In vivo transcriptional profile analysis reveals RNA splicing and chromatin remodeling as prominent processes for adult neurogenesis

wwwelseviercomlocateymcne

Mol Cell Neurosci 31 (2006) 131 ndash 148

In vivo transcriptional profile analysis reveals RNA splicing and

chromatin remodeling as prominent processes for adult neurogenesis

Daniel A Lima Mayte Suarez-Farinasb Felix Naefb Coleen R Hackerc Benedicte Menna

Hirohide Takebayashia Marcelo Magnascob Nila Patilc and Arturo Alvarez-Buyllaa

aDepartment of Neurological Surgery and Developmental and Stem Cell Biology Program University of California

San Francisco CA 94143 USAbThe Rockefeller University 1230 York Ave New York NY 10021 USAcPerlegen Sciences Inc 3380 Central Expressway Santa Clara CA 95051 USA

Received 10 May 2005 revised 21 August 2005 accepted 4 October 2005

Available online 5 December 2005

Neural stem cells and neurogenesis persist in the adult mammalian

brain subventricular zone (SVZ) Cells born in the rodent SVZ

migrate to the olfactory bulb (Ob) where they differentiate into

interneurons To determine the gene expression and functional

profile of SVZ neurogenesis we performed three complementary

sets of transcriptional analysis experiments using Affymetrix

GeneChips (1) comparison of adult mouse SVZ and Ob gene

expression profiles with those of the striatum cerebral cortex and

hippocampus (2) profiling of SVZ stem cells and ependyma isolated

by fluorescent-activated cell sorting (FACS) and (3) analysis of gene

expression changes during in vivo SVZ regeneration after anti-

mitotic treatment Gene Ontology (GO) analysis of data from these

three separate approaches showed that in adult SVZ neurogenesis

RNA splicing and chromatin remodeling are biological processes as

statistically significant as cell proliferation transcription and

neurogenesis In non-neurogenic brain regions RNA splicing and

chromatin remodeling were not prominent processes Fourteen

mRNA splicing factors including Sf3b1 Sfrs2 Lsm4 and Khdrbs1

Sam68 were detected along with 9 chromatin remodeling genes

including Mll Bmi1 Smarcad1 Baf53a and Hat1 We validated the

transcriptional profile data with Northern blot analysis and in situ

hybridization The data greatly expand the catalogue of cell cycle

components transcription factors and migration genes for adult

1044-7431$ - see front matter D 2005 Elsevier Inc All rights reserved

doi101016jmcn200510005

Abbreviations SVZ subventricular zone Ob olfactory bulb ObC

olfactory bulb core Ctx cortex St striatum Hp hippocampus ds cDNA

double-stranded complementary DNA cRNA complementary (antisense)

RNA FACS fluorescent-activated cell sorting ECM extracellular matrix

RMS rostral migratory stream EGF epidermal growth factor FGF

fibroblast growth factor

Corresponding authors

E-mail addresses limdneurosurgucsfedu (DA Lim)

abuyllaitsaucsfedu (A Alvarez-Buylla)

Available online on ScienceDirect (wwwsciencedirectcom)

SVZ neurogenesis and reveal RNA splicing and chromatin remodel-

ing as prominent biological processes for these germinal cells

D 2005 Elsevier Inc All rights reserved

Keywords Subventricular zone (SVZ) Neurogenesis Stem cell Adult

brain Microarray Transcription Transcriptional profile Chromatin

remodeling RNA splicing

Introduction

The adult brain harbors neurogenic stem cells within the

subventricular zone (SVZ) of the lateral ventricle wall (Garcia-

Verdugo et al 1998 Gage 2000) In neonatal (Luskin 1993) and

adult mice (Lois and Alvarez-Buylla 1994 Doetsch and Alvarez-

Buylla 1996 Jankovski and Sotelo 1996 Thomas et al 1996)

cells born in the SVZ migrate a long distance to the olfactory bulb

(Ob) where they differentiate into interneurons SVZ astrocytes

(type B cells) are neural stem cells (Doetsch et al 1999ab Laywell

et al 2000) and give rise to rapidly dividing immature-appearing

cells (type C cells) that generate migratory neuroblasts (type A

cells) (Lois and Alvarez-Buylla 1994 Peretto et al 1997 Luskin

1998 Doetsch et al 1999ab) See Figs 1B C SVZ ependymal

cells are themselves not neurogenic (Chiasson et al 1999 Laywell

et al 2000 Capela and Temple 2002) but may be important for

generating the SVZ neurogenic niche (Lim et al 2000 Goldman

2003 Peretto et al 2004) Although the SVZ cellular architecture

(Gates et al 1995 Jankovski and Sotelo 1996 Doetsch et al

1997 Peretto et al 1997) stem cell identity (Chiasson et al 1999

Doetsch et al 1999ab Laywell et al 2000 Rietze et al 2001

Capela and Temple 2002 Imura et al 2003) and neurogenic

lineage (Doetsch et al 1999ab) have been defined the genetic

program for adult SVZ neurogenesis is poorly understood

The transcriptional changes of differentiating neocortical (East-

erday et al 2003 Karsten et al 2003) and postnatal SVZ-derived

Fig 1 (A) Brain regions dissected for the brain region transcriptional

analysis Dissected areas are shown in yellow The SVZ contains three

populations of neurogenic precursorsmdashtype B C and A cells (B) The

lineage of SVZ neurogenesis TypeB cells (blue) are SVZ astrocytes that self-

renew and give rise to a rapidly dividing population of immature-appearing

cellsmdashtype C cells (green) The transit-amplifying type C cells then become

type A cells (red) the neuroblasts that migrate into the ObC (C) Architecture

of the SVZ The ventricle is to the left Ciliated ependymal cells (gray) line

the ventricle wall Some type B cells (blue) make contact with the ventricle

lumen (arrow) Both type C (green) and A cells (red) are in direct contact with

the type B cells In this panel type A cells are migrating toward the ObC in a

direction perpendicular to the page (D) Sagittal view of the mouse brain

Within the SVZ there is an extensive network of type A cells migrating

tangentially toward the ObC This network of pathways coalesces at the

anterior of the SVZ to form the rostral migratory stream (curved arrow) The

rostral migratory stream enters the ObC where type A cells then migrate

radially and disperse (red dots) throughout the Ob The major biological

processes that occur in the SVZ alone (SVZ profile) SVZ and ObC (SO

profile) and ObC alone (ObC profile) are listed to the left middle and right

respectively the cell types of the SVZ and ObC profiles are in bold

DA Lim et al Mol Cell Neurosci 31 (2006) 131ndash148132

(Gurok et al 2004) neurospheres have also been studied in vitro

Many neurospheres are derived from transit-amplifying cells (type

C cells) (Doetsch et al 2002) and their exposure to growth factors

(EGF or FGF) in vitro deregulates the normal genetic control of

cell differentiation that occurs in vivo (Gabay et al 2003 Santa-

Olalla et al 2003 Hack et al 2004) it is likely that the expression

profiles of neurospheres and endogenous SVZ precursors differ

Furthermore in vivo SVZ neurogenesis involves a long-distance

directional migration to the Ob while neurospheres do not appear

to have a similar migration capacity Therefore transcriptional

analysis of in vivo SVZ neurogenesis is required to identify genes

and biological processes involved in this continual generation of

neurons for the Ob

Using high-density oligonucleotide (GeneChip) arrays we

undertook three complementary approaches to determine the

transcriptional profile of in vivo SVZ neurogenesis We first

compared gene expression differences of the SVZ-Ob system with

that of three other brain regions We then utilized FACS methods to

compare the transcriptional profiles of type B cells ndash the

neurogenic stem cell ndash and the non-neurogenic ependyma Finally

we analyzed the transcriptional changes of the SVZ as it

regenerated type C and A cells from a population of type B cells

Data integrated from these three approaches identified genes

signaling pathways and biological processes related to SVZ

neurogenesis In addition to expanding the catalogue of cell cycle

components transcription factors and genes for migration we

identified RNA splicing and chromatin remodeling as prominent

processes for adult neurogenesis The importance of RNA splicing

and chromatin remodeling has not been described for SVZ neuro-

genesis and we here provide evidence that these processes are as

upregulated as the expected processes of cell cycle transcription

and neurogenesis We focused our Results and Discussion below

only on a subset of genes with special attention to RNA splicing and

chromatin remodeling however both the raw chip image data and

other data analyses are available (Supplementary data and at http

asterionrockefelleredumayteNeurogenesis) for future compara-

tive expression profile analyses with other developmental adult or

tumor cell populations

Results

Brain region transcriptional profile analysis identified genes with

increased expression in the SVZ-ObC neurogenic system

We analyzed the transcriptional profiles of the SVZ Ob core

(ObC) and three other brain regions indicated in Fig 1A The ObC

dissection excluded themitral and periglomerular layers providing a

RNA sample primarily representing migratory type A cells

maturing neuroblasts and mature granule cells The hippocampus

(Hp) dissection included the non-neurogenic CA1ndashCA3 regions as

well the dentate gyrus The striatum (St) was the region directly

underlying the SVZ dissection The cortex (Ctx) did not include the

corpus callosum Biotin-labeled complementary RNAs (cRNAs)

derived from each brain region were analyzed on GeneChip Mu11k

expression arrays which contain more than 13000 probe sets

analyzing the expression of over 11000 unique genes Each brain

region was analyzed independently twice the data among the

duplicates were consistent (Supplementary data S1)

To focus our analysis on those genes more likely to be involved

in SVZ neurogenesis we filtered the data (see Experimental

methods) for those genes that are (1) increased in the SVZmdashthe

SVZ profile (2) increased in the ObCmdashthe ObC profile and (3)

increased in both the SVZ and ObCmdashthe SO profile (Fig 1D) The

SVZ profile (Supplementary data S2) contained 65 unique genes

(71 probe sets) with increased expression in the SVZ as compared

to all other regions (ObC Hp Ctx St) The ObC profile

(Supplementary data S3) included 168 genes (209 probe sets)

and the SO profile (Supplementary data S4) contained 60 genes (80

probe sets) Genes in the SVZ SO ObC profiles are shown

Table 1

Correlation between published expression data and GeneChip brain region

profile analysis

Published expressionGene Profile

SVZ ObC Reference

Dlx1 SO + + Lois 1996

Dlx2 SO + + Doetsch et al 2002

Sox2 SO + + Ferri et al 2004

Pbx1 ObC + ++ Redmond et al 1996

Mash1 ndash + + Parras et al 2004

Er81Etv1 ndash + + Stenman et al 2003

Vim SVZ + Doetsch et al 1997

Mki67 SVZ + Zhu et al 2003

Rrm1 SVZ + Zhu et al 2003

Notch1 ndash + Stump et al 2002

Wnt5a ObC + Shimogori et al 2004

Thra SVZ + Lemkine et al 2005

Nog ObC + ++ Peretto et al 2004

Nestin ndash + Doetsch et al 1997

Cd24 SO + + Calaora et al 1996

Genes expressed in SVZ andor ObC but not on Mu11K chip Olig2 Emx2

Slit Ng2 Dcx Gli1

Fig 2 Northern hybridizations substantiate array data Northern blot

analysis was performed on the cRNA samples (left) Corresponding

GeneChip array data for the brain region analysis (duplicate data shown

indicated as 1 or 2 under the brackets) is shown as a color matrix (right

redmdashincreased expression greenmdashdecreased expression) Eight out of

8 genes tested by Northern blot had good agreement with the array data

Fold change scale (log2) for the color matrix is shown at the bottom right

DA Lim et al Mol Cell Neurosci 31 (2006) 131ndash148 133

clustered in a color matrix in Fig 3A Genes that had decreased

expression in the SVZ SO and ObC can be found in

Supplementary data S12

To assess the sensitivity of the SVZ ObC and SO profiles we

surveyed the literature to identify those genes that would be

expected to be detected in our analysis Of the genes represented

on the Mu11K GeneChip set we identified 15 that are highly

expressed in the SVZ andor ObC relative to the other brain regions

(Hp Ctx St) Of these 15 genes our analysis detected 11 (73)

with a profile matching the published in situ hybridization or

immunohistochemical data (Table 1) Six other genes previously

described to be expressed highly in the SVZ andor ObC were not

represented on the Mu11K GeneChip set

To validate the array data with another measure of transcript

levels we analyzed 8 genes by Northern blot Ccnd2 Hmgb2

Mia Pdyn Dlx1 2310021G01Rik Sox11 and Col6a1 For all of

the genes tested the Northern blot data paralleled the pattern of

expression observed on GeneChip analysis (Fig 2)

