Improved 16S rRNA-targeted probe set for analysis of sulfate-reducing bacteria by fluorescence in situ hybridization

Journal of Microbiological Methods 69 (2007) 523–528www.elsevier.com/locate/jmicmeth

Note

Improved 16S rRNA-targeted probe set for analysis of sulfate-reducingbacteria by fluorescence in situ hybridization

Sebastian Lücker a, Doris Steger a, Kasper Urup Kjeldsen b, Barbara J. MacGregor c,Michael Wagner a, Alexander Loy a,⁎

a Department of Microbial Ecology, Faculty of Life Sciences, University of Vienna, A-1090 Wien, Austriab Department of Microbiology, Institute of Biological Sciences, University of Aarhus, Ny Munkegade Building 540, DK-8000 Aarhus C., Denmark

c Department of Marine Sciences, University of North Carolina-Chapel Hill, Chapel Hill, NC 27599, USA

Received 22 December 2006; received in revised form 31 January 2007; accepted 20 February 2007Available online 28 February 2007

Abstract

An updated dataset of in silico specificities for 54 previously published 16S rRNA-targeted oligonucleotides was assembled to provideguidance for reliable fluorescence in situ hybridization (FISH) analysis of sulfate-reducing bacteria. Additionally, six new FISH probes weredeveloped for major deltaproteobacterial taxa, including a probe trio targeting most Deltaproteobacteria and Gemmatimonadetes.© 2007 Elsevier B.V. All rights reserved.

Keywords: Fluorescence in situ hybridization; Deltaproteobacteria; Sulfate-reducing bacteria; 16S rRNA-targeted probes

The physiological versatility of dissimilatory sulfate-redu-cing microorganisms (SRMs) enables them to occupy a widevariety of niches in the environment, where they are key to thebiogeochemical cycling of sulfur and carbon (Jørgensen, 1982).From an anthropocentric perspective, the activity of SRMs canalso be detrimental, for instance, during oil production, causingsouring of oil and corrosion of pipelines (Hamilton, 1985), or bybeing associated with human diseases such as periodontitis(Langendijk et al., 2000), liver abscess (Tee et al., 1996), andbacteremia (Loubinoux et al., 2000). The development andongoing evaluation of molecular methods, which are notdependent on time-consuming cultivation, is thus importantfor rapid and reliable monitoring of SRMs in environmental,industrial, and clinical settings (Stahl et al., in press). A popularmethod for microscopic identification of SRMs is fluorescencein situ hybridization (FISH) using rRNA-targeted oligonucleo-tide probes (Amann et al., 2001; Wagner et al., 2003). FISH notonly allows identification and enumeration on a single celllevel, but can also reveal the spatial arrangement of micro-

⁎ Corresponding author. Department für Mikrobielle Ökologie, Fakultät fürLebenswissenschaften, Universität Wien, Althanstr. 14, A-1090 Wien, Austria.Tel.: +43 1 4277 54207; fax: +43 1 4277 54389.

E-mail address: [email protected] (A. Loy).

0167-7012/$ - see front matter © 2007 Elsevier B.V. All rights reserved.doi:10.1016/j.mimet.2007.02.009

organisms in their natural surrounding. Sophisticated programsaid in semi-automatic quantification and reconstruction ofthree-dimensional objects from digital FISH images (Daimset al., 2006; Pernthaler et al., 2003). An additional corollary ofFISH is its possible combination with analytical techniques thatallow inference of the ecophysiology of fluorescent probe-labeled microorganisms (Lee et al., 1999; Orphan et al., 2001;Ramsing et al., 1993).

However, full exploitation of FISH-based techniques forstructure–function analyses of known SRMs is hampered by theincompleteness of the available 16S rRNA-targeted FISH probeset. Furthermore, the recognized specificity and coverage of anexisting probemay changewith the rapidly increasing number of16S rRNA sequences that are deposited in public databases(Rappe and Giovannoni, 2003). 16S rRNA databases withintegrated probe-match tools allow the target ranges of probes tobe periodically re-evaluated in silico (Cole et al., 2005; DeSantiset al., 2006; Ludwig et al., 2004). The need for such re-evaluations is exemplified by probe SRB385 and its variantSRB385Db. SRB385 was developed for deltaproteobacterialSRMs as one of the first FISH probes ever (Amann et al., 1990),based on the very limited sequence dataset existing at that time.SRB385 was later extended by SRB385Db, which was thoughtto specifically target Desulfobacteraceae (Rabus et al., 1996).

524 S. Lücker et al. / Journal of Microbiological Methods 69 (2007) 523–528

However, later evaluations against larger sequence datasetsrevealed that both probes also perfectly match numerous non-target bacteria (Ashelford et al., 2002; Loy et al., 2002)(Supplementary online material (SOM) Table 1). Applicationof such probes by investigators unaware of their ‘outdated’specificities inevitably leads to wrong conclusions. Hence, wehave re-evaluated the specificity of all 54 previously published16S rRNA-targeted FISH probes for SRMs against the RDP IIdatabase (Cole et al., 2005) and a curated deltaproteobacterialGreengenes-based ARB database (DeSantis et al., 2006), fromwhich putative chimeric sequences were removed. The data aresummarized in the SOM (Table 1 and Fig. 1) and provide arational basis for the selection of specific probes and probecombinations in line with the ‘multiple nested probe concept’(Amann and Schleifer, 2001).

Although a much larger collection of probes is in principleavailable for different SRM groups {see ‘list probes by cate-gory’ option of probeBase http://www.microbial-ecology.net/probebase/ (Loy et al., 2007)}, only a minor fraction of theseprobes has so far been used for FISH. Consequently, validatedand specific FISH probes for major deltaproteobacterial SRMfamilies such as the Desulfobacteraceae, Desulfobulbaceae, andSyntrophobacteraceae do not exist. We have thus tested thesuitability of eight probes for FISH that, with one exception(DELTA495a) (Macalady et al., 2006), have previously onlybeen applied for microarray (DELTA495b, DELTA495c,DSB706, DSB230, DSM213) (Loy et al., 2002) and/or mem-brane hybridization (DSBAC355, SYN835) (Scheid and Stub-ner, 2001) (Tables 1 and 2). Fluorescently-labeled probes,modified at the 5′-end with the dye FLUOS [5(6)-carboxyfluor-

Table 116S rRNA-targeted oligonucleotide probes used in this study

probeBaseaccession number

Probe name Specificity a FA

pB-00159 EUB338 Most Bacteria 0–

pB-00432 DELTA495a Most Deltaproteobacteria andmost Gemmatimonadetes

35

– cDELTA495a Competitor for DELTA495a –pB-00433 DELTA495b Some Deltaproteobacteria 35– cDELTA495b Competitor for DELTA495b –pB-00434 DELTA495c Some Deltaproteobacteria 35– cDELTA495c Competitor for DELTA495c –pB-00076 DSBAC355 Most Desulfobacteraceae and

SyntrophobacteraceaeLo

pB-01320 DSBAC357 Most Desulfobacteraceae andSyntrophobacteraceae

35

– c1DSBAC357 Competitor for DSBAC357 –– c2DSBAC357 Competitor for DSBAC357 –pB-00436 DSB706 Most Desulfobulbaceae and

Thermodesulforhabdus20

pB-00437 DSB230 Desulfotalea–Desulforhopalus–Desulfocapsa–Desulfofustis lineage

No

pB-00507 DSM213 Desulfomicrobium 15pB-00307 SYN835 Syntrophobacter, Desulforhabdus No

See probeBase at http://www.microbial-ecology.net/probebase/ for further probe deta The intended specificity of the probe.b FA [%]: formamide concentration in the hybridization buffer to ensure specificc Probe tested for FISH but showed no or only a very weak fluorescence signal.

escein-N-hydroxysuccinimide ester] or with the sulfoindocya-nine dyes Cy3 or Cy5, were obtained from ThermoHybaid(Interactiva Division, Ulm, Germany). Fixation of cells withparaformaldehyde and subsequent hybridization assays wereperformed according to standard protocols (Daims et al., 2006;Daims et al., 2005). Fluorescence intensities of probe-labeledmicroorganisms were imaged using a confocal laser scanningmicroscope (LSM 510 Meta, Zeiss, Oberkochen, Germany) andquantified with the image-analysis software DAIME version 1.1(Daims et al., 2006). Table 3 lists the 17 reference microorgan-isms that were used for determining optimal hybridizationconditions for the new probes. A pure culture that perfectlymatched probe DELTA495c was not available in our laboratoriesand thus Clone-FISH was applied to test this probe (Schramm etal., 2002). Briefly, the plasmid pCR®2.1-TOPO (Invitrogen,Carlsbad, CA, USA), containing the nearly complete 16S rRNAgene (Escherichia coli position 8–1542) ofDesulfovibrio longus,was cloned and transcribed in vivo in E. coli JM109(DE3)(Promega, Madison, USA) prior to fixation of the cells. Initialhybridizations with the bacterial EUB338 probe at 0 and 10%formamide in the hybridization buffer demonstrated that cells ofall reference organisms were permeable to probes tagged withsingle fluorescent dye molecules and contained a detectablenumber of ribosomes. Nevertheless, little or no fluorescentsignal was observed for probe DSB230 or SYN835, even afterhybridization for up to 72 h (Yilmaz et al., 2006), indicatingthat the probe target sites in the perfectly-matching targetorganisms were poorly accessible (Behrens et al., 2003). Helperprobes (unlabeled oligonucleotides complementary to consen-sus sequences for regions flanking a probe target site)

[%] b Sequence 5′–3′ Reference

50 GCTGCCTCCCGTAGGAGT Amann et al., 1990;Daims et al., 1999

AGTTAGCCGGTGCTTCCT Loy et al., 2002

AGTTAGCCGGTGCTTCTT Macalady et al., 2006AGTTAGCCGGCGCTTCCT Loy et al., 2002AGTTAGCCGGCGCTTC(T/G)T This studyAATTAGCCGGTGCTTCCT Loy et al., 2002AATTAGCCGGTGCTTCTT This study

w signal c GCGCAAAATTCCTCACTG Scheid and Stubner, 2001

CCATTGCGCAAAATTCCTCAC Modified fromScheid and Stubner, 2001

CCATTGCGCAAAATTCCCCAC This studyCCATTGCGCAAAATCCCTCAC This study

–55 (45) ACCGGTATTCCTCCCGAT Loy et al., 2002

signal c CTAATGGTACGCAAGCTC Loy et al., 2002

CATCCTCGGACGAATGCA Loy et al., 2002signal c GCAGGAATGAGTACCCGC Scheid and Stubner, 2001

ails (Loy et al., 2007).

detection of target organisms.

Table 2In silico evaluation of probes used in this study

Probe name Probe evaluation with RDP II probe mathch a

RDP II target taxon Coverageof targettaxon b (%)

Hits intargettaxon c

Totalnon-targethits d

Major non-target taxa Coverage ofnon-targettaxon b (%)

Hits in non-targettaxon c

EUB338 Domain Bacteria 90.5 181,522 0 NAe

DELTA495a Class Deltaproteobacteria 71.4 4605 792 PhylumGemmatimonadetes

88.7 376

Order Desulfurellales 96.3 26 5371 PhylumGenera_incertae_sedis_WS3

29.9 23

Order Desulfovibrionales 87.1 1217 4180Order Desulfobacterales 87.6 1592 3805Order Desulfarcales 83.3 5 5392Order Desulfuromonales 88.7 528 4869Order Syntrophobacterales 84.3 418 4979Order Bdellovibrionales 41.9 78 5319Order Myxococcales 14.1 134 5263Unclassified_Deltaproteobacteria 62.6 607 4790

DELTA495b Class Deltaproteobacteria 2.4 156 111 PhylumGenera_incertae_sedis_WS3

11.7 9

DELTA495c Class Deltaproteobacteria 0.9 55 13 – – –Order Desulfovibrionales 3.9 54 14

DSBAC355 Class Deltaproteobacteria 15.0 858 108 Phylum Nitrospira 5.0 30Family Desulfobacteraceae 85.5 619 347Family Syntrophobacteraceae 86.8 125 841

DSBAC357 Class Deltaproteobacteria 14.7 844 105 Phylum Nitrospira 5.1 31Family Desulfobacteraceae 84.7 613 336Family Syntrophobacteraceae 86.1 124 825

DSB706 Class Deltaproteobacteria 9.3 593 26 – – –Family Desulfobulbaceae 74.1 555 64Family Syntrophobacteraceae 11.2 20 599Genus Thermodesulforhabdus 100.0 16 603

DSB230 Class Deltaproteobacteria 5.6 301 2 – – –Family Desulfobulbaceae 46.9 295 8Genus Desulfocapsa 95.9 71 232Genus Desulfofustis 83.3 5 298Genus Desulforhopalus 57.0 53 250Genus Desulfotalea 87.5 21 282Unclassified_Desulfobulbaceae 50.0 145 158

DSM213 Genus Desulfomicrobium 83.8 62 0 – – –SYN835 Family Syntrophobacteraceae 59.3 99 0 – – –

Genus Syntrophobacter 88.2 75 24Genus Desulforhabdus 100.0 11 88Unclassified_Syntrophobacteraceae 36.4 12 87

a RDP II probe match was performed with database release 9.44 (Oct 31, 2006) containing 273,300 bacterial 16S rRNA sequences. The search for each probe wasrestricted to sequences of good quality with data in the respective probe binding region.b The percentage of sequences within the RDP II (non-)target taxon that shows a full match to the probe sequence.c The number of sequences within the RDP II (non-)target taxon that shows a full match to the probe sequence.d The total number of sequences outside the respective RDP II target taxon that shows a full match to the probe sequence.e NA, not applicable because RDP II only contains bacterial 16S rRNA sequences.

525S. Lücker et al. / Journal of Microbiological Methods 69 (2007) 523–528

potentially alleviate local secondary structures in the rRNAmolecule, thereby increasing the accessibility of the probetarget site (Fuchs et al., 2000). Due to the relatively low degreeof sequence conservation in the regions surrounding the bindingsites of probes DSB230 and SYN835, we have not used thisapproach. Probe DSBAC355 also gave a relatively weak signal.By using the ARB probe match tool (Ludwig et al., 2004), weextended the length and shifted the binding site of probeDSBAC355 without significantly changing its in silicospecificity. This led to an approximately 30% increase insignal intensity for the new probe DSBAC357. Subsequently,melting profiles of probes DELTA495a, DELTA495b, DEL-

TA495c, DSBAC357, DSB706, and DSM213 were recorded(SOM Fig. 2). Even without competitor probes, dissociationprofiles of target microorganisms were clearly different fromthe profiles of non-target microorganisms for all probes tested,allowing us to propose optimal formamide concentrations atwhich specific hybridization is ensured (Table 1). For example,equimolar amounts of probes DELTA495a, DELTA495b, andDELTA495c can be used at a formamide concentration of 35%for specific detection of most (75%) members of the classDeltaproteobacteria (note that most members of the orderMyxococcales and family Bdellovibrionaceae are not coveredby this probe set) and the phylum Gemmatimonadetes (89%).

Table 3Reference strain — SRM probe combinations tested for FISH

Species Strain 16S rRNA accession number Probe name Number of mismatches(weighted mismatches) a

Burkholderia cepacia DSM 7288 M22518, U96927 DELTA495a 1 (0.8)Desulfacinum infernum DSM 9756 L27426 DSBAC355 b 0 (0)

DSBAC357 0 (0)Desulfobacter halotolerans DSM 11383 Y14745 DELTA495b 0 (0)

DELTA495a 1 (0.3)DSBAC355 b 0 (0)

“Desulfobacterium oleovorans” DSM 6200 Y17698 DSBAC355 b 0 (0)Desulfobacula phenolica DSM 3384 AJ237606 DSBAC355 b 0 (0)Desulfobulbus propionicus DSM 2032 AY548789 DSB706 0 (0)Desulfocella halophila DSM 11763 AF022936 DSBAC357 1 (0.2)Desulfofaba hansenii(Desulfomusa hansenii)

DSM 12642 AF321820 DELTA495a 0 (0)

DSBAC355 b 0 (0)DSBAC357 0 (0)DSB706 2 (2.7)

Desulfofustis glycolicus DSM 9705 X99707 DSB706 0 (0)DSB230 b 0 (0)

Desulfohalobium retbaense DSM 5692 U48244, X99235 DSB706 1 (1.3)Desulfomicrobium apsheronum DSM 5918 U64865 DELTA495a 0 (0)

DSM213 0 (0)Desulfomicrobium orale DSM 12838 AJ251623 DSM213 0 (0)Desulfonema limicola DSM 2076 U45990 DSBAC355 b 0 (0)Desulfovibrio longus c DSM 6739 AY359867 DELTA495c 0 (0)Desulfovibrio piger(Desulfomonas pigra)

DSM 749 AF192152 DELTA495a 0 (0)

DELTA495b 1 (1.9)DELTA495c 1 (0.8)

Escherichia coli DSM 30083 X80725 DELTA495a 1 (0.8)DELTA495c 2 (1.5)

Syntrophobacter wolinii DSM 2805 X70905 SYN835b 0 (0)a The number of (weighted) mismatches between the probe and the reference organism was determined with the ARB probe match tool.b Probe did not yield any or only a weak fluorescent signal.c 16S rRNA gene sequence of D. longus was transformed and transcribed in E. coli JM109(DE3) for Clone-FISH.

526 S. Lücker et al. / Journal of Microbiological Methods 69 (2007) 523–528

This is in contrast to the recently recommended optimalformamide concentration of 45% for probe DELTA495a(Macalady et al., 2006). Hybridization at 45% formamideyielded significantly reduced signals in our experiments (SOMFig. 2), potentially leading to underestimation of the actualtarget cell numbers in environmental samples. The 16S rRNAsequence conservation profile of Deltaproteobacteria does notallow the design of a diagnostic oligonucleotide probe (set) thatexclusively targets members of this class. Hence, although theDELTA495 probe trio also binds to most Gemmatimonadetes, itrepresents the best possible probe set for Deltaproteobacteria.Differentiation between the two taxa in multi-color FISHexperiments (Amann et al., 1996) will become feasible uponavailability of a Gemmatimonadetes-specific probe (set). In themeantime, we give full consideration to the “one probe is noprobe” dogma (Schramm and Amann, 1999) by recommendingsimultaneous use of the DELTA495 probe mix with the selectedprobes listed below. When the DELTA495 probe mix and theother probe are labeled with different dyes, then only thefollowing organisms will exhibit overlapping fluorescencesignals:

(i) SRB385 ⇒ most Desulfobulbaceae and Desulfovibrio-naceae, but less than 20% of all Gemmatimonadetes

(ii) SRB385Db⇒ Desulfobacteraceae, Nitrospinaceae, Desul-fomicrobiaceae, Desulfonatronumaceae, Geobacteraceae,Syntrophaceae, Cystobacterineae, and some Desulfuromo-naceae and Syntrophobacteraceae.

(iii) DSBAC357 ⇒ Desulfobacteraceae, Syntrophobactera-ceae (with the exception of Thermodesulforhabdus), andmembers of the “Desulfobacterium anilini” clade

(iv) DSB706⇒Desulfobulbaceae and Thermodesulforhabdus

Analysis of a sample from an anaerobic sludge digesterexemplarily illustrated the benefit of co-hybridizations withmultiple, differentially-labeled probes (SOM Fig. 3). Thedetection of at least three distinct microbial consortia in thissample would not have been possible if the SRM probes hadbeen applied separately.

In order to further enhance the specificity of the FISHanalysis in samples containing a complex and not fullycharacterized diversity of microorganisms, we also recommenduse of equimolar concentrations of the newly-developed probesand their respective unlabeled competitors (Table 1) (Daimset al., 2005; Manz et al., 1992).

In conclusion, novel probes were developed for FISH-baseddetection of major phylogenetic groups of SRMs, and the insilico specificities of all FISH probes for SRMs were evaluated

527S. Lücker et al. / Journal of Microbiological Methods 69 (2007) 523–528

against current 16S rRNA gene databases. Although environ-mental surveys of dsrAB, encoding the SRM key enzymedissimilatory (bi)sulfite reductase, suggest the existence of ahigh diversity of novel SRMs (Leloup et al., 2007; Loy et al.,2004), the probe data collected in this study represent a vitalfoundation for targeted selection of appropriate probe combina-tions (see above for a few examples) for specific identificationand differentiation of known SRM groups in multi-color FISHanalyses (Amann et al., 1996).

Supplementary online material (illustrating the in silicospecificities of previously-published SRM-targeted FISHprobes, and including melting profiles and an applicationexample of the newly developed probes) is available at http://www.microbial-ecology.net/download.asp.

Acknowledgment

The authors thank Kjeld Ingvorsen for provision of the strains.Kilian Stoecker and Frank Maixner are acknowledged forexcellent help with confocal laser scanning microscopy and forupdating probeBase, respectively. This study was supported bygrants from the European Community (Marie Curie Intra-European Fellowship within the 6th Framework Programme)and the Fonds zur Förderung der wissenschaftlichen Forschung(project P18836-B17) to AL, and the bmb+f (project 01 LC0021A-TP2 in the framework of theBIOLOG II program) toMW.

Appendix A. Supplementary data

Supplementary data associated with this article can be found,in the online version, at doi:10.1016/j.mimet.2007.02.009.

References

Amann, R., Schleifer, K.-H., 2001. Nucