6 and 3.2 μM did not inducealterations in muscle fibers, but some tissue changes un-derneath these fibers were observed. After incubation witha b-AP15 concentration of 50 μM, the tissues of the fe-male parasites presented with some points of necrosis andcell and nuclear membrane fragmentation. Specifically, anarrow band of muscle fibers was observed, and the tissueunder these fibers was necrotic. The parasite couple incu-bated with 1.6 and 3.2 μM b-AP15 for 72 h did not showgreater modifications than the female worms incubatedwith the inhibitor at these concentrations for 24 h.However, the inhibitor concentration of 50 μM inducedgreater alterations in the area outside of the tegument,and these alterations resulted in spine loss in the tegument.Tissue necrosis was observed in all the tissues below thetegument, and a large number of lipid granules were ob-served. No cells or organelles were detected, and only afew fragmented nuclei could be visualized. After incuba-tion with the inhibitor concentration of 50 μM for 72 h, theparasite couples were dead (ESM_2 and ESM_3). Theseresults show that b-AP15 not only inhibits oviposition butalso induces marked alterations in cells and tissues of par-asite couples, and a concentration of 50 μM was found tobe lethal.

Exposure to b-AP15 for 24 h interfereswith the S. mansoni UPS and the growth factorand transformation factor pathway but does notactivate the apoptotic pathway in S. mansoni couples

The expression levels of the ubiquitin (Ub) receptors (Rpn10and Rpn13) and deubiquitinating enzyme (USP14, UCHL5,and Rpn11) genes that regulate the UPS and the Ub gene inthe parasite couples incubated with 0.8 and 1.6 μM b-AP15were analyzed. The analysis of SmUbiquitin, SmRpn11, andSmRpn13 gene expression showed that these genes were up-regulated in the parasites exposed to b-AP15 at a concentra-tion of 1.6 μM, and this upregulation was significant com-pared with the level found in the parasites in the negativecontrol group (0.1% DMSO). In contrast, the SmRpn10,SmUSP14, and SmUCHL5 gene expression levels did not ex-hibit a significant change (Fig. 7).

The relative quantification of ubiquitinated proteins in thetotal protein extract of the parasites was analyzed by Western

blotting to determine the accumulation of high molecularweight conjugates in parasite couples after exposure to 0.8to 50 μM b-AP15 for 24 h and to compare the b-AP15-mediated inhibition of the 26S proteasome with that obtainedwith the classic inhibitor of the 26S proteasome (MG132).The accumulation of proteins in the parasite couples incubatedwith the concentration that inhibits oviposition (1.6 μM) wassignificantly different from that found in the negative controlgroup (incubated with RPMI 1640 medium alone or in thepresence 0.1% DMSO), and similar significant differenceswere obtained with increase inhibitor concentrations. No sig-nificant difference was found between 3.2 μM b-AP15 and3.2 μM MG132. However, significant increases in theubiquitinated conjugates were obtained in the negative controlgroup and after incubation with all the tested b-AP15 concen-trations compared with 50 μM MG 132 as positive control

Parasitol Res

group. Off-target effects of high b-AP15 concentrations of50 μM can not be discounted and did not interfere with theaccumulation of ubiquitinated conjugates, which is an out-come similar to that obtained with 50 μM MG132 (Fig. 8a,ESM_4). These results indicated that b-AP15 causes 26S pro-teasome dysfunction in parasite couples, and these findingscombined with the TEM results indicate that this inhibitorcould induce proteotoxic stress due to of the accumulationof ubiquitinated proteins and the generation of reactive oxy-gen species in mitochondria. However, more experiments areneeded to obtain formal biochemical evidence to support thisfinding.

The 20S complex has the same proteolytic activity as the26S proteasome, and the subunits of the complex responsiblefor peptide hydrolysis are β1, β2, and β5. These subunitshave caspase- l ike (C-L), t rypsin- l ike (T-L), andchymotrypsin-like (CT-L) activities. The fluorogenic substratesuccinyl-Leu-Leu-Val-Tyr-7-amido-4-methylcoumarin (Suc-Leu-Leu-Al-Tyr-AMC) was used to measure the b-AP15-mediated inhibition of the β5 subunit. The extracts from theworm couples in the negative control groups in the presence orabsence of 0.1% DMSO and 0.8 μM b-AP15 exhibited nor-mal CT-L activity. The CT-L activity began to decrease afterincubation with a concentration of 1.6 μM, and 50% activitywas obtained with concentrations between 3.2 and 50 μM.Incubation with the positive control MG132 resulted in noactivity (Fig. 8b).

In the parasite couples, the growth factor and transforma-tion factor (TGF β) pathway is involved in the process ofoviposition (Freitas et al. 2007; Osman et al. 2006; Osmanet al. 2001, 2004). Some of the genes expressed during this

process are associated with Ub-ligating enzymes (E3 en-zymes) and DUBs. Pickart (2000) showed that conjugationis catalyzed by the successive action of three enzymes: Ub-activating E1, E2-conjugating enzymes, and E3 ligase en-zyme. Furthermore, Ub binds in the substrate, and the sub-strate might be mono or polyubiquitinated based on the num-ber of bonds between Ub (Komander and Rape 2012).Deubiquitination, which is the reversed process, is strictlycontrolled by DUBs (Vogel et al. 2015), which are enzymesin the TGF β pathway, and the 26S proteasome in parasitecouples incubated with 0.8 and 1.6 μM b-AP15 for 24 h wasanalyzed (Fig. 9). The USP15 protein is known to interactwith TGF β receptors, which are deubiquitinated and not de-graded. This DUB is a positive regulator of the TGF β path-way (Iyengar 2017). The expression of the SmUSP15 gene inthe incubated couples was not significantly different from thatfound in the negative control group (0.1% DMSO). TheUSP9x DUB is known to interact with the Smad4 protein,and the gene expression analysis revealed that the SmUP9xgene was downregulated. Genes that encode proteins that par-ticipate in the canonical TGF β pathway were analyzed,namely, SmRITGFβ and SmSmad1/4, and the expression ofthese genes was also found to be downregulated. TheSmSmad6 gene encodes a protein that participates in the non-canonical TGF β pathway and did not exhibit an altered ex-pression level. These results show that b-AP15 alters the ex-pression of some genes involved in the TGF β pathway, andthese findings combined with the results obtained from theanalysis of the total number of eggs, and the TEM observa-tions show that b-AP15 induces molecular and ultrastructuralalterations in parasite couples.

TEM and SEM analyses were performed to assess the au-tophagic processes in the cells of parasite couples. However,b-AP15 activation caspase-3 in a dose-dependent manner andthe caspase pathway is activated after autophagy (Feng et al.2014). Because whether and when apoptosis occurs inS. mansoni incubated with the inhibitor are unclear, we per-formed the following experimental tests. First, we incubatedparasite couples with 0.8, 1.6, and 3.2 μM b-AP15 for 24 hand evaluated the apoptotic signaling pathway the expressionof the SmCaspase-3 gene in these parasite couples was signif-icantly different compared with its expression in parasites ex-posed to 0.1% DMSO (Fig. 10a). In addition, another exper-iment aimed to identify the level of caspase-3 activity byWestern blotting. Specifically, the relative active caspase-3level among the total proteins was determined using aFastCast gel, and the enzyme expression was evaluated. Nosignificant difference was found between the treated parasitesand the negative control group, but the cleaved forms of theenzyme with molecular masses of approximately 17 and19 kDa, which dimerize to produce the active form of theprotein, were not identified. In fact, only the inactive 35 kDaenzyme form was identified (Fig. 10b and ESM_5). The

�Fig. 8 b-AP15 induces the accumulation of ubiquitinated conjugates andalters 20S proteasome activity in S. mansoni couples. a Adult wormcouples were incubated in the presence and absence of b-AP15 for24 h, and the concentrations of b-AP15 used were 0.8, 1.6, 3.2, and50 μM. Parasites incubated in RPMI 1640 medium in the absence(CTRL) and presence of 0.1% DMSO were used as negative controls,and parasites incubated in RPMI 1640 with 3.2 and 50 μMMG132 wereused as positive controls. The quantifiedWestern blotting results based onthe detection of ubiquitinated conjugates showed significant differencesbetween the control parasites and the parasites exposed to b-AP15. Therelative quantitation of ubiquitinated conjugates was performed byWestern blotting/FastCast gel and was performed using ImageJ software.The asterisks (*) indicate significant differences with the CTR group(p < 0.05). The experiment was performed using biological triplicates,and one-way ANOVA and Tukey’s posttest were used for the statisticalanalyses of the Western blotting results. b 20S proteasome activity ofparasite couples incubated in the presence and absence of the inhibitorb-AP15. Lysates from parasite couples (50 μg) were incubated with theLLVY-AMC substrate in the presence of buffer solution, and the level ofAMC released from the proteasome was measured using a Perkin ElmerEnSpire Multimode Plate Reader. Biological triplicates were included inthe experiment, and fivefold techniques were performed. Column statis-tics and the D’Agostino-Pearson posttest were used for the statisticalanalyses

Parasitol Res

activity of the caspase-3 enzyme was identified, and the onlysignificant difference was found between the treatments andthe positive control provided with the kit (Fig. 10c). The dataanalysis showed that the apoptotic signaling pathway was notactivated in S. mansoni couples incubated with the inhibitorfor 24 h.

Discussion

Several drugs have been studied as potential pharmacologicaltargets for the treatment of schistosomiasis. Most of thesedrugs induce a decrease in oviposition but are not necessarilylethal to parasite couples when administered at low concentra-tions (Aguiar et al. 2016; Meleti et al. 2020; Pereira et al.2018). In this study, we showed the exposure of parasite cou-ples 1.6 μM b-AP15 for 24 h resulted in 80% inhibition of

without a change in viability or motility, and this low level ofoviposition was maintained after incubation for 72 h; howev-er, 50 μM b-AP15 was lethal to the parasite. The in vitroincubation of S. mansoni couples with 50μMMG132 showedthat oviposition ceased because the parasite couples separated,but this finding could not be confirmed due to inhibition of theproteasome complex (unpublished data). Bibo-Verdugo et al.(2019) showed that the incubation of adult worms with 1 μMMG132 for 24 h did not alter their motility, but incubationwith bortezomib and carfilzomib at the same concentrationfor the same duration induced 87% inhibition of 20S particleactivity and changed the motility of worms. In our study, a lowconcentration of b-AP15 (1.6 μM) did not separate the cou-ples but did not change their motor activity (motility). Theviability and motor activity of parasites couples were de-creased by exposure to b-AP15 at a concentration of 3.2 μMfor 24 h, and this treatment also separated the couples.

Fig. 9 Quantitative expression ofTGF β pathway-related mRNAs.The expression levels of themRNAs in adult worm couplesincubated in the presence and ab-sence of b-AP15 for 24 h wereanalyzed by quantitative PCR.The concentrations of b-AP15used in this study were 0.8 and1.6 μM. Parasites incubated inRPMI 1640 medium in the pres-ence of 0.1%DMSOwere used asa negative control. The expressionlevels of the mRNAs were calcu-lated according to the 2-ΔΔCT

method and normalized to theexpression of the endogenousSmGAPDH standard. The aster-isks (*) indicate significant dif-ferences compared with the 0.1%DMSO group (p < 0.05). The ex-periment was performed usingtechnical and biological tripli-cates, and one-way ANOVA andTukey’s posttest were used for thestatistical analyses

Parasitol Res

Therefore, a low concentration of the inhibitor is capable ofboth altering parasite viability and affecting oviposition.

Considering the alterations observed by SEM, we foundthat the inhibitor injured the tegument of parasite couples,particularly that of the male parasite, and the progressive in-jury was observed during 72 h period of incubation. Castro-Borges et al. (2007) demonstrated that the tegument is a com-partment of the parasite that contains relatively more complexand polyubiquitinated proteins, and an analysis of parasitecouples exposed to the inhibitor showed that the protein ac-cumulation was caused by changes in their teguments. Thesedata are of fundamental importance because the tegument isan important target for drugs, is essential for the survival of

parasites in the host, and plays vital roles in both immuneevasion of the parasite, the nutrient absorption, and cholesterolmetabolism processes of the host (Bertão et al. 2012; DeFarias Santiago et al. 2014; Manneck et al. 2010).

We evaluated the cell organelles by TEM, and damages to26S proteasome function in the protein degradation systemresulted in alterations in all cell organelles. The followingtwo organelles serve as sensors that indicate reduced protea-some activity: mitochondria and endoplasmic reticulum. b-AP15 induced deformation of the mitochondria, and thiscould be because the accumulation of high molecular weightconjugates in parasite cells and reactive oxygen species (ROS)in mitochondria and proteotoxic stress as revealed by analyses

Fig. 10 b-AP15 decreased the expression of SmCaspase-3 but did notalters the caspase -3 protein. Adult worm couples were incubated in thepresence and absence of b-AP15 for 24 h, and the concentrations of b-AP15 used in this experiment were 0.8, 1.6, and 3.2 μM. Parasites incu-bated in RPMI 1640 medium in the absence (CTRL) and presence of0.1%DMSOwere used as negative controls. a The RNA expression levelwas analyzed by quantitative PCR. The expression levels were calculatedusing the 2-ΔΔCT method and normalized to the expression of the endog-enous SmGAPDH standard. The experiment was performed using tech-nical and biological triplicates. The asterisks (*) indicate significant

differences compared with the negative control groups (p < 0.05). bQuantification of the Western blotting analyses for the detection of activecaspase-3 protein. The graphic shows no significant difference in theprotein level between the controls and the inhibitor treatments. The anti-body used in the Western blotting analysis was an active anti-caspase-3monoclonal antibody (1:1000). c Caspase-3 activity of S. mansoni wormcouples. The experiment was performed using biological triplicates. Theasterisks (*) indicate significant differences between the samples(p < 0.05), and one-way ANOVA and Tukey’s posttest were used forthe statistical analyses (Prisma 6.0)

Parasitol Res

of the mitochondria in human carcinoma cells (Liebl andHoppe 2016; Pardal et al. 2019; X. Zhang et al. 2018,2019). Therefore, TEM images of couples exposed to b-AP15 at a concentration of 1.6 μM suggest that the inhibitionof UCHL5 and USP14 causes cytotoxicity in the cells.

The 26S proteasome is linked to protein regulation dur-ing the parasite life cycle and plays important roles inmolecular and metabolic changes throughout life(Botelho-Machado et al. 2010; Castro-Borges et al. 2007;Guerra-Sá et al. 2005; Pereira-Júnior et al. 2013). Thein vitro inhibition of the 26S proteasome in adult wormsexposed to 50 μM MG132 upregulates the expression ofsome genes related to the 26S proteasome complex(Morais et al. 2017). In this study, we analyzed the expres-sion levels of Ub receptor subunits and DUBs relatedgenes encoding components of the complex. The expres-sion of the SmUbiquitin, SmRpn13, and SmRpn11 geneswas upregulated after exposure to 1.6 μM b-AP15. Thisfinding demonstrates a strategy used by cells to maintaintheir homeostasis. The observed increase in the level ofSmRpn11 gene expression might reflect an attempt to bal-ance the deubiquitinating activity of the complex becauseRpn11 cleaves the Ub chain, which aids the translocationof the protein to the 20S particle for its degradation (dePoot et al. 2017), and because the intrinsic Ub receptors ofthe 19S particle are involved with the opening of the 20Sparticle, which is involved in the degradation ofubiquitinated proteins (Rpn1, Rpn10, and Rpn13) (Bardet al. 2018). Furthermore, the treatment upregulatedSmRpn13, but did not change SmRpn10 expression, poten-tially because the 26S proteasome subunits are not suffi-ciently regulated by the inhibition of UCHL5 and USP14,and this inhibition induces deregulation of the system be-cause deubiquitinating enzymes are responsible for main-taining the pool of Ub in the cell (Chernova et al. 2003; dePoot et al. 2017). The alterations in 19S particle functionwere demonstrated by Western blotting, and the resultsshowed the accumulation of highly ubiquitinated conju-ga t es . USP14 and UCHL5 are re spons ib l e fo rdeubiquitination of the polyubiquitinated chains of pro-teins, USP14 can hydrolyze free Ub chains although ithas an in vitro preference for substrates with multiple Ubmodifications, and UCH37 mediates the cleavage of longUb chains (de Poot et al. 2017).

The different concentrations of b-AP15 analyzed in thisstudy showed that the inhibition of UCHL5 and USP14 inter-feres with the chymotrypsin-like activity of 20S particles. At aconcentration of between 3.2 and 50 μM, the inhibitor de-creased 26S proteasome activity by 50%, whereas 50 μMMG132 completely inhibited the activity of the 26S protea-some (Guerra-Sá et al. 2005). The study conducted by Bibo-Verdugo et al. (2019) showed that couples of S. mansoni in-cubated with 1 μM bortezomib and carfilzomib for 24 h,

which are inhibitors of the 20S particle, decreased the protea-some activity in endogenous worms by more than 75%, butMG132 at the same concentration did not inhibit proteasomeactivity. We can hypothesize that this biochemical phenome-non occurs due to the promiscuous binding of the inhibitor tothe 26S complex because the b-AP15 molecule has multipleMichael acceptors that interact with the amino acid hydroxyland sulfhydryl groups of proteins (Wang et al. 2014) and bindspromiscuously to the β5 subunit of the 20S particle.

The finding that 24 h of incubation with b-AP15 did notchange the caspase-3 apoptotic pathway in parasites was dem-onstrated through caspase-3 detection assays. b-AP15 inducesautophagy processes and proteotoxic stress, which occur priorto cellular apoptosis in human cells (Vogel et al. 2015). Inparasite couples, autophagy process might occur during thefirst 24 h of exposure to b-AP15, at 72 h of exposure to thisinhibitor induces cellular apoptosis. This process is possiblebecause in cancer cells incubated with b-AP15, apoptosis me-diates cell death as a compensatory mechanism in response tothe stress induced in the proteasome Ub system (Vogel et al.2015). The results reported by Morais et al. (2017) suggestthat high concentrations of MG132 (50 μM) deregulate theapoptotic pathway, but Bibo-Verdugo et al. (2019) incubatedadult worms with 1 μMMG132, bortezomib, and carfilzomibfor 24 h and found no alteration in caspase activity in theparasites incubated with MG132, whereas bortezomib andcarfilzomib induced significant increases in caspase activity.However, more experiments are needed to elucidate the apo-ptotic pathway activated in the male and female parasites byexposure to b-AP15 because it is known that the inhibitor hasactivity in the Bax and Bcl-2 pathways in cancer cells (Fenget al. 2014).

Pereira et al. (2014, 2015) evaluated the importance ofdeubiquitinating enzymes, including the expression of genesbelonging to diverse subfamilies (USP, OTU, andMJD) in theparasite life cycle. The gene expression profile of all the tran-scripts of DUBs show differences among cercariae,schistosomula, and adult worms but exhibit conserved pat-terns in relation to other eukaryotes. The data suggest thatthese protein subfamilies are regulated by UPS activity duringthe parasite life cycle. The TGF-β pathway, which is the moststudied signaling pathway in S. mansoni, regulates differentvital processes such as cell growth, differentiation, morpho-genesis, and apoptosis (Freitas et al. 2007; Osman et al. 2006;Osman et al. 2001, 2004). The statistical analysis ofSmUSP9x, SmRITGFβ, and SmSmad1/4 gene expression inthe TGFβ pathway showed that these genes were downregu-lated in all parasite couples exposed to b-AP15. Previous stud-ies have revealedmultiple roles for the TGFβ pathway duringfemale reproductive development and egg production (Freitaset al. 2007). According to these researchers, the followingcomponents of the TGF β pathway are expressed in thevitellary of the parasites: SmIn/Act, the SmTβRII, and

Parasitol Res

SmTβRI receptors and SmSmad1, SmSmad2, and SmSmad4proteins. The 26S proteasomemodulates and degrades variouscomponents of this pathway, such as receptor TGF β type 1,Smad1, Smad2, and Smad4 (Zhang and Laiho 2003). Thedeubiquitinating enzymes USP9x and USP15 are expressedin adult S. mansoni worms (Pereira et al. 2015) and also act inthe TGF β pathway. The USP9x protein deubiquitinatesSmad4, and Smad4, together with R-Smad (the Smad4/R-Smad complex), activates promoter sequences and modulatesthe transcription of genes specific for TGF β due to the “li-gand effect” (Osman et al. 2004). The expression of theSmUSP9x and SmSmad4 genes is downregulated, and thesegenes encode proteins that affect p21 transcription, which isinvolved in cell cycle progression (Zhang et al. 2014).

In summary, the studies conducted by our researchgroup and the results obtained in this study show thatthe 26S proteasome is important not only to parasite biol-ogy but also for understanding the UCHL5 and USP14enzymes, which are reversibly bound to 19S particles. b-AP15 leads to parasite death and is an interesting drugtarget for the treatment of schistosomiasis. Future studiesare needed to determine the signaling pathways in theparasites that are activated by the inhibitor and the asso-ciated mechanisms of action. In vivo studies are needed todetermine whether b-AP15 might be a useful new drug forthe treatment of schistosomiasis.

Acknowledgments The authors are grateful to the Electron MicroscopyLaboratory in Ribeirao Preto, University of Sao Paulo, Brazil, for thesupport provided with the transmission and scanning electronmicroscopyexaminations. The authors are grateful to OnTarget Chemistry (Sweden)for providing the b-AP15 inhibitor. The authors are also thankful to Prof.Adriano Silva Sebollela for the technical support provided by your labo-ratory. Andressa Barban do Patrocinio was the recipient of a Ph.D. stu-dentship from the University of São Paulo Ribeirão Preto MedicalSchool, Department of Biochemistry and Immunology, HigherEducation Personnel Improvement Coordination (CAPES).

Author contributions All authors contributed to the study design of thestudy. The materials were collected by [Andressa Barban do Patrocinio]and [Olinda Mara Brigato], and the materials were prepared by [LizandraGuidi Magalhães], [Andressa Barban do Patrocinio], and [Lucas Antôniode Lima Paula]. The real-time polymerase chain reaction was performedby [Andressa Barban do Patrocinio], [Larissa Franco], and [FernandaJanku Cabral]. The Western blotting assays were performed by[Andressa Barban do Patrocinio] and [André Luiz Brandão Bitencourt],and the data were analyzed by [Andressa Barban do Patrocinio].Transmission and scanning electron microscopy were performed by[Andressa Barban do Patrocinio], and the data were analyzed by[Renata Guerra-Sá] and [Andressa Barban do Patrocinio]. The researchwas conducted by [Renata Guerra-Sá] and [Vanderlei Rodrigues]. Thefirst draft of the manuscript was written by [Andressa Barban doPatrocinio], and all the authors commented on previous versions of themanuscript and read and approved the final version of the manuscript.

Funding information This work was supported by grants from the SãoPaulo Research Foundation (FAPESP) #2016/06769-2 to Prof. VanderleiRodrigues and #17/07364-9 to Fernanda Janku Cabral.

Compliance with ethical standards

Ethical approval All applicable international, national, and/or institutional guide-lines for the care and use of animals were followed. In addition, a procedureperformed in studies involving animals were approved by the Ethical Committeefor Animal Care of the University of São Paulo (Protocol 195/2015).

References

Bard J, Goodall EA, Greene ER, Jonsson E, Dong KC, Martin A (2018)Structure and function of the 26S proteasome. Annu Rev Biochem87:697–724. https://doi.org/10.1146/annurev-biochem-062917-011931

Bertão HG, da Silva RAR, Padilha RJR, de Azevedo Albuquerque MCP,Rádis-Baptista G (2012) Ultrastructural analysis of miltefosine-induced surface membrane damage in adult Schistosoma MansoniBH strain worms. Parasitol Res 110(6):2465–2473

Bibo-Verdugo B, Wang SC, Almaliti J et al (2019) The proteasome as adrug target in the metazoan pathogen, Schistosoma mansoni. ACSInfect Dis 5(10):1802–1812. https://doi.org/10.1021/acsinfecdis.9b00237

Botelho-Machado C, Cabral FJ, Soares CS, Moreira EBC, Morais ER,Magalhães LG, Gomes MS, Guerra-Sá R, Rosa JC, Ruller R, WardRJ, Rodrigues V (2010) Characterization and MRNA expressionanalysis of PI31, an endogenous proteasome inhibitor fromSchistosoma mansoni. Parasitol Res 107(5):1163–1171

Carneiro VC, de Abreu da Silva IC, Torres EJL, Caby S, Lancelot J,Vanderstraete M, Furdas SD, Jung M, Pierce RJ, Fantappié MR(2014) Epigenetic changes modulate Schistosome egg formationand are a novel target for reducing t ransmiss ion ofSchistosomiasis. PLoS Pathog 10(5):e1004116. https://doi.org/10.1371/journal.ppat.1004116

Castro-Borges W, Cartwright J, Ashton PD, Braschi S, Guerra Sa R,Rodrigues V, Wilson RA, Curwen RS (2007) The 20S proteasomeof Schistosoma mansoni: a proteomic analysis. Proteomics 7(7):1065–1075

Chernova TA, Allen KD, Wesoloski LM, Shanks JR, Chernoff YO,Wilkinson KD (2003) Pleiotropic effects of Ubp6 loss on drug sen-sitivities and yeast prion are due to depletion of the free ubiquitinpool. J Biol Chem 278(52):52102–52115

Ciechanover A, Stanhill A (2014) The complexity of recognition ofubiquitinated substrates by the 26S proteasome. Biochim BiophysActa, Mol Cell Res 1843(1):86–96. https://doi.org/10.1016/j.bbamcr.2013.07.007

Comley JCW, Rees MJ, Turner CH, Jenkins DC (1989) Colorimetricquantitation of filarial viability. Int J Parasitol 19(1):77–83

D’Arcy P et al (2011) Inhibition of proteasome deubiquitinating activityas a new cancer therapy. Nat Med 17(12):1636–1640

De Farias Santiago E et al (2014) Evaluation of the anti-Schistosomamansoni activity of thiosemicarbazones and thiazoles. AntimicrobAgents Chemother 58(1):352–363

Aguiar D, Paula D et al (2016) Curcumin generates oxidative stress and inducesapoptosis in adult Schistosoma mansoni worms. PLoS One 11(11):1–25

Feng X, Holmlund T, Zheng C, Fadeel B (2014) Proapoptotic effects ofthe novel proteasome inhibitor B-AP15 on multiple myeloma cellsand natural killer cells. Exp Hematol 42(3):172–182. https://doi.org/10.1016/j.exphem.2013.11.010

Foongladda S, Roengsanthia D, Arjrattanakool W, Chuchottaworn C,Chaiprasert A, Franzblau SG (2002) Rapid and simpleMTTmethodfor rifampicin and isoniazid susceptibility testing of mycobacteriumtuberculosis. Int J Tubercul Lung Dis 6(12):1118–1122

Parasitol Res

Freitas TC, Jung E, Pearce EJ (2007) TGF-β signaling controls embryodevelopment in the parasitic flatworm Schistosoma mansoni. PLoSPathog 3(4):489–497

Guerra-Sá R, Castro-Borges W, Evangelista EA, Kettelhut IC, Rodrigues V(2005) Schistosoma mansoni: functional proteasomes are required for de-velopment in the vertebrate host. Exp Parasitol 109(4):228–236

Iyengar PV (2017) Regulation of ubiquitin enzymes in the TGF-β path-way. Int J Mol Sci 18(4):877. https://doi.org/10.3390/ijms18040877

King CH (2009) Toward the elimination of Schistosomiasis. N Engl JMed 360(2):106–109

Komander D, Rape M (2012) The ubiquitin code. Annu Rev Biochem81(1):203–229

Liebl MP, Hoppe T (2016) It’s all about talking: two-way communicationbetween proteasomal and lysosomal degradation pathways via ubiq-uitin. Am J Phys Cell Phys 311(2):C166–C178

Lima MG, Montresor LC, Pontes J, Augusto R d C, Silva JP d, ThiengoSC (2019) Compatibility polymorphism based on long-term host-parasite relationships: cross talking between Biomphalaria Glabrataand the trematode Schistosoma mansoni from endemic areas inBrazil. Front Immunol 10(April):328

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expressiondata using real-time quantitative PCR and the 2-ΔΔCT method.Methods 25(4):402–408

Manneck T, Haggenmüller Y, Keiser J (2010) Morphological effects andtegumental alterations induced by mefloquine on schistosomula andadult flukes of Schistosoma Mansoni. Parasitology 137(1):85–98

Mathieson W, Castro-Borges W, Alan Wilson R (2011) The proteasome-ubiquitin pathway in the Schistosoma mansoni egg hasdevelopment- and morphology-specific characteristics. MolBiochem Parasitol 175(2):118–125. https://doi.org/10.1016/j.molbiopara.2010.10.005

Meleti VR, EsperandimVR, Flauzino LGB et al (2020) (±)-Licarin A andits semi-synthetic derivatives: in vitro and in silico evaluation oftrypanocidal and schistosomicidal activities. Acta Trop 202:105248. https://doi.org/10.1016/j.actatropica.2019.105248

Morais ER et al (2017) Effects of proteasome inhibitor MG-132 on theparasite Schistosoma mansoni. PLoS One 12(9):1–20

Osman A, Niles EG, LoVerde PT (2001) Identification and characteriza-tion of a Smad2 homologue from Schistosoma mansoni, atransforming growth factor-β signal transducer. J Biol Chem276(13):10072–10082

Osman A, Niles EG, LoVerde PT (2004) Expression of functionalSchistosoma mansoni Smad4: role in Erk-mediated transforminggrowth factor beta (TGF-beta) down-regulation. J Biol Chem279(8):6474–6486

Osman A, Niles EG, Verjovski-Almeida S, LoVerde PT (2006)Schistosoma mansoni TGF-β receptor II: role in host ligand-induced regulation of a Schistosome target gene. PLoS Pathog2(6):0536–0550

Pardal AJ, Fernandes-Duarte F, Bowman AJ (2019) The histonechaperoning pathway: from ribosome to nucleosome. EssaysBiochem 63(1):29–43 http://essays.biochemistry.org/lookup/doi/10.1042/EBC20180055

Pereira-Júnior OS, Pereira RV, Silva CS, Castro-Borges W, Sá RG, Cabral FJ,Silva SH, Soares CS,Morais ER,Moreira ÉBC,Magalhães LG, de PaulaFM, Rodrigues V (2013) Investigation on the 19S ATPase proteasomesubunits (Rpt1-6) conservation and their differential gene expression inSchistosoma Mansoni. Parasitol Res 112(1):235–242

Pereira, Adriana S.A. et al. (2018) 12 PLoS neglected tropical diseasesInhibition of Histone Methyltransferase EZH2 in Schistosomamansoni in vitro by GSK343 reduces egg laying and decreases the

expression of genes implicated in DNA replication and noncodingRNA metabolism

Pereira RV et al (2015) Ubiquitin-specific proteases are differentiallyexpressed throughout the Schistosoma mansoni life cycle. ParasitVectors:1–11. https://doi.org/10.1186/s13071-015-0957-4

Pereira RV, Vieira HGS, Oliveira VF d, Gomes M d S, Passos LKJ,Borges W d C, Guerra-Sá R (2014) Conservation and developmen-tal expression of ubiquitin isopeptidases in Schistosoma mansoni.Mem Inst Oswaldo Cruz 109(1):1–8

Pickart CM (2000) Ubiquitin in chains. Trends Biochem Sci 25(11):544–548de Poot SAH, Tian G, Finley D (2017) Meddling with fate: the proteasomal

deubiquitinating enzymes. J Mol Biol 429(22):3525–3545Ramirez B et al (2007) Schistosomes: challenges in compound screening.

Expert Opin Drug Discovery 2(sup1):S53–S61Roderfeld M, Padem S, Lichtenberger J, Quack T, Weiskirchen R,

Longerich T et al (2019) Schistosoma mansoni Egg–secreted anti-gens activate hepatocellular carcinoma–associated transcription fac-tors c-Jun and STAT3 in hamster and human hepatocytes [publishedonline ahead of print, 2018 Jul 27]. Hepatology:1–16. https://doi.org/10.1002/hep.30192

Roeten MSF, Cloos J, Jansen G (2018) Positioning of proteasome inhib-itors in therapy of solid malignancies. Cancer Chemother Pharmacol81(2):227–243. https://doi.org/10.1007/s00280-017-3489-0

Roquis D, Lepesant JMJ, PicardMAL, FreitagM, Parrinello H, GrothM,Emans R, Cosseau C, Grunau C (2015) The epigenome ofSchistosoma mansoni provides insight about how cercariae poisetranscription until infection. PLoS Negl Trop Dis 9(8):1–22.https://doi.org/10.1371/journal.pntd.0003853

Roquis D, Taudt A, Geyer KK, Padalino G, Hoffmann KF, Holroyd Net al (2018) Histone methylation changes are required for life cycleprogression in the human parasite Schistosoma mansoni. PLoSPathog 14(5):1–26

Vogel RI, Coughlin K, Scotti A, Iizuka Y, Anchoori R, Roden RBS,Marastoni M, Bazzaro M (2015) Simultaneous inhibition ofdeubiquitinating enzymes (DUBs) and autophagy synergisticallykills breast cancer cells. Oncotarget 6(6):4159–4170

Wang X, Stafford W, Mazurkiewicz M, Fryknäs M, Brjnic S, Zhang X,Gullbo J, Larsson R, Arnér ESJ, D'Arcy P, Linder S (2014) The 19Sdeubiquitinase inhibitor B-AP15 is enriched in cells and elicits rapidcommitment to cell death. Mol Pharmacol 85(6):932–945

WHO (2017) Schistosomiasis. Fact sheet Nº 115. Disponível em.Accessed 19 July 2019

Zhang F, Laiho M (2003) On and off: proteasome and TGF-β signaling.Exp Cell Res 291(2):275–281

Zhang J, Zhang X, Xie F, Zhang Z, van Dam H, Zhang L, Zhou F (2014)The regulation of TGF-β /SMAD signaling by proteindeubiquitination. Protein Cell 5(7):503–517

Zhang X, Pellegrini P, Saei AA, Hillert E-K, Mazurkiewicz M, OlofssonMH, Zubarev RA, D'Arcy P, Linder S (2018) The deubiquitinaseinhibitor B-AP15 induces strong proteotoxic stress and mitochon-drial damage. Biochem Pharmacol 156:291–301. https://doi.org/10.1016/j.bcp.2018.08.039

Zhang X, Espinosa B, Saei AA, D'Arcy P, Zubarev RA, Linder S (2019)Oxidative stress induced by the deubiquitinase inhibitor B-AP15 isassociated with mitochondrial impairment. Oxidative Med CellLongev 2019:1–11

Publisher’s note Springer Nature remains neutral with regard to jurisdic-tional claims in published maps and institutional affiliations.

Parasitol Res