Gene Ontology analysis identifies RNA splicing and chromatin

regulation as prominent biological events in the SVZ and ObC

brain regions

To translate the gene expression data into functional profiles we

used Gene Ontology (GO) analysis GO provides an organized

vocabulary of terms that can be used to describe a gene productrsquos

attributes (wwwgeneontologyorg) GO terms are organized into

three categories (biological process cellular component and

molecular function) in structures called directed acyclic graphs

these structures differ from hierarchies in that a Fchild_ (more

specialized term) can have several Fparents_ (less specialized term)

To analyze the GO terms of the SVZ SO and ObC profiles we

used Onto-Express (Khatri et al 2002 2004) For each GO term

Onto-Express computes its significance (P value) allowing one to

distinguish prominent biological processes from non-significant

events A complete list of GO terms for the SVZ SO and ObC

profiles with associated P values is in Supplementary data S5 and

the parentndashchild relationship of the GO terms can be browsed with

Onto-Express (see Experimental methods) The functional profiles

of SVZ SO and ObC gene expression are shown in the pie charts of

Figs 3BndashD

The SVZ is the primary site where type B and C cells are

maintained and proliferate Compared to the other brain regions in

our analysis the SVZ is the most proliferative As expected the

biological processes of proliferation and cell cycle were prominent

in the SVZ profile (Fig 3B) From the SVZ type A cells tangentially

migrate into theObCwhere they then turn tomigrate radially into the

granule cell layer Within the granule cell layer the type A cells

undergo terminal differentiation and integrate into local circuits (Fig

1D) There is also a continual turnover of young neurons in the Ob

involving apoptosis (Najbauer and Leon 1995 Fiske and Brunjes

2001 Petreanu and Alvarez-Buylla 2002) The ObC profile

therefore should reflect these later stages of SVZ-Ob neurogenesis

as well as granule cell turnover Indeed significant biological

processes were development neurogenesis and cell differentiation

other highly significant GO terms included CNS and brain

development negative regulation of cell proliferation axono-

genesis and apoptosisprogrammed cell death (Fig 3D) Therefore

GO analysis described many of the major known and expected

biological processes that occur in the SVZ and ObC regions

The SO profile represents gene expression common to both the

SVZ and ObC As expected SO profile terms related to cell growth

transcription protein metabolism and development (Fig 3C) The

most prominent biological process in the SO profile however was

RNA splicing (Fig 3C) terms related to RNA splicing appeared 9

times in this analysis (in Supplementary data S5) all with very high

significance (P values are in the figure) GO terms related to

chromatin regulation terms appeared 7 times including terms from

all three GO categories (Fig 3C and in Supplementary data S5) The

SVZ profile also was significant for Festablishment andor mainte-

nance of chromatin architecture_ as well as components of chromatin

Fig 3 The brain region transcriptional profiles (A) Color matrix of the SVZ SO and ObC profiles Genes are ordered along the vertical axis using hierarchical

clustering Duplicate profiles of the brain regions are presented on the horizontal axis The color and color intensity of each cell in the matrix relate to the

expression ratio of each gene Red indicates a positive ratio (expression greater than the mean of the other brain regions) green indicates a negative ratio and

black indicates a ratio of 1 A color scale (log2) indicating the magnitude of the expression ratios is shown in the bottom (BndashD) GO analysis pie charts for the

brain region profiles The entire pie represents all GO terms in the analysis Pie slices are proportional to the number of genes (in parentheses) related to a

particular GO Fparent_ term (legend for color code is in the inset to the right of each panel) GO terms that are Fchildren_ of a parent term are listed next to the

pie chart with an indicating line Further parentndashchild relationship of the GO tree structure is indicated by indentation with hyphen All listed GO terms are

statistically significant and color of the type indicates the GO category (see legend at the lower right of the figure)



and nucleosomes (Fig 3B) Thus the data suggest that both RNA

splicing and chromatin regulation are important biological processes

for SVZ neurogenesis

To determine the relative prominence of RNA splicing and

chromatin remodeling for SVZ neurogenesis in comparison to non-

neurogenic brain regions we performed GO analysis on the sets of

genes that were increased in the Ctx (Ctx profile) St (St profile) and

Hp (Hp profile) (probe set lists in Supplementary data S11 GO term

lists in S5) No terms related to RNA splicing were statistically

significant in the Ctx St or Hp profiles In the Ctx profile the term

Fchromatin remodeling_ was associated with 2 genes and a P value

of 002 however the parent term of Festablishment andor

maintenance of chromatin architecture_ was not statistically

significant ( P = 037) No GO terms related to chromatin

remodeling were significant in the St or Hp profiles Thus RNA

splicing and chromatin remodeling were much more prominent in

the SVZ and SO profiles than in the Ctx St and Hp

In the Supplementary text we identify and discuss the genes

detected in our SVZ-Ob analysis related to cell cycle transcription

migration and apoptosis The majority of those genes has not been

previously described for adult SVZ-Ob neurogenesis and thus the

data present a wealth of gene candidates for future study In this

manuscript we focus on RNA splicing and chromatin remodeling

Table 2

Chromatin-remodeling and RNA splicing genes in the brain region profiles

Highlighted cells indicate the profile to which each probe setgene belongs (eg Ba

SO profile)

because they are important biological processes but not well

described for the adult SVZ and Ob

Using the GO analysis and a review of the literature we

identified genes related to RNA splicing and chromatin remodel-

ing in the SVZ SO and ObC expression profiles The SO profile

contained RNA splicing factors Sf3b1 Sfrs2 Lsm4 Snrpg

Snrpd2 Hnrpa2b1 Hnrpd Hnrpm Hnrpdl Hnrph1 and

Khdrbs1Sam68 and the ObC profile contained Snrpb (Table

2) Chromatin-remodeling genes Mll Hat1 Hmgb3 and Baf53a

were detected in the SO profile Hmgb2 and H2afx were in the

SVZ profile and the ObC profile contained Bmi1 and Smarcad1

(Table 2)

Gene expression comparison of the type B SVZ stem cell and the

non-neurogenic ependyma reveals chromatin regulation as a

prominent process in type B cells

Neurogenic SVZ cells are closely associated with the non-

proliferative ependymal cells that line the walls of the lateral

ventricle (see Fig 1C) The SVZ and SO profiles therefore

contained the gene expression of non-neurogenic ependyma We

used fluorescent-activated cell sorting (FACS) to separate the type

B cells and ependyma and compared their gene expression profiles

f53a has cells in both the SVZ and ObC columns highlighted indicating the


To isolate type B cells we used antibodies to GFAP (Doetsch et al

1999ab) Immunocytochemistry for this intracellular antigen

requires permeabilization of the cell membrane We developed

methods to isolate RNA from cells permeabilized by a non-ionic

detergent (Tween-20) and confirmed that the RNAs are stable

through the immunostaining protocol (Figs 4H I K) GFAP+ cells

were generally round or elliptical and not ciliated (Figs 4C D)

We used CD24 antibodies to purify ependymal cells (Capela and

Temple 2002) CD24 staining was also performed with Tween-20

so that any changes in the gene expression profile associated with

this agent would be comparable to those observed in the GFAP+

population To a lesser degree CD24 antibodies also stain SVZ Type

A cells (Calaora et al 1996) however our dissociation protocol and

Tween-20 treatment eliminated the CD24 epitope from the surface

of type A cells CD24 antibody staining strongly labeled multi-

ciliated ependymal cells (Figs 4A B) CD24+ non-ciliated cells

were not observed

SVZ cells immunostained for CD24 and GFAP were sorted by

FACS (Figs 4E F) Total RNA from type B and ependymal cell

populations was isolated and mRNAs were amplified as schema-

tized in Fig 4G and described in Experimental methods The

amplification procedure preserved the appropriate mRNA size

distribution as well as differential expression of GFAP and CD24

(Figs 4I J) The cRNAs produced for GeneChip analysis were

also of an appropriate size distribution and GAPDH Northern blot

analysis shows a single band of expected size indicating that the

amplification procedure did not produce degraded transcripts (Fig

4K) Scatter plots comparing expression profiles of duplicate

samples show good reproducibility (see Supplementary data S6)

Differential expression of 1324 probe sets (1282 unique genes)

was detected between GFAP+ and CD24+ cells 54 of the genes

had increased expression in GFAP+ cells and 46 were increased

in the CD24+ cells To confirm the FACS cell separation and

cDNA amplification we examined the data for expected differen-

tial gene expression Cd24 itself was strongly increased (146-fold)

in the CD24+ population paralleling the RT-PCR result of Fig 4J

In the SVZ Sox2 is expressed highest in the ependyma (Ferri et al

2004) and the FACS data reported Sox2 expression as 38-fold

higher in the ependymal cells relative to the type B cells Spa17 is

a component of cilia (Grizzi et al 2004) and it was expressed 11-

fold higher in the ciliated CD24+ ependymal cells The probe set

Fig 4 FACS analysis of SVZ cells (AndashD) Immunostaining of dissociated SVZ cel

positive ependymal cell Arrow indicates ependymal cilia Panels C andD show resp

F) FACS of immunostained SVZ cells (E) SVZ cells stained only with secondary

lower left quadrant (F) SVZ cells stained for CD24 and GFAP Rectangle R1 indic

collection gate for the GFAP CD24+ cells (G) Schematic of cDNA amplificatio

containing a T7 RNA polymerase promoter sequence A specific oligonucleotide

reaction and the lsquolsquostrand-switchingrsquorsquo activity of the reverse transcriptase copies the

and oligo-dTT7 promoter sequences two rounds of long-distance PCR (LD-PCR) ar

3V T7 promoter See Experimental methods for details (H) Cellular RNAs are sta

immunostained for GFAP and CD24 Omission of 01 Tween-20 results in no G

solutionswhere indicated (+) After staining cells were incubated at 4-C for an additi

No RNA degradation was detected in any staining protocol Note that if SVZ cells

degraded (right lane) (I) Analysis of ds cDNA libraries from FACS SVZ cells A por

in a second round of control LD-PCR reactions in which aliquots were taken after 6

panel) The size distribution of the amplified cDNAs was not biased toward smaller p

indicating that the initial mRNAwas not heavily degraded The linear range of am

inspection of the ethidium bromide stained cDNA population (J) Semi-quantitative

was more than 10-fold enriched in the cDNAs prepared from the GFAP+ CD24Conversely the CD24 message was more than 20-fold enriched in the cDNAs from

gel and Northern analysis of cRNAs from FACS-derived ds cDNAs Size distributio

of mRNA degradation

for Gfap did not show differential expression however the Gfap

mRNA was differentially represented in the representative cDNA

libraries as shown by RT-PCR (Fig 4J) A small fraction of the

probe sets on the Mu11K arrays assess transcript levels poorly (N

Patil personal communication) and it is possible that the probe set

for Gfap is problematic NOG (Noggin) protein has been

previously shown to be highly expressed in ependymal cells

(Lim et al 2000 Peretto et al 2004) and SVZ astrocytes (Peretto

et al 2004) however we did not find elevated expression of Nog

in either the SVZ profile or CD24+ cells There may be a mismatch

between transcription and translation for the Nog gene resulting in

a pattern of low mRNA transcript levels but high Noggin protein

concentrations in the SVZ and ependymal cells It is also possible

that differential expression for any gene is not detected due to a

loss of transcript during FACS or cDNA amplification

GO analysis showed that type B cells are significant for cell

proliferation and cell cycle while ependymal cells are significant for

cell cycle arrest (Table 3) These data are consistent with the finding

that ependymal cells do not divide in vivo (Doetsch et al 1999ab

Capela and Temple 2002 Spassky et al 2005) The process of

neurogenesis was also significant in type B cells and not in

ependyma supporting the data that ependyma are non-neurogenic

(Chiasson et al 1999 Capela and Temple 2002) Like the SVZ and

SO profiles establishment andor maintenance of chromatin

architecture was prominent in type B cells along with histone

acetyltransferase activity FmRNA metabolism_ FmRNA proc-

essing_ and Fnuclear mRNA splicing via spliceosome_ were not

significant GO terms in either cell population Ependymal cells have

a basalndashapical orientation and the GO term for Fapical plasma

membrane_ was significant in these cells along with peroxidase

activity A complete listing of GO terms for the FACS data is in


There were 82 probe sets (78 unique genes) at the intersection of

the FACS data and the brain region profile data Fold-change values

for genes at this intersection are indicated in the tables of

Supplementary data S2ndash4 Cell cycle related genes Ccnd2 Cdca7

Mki67 Rrm2 and Mcm7 were increased in type B cells no cell

cycle genes were statistically significantly elevated in the CD24+

population Of the 10 RNA splicing genes in the SO profiles only

Snrpg was differentially expressed (17-fold increased in CD24+

cells) Of the chromatin-remodeling genesMll H2afx and Hmgb3

ls (A) DIC image and (B) immunofluorescent image of a multiciliated CD24-

ective DIC and immunofluorescence images of a GFAP-positive SVZ cell (E

antibodies Cross-bars shown isolate gt99 of the non-specific signal in the

ates the collection gate for the GFAP+ CD24 population R2 indicates the

n procedure Briefly mRNA is reverse transcribed from an oligo-dT primer

(SMARTIII oligo) containing a stretch of dG nucleotides is included in the

SMARTIII sequence to the end of the cDNA With primers to the SMARTIII

e used to amplify the cDNA For hybridization cRNAs are produced from the

ble through the immunostaining protocol 1 106 SVZ cells were double

FAP staining 1 Tween-20 RNasin and DTT were added to the staining

onal 15 h Total cellular RNAwas then extracted and analyzed on agarose gel

are freeze thawed and incubated at 37-C all of the 28S and 18S RNAs are

tion of the ds cDNAs after the first round of LD-PCRwas used as the template

8 10 and 12 cycles The cDNA aliquots were analyzed on agarose gels (left

roducts by the LD-PCR Southern blot signal for GAPDHwas a single band

plification was determined by both the GAPDH signal intensity and visual

RT-PCR confirms the separation of SVZ cells by FACS The GFAP message

cell population (R1) as compared to the GFAP CD24+ population (R2)

the R2 population in comparison with that of the R1 population (K) Agarose

ns were as expected for brain tissue and GAPDHmessages did not show signs


were increased in type B cells by 37 94 and 16-fold respectively

(Table 2) Therefore some chromatin-remodeling genes may begin

expression in the stem cell population of the SVZ and continue into

the ObC Discussion of some of the other notable gene expression

differences between type B cells and ependyma is in the

Supplementary text

Analysis of SVZ gene expression changes during SVZ regeneration

also identifies RNA splicing and chromosome organization as

prominent biological processes

We next analyzed gene expression changes during in vivo

regeneration of the SVZ germinal zone Osmotic pump infusion of

the anti-mitotic cytosine arabinoside (AraC) onto the surface of the

brain eliminates type A and C cells leaving behind only type B cells

and ependyma After AraC pump removal the SVZ regenerates with

remarkable fidelity First type B cells begin dividing Between 2 to 4

days after pump removal type C cells emerge and after that type A

cells form Within 10 days the entire network of migrating

neuroblasts with clusters of B and C cells is reconstituted (Doetsch

et al 1999ab) See Fig 5A for illustration of SVZ regeneration

We profiled gene expression at 1 3 and 10 days (A1 A3 A10)

after AraC pump removal To control for the effects of surgery we

analyzed gene expression of saline infusion at 1 day (S1) and 10

days (S10) after pump removal We also in parallel analyzed SVZ

from unmanipulated animals

First we identified genes whose expression was significantly

regulated (P lt 005) in at least one comparison to untreated SVZ

(total of 1758 probe sets) SVZ dissections include a small amount of

underlying striatal tissue to focus our analysis on genes expressed

strongly in the SVZ we filtered the AraC data with the list of genes

(985 probe sets) that were determined to be increased in the SVZ as

compared to the underlying striatum (P lt 005) in the brain region

experiment The 229 probe sets at the intersection of these two lists

Table 3

GO term differences between type B cells (GFAP+) and ependyma

(CD24+)

Highlighting indicates statistical significance of the listed GO term (eg

Fcell cycle arrest_ is significant in the CD24+ cells and not the GFAP+ cells


were then analyzed with Principle Component Analysis (PCA) to

allow us to separate the gene expression changes of SVZ

regeneration from that of surgery and saline infusion (see

Experimental methods for details of the filters and PCA) The gene

expression pattern of the 59 probe sets (57 unique genes) most

related to SVZ regeneration is shown clustered in a colormatrix (Fig

5B) and a list of these genes is in Supplementary data S8

The 59 probe sets shown share a similar expression pattern

representing the initial destruction and later regeneration of the

SVZ At A1 gene expression is decreased relative to S1 (A1 lt S1)

Between A1 and A10 gene expression returns to near normal

levels (A10 S10) or even Fsupranormal_ levels (A10 gt S10)

these Fsupranormal_ levels may be due to the robust surge of

neurogenesis after AraC treatment producing chains of type A

cells more dense than in saline controls (Doetsch et al 1999ab

Doetsch and Alvarez-Buylla 1996)

We applied GO analysis to the genes regulated during SVZ

regeneration Similar to the SO profile terms related to mRNA

splicing were the most significant (Fig 5C) GO terms related to

regulation of cell cycle proliferation enzyme regulation and

chromosome organization and chromatinnucleosome structure

were also significant (Fig 5C and Supplementary data S9 contains

a list of all GO terms for SVZ regeneration) Of the 59 probe sets in

this analysis 16 (29) were also found in the SVZ or SO profiles

(Table 4) The probability of having such an intersection at random

is approximately 1050 with the expected number of genes in the

random intersection being 07 Of these 16 genes 4 had increased

expression in the FACS GFAP+ population (Table 4) the

probability of this intersection by chance is smaller than 1010

In situ hybridization (ISH) validates gene expression data

The SVZ SO and ObC expression profiles suggested genes

that may be important for SVZ-Ob neurogenesis Because these

profiles are derived from filters based on expression levels relative

to an artificial mean (see Experimental methods) they are not

intended to indicate the absolute presence or absence of gene

expression in the brain regions analyzed For instance a gene in the

ObC profile should be expressed at a level statistically higher than

the calculated average of all brain regions however an ObC

profile gene may not necessarily be expressed exclusively in the

ObC To better understand how the expression profile data predicts

in vivo expression patterns we performed ISH for some of the

genes

Dlx5 and Mrg1Meis2 were found in the ObC profile and ISH

demonstrated that both Dlx5 andMrg1Meis2 are expressed in both

the ObC and the SVZ (Figs 6A B E F) To provide a comparison

to an SO profile gene we performed ISH for Dlx2 in parallel (Figs

6C D) As assessed by ISH ObC profile genes Dlx5 and Mrg1

Meis2 both were more intensely expressed in the ObC as compared

to the SVZ in comparison the SO profile gene Dlx2 was

expressed higher in the SVZ than in the ObC Therefore ObC

profile genes may be expressed in SVZ but the ObCSVZ

expression ratio is higher than that of SO profile genes The

GeneChip data also predict that MrgMeis2 expression levels in the

SVZ and St should be similar and the ISH data are consistent with

this prediction Thus the GeneChip data provide a reasonable

estimation of relative gene expression levels as assessed by ISH

We next used ISH to examine the gene expression of the RNA

splicing genes Sfrs2 Sf3b1 Lsm4 and Khdrbs1Sam68 and

chromatin remodeling genes Mll and Smarcad1 (Fig 6) Sfrs2 is

clearly expressed in the SVZ and ObC A low level of Lsm4

expression was detected in the ObC however ISH was not evident

outside of that region it is likely that the ISH detection threshold

for this gene was low and we confirmed Lsm4 expression in both

the SVZ and ObC with RT-PCR (data not shown) Sf3b1 and

Khdrbs1Sam68 were both clearly expressed in the SVZ and ObC

at levels higher than the other brain regions The chromatin-

remodeling gene Mll was expressed at moderate levels in all brain

regions however it was detected in the SVZ and at relatively

higher levels in the ObC Similarly SWISNF family member

Smarcad1 was expressed moderately in all brain regions however

its expression was very prominent in the SVZ and ObC

Discussion

We used Affymetrix GeneChips in three different approaches to

identify gene sets associated with in vivo SVZ neurogenesis We

first obtained the gene expression profiles of five adult mouse brain

regions and filtered for genes that had increased expression in the

germinal SVZ andor Ob target of neuronal differentiation GO

analysis identified RNA splicing and chromatin remodeling as

prominent biological processes in the neurogenic SVZ and Ob

brain regions Using FACS and cDNA amplification we then

compared the expression profiles of two SVZ cell populations

important for neurogenesis the SVZ astrocytes which function as

the stem cells (Doetsch et al 1999ab) and the ependymal cells

which contribute to the creation of a neurogenic niche (reviewed in

Goldman 2003 Alvarez-Buylla and Lim 2004) SVZ astrocytes

were significant for the processes of cell proliferation neuro-

genesis and chromatin remodeling For a more dynamic portrait of

SVZ neurogenesis we analyzed the transcriptional profiles during

SVZ regeneration which proceeds sequentially from B to C to A

cells (Doetsch et al 1999ab) GO analysis of the SVZ

Fig 5 Transcriptional profile of SVZ regeneration after AraC treatment (A) Schematic of AraC infusion and associated changes in SVZ cellular composition

after AraC pump removal At 1 day only ependyma (gray) and type B cells (blue) remain At 3 days type C (green) cells return At 10 days all SVZ cell types

including type A cells (red) have been regenerated (B) Transcriptional profile of SVZ regeneration The columns labeled A1 A3 and A10 represent the

timepoints after AraC infusion Columns S1 and S10 are the timepoints after control saline infusion The SVZ column is the gene expression of unmanipulated

controls Genes are ordered along the vertical axis using hierarchical clustering The color and color intensity of each cell in the matrix relate to the expression

ratio of each gene Red indicates a positive ratio (expression greater than the mean of the other brain regions) green indicates a negative ratio and black

indicates a ratio of 1 A color scale (log2) indicating the magnitude of the expression ratios is at the bottom of the panel (C) GO analysis pie chart for SVZ

regeneration The entire pie represents all GO terms in the analysis Pie slices are proportional to the number of genes (in parentheses) related to a particular GO

Fparent_ term (legend for color code is in the inset to the right of each panel) GO terms that are Fchildren_ of a parent term are listed next to the pie chart with an

indicating line Further parentndashchild relationship of the GO tree structure is indicated by indentation with hyphen All listed GO terms are statistically

significant and color of the type indicates the GO category (see legend at the lower right of the figure)


regeneration data also found RNA splicing and chromosome

organization as prominent biological processes

These three approaches have distinct advantages and dis-

advantages The brain region comparison yields the cleanest

expression data but it represents the average expression profile of

entire regions and may reveal components beyond those related

to neurogenesis The cell-type comparison is a more direct

analysis of the neurogenic transcriptional profile but the extra

amplification required for chip hybridization results in noisier

data The regeneration analysis is a fairly direct test for genes that

are dynamically regulated during neurogenesis yet the invasive-

ness of the procedure complicates analysis Because the

expression data derived from these three approaches differ in

quality and nature we analyzed the GeneChip array data of the

three experiments separately For the brain region and cell-

specific transcriptional profile analyses we used the t test to

determine differential gene expression for the SVZ regeneration

experiment we used PCA to separate the gene expression due to

SVZ regeneration from that of surgery and saline infusion (see

Experimental methods Data analysis for details of these

methods) Each experimental approach provided us with a

different view of the transcriptional profile for SVZ neurogenesis

and the transcriptional profiles from all three approaches were

unified by GO analysis which gave us an overview of the

biological processes involved

Supporting our experimental approaches we found that some of

our expression data matched previously known regional and cell-

specific expression patterns and Northern blot analysis and ISH

validated other data A large number of genes identified in this study

have not been previously described to be present in the SVZ or Ob

and are available in the Supplementary data In the Results section

we presented data mostly for the RNA splicing and chromatin

remodeling genes however taken together the data appeared to fit

into a biological lsquolsquostoryrsquorsquo of SVZ neurogenesis progressing through

cell cycle transcriptional regulation RNA processing migration

and apoptosis (see Fig 7 and Supplementary text)

Recent progress in the description of stem cell gene expression

has been made by comparing gene profiles of embryonic

hematopoietic and neural stem cells grown as neurospheres

(Ivanova et al 2002 Ramalho-Santos et al 2002) These analyses

identified sets of genes that may be important for basic stem cell

properties such as self-renewal however the process of neuro-

genesis was not specifically addressed Prior gene expression studies

of neurogenesis have been performed with neurospheres in vitro

Table 4

Intersection with SVZ regeneration data

Highlighted cells indicate the profile to which each probe setgene belongs (eg Ccnd2 has its cell in SVZ column highlighted indicating the SVZ profile)


Neurospheres are spherical clusters of cells propagated in vitro from

single cells by addition of EGF andor FGF Neurospheres can

generate neurons astrocytes and oligodendrocytes (Reynolds and

Weiss 1992 Morshead et al 1994 Gritti et al 1996 Kukekov et

al 1999 Caldwell et al 2001) For the transcriptional profile

studies neurospheres were obtained from embryonic and early

postnatal cortex (not SVZ) (Geschwind et al 2001 Easterday et al

2003 Karsten et al 2003) embryonic striatum (contains SVZ)

(Zhou et al 2001 Wen et al 2002) or postnatal SVZ (Gurok et al

2004) the adult SVZ differs in gene expression and cellular

composition from that of embryonic and postnatal SVZ as well as

developing cortex (Tramontin et al 2003) Also the high levels of

exogenous growth factors (EGF or FGF) used to propagate

neurospheres deregulates normal gene expression (Gabay et al

2003 Hack et al 2004) likely leading to significant alterations in

their transcriptional profiles Notwithstanding these differences

there were genes and biological processes overlapping between our

in vivo analysis and the in vitro neurosphere studies certain cell

cycle genes (Ccnd2Mcm3Mcm7 S100a6MdkPcnaGadd45b)

cytoskeletalmigration genes (Tubb3 Tagln Racgap1) Hmgb2

Fyn and Rbp1 were common to our analysis and one or more of the

neurosphere gene expression studies (Geschwind et al 2001

Easterday et al 2003 Karsten et al 2003 Gurok et al 2004) In

addition to identifying these genes our study provided spatial (brain

region and SVZ cell type) andor temporal (during regeneration)

expression information The raw data sets and complete gene lists

are available in the Supplementary data allowing further analysis of

the similarities and differences between mouse in vitro neurospheres

and in vivo SVZ neurogenesis Such analyses along with compar-

isons to human neurosphere transcriptional profiles (Wright et al

2003) may allow us to narrow down the list of genes that may be

important for neural stem cell function

The GFAP+ and CD24+ transcriptional profiles allowed us to

assign a subset of genes to either the neurogenic type B cells or the

non-neurogenic ependyma It is possible that the GFAP+ cells in the

SVZ are intrinsically different from GFAP+ astrocytes in non-

germinal regions It will be interesting to compare the SVZ GFAP+

transcriptional profile to those of astrocytes without stem cell

properties the differences revealed by such an analysis may reveal

the molecular basis of the stem cell properties unique to SVZ

astrocytes There is very little information about the gene expression

of ependymal cells These important epithelial cells are born in the

embryo (Spassky et al 2005) and play essential roles in brain

cerebrospinal fluid circulation and homeostasis Ependymal cell also

contribute to the neurogenic niche (Lim et al 2000 Goldman 2003

Peretto et al 2004) Our transcriptional profile of the CD24+ cells

provides a gene expression database for ependymal cells and should

serve as an important resource for further molecular analysis of these

cells (see Supplementary text) The gene expression profile of

isolated type A cells has also been studied (Pennartz et al 2004)

therefore to date transcriptional profiles of type B ependymal and

type A cells are available and together they should assist

investigators in the formation of hypotheses about gene function

in the SVZ

RNA splicing in SVZ neurogenesis

It has been proposed that RNA splicing is vital for

generating the complexity of the nervous system (Grabowski

and Black 2001 Black and Grabowski 2003) Alternative

splicing of the same gene can induce dramatic changes in neural

developmental for instance distinct splice isoforms of Numb

direct either proliferation or differentiation (Verdi et al 1999)

RNA splicing can regulate cell fate transcription factor activity

axon guidance neurotransmitter receptor and ion channel

function and apoptosis because all of these processes occur

in the SVZ throughout adult life the SVZ may be an ideal

system in which to study RNA splicing function in neural

Fig 6 In situ hybridization (ISH) validates transcriptional profile expression data ISH was performed for Dlx2 (A B) Dlx5 (C D)Meis2 (E F) Sfrs2 (G H)

Sf3b1 (I J) Lsm4 (K L) Khrdbs1Sam68 (M N) Mll (O P) and Smarcad1 (R S) on coronal adult brain sections The dotted line in panel A shows the

boundary between the corpus callosum (CC) and the Ctx and the SVZ is indicated by arrows The ventricle is to the left Scale bars = 100 Am (A C E G I K

M O R) 500 Am (B D F H J L N P S)


development In this study we identified 11 genes for RNA

splicing that may be important for adult SVZ neurogenesis The

SO profile contained Sf3b1 (splicing factor 3b subunit 1) Sfrs2

(splicing factor arginineserine-rich 2 SC35) Lsm4 (LSM4

homologue U6 small nuclear RNA associated) Snrpg (small

nuclear ribonucleoprotein polypeptide G) Khdrbs1Sam68 (KH

domain containing RNA binding signal transduction associated

1) and four members of the heterogeneous nuclear ribonucleo-

protein familymdashHnrpa2b1 Hnrpm Hnrph1 and Hnrpd The

analysis of SVZ regeneration also recognized Sf3b1 Hnrpd and

Lsm4 additionally three other genes for RNA splicing were

identified in the regeneration experiment Brunol4 Prpf8 and

Hnrpab (Supplementary data S8)

Sf3b1 Sfrs2 Prpf8 Lsm4 Snrpg Hnrpa2b1 Hnrpm Hnrph1

Hnrpd andHnrpab are all components of the spliceosome complex

(reviewed in Jurica andMoore 2003) The activity and specificity of

the spliceosome are regulated for instance changes in levels of

Hnrpab mediate mRNA splice site selection in developing

erythroblasts (Hou et al 2002) The heterogeneous nuclear

ribonucleoprotein (Hnrp) family members (eg Hnrpab) them-

selves are regulated by methylation at arginine (reviewed in

McBride and Silver 2001) and the arginine methyltransferase


Hmrt1l2 (Scott et al 1998) was in the SO profile suggesting its

interaction with the Hnrps Brunol4 belongs to the brunoelav

family of RNA binding proteins that regulate mRNA processing

(Good et al 2000) the human homologue of Brunol4 promotes

specific exon exclusion in developing muscle (Ladd et al 2001)

Perhaps most intriguingly Khdrbs1Sam68 is a prototype splice

site regulator whose activity is modified by extracellular signal-

regulated kinase (ERK) transduction (Matter et al 2002) as such

Khdrbs1Sam68 may link the SVZ precursor RNA splicing

machinery to changes in the extracellular environment Khdrbs1

Sam68 like the Hnrp family members is also regulated by arginine

methylation (Bedford et al 2000) Fyn is a kinase found in the ObC

profile and FYN phosphorylation of KHDRBS1SAM68 changes

its subcellular localization interaction with the spliceosome

components and splice site selection (Hartmann et al 1999) the

increased expression of Fyn in the ObC could induce Khdrbs1

Sam68 to change mRNA splicing regulation in type A cells leading

to their cell cycle exit change to radial migration and integration

into local circuits

Neuroblasts born in the SVZ have different destinations in the

Ob Some end up in the granule cell layer while others migrate

farther into the periglomerular layer Granule cell and periglomer-

ular interneurons have different synaptic organization as well as

neurotransmitter phenotypes If these two types of Ob interneurons

are derived from the same SVZ neural stem cell (this is currently

unclear) it is possible that alternative splicing may be critical for

determining the migratory path of the neuroblasts as well as the cell

fate choice Recently a genome-wide analysis of alternative

splicing determined by the Nova splicing factor has indicated that

RNA splicing may play important roles in synapse formation

axonogenesis neurite morphogenesis and neurogenesis (Ule et al

2005) Ephephrin signaling plays a role in SVZ migration and

proliferation (Conover et al 2000) and alternative splice forms of

certain Eph receptors can regulate cellular repulsion or adhesion

(Holmberg et al 2000) Hence alternative splicing of the same

sets of transcripts could account for the generation of different

destinations and phenotypes of SVZ-born neuroblasts

Chromatin remodeling in SVZ neurogenesis

Chromatin remodeling can engage or maintain particular

genetic lsquolsquoprogramsrsquorsquo and therefore likely plays a critical role in

both stem cell maintenance as well as daughter cell differenti-

ation (reviewed in Rasmussen 2003 Cerny and Quesenberry

2004 Ehrenhofer-Murray 2004) There also is increasing

evidence that chromatin remodeling is important for neural

development (reviewed in Hsieh and Gage 2004) Bmi1 a

member of the Polycomb group of chromatin modifiers is

important for self-renewal of embryonic and postnatal SVZ stem

cell regulation (Molofsky et al 2003) in the adult SVZ we

identified Bmi1 in the ObC profile Polycomb group members

such as Bmi1 work in concert with trithorax group proteins to

regulate chromatin structure (Orlando 2003) appropriately Mll

a member of the trithorax family was expressed in the SO

Fig 7 Schematic of genes biological processes and gene interactions for SVZ ne

SVZ regeneration analysis are integrated This figure highlights 89 genes selec

Supplementary text Genes in the SVZ SO and ObC profiles are arranged over

CD24+ cells are boldfaced in blue and black respectively Genes regulated during

indicated by dotted lines and red arrows respectively See the legend at the lowe

profile BMI1 physically interacts with and is antagonized by

MLL (Hanson et al 1999 Xia et al 2003)

Mll establishes and maintains specific gene expression patterns

through serial mitotic cell cycles (Yu et al 1998 Milne et al

2002) The increased expression ofMll in the B cell population and

presence in the SO profile (Table 2) suggests that Mll expression

begins in B cells and continues through the lineage to type A cells

Mll therefore potentially regulates global developmental transcrip-

tional patterns throughout the entire SVZ neurogenic lineage Mll

regulates Dlx1 Dlx2 and Dlx5 (Ferrari et al 2003) transcription

factors in the SO profile and MLL fusion proteins regulate Pbx3

and Meis1 (ObC profile) (Zeisig et al 2004) Additionally using

transcriptional profile analysis Schraets et al identified potential

gene targets of Mll regulation (Schraets et al 2003) and among

the top candidates are Col6a (SO profile) Fhl1 (Four-and-a-half

LIM domains 1 ObC profile) Nestin (neural precursor cell marker

expressed in SVZ (Gates et al 1995 Doetsch et al 1997)) and

Tenascin-C (SVZ stem cell niche ECM component (Garcion et al

2004)) Hence we have not only identified Mll in the SVZ but also

9 genes that Mll may regulate

H2afx (SVZ profile regulated during regeneration) is a histone

H2A variant that is critical for chromatin remodeling and

inactivation of sex chromosomes in meiosis (Fernandez-Capetillo

et al 2003) Methylation of histone arginine residues modifies

chromatin function (reviewed in Trievel 2004) and the arginine

methyltransferase Hmrt1l2 (Scott et al 1998) was found in the SO

profile One of the best characterized histone modifications is

lysine acetylation (reviewed in Sterner and Berger 2000) and

Hat1 (histone acetyltransferase 1) was in the SVZ profile In

addition to modifying histones Hat1 can acetylate high mobility

group proteins (HMGs) which were also present in our analysis

Hmgb2 (SVZ profile) and Hmgb3 (SO profile increased in type B

cells) are members of the high-mobility group B (HMGB) family

which can activate or repress transcription by modifying DNAndash

histone complexes (Ge and Roeder 1994 Shykind et al 1995

Thomas 2001) Hmgb2 was also identified in neurospheres

(Karsten et al 2003 Gurok et al 2004) In primitive blood cell

precursors enforced expression of Hmgb3 inhibits B cell and

myeloid lineages (Nemeth et al 2003) and Hmgb3-deficient mice

have dysregulated lymphoid and myeloid cell development

(Nemeth et al 2004)

SWISNF chromatin modifiers also regulate transcription

Smarcad1 (ObC profile) is a SWISNF component and

Smarcad1-deficient mice have impaired fertility skeletal dyspla-

sias and growth retardation (Schoor et al 1999) Arp (actin-

related protein) family members regulate SWISNF complexes

(reviewed in Olave et al 2002) and Baf53a (ArpNa) was

identified in the SO profile Intriguingly Baf53a is brain specific

and expressed in developing neurons in vitro (Kuroda et al

2002) Among the 216 lsquolsquostemnessrsquorsquo genes common to brain

blood and embryonic stem cells are two members of the SWI

SNF family of chromatin modifiers (Ramalho-Santos et al

2002) further suggesting the importance of chromatin modifica-

tion for stem cell regulation

urogenesis Data from the SVZ SO ObC profiles the FACS data and the

ted from the data these genes are discussed in the Results section and

a yellow background in vertical columns Genes increased in GFAP+ and

SVZ regeneration are circled Known physical and genetic interactions are

r right



Concluding remarks

Any attempt to understand adult neurogenesis at the molecular

level needs to take into consideration large sets of genes acting in

parallel This study provides data on genes that contribute to adult

neurogenesis The data hint to the groups of genes involved in

proliferation migration and differentiation and reveal chromatin

remodeling and RNA splicing as important components of these

processes This in vivo molecular description of SVZ neurogenesis

provides the launching point of future studies into the regulation of

this adult germinal zone The challenge now is to understand the

contribution of individual genes in the context of the complexity

revealed by this study

Experimental methods

Production of ds T7 cDNA from adult brain regions

Adult (2ndash3 months) CD-1 (Charles River Laboratories) mouse

brains were used for RNA isolation SVZ was dissected as

previously described (Lim and Alvarez-Buylla 1999) and Ctx

and St were obtained from the same coronal slice ObC was

dissected from serial coronal slices of the Ob Hp was isolated by

cutting the fimbria and blunt dissection 10 mice were used for

each of the 2 experimental replicates Dissected tissues were snap

frozen in 15-ml tubes with liquid N2 Tissues were disrupted in

RNeasy (Qiagen) lysis buffer with needle trituration and Qiash-

redder columns (Qiagen) DNase treated total RNA was isolated

with RNeasy mini-columns (Qiagen) PolyA RNA was then

purified with magnetic oligo-dT beads (Dynal) For each brain

region 1 Ag of polyA RNAwas converted to ds T7cDNAwith the

T7LD3V primer using standard Superscript II reverse transcriptase

and DNA polymerase protocols (Invitrogen)

FACS isolation of type B and ependymal cells and ds cDNA

production

Adult SVZ cells were dissociated cleared of dead cells and

debris by 22 Percoll (Sigma) step gradient as previously

described (Lim et al 2000) and passed through a 40-Am nylon

cell strainer (BD Biosciences) All immunostaining incubations

and washes were performed at 0ndash4-C with pre-chilled buffers

Biotinylated mCD24 antibody (BD Biosciences Pharmingen)

was used at 110 and rabbit GFAP antibody (DakoCytomation)

was used at 1100 About 1 106 SVZ cells were resuspended

in 100 Al PBS containing both primary antibodies 01 Tween-

20 (Sigma) and 100ndash200 units of RNasin (Promega) and

incubated for 15 min on ice Cells were pelleted by gentle

centrifugation and washed in PBS three times Cells were then

resuspended in 100 Al of PBS containing streptavidin-Cy2 at

1100 and anti-rabbit F(ab)2 at 125 (Jackson Immunoresearch)

01 Tween-20 and 100ndash200 units of RNasin and incubated

for 10 min on ice Cells were again washed 3 times with PBS

Omission of primary antibodies resulted in no staining

Immunostained cells were isolated with the FACS Vantage

(BD Biosciences) For each of the 2 experimental replicates

10000 cells (from the SVZ of 25 mice) were collected directly

into RNeasy lysis buffer and DNAse-treated RNA was isolated

with RNeasy columns RNA was then converted to cDNA with

the T7LD3V primer using standard Superscript II reverse

transcriptase protocols Using the cDNA as template 20 cycles

of LD-PCR (BD Biosciences Clontech) were performed ds

T7cDNA from the LD-PCR reactions were phenolCHCl3extracted and spun through a Chromospin400 column (BD

Biosciences Clontech) An aliquot of the ds T7cDNA was used

as template for a second LD-PCR and aliquots were removed at

6 8 10 and 12 cycles these were analyzed on agarose gels by

ethidium bromide staining and GAPDH Southern blot to

determine the linear range of amplification

Analysis of regenerating SVZ

2 AraC in vehicle (saline 09) or vehicle alone were infused

onto the surface of 2- to 3-month-old CD-1 mice for 6 days by

mini-osmotic pump (Alzet Palo Alto CA Model 1007D) as

described (Doetsch et al 1999ab) At the end of infusion osmotic

pumps were surgically removed from their suprascapular place-

ment cannulas were left in place until after animals were

sacrificed Only the SVZ from the side of cannula placement

(right side) was dissected A total of 18 mice were used for this

experiment 4 for the no-surgery control 4 for A1 3 for A3 3 for

A10 2 for S1 and 2 for S10 Total RNA from dissected SVZ tissue

was isolated as described above 3ndash12 Ag of total RNA from

pooled SVZ tissue for each time pointcondition was converted to

ds T7 cDNA using the above protocols and equal amounts of

biotin-labeled cRNA were used for GeneChip hybridizations

GeneChip probe production and hybridizations

Biotin-labeled cRNAs were produced from the ds T7cDNA

libraries and hybridized to Mu11K chips according to standard

protocols (Affymetrix Santa Clara CA) Chips were scanned on

a GeneArray scanner (Affymetrix) For each brain region cRNAs

were prepared from independent ds cDNA libraries from different

dissection sessions Likewise for each FACS population cRNAs

were generated from independent ds cDNA libraries prepared

from different dissection sessions and FACS runs

Northern and Southern blots and PCR analysis

Northern and Southern blots were performed according to

standard protocols using ExpressHyb (BD Biosciences Clontech)

or ULTRAhyb (Ambion) Probes for hybridizations were produced

by PCR cloning All probes were sequenced to verify their identity

Semi-quantitative PCR analysis for CD24 and GFAP was

performed as previously described (Lim et al 2000)

In situ hybridization

For in situ hybridization (ISH) on cryosections we used a

modification of methods previously described (Wilkinson 1999)

After perfusionndashfixation of 2- to 3-month old mice brain tissues

were fixed with 4 PFA cryoprotected by 10 and 20 sucrose

PBS embedded in OCT compound (Sakura Finetechnical Co

Ltd Tokyo Japan) frozen and sectioned at 18 Am thickness

After ISH staining the sections were counterstained by nuclear

fast red The following mouse cDNA was used for making

digoxigenin labeled probes Meis2 (GenBank accession num-

berBF472214) Dlx2 (GenBankNM_010054nt746-1355) Dlx5

(GenBankAW046057) Mll1 (GenBankBC044818) Smarcad1

(GenBank BC042442) Sf3b1 (GenBankBC037098) Sfrs2 (Gen-


BankBC005493) Sam68 (GenBankBC002051) and Lsm4 (Gen-

BankBC026747) Dlx2 cDNAwas cloned by RT-PCR and others

were obtained as EST clones

Data analysis

Data analysis was performed with the R packages available at

the Bioconductor project site (wwwbioconductororg) We used

the GCRMA algorithm to obtain expression measures from the

fluorescent intensities of the individual probes This algorithm

employs a statistical model that uses probe sequence information

for background adjustment (Naef and Magnasco 2003 Wu and

Irizarry in press) which proved to be more sensitive than other

preprocessing methods (see httpaffycompbiostatjhsphedu) in-

cluding the GeneChip software (MAS 5) The normalization step

utilizes a quantile normalization algorithm (Bolstad et al 2003

Bolstad 2004) and probe sets were summarized using medianpol-

ish (Bolstad et al 2003 Irizarry et al 2003)

To identify genes of the SVZ SO and ObC profile we

first filtered the data to exclude genes with low variability

across all brain region samples (standard deviation smaller than

015) Then the t test was used to determine the set of genes

differentially expressed in the region under question as

compared to the other brain regions P values were adjusted

for multiple hypothesis test as suggested in Benjamini and

Hochberg (2001) and Dudoit and Shaffer (2003) using the

Benjamin and Hochbert procedure the permutations procedure

was not used We then filtered for genes with statistical

significance (P lt 005) and with difference greater than 05

(ie more than 142-fold change) to obtain 71 80 and 209

filtered probe sets in the SVZ SO and ObC profiles

respectively (65 60 168 UniGene identifiers) Similar proce-

dures were carried out in other comparisons t tests were

applied to FACS data (to determine those genes that are

differentially expressed between CD24+ and GFAP+ cells P lt

005) and to determine those genes expressed higher in the

SVZ as compared to the St (to provide the list of genes that

was used to as a filter for the AraC data see below)

The gene expression analysis of SVZ regeneration is confound-

ed by the changes induced by the surgery Some of these effects

may be adequately controlled by comparison with the saline

control groups however the response to surgical lesions is variable

from animal to animal and may differ between saline and AraC

treated animals For this reason we pooled the RNA from the SVZ

for each of the different time points (see Analysis of Regenerating

SVZ above) Since this pooled RNAwas analyzed on a single chip

set we used Principal Component Analysis (PCA) after filtering

the data To filter the data we considered the differences between

untreated SVZ and all other samples (three AraC and two saline

time points) within this experiment we selected genes that show

differences in at least one comparison the threshold of the t test

was based on the distribution of the differences for all genes rather

than on a gene-by-gene basis This set of 1764 probe sets was

filtered with the list of genes that are increased in the SVZ as

compared with St (P lt 005 in the brain region analysis) to

eliminate from analysis those genes that normally are expressed at

high levels in the striatum In order to separate the gene expression

changes of SVZ regeneration from that of surgery and infusion of

saline vehicle the 229 probe sets at the intersection of these two

lists were analyzed by applying PCA to the expression matrix of

the 229 probe sets and the 6 chips

PCA a widely used data mining technique (see eg Jolliffe

2003) creates new independent variables (the principal compo-

nents) as those linear combinations of the original variables that

capture as much of the variability of the original system as possible

In other words PCA models a cloud of points in high dimensional

space by finding the direction along which the cloud has the largest

spread (the first component) the perpendicular direction with the

second largest spread (the second component) and so on We found

that the first three principal components were enough to explain

almost 90 of the variability among chips thereby reducing our 6-

dimension space to a 3-dimension space In this new space the first

component was basically the overall expression of the genes The

second component described the lsquolsquorecoveryrsquorsquo from surgery and saline

infusion while the third component captured the gene expression

due to the regeneration of the SVZ cellular population (see

Supplementary data S10) We emphasize that these 3 new variables

are independent in the population considered and so the recovery

from saline infusion and the SVZ regeneration are now independent

variables The 229 probe sets were then listed by magnitude of the

third component so that those genes at the top represent those most

related to SVZ regeneration and not the effect of saline or surgery

The expression array data for the top 25 of this list (59 probe sets

56 unique genes Supplementary data S8) was then clustered and is

shown in Fig 4

Clustering analysis was done using Gene Cluster 30 software

and Tree View 16 (Eisen et al 1998) available at httpranalblgov

EisenSoftwarehtm We used hierarchical clustering with Complete

Average Linkage method and Euclidean distance as similarity

matrix for the SVZ SO and ObC profile data and with the Pearson

Correlation coefficient for the AraC data

Analysis of GO annotations was done using the Onto-Express

(Khatri et al 2002 Draghici et al 2003 Khatri et al 2004) a

web-based tool available at httpvortexcswayneeduProj-

ectshtml To find those GO terms that were over-represented in

the transcriptional profile in question (eg the SVZ SO or ObC

profiles) we compared the list of genes in the profile with the

entire set of genes in Mu11K A and B chips Significance was

assessed by using the hypergeometric distribution and P values

were corrected for multiple hypothesis controlling fdr (false

discovery rate) Only nodes (in the ontology tree) with fdr lt01

and gt1 gene were considered Supplementary data S11 contains

the probe set identifiers for the SVZ SO ObC Ctx St Hp

GFAP+ CD24+ and SVZ regeneration profiles as well as the

background Mu11kA and B chips these probe set lists can be

used with the Onto-Express tool allowing one to browse through

the GO terms organized in the tree structure

Primer sequences

T7LD3 V ATTCTAGAGGCCGAGGCGGCCGACATG-

TAATACGACTCACTATAGGGCGTTTTTTTTTTTTTTTTT-

TTTTTTTTTTTTTVN (V = AGC N = AGCT)

SMART III AAGCAGTGGTATCAACGCAGAGTGGCCAT-

TATGGCCGGG

5VPCR AAGCAGTGGTATCAACGCAGAGTGGCCAT-

TATGG

3VPCR ATTCTAGAGGCCGAGGCGGCCGACATGTAA-

TACGACTCACTATAGGGCG

Gapdh CCCACTAACATCAAATGGGG CTCACTTGT-

GGCCCAGGTAT


Dlx1 TCCTGAATGGTCTTCTTCCG CTGGGGTGGTAC-

GAAGATGG

2310021601Rik AGATGATAGCTGAGCAGCGG CTGG-

CAGAGAGGTTCAAAGC

Sox11 CAGGCACTTCTTCCCTTTTG CAGCTCT-

GAGGTCTATGTCACC

Col6a1 CCCCATTGGACCTAAAGGAT CAGCACGAA-

GAGGATGTCAA

Ccnd2 CCTCACGACTTCATTGAGCA ATGCTGCTCTT-

GACGGAACT

Hmgb2 AGCTTGGGGAAGGAAGTCTC AGCAAAACAG-

GAAGAAGGCA

Mia AGCCCAGAGACCTCGTTCTT ATCAATTTTGC-

CAGGTTTCG

Pdyn GATCAGGTAGGGCATGAGGA TTCTCT-

GGATTCTGGGATGG

Gfap CTCAATGCTGGCTTCAAGGAGA GACG-

CAGCGTCTGTGAGGTC

Cd24 ATGCAAAGGAGCCAAAACTG GTGACCATGC-

GAACAAAAGA

Acknowledgments

We thank Miguel Ramalho-Santos for the many helpful dis-

cussions and editorial comments HT was supported by the

Mochida Memorial Foundation for Medical and Pharmaceutical

Research This work was supported by NIH grant NS28478-12 to

AAB

Appendix A Supplementary data

Supplementary data associated with this article can be found in

the online version at doi101016jmcn200510005

References

Alvarez-Buylla A Lim DA 2004 For the long run maintaining

germinal niches in the adult brain Neuron 41 683ndash686

Bedford MT Frankel A Yaffe MB Clarke S Leder P Richard

S 2000 Arginine methylation inhibits the binding of proline-rich

ligands to Src homology 3 but not WW domains J Biol Chem

275 16030ndash16036

Benjamini Y Hochberg YC 2001 Controlling the false discovery rate a

practical and powerful approach to multiple testing J R Stat Soc 57

289ndash300

Black DL Grabowski PJ 2003 Alternative pre-mRNA splicing and

neuronal function Prog Mol Subcell Biol 31 187ndash216

Bolstad BM 2004 Low level analysis of high-density oligonucleotide

array data background normalization and summarization Biostatistics

University of California Berkeley pp 156

Bolstad BM Irizarry RA Astrand M Speed TP 2003 A comparison

of normalization methods for high density oligonucleotide array data

based on variance and bias Bioinformatics 19 185ndash193

Calaora V Chazal G Nielsen PJ Rougon G Moreau H 1996

mCD24 expression in the developing mouse brain and in zones of

secondary neurogenesis in the adult Neuroscience 73 581ndash594

Caldwell MA He X Wilkie N Pollack S Marshall G Wafford KA

Svendsen CN 2001 Growth factors regulate the survival and fate of

cells derived from human neurospheres Nat Biotechnol 19 475ndash479

Capela A Temple S 2002 LeXssea-1 is expressed by adult mouse CNS

stem cells identifying them as nonependymal Neuron 35 865ndash875

Cerny J Quesenberry PJ 2004 Chromatin remodeling and stem cell

theory of relativity J Cell Physiol 201 1ndash16

Chiasson BJ Tropepe V Morshead CM Van der Kooy D 1999

Adult mammalian forebrain ependymal and subependymal cells

demonstrate proliferative potential but only subependymal cells have

neural stem cell characteristics J Neurosci 19 4462ndash4471

Conover JC Doetsch F Garcia-Verdugo JM Gale NW Yancopou-

los GD Alvarez-Buylla A 2000 Disruption of Ephephrin signaling

affects migration and proliferation in the adult subventricular zone Nat

Neurosci 3 1091ndash1097

Doetsch F Alvarez-Buylla A 1996 Network of tangential pathways for

neuronal migration in adult mammalian brain Proc Natl Acad Sci U

S A 93 14895ndash14900

Doetsch F Garcia-Verdugo JM Alvarez-Buylla A 1997 Cellular

composition and three-dimensional organization of the subventric-

ular germinal zone in the adult mammalian brain J Neurosci 17

5046ndash5061

Doetsch F Caille I Lim DA Garcia-Verdugo JM Alvarez-Buylla

A 1999a Subventricular zone astrocytes are neural stem cells in the

adult mammalian brain Cell 97 703ndash716

Doetsch F Garcia-Verdugo JM Alvarez-Buylla A 1999b Regenera-

tion of a germinal layer in the adult mammalian brain Proc Natl Acad

Sci U S A 96 11619ndash11624

Doetsch F Petreanu L Caille I Garcia-Verdugo JM Alvarez-Buylla

A 2002 EGF converts transit-amplifying neurogenic precursors in the

adult brain into multipotent stem cells Neuron 36 1021ndash1034

Draghici S Khatri P Bhavsar P Shah A Krawetz SA Tainsky

MA 2003 Onto-Tools the toolkit of the modern biologist Onto-

Express Onto-Compare Onto-Design and Onto-Translate Nucleic

Acids Res 31 3775ndash3781

Dudoit S Shaffer J 2003 Multiple hypothesis testing in microarray

experiments Stat Sci 18 71ndash103

Easterday MC Dougherty JD Jackson RL Ou J Nakano I Paucar

AA Roobini B Dianati M Irvin DK Weissman IL Terskikh

AV Geschwind DH Kornblum HI 2003 Neural progenitor genes

Germinal zone expression and analysis of genetic overlap in stem cell

populations Dev Biol 264 309ndash322

Ehrenhofer-Murray AE 2004 Chromatin dynamics at DNA replication

transcription and repair Eur J Biochem 271 2335ndash2349

Eisen MB Spellman PT Brown PO Botstein D 1998 Cluster

analysis and display of genome-wide expression patterns Proc Natl

Acad Sci U S A 95 14863ndash14868

Fernandez-Capetillo O Mahadevaiah SK Celeste A Romanienko PJ

Camerini-Otero RD Bonner WM Manova K Burgoyne P

Nussenzweig A 2003 H2AX is required for chromatin remodeling

and inactivation of sex chromosomes in male mouse meiosis Dev Cell

4 497ndash508

Ferrari N Palmisano GL Paleari L Basso G Mangioni M Fidanza

V Albini A Croce CM Levi G Brigati C 2003 DLX genes as

targets of ALL-1 DLX 234 down-regulation in t(411) acute

lymphoblastic leukemias J Leukocyte Biol 74 302ndash305

Ferri AL Cavallaro M Braida D Di Cristofano A Canta A

Vezzani A Ottolenghi S Pandolfi PP Sala M DeBiasi S

Nicolis SK 2004 Sox2 deficiency causes neurodegeneration and

impaired neurogenesis in the adult mouse brain Development 131

3805ndash3819

Fiske BK Brunjes PC 2001 Cell death in the developing and sensory-

deprived rat olfactory bulb J Comp Neurol 431 311ndash319

Gabay L Lowell S Rubin LL Anderson DJ 2003 Deregulation of

dorsoventral patterning by FGF confers trilineage differentiation

capacity on CNS stem cells in vitro Neuron 40 485ndash499

Gage FH 2000 Mammalian neural stem cells Science 287 1433ndash1438

Garcia-Verdugo JM Doetsch F Wichterle H Lim DA Alvarez-

Buylla A 1998 Architecture and cell types of the adult subventricular

zone in search of the stem cells J Neurobiol 36 234ndash248


Garcion E Halilagic A Faissner A ffrench-Constant C 2004

Generation of an environmental niche for neural stem cell development

by the extracellular matrix molecule tenascin C Development 131

3423ndash3432

Gates MA Thomas LB Howard EM Laywell ED Sajin B

Faissner A Gotz B Silver J Steindler DA 1995 Cell and

molecular analysis of the developing and adult mouse subventricular

zone of the cerebral hemispheres J Comp Neurol 361 249ndash266

Ge H Roeder RG 1994 The high mobility group protein HMG1 can

reversibly inhibit class II gene transcription by interaction with the

TATA-binding protein J Biol Chem 269 17136ndash17140

Geschwind DH Ou J Easterday MC Dougherty JD Jackson RL

Chen Z Antoine H Terskikh A Weissman IL Nelson SF

Kornblum HI 2001 A genetic analysis of neural progenitor

differentiation Neuron 29 325ndash339

Goldman S 2003 Glia as neural progenitor cells Trends Neurosci 26

590ndash596

Good PJ Chen Q Warner SJ Herring DC 2000 A family of human

RNA-binding proteins related to the Drosophila Bruno translational

regulator J Biol Chem 275 28583ndash28592

Grabowski PJ Black DL 2001 Alternative RNA splicing in the

nervous system Prog Neurobiol 65 289ndash308

Gritti A Parati EA Cova L Frolichsthal P Galli R Wanke E

Faravelli L Morassutti DJ Roisen F Nickel DD Vescovi AL

1996 Multipotential stem cells from the adult mouse brain proliferate

and self-renew in response to basic fibroblast growth factor J Neurosci

16 1091ndash1100

Grizzi F Chiriva-Internati M Franceschini B Bumm K Colombo P

Ciccarelli M Donetti E Gagliano N Hermonat PL Bright RK

Gioia M Dioguardi N Kast WM 2004 Sperm protein 17 is

expressed in human somatic ciliated epithelia J Histochem Cytochem

52 549ndash554

Gurok U Steinhoff C Lipkowitz B Ropers HH Scharff C Nuber

UA 2004 Gene expression changes in the course of neural progenitor

cell differentiation J Neurosci 24 5982ndash6002

Hack MA Sugimori M Lundberg C Nakafuku M Gotz M 2004

Regionalization and fate specification in neurospheres the role of Olig2

and Pax6 Mol Cell Neurosci 25 664ndash678

Hanson RD Hess JL Yu BD Ernst P van Lohuizen M Berns A

van der Lugt NM Shashikant CS Ruddle FH Seto M

Korsmeyer SJ 1999 Mammalian Trithorax and polycomb-group

homologues are antagonistic regulators of homeotic development Proc

Natl Acad Sci U S A 96 14372ndash14377

Hartmann AM Nayler O Schwaiger FW Obermeier A Stamm S

1999 The interaction and colocalization of Sam68 with the splicing-

associated factor YT521-B in nuclear dots is regulated by the Src family

kinase p59(fyn) Mol Biol Cell 10 3909ndash3926

Holmberg J Clarke DL Frisen J 2000 Regulation of repulsion

versus adhesion by different splice forms of an Eph receptor Nature

408 203ndash206

Hou VC Lersch R Gee SL Ponthier JL Lo AJ Wu M Turck

CW Koury M Krainer AR Mayeda A Conboy JG 2002

Decrease in hnRNP AB expression during erythropoiesis mediates a

pre-mRNA splicing switch EMBO J 21 6195ndash6204

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate

Curr Opin Genet Dev 14 461ndash469

Imura T Kornblum HI Sofroniew MV 2003 The predominant

neural stem cell isolated from postnatal and adult forebrain but

not early embryonic forebrain expresses GFAP J Neurosci 23

2824ndash2832

Irizarry RA Hobbs B Collin F Beazer-Barclay YD Antonellis KJ

Scherf U Speed TP 2003 Exploration normalization and summa-

ries of high density oligonucleotide array probe level data Biostatistics

4 249ndash264

Ivanova NB Dimos JT Schaniel C Hackney JA Moore KA

Lemischka IR 2002 A stem cell molecular signature Science 298

601ndash604

Jankovski A Sotelo C 1996 Subventricular zone-olfactory bulb

migratory pathway in the adult mouse Cellular composition and

specificity as determined by heterochronic and heterotopic transplanta-

tion J Comp Neurol 371 376ndash396

Jolliffe I 2003 Principle Component Analysis Springler-Verlag New

York

Jurica MS Moore MJ 2003 Pre-mRNA splicing awash in a sea of

proteins Mol Cell 12 5ndash14

Karsten SL Kudo LC Jackson R Sabatti C Kornblum HI

Geschwind DH 2003 Global analysis of gene expression in neural

progenitors reveals specific cell-cycle signaling and metabolic net-

works Dev Biol 261 165ndash182

Khatri P Draghici S Ostermeier GC Krawetz SA 2002 Profiling

gene expression using onto-express Genomics 79 266ndash270

Khatri P Bhavsar P Bawa G Draghici S 2004 Onto-Tools an

ensemble of web-accessible ontology-based tools for the functional

design and interpretation of high-throughput gene expression experi-

ments Nucleic Acids Res 32 W449ndashW456

Kukekov VG Laywell ED Suslov O Davies K Scheffler B

Thomas LB OrsquoBrien TF Kusakabe M Steindler DA 1999

Multipotent stemprogenitor cells with similar properties arise from

two neurogenic regions of adult human brain Exp Neurol 156

333ndash344

Kuroda Y Oma Y Nishimori K Ohta T Harata M 2002 Brain-

specific expression of the nuclear actin-related protein ArpNalpha and

its involvement in mammalian SWISNF chromatin remodeling

complex Biochem Biophys Res Commun 299 328ndash334

Ladd AN Charlet N Cooper TA 2001 The CELF family of RNA

binding proteins is implicated in cell-specific and developmentally

regulated alternative splicing Mol Cell Biol 21 1285ndash1296

Laywell ED Rakic P Kukekov VG Holland EC Steindler DA

2000 Identification of a multipotent astrocytic stem cell in the

immature and adult mouse brain Proc Natl Acad Sci U S A 97

13883ndash13888

Lemkine GF Raji A Alfama G Turque N Hassani Z Alegria-

Prevot O Samarut J Levi G Demeneix BA 2005 Adult neural

stem cell cycling in vivo requires thyroid hormone and its alpha

receptor FASEB J 19 863ndash865

Lim DA Alvarez-Buylla A 1999 Interaction between astrocytes and

adult subventricular zone precursors stimulates neurogenesis Proc


Lim DA Tramontin AD Trevejo JM Herrera DG Garcia-Verdugo

JM Alvarez-Buylla A 2000 Noggin antagonizes BMP signaling to

create a niche for adult neurogenesis Neuron 28 713ndash726

Lois C 1996 Long Distance Neuronal Migration in the Adult Mammalian

Brain Rockefeller New York pp 160

Lois C Alvarez-Buylla A 1994 Long-distance neuronal migration in the

adult mammalian brain Science 264 1145ndash1148

Luskin MB 1993 Restricted proliferation and migration of postnatally

generated neurons derived from the forebrain subventricular zone

Neuron 11 173ndash189

Luskin MB 1998 Neuroblasts of the postnatal mammalian forebrain

their phenotype and fate J Neurobiol 36 221ndash233

Matter N Herrlich P Konig H 2002 Signal-dependent regulation of

splicing via phosphorylation of Sam68 Nature 420 691ndash695

McBride AE Silver PA 2001 State of the arg protein methylation at

arginine comes of age Cell 106 5ndash8

Milne TA Briggs SD Brock HW Martin ME Gibbs D Allis

CD Hess JL 2002 MLL targets SET domain methyltransferase

activity to Hox gene promoters Mol Cell 10 1107ndash1117

Molofsky AV Pardal R Iwashita T Park IK Clarke MF Morrison

SJ 2003 Bmi-1 dependence distinguishes neural stem cell self-

renewal from progenitor proliferation Nature 425 962ndash967

Morshead CM Reynolds BA Craig CG McBurney MW Staines

WA Morassutti D Weiss S Van der Kooy D 1994 Neural stem

cells in the adult mammalian forebrain a relatively quiescent

subpopulation of subependymal cells Neuron 13 1071ndash1082


Naef F Magnasco MO 2003 Solving the riddle of the bright

mismatches labeling and effective binding in oligonucleotide arrays

Phys Rev E Stat Nonlinear Soft Matter Phys 68 011906

Najbauer J Leon M 1995 Olfactory experience modulated apoptosis in

the developing olfactory bulb Brain Res 674 245ndash251

Nemeth MJ Curtis DJ Kirby MR Garrett-Beal LJ Seidel NE

Cline AP Bodine DM 2003 Hmgb3 an HMG-box family member

expressed in primitive hematopoietic cells that inhibits myeloid and B-

cell differentiation Blood 102 1298ndash1306

Nemeth MJ Cline AP Anderson SM Garrett-Beal LJ Bodine

DM 2005 Hmgb3 deficiency deregulates proliferation and differen-

tiation of common lymphoid and myeloid progenitors Blood 105

627ndash634

Olave IA Reck-Peterson SL Crabtree GR 2002 Nuclear actin and

actin-related proteins in chromatin remodeling Annu Rev Biochem

71 755ndash781

Orlando V 2003 Polycomb epigenomes and control of cell identity Cell

112 599ndash606

Parras CM Galli R Britz O Soares S Galichet C Battiste J

Johnson JE Nakafuku M Vescovi A Guillemot F 2004 Mash1

specifies neurons and oligodendrocytes in the postnatal brain EMBO J

23 4495ndash4505

Pennartz S Belvindrah R Tomiuk S Zimmer C Hofmann K

Conradt M Bosio A Cremer H 2004 Purification of neuronal

precursors from the adult mouse brain comprehensive gene expression

analysis provides new insights into the control of cell migration

differentiation and homeostasis Mol Cell Neurosci 25 692ndash706

Peretto P Merighi A Fasolo A Bonfanti L 1997 Glial tubes in the

rostral migratory stream of the adult rat Brain Res Bull 42 9ndash21

Peretto P Dati C De Marchis S Kim HH Ukhanova M Fasolo A

Margolis FL 2004 Expression of the secreted factors noggin and

bone morphogenetic proteins in the subependymal layer and olfactory

bulb of the adult mouse brain Neuroscience 128 685ndash696

Petreanu L Alvarez-Buylla A 2002 Maturation and death of adult-born

olfactory bulb granule neurons role of olfaction J Neurosci 22

6106ndash6113

Ramalho-Santos M Yoon S Matsuzaki Y Mulligan RC Melton

DA 2002 lsquolsquoStemnessrsquorsquo transcriptional profiling of embryonic and

adult stem cells Science 298 597ndash600

Rasmussen TP 2003 Embryonic stem cell differentiation a chromatin

perspective Reprod Biol Endocrinol 1 100

Redmond L Hockfield S Morabito MA 1996 The divergent

homeobox gene PBX1 is expressed in the postnatal subven-

tricular zone and interneurons of the olfactory bulb J Neurosci

16 2972ndash2982

Reynolds B Weiss S 1992 Generation of neurons and astrocytes from

isolated cells of the adult mammalian central nervous system Science

255 1707ndash1710

Rietze RL Valcanis H Brooker GF Thomas T Voss AK Bartlett

PF 2001 Purification of a pluripotent neural stem cell from the adult

mouse brain Nature 412 736ndash739

Santa-Olalla J Baizabal JM Fregoso M del Carmen Cardenas M

Covarrubias L 2003 The in vivo positional identity gene expression

code is not preserved in neural stem cells grown in culture Eur J


Schoor M Schuster-Gossler K Roopenian D Gossler A 1999

Skeletal dysplasias growth retardation reduced postnatal survival

and impaired fertility in mice lacking the SNF2SWI2 family member

ETL1 Mech Dev 85 73ndash83

Schraets D Lehmann T Dingermann T Marschalek R 2003 MLL-

mediated transcriptional gene regulation investigated by gene expres-

sion profiling Oncogene 22 3655ndash3668

Scott HS Antonarakis SE Lalioti MD Rossier C Silver PA

Henry MF 1998 Identification and characterization of two putative

human arginine methyltransferases (HRMT1L1 and HRMT1L2)

Genomics 48 330ndash340

Shimogori T VanSant J Paik E Grove EA 2004 Members of the

Wnt Fz and Frp gene families expressed in postnatal mouse cerebral

cortex J Comp Neurol 473 496ndash510

Shykind BM Kim J Sharp PA 1995 Activation of the TFIID-TFIIA

complex with HMG-2 Genes Dev 9 1354ndash1365

Spassky N Merkle FT Flames N Tramontin AD Garcia-Verdugo

JM Alvarez-Buylla A 2005 Adult ependymal cells are postmitotic

and are derived from radial glial cells during embryogenesis J Neurosci

25 10ndash18

Stenman J Toresson H Campbell K 2003 Identification of two distinct

progenitor populations in the lateral ganglionic eminence implications

for striatal and olfactory bulb neurogenesis J Neurosci 23 167ndash174

Sterner DE Berger SL 2000 Acetylation of histones and transcription-

related factors Microbiol Mol Biol Rev 64 435ndash459

Stump G Durrer A Klein AL Lutolf S Suter U Taylor V 2002

Notch1 and its ligands Delta-like and Jagged are expressed and active in

distinct cell populations in the postnatal mouse brain Mech Dev 114

153ndash159

Thomas JO 2001 HMG1 and 2 architectural DNA-binding proteins

Biochem Soc Trans 29 395ndash401

Thomas LB Gates MA Steindler DA 1996 Young neurons from the

adult subependymal zone proliferate and migrate along an astrocyte

extracellular matrix-rich pathway Glia 17 1ndash14

Tramontin AD Garcia-Verdugo JM Lim DA Alvarez-Buylla A

2003 Postnatal development of radial glia and the ventricular zone

(VZ) a continuum of the neural stem cell compartment Cereb Cortex

13 580ndash587

Trievel RC 2004 Structure and function of histone methyltransferases

Crit Rev Eukaryotic Gene Expression 14 147ndash169

Ule J Ule A Spencer J Williams A Hu JS Cline M Wang H

Clark T Fraser C Ruggiu M Zeeberg BR Kane D Weinstein

JN Blume J Darnell RB 2005 Nova regulates brain-specific

splicing to shape the synapse Nat Genet 37 844ndash852

Verdi JM Bashirullah A Goldhawk DE Kubu CJ Jamali M

Meakin SO Lipshitz HD 1999 Distinct human NUMB isoforms

regulate differentiation vs proliferation in the neuronal lineage Proc


Wen T Gu P Minning TA Wu Q Liu M Chen F Liu H Huang

H 2002 Microarray analysis of neural stem cell differentiation in the

striatum of the fetal rat Cell Mol Neurobiol 22 407ndash416

Wilkinson DG (Ed) 1999 In Situ Hybridization A Practical Approach

Oxford Univ Press Oxford

Wright LS Li J Caldwell MA Wallace K Johnson JA Svendsen

CN 2003 Gene expression in human neural stem cells effects of

leukemia inhibitory factor J Neurochem 86 179ndash195

Wu Z Irizarry RA Gentleman R Martinez-Murillo F Spencer F

2004 A model based background adjustment for oligonucleotide

expression arrays J Am Stat Assoc 99 909ndash917

Xia ZB Anderson M Diaz MO Zeleznik-Le NJ 2003 MLL

repression domain interacts with histone deacetylases the polycomb

group proteins HPC2 and BMI-1 and the corepressor C-terminal-

binding protein Proc Natl Acad Sci U S A 100 8342ndash8347

Yu BD Hanson RD Hess JL Horning SE Korsmeyer SJ 1998

MLL a mammalian trithorax-group gene functions as a transcriptional

maintenance factor in morphogenesis Proc Natl Acad Sci U S A

95 10632ndash10636

Zeisig BB Milne T Garcia-Cuellar MP Schreiner S Martin

ME Fuchs U Borkhardt A Chanda SK Walker J Soden

R Hess JL Slany RK 2004 Hoxa9 and Meis1 are key targets

for MLL-ENL-mediated cellular immortalization Mol Cell Biol

24 617ndash628

Zhou FC Duguid JR Edenberg HJ McClintick J Young P Nelson

P 2001 DNA microarray analysis of differential gene expression of 6-

year-old rat neural striatal progenitor cells during early differentiation

Restor Neurol Neurosci 18 95ndash104

Zhu H Wang ZY Hansson HA 2003 Visualization of proliferating

cells in the adult mammalian brain with the aid of ribonucleotide

reductase Brain Res 977 180ndash189

Fig 1 (A) Brain regions dissected for the brain region transcriptional

analysis Dissected areas are shown in yellow The SVZ contains three

populations of neurogenic precursorsmdashtype B C and A cells (B) The

lineage of SVZ neurogenesis TypeB cells (blue) are SVZ astrocytes that self-

renew and give rise to a rapidly dividing population of immature-appearing

cellsmdashtype C cells (green) The transit-amplifying type C cells then become

type A cells (red) the neuroblasts that migrate into the ObC (C) Architecture

of the SVZ The ventricle is to the left Ciliated ependymal cells (gray) line

the ventricle wall Some type B cells (blue) make contact with the ventricle

lumen (arrow) Both type C (green) and A cells (red) are in direct contact with

the type B cells In this panel type A cells are migrating toward the ObC in a

direction perpendicular to the page (D) Sagittal view of the mouse brain

Within the SVZ there is an extensive network of type A cells migrating

tangentially toward the ObC This network of pathways coalesces at the

anterior of the SVZ to form the rostral migratory stream (curved arrow) The

rostral migratory stream enters the ObC where type A cells then migrate

radially and disperse (red dots) throughout the Ob The major biological

processes that occur in the SVZ alone (SVZ profile) SVZ and ObC (SO

profile) and ObC alone (ObC profile) are listed to the left middle and right

respectively the cell types of the SVZ and ObC profiles are in bold


(Gurok et al 2004) neurospheres have also been studied in vitro

Many neurospheres are derived from transit-amplifying cells (type

C cells) (Doetsch et al 2002) and their exposure to growth factors

(EGF or FGF) in vitro deregulates the normal genetic control of

cell differentiation that occurs in vivo (Gabay et al 2003 Santa-

Olalla et al 2003 Hack et al 2004) it is likely that the expression

profiles of neurospheres and endogenous SVZ precursors differ

Furthermore in vivo SVZ neurogenesis involves a long-distance

directional migration to the Ob while neurospheres do not appear

to have a similar migration capacity Therefore transcriptional

analysis of in vivo SVZ neurogenesis is required to identify genes

and biological processes involved in this continual generation of

neurons for the Ob

Using high-density oligonucleotide (GeneChip) arrays we

undertook three complementary approaches to determine the

transcriptional profile of in vivo SVZ neurogenesis We first

compared gene expression differences of the SVZ-Ob system with

that of three other brain regions We then utilized FACS methods to

compare the transcriptional profiles of type B cells ndash the

neurogenic stem cell ndash and the non-neurogenic ependyma Finally

we analyzed the transcriptional changes of the SVZ as it

regenerated type C and A cells from a population of type B cells

Data integrated from these three approaches identified genes

signaling pathways and biological processes related to SVZ

neurogenesis In addition to expanding the catalogue of cell cycle

components transcription factors and genes for migration we

identified RNA splicing and chromatin remodeling as prominent

processes for adult neurogenesis The importance of RNA splicing

and chromatin remodeling has not been described for SVZ neuro-

genesis and we here provide evidence that these processes are as

upregulated as the expected processes of cell cycle transcription

and neurogenesis We focused our Results and Discussion below

only on a subset of genes with special attention to RNA splicing and

chromatin remodeling however both the raw chip image data and

other data analyses are available (Supplementary data and at http

asterionrockefelleredumayteNeurogenesis) for future compara-

tive expression profile analyses with other developmental adult or

tumor cell populations

Results

Brain region transcriptional profile analysis identified genes with

increased expression in the SVZ-ObC neurogenic system

We analyzed the transcriptional profiles of the SVZ Ob core

(ObC) and three other brain regions indicated in Fig 1A The ObC

dissection excluded themitral and periglomerular layers providing a

RNA sample primarily representing migratory type A cells

maturing neuroblasts and mature granule cells The hippocampus

(Hp) dissection included the non-neurogenic CA1ndashCA3 regions as

well the dentate gyrus The striatum (St) was the region directly

underlying the SVZ dissection The cortex (Ctx) did not include the

corpus callosum Biotin-labeled complementary RNAs (cRNAs)

derived from each brain region were analyzed on GeneChip Mu11k

expression arrays which contain more than 13000 probe sets

analyzing the expression of over 11000 unique genes Each brain

region was analyzed independently twice the data among the

duplicates were consistent (Supplementary data S1)

To focus our analysis on those genes more likely to be involved

in SVZ neurogenesis we filtered the data (see Experimental

methods) for those genes that are (1) increased in the SVZmdashthe

SVZ profile (2) increased in the ObCmdashthe ObC profile and (3)

increased in both the SVZ and ObCmdashthe SO profile (Fig 1D) The

SVZ profile (Supplementary data S2) contained 65 unique genes

(71 probe sets) with increased expression in the SVZ as compared

to all other regions (ObC Hp Ctx St) The ObC profile

(Supplementary data S3) included 168 genes (209 probe sets)

and the SO profile (Supplementary data S4) contained 60 genes (80

probe sets) Genes in the SVZ SO ObC profiles are shown

Table 1


profile analysis


SVZ ObC Reference

















Slit Ng2 Dcx Gli1





























brain regions


















Figs 3BndashD
































































Table 2



SO profile)












(Table 2)




























were not observed












































of mRNA degradation




































































Supplementary text



























Table 3


(CD24+)













































genes






























Discussion











































































Table 4

























































in the SVZ



























































into local circuits















































































(Nemeth et al 2004)


















r right



Concluding remarks






























production
















































































Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628








Table 1


profile analysis


SVZ ObC Reference

















Slit Ng2 Dcx Gli1





























brain regions


















Figs 3BndashD
































































Table 2



SO profile)












(Table 2)




























were not observed












































of mRNA degradation




































































Supplementary text



























Table 3


(CD24+)













































genes






























Discussion











































































Table 4

























































in the SVZ



























































into local circuits















































































(Nemeth et al 2004)


















r right



Concluding remarks






























production
















































































Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628









































Table 2



SO profile)












(Table 2)




























were not observed












































of mRNA degradation




































































Supplementary text



























Table 3


(CD24+)













































genes






























Discussion











































































Table 4

























































in the SVZ



























































into local circuits















































































(Nemeth et al 2004)


















r right



Concluding remarks






























production
















































































Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628
































Table 2



SO profile)












(Table 2)




























were not observed












































of mRNA degradation




































































Supplementary text



























Table 3


(CD24+)













































genes






























Discussion











































































Table 4

























































in the SVZ



























































into local circuits















































































(Nemeth et al 2004)


















r right



Concluding remarks






























production
















































































Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628

























were not observed












































of mRNA degradation




































































Supplementary text



























Table 3


(CD24+)













































genes






























Discussion











































































Table 4

























































in the SVZ



























































into local circuits















































































(Nemeth et al 2004)


















r right



Concluding remarks






























production
















































































Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628














Supplementary text



























Table 3


(CD24+)













































genes






























Discussion











































































Table 4

























































in the SVZ



























































into local circuits















































































(Nemeth et al 2004)


















r right



Concluding remarks






























production
















































































Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628








Table 3


(CD24+)













































genes






























Discussion











































































Table 4

























































in the SVZ



























































into local circuits















































































(Nemeth et al 2004)


















r right



Concluding remarks






























production
















































































Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628
































































Table 4

























































in the SVZ



























































into local circuits















































































(Nemeth et al 2004)


















r right



Concluding remarks






























production
















































































Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628








Table 4

























































in the SVZ



























































into local circuits















































































(Nemeth et al 2004)


















r right



Concluding remarks






























production
















































































Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628






















































into local circuits















































































(Nemeth et al 2004)


















r right



Concluding remarks






























production
















































































Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628



























into local circuits















































































(Nemeth et al 2004)


















r right



Concluding remarks






























production
















































































Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628










Concluding remarks






























production
















































































Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628









Concluding remarks






























production
















































































Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628












Data analysis















































































shown in Fig 4























Primer sequences





TATGGCCGGG


TATGG


TACGACTCACTATAGGGCG


GGCCCAGGTAT



GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628










GAAGATGG


CAGAGAGGTTCAAAGC


GAGGTCTATGTCACC


GAGGATGTCAA


GACGGAACT


GAAGAAGGCA


CAGGTTTCG


GGATTCTGGGATGG


CAGCGTCTGTGAGGTC


GAACAAAAGA

Acknowledgments





AAB




References






275 16030ndash16036



289ndash300





























S A 93 14895ndash14900




5046ndash5061






Sci U S A 96 11619ndash11624
























4 497ndash508









3805ndash3819














3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628












3423ndash3432













590ndash596










16 1091ndash1100





52 549ndash554


















408 203ndash206










2824ndash2832




4 249ndash264



601ndash604






York

















333ndash344











13883ndash13888















































627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628





















627ndash634



71 755ndash781


112 599ndash606




23 4495ndash4505














6106ndash6113









16 2972ndash2982



255 1707ndash1710



























25 10ndash18









153ndash159









13 580ndash587





























95 10632ndash10636





24 617ndash628








In vivo transcriptional profile analysis reveals RNA splicing and chromatin remodeling as prominent processes for adult neurogenesis

Documents