INEC annual meeting Granada, May 25-26, 2000 Universitat de les Illes Balears and IMEDEA (CSIC-UIB) Area de Microbiología Departamento de Biología y Departamento de Recursos Naturales Vicente J. Benedí Locust bean or guar? Locust bean or guar? Molecular methods for detecting Molecular methods for detecting additions of guar gum to locust additions of guar gum to locust bean gum bean gum
30
Embed
INEC annual meeting Granada, May 25-26, 2000 Universitat de les Illes Balears and IMEDEA (CSIC-UIB) Area de Microbiología Departamento de Biología y Departamento.
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
INEC annual meetingGranada, May 25-26, 2000
Universitat de les Illes Balears andIMEDEA (CSIC-UIB)
Area de Microbiología Departamento de Biología y
Departamento de Recursos NaturalesVicente J. Benedí
Locust bean or guar? Locust bean or guar? Molecular methods for detecting additions Molecular methods for detecting additions
of guar gum to locust bean gumof guar gum to locust bean gum
E 410 vs. E 412: what the EC says (I. Definitions)Off. J. of the E.C. L334, 09.12.98
E 410Locust bean gum is the ground endosperm of the seeds of the natural strains of carob tree, Cerationia siliqua (L.) Taub. (family Leguminosae). Consists mainly of a high molecular weight hydrocolloidal polysaccharide, composed of galactopyranose and mannopyranose units combined through glycosidic linkages, which may be described chemically as galactomannansE 412Guar gum is the ground endosperm of the seeds of the natural strains of guar plant, Cyamopsis tetragonlobus (L.) Taub. (family Leguminosae). Consists mainly of a high molecular weight hydrocolloidal polysaccharide, composed of galactopyranose and mannopyranose units combined through glycosidic linkages, which may be described chemically as galactomannans
E 410 vs. E 412: what the EC says (II. Identification) Off. J. of the E.C. L334, 09.12.98
E 410A. Positive tests for galactose mannoseB. Microscopic examination (see next slide)C. Solubility: soluble in hot water, insoluble in ethanol
E 412A. Positive tests for galactose mannoseB. Solubility: soluble in cold water
E 410 vs. E 412: what the EC says (II. Identification)
B. Microscopical identification(Place some…containing 0.5% iodine and…and examine under the microscope.)
Locust bean gum contains long stretched tubiform cells, separated or highly interspaced. Their brown contents are much less regularly formed in guar gum. Guar gum shows close groups of round to pear shaped cells. Their contents are yellow to brown.
E 410 E 412
E 410 vs. E 412: what the EC says (II. Identification)
Control LBGControl Guar gum
A B
Other methods from literature
• Methods based on the polysaccharide composition• Galactose to mannose ratios
• Methods based on the polysaccharide composition and structure• Lectin assays
Mannose to galactose ratios (I)
• EC says nothing in E 410 and E 412 descriptions
• But when describes E 417 says that mannose:galactose ratios are– 3:1 for E 417
– 4:1 for E 410
– 2:1 for E 412
(m-m-m-m-m-m-m-m-m-m-m-m)nIg Ig Ig Ig
(m-m-m-m-m-m-m-m-m-m-m-m)nIg Ig Ig IgIg Ig
(m-m-m-m-m-m-m-m-m-m-m-m)nIg IgIg
Mannose to galactose ratios (II)
• 4:1 for E 410; 2:1 for E 412• But, different ratios have been described:
– 3.0:1 and 1.5:1 (Preuss and Their, Z Lebensm Unters Forsch, 175:93, 1982)
– 2.7:1 and 1.4:1 (Angelini et al, Riv Soc Ital Alim, 13:479, 1984) – 3.7:1 and 2.3:1 (Cheetham et al, Carbohyd Pol 6:257, 1986)
– 3.7 to 7.7:1 depending on the solubilization temperature of E 410 (Lopes da Silva and Gonzales, Foof Hydrocol. 4:277, 1990)
Mannose to galactose ratios (III)
• Variations difficult demonstration of E 412 presence in E 410/E 412 mixtures
• Furthermore, man:gal ratios will be affected if other food additives (e.g., man from E 415)
• Also, man and gal can be present in processed foods, thus affecting the man:gal ratios
Techniques are cumbersome and require complex extractions
Lectin assays• Lectins are plant proteins which bind polysaccharides• Different lectins bind different polysaccharides• Patel et al. (Leatherhead Food RA)
immobilized lectin
lectin binds guarbut not LBG
bound guar is detected with the
same lectin labeled with an
enzyme
LBG
GUAR
color readings
lectinguar
LBGenzyme
support
Enzyme-Linked Lectin Assay (ELLA)
LBG Guar Tara E 410 commercial samples
Opt
ical
den
sity
1.2
0.8
0.6
0.4
1.0
0.2
0
buffer
Development of new (DNA-based) methodsE 410Locust bean gum is the ground endosperm of the seeds of the natural strains of carob tree, Cerationia siliqua (L.) Taub. (family Leguminosae). Consists mainly of a high molecular weight hydrocolloidal polysaccharide, composed of galactopyranose and mannopyranose units combined through glycosidic linkages, which may be described chemically as galactomannansE 412Guar gum is the ground endosperm of the seeds of the natural strains of guar plant, Cyamopsis tetragonlobus (L.) Taub. (family Leguminosae). Consists mainly of a high molecular weight hydrocolloidal polysaccharide, composed of galactopyranose and mannopyranose units combined through glycosidic linkages, which may be described chemically as galactomannans
DNA and its building blocks
Examples of languages (messages)
English
MusicalScore
Morsecode
Chinese
DNA
DNA vs. amino acid information
DNA information is conserved
The Polymerase Chain Reaction
Amplification step of the PCR
Seeds as sources of DNA• Germination of seeds (carob and guar)• Extraction of DNA from fresh tissues• PCR amplification of extracted DNA• Electrophoretic analysis of amplification products
CAROB TREE sequence (Marker 1)ACCTTCCTCTTCAGCATTGTTCCAAAAGCATCCACTTGGACACCTTCCTAGTAACAGCTACGGAGTGTTTTGCTTGCTGGACGCTTAACCAATTTGATAGCCCCCGCCCCCCGCACGCAGGAGGGTTCGGAGGTACAGCCCTCCGCGGACACCGGGGGGCGGTGAGCACGATGGAGCTGGTTTTTTGATTGGGACCGCAAATTGCGCGGTTCCTTGATGTTGGTCACTCGCACGAGGGCTACTGGACCATTGCCGCTAGCTAGCTACTCGCAGCACTGTAAGAATAGGTTTTACTGAGAGCCATTGCCTATAGAGCCGAGAGCGTAGCTACTTCTTGCGTCGT
CAROB TREE sequence (Marker 1)ACCTTCCTCTTCAGCATTGTTCCAAAAGCATCCACTTGGACACCTTCCTAGTAACAGCTACGGAGTGTTTTGCTTGCTGGACGCTTAACCAATTTGATAGCCCCCGCCCCCCGCACGCAGGAGGGTTCGGAGGTACAGCCCTCCGCGGACACCGGGGGGCGGTGAGCACGATGGAGCTGGTTTTTTGATTGGGACCGCAAATTGCGCGGTTCCTTGATGTTGGTCACTCGCACGAGGGCTACTGGACCATTGCCGCTAGCTAGCTACTCGCAGCACTGTAAGAATAGGTTTTACTGAGAGCCATTGCCTATAGAGCCGAGAGCGTAGCTACTTCTTGCGTCGT
Carob vs. guar sequences (Marker 2)identicaldifferent P3
Guar 4 3.21 ND NA —30% Guar 4 0.3 ND NA —10% Guar 4 0.64 ND NA —
Locust bean 4 0.86 ND NA —
Specific amplification of guar DNA from mixtures of LBG and known additions of guar gum
100200300
30% 20% 10% 12% 6% 2% guar+LBG
mixture 1 mixture 2
LBG
GUAR
Specific detection of guar DNA in commercial samples labeled as E 410
300
200
100
Guar
LBG
Commercial sampleslabeled as E 410
Specificity of the amplified products
uncut T a q I X h o I restrictions
Amplification products were • cutted with a restrictase specific of the guar sequence• analyzed by gel electrophoresis
Molecular methods for detecting additions Molecular methods for detecting additions of guar gum to locust bean gumof guar gum to locust bean gum
Work developed by:Work developed by:• S. Albertí, A. Doménech-Sánchez, V.J. Benedí S. Albertí, A. Doménech-Sánchez, V.J. Benedí • M.L. Hernández, J.A. RossellóM.L. Hernández, J.A. Rosselló
Funded by:Funded by:• Carob S.A.Carob S.A.
With the collaboration of:With the collaboration of:• A. Juan, J. Sansegundo (Carob S.A., lab) A. Juan, J. Sansegundo (Carob S.A., lab) • D. Álvarez, M. Urdiaín (UIB)D. Álvarez, M. Urdiaín (UIB)• C. Murillo and R. Jiménez-Flores (CalPoly, USA)C. Murillo and R. Jiménez-Flores (CalPoly, USA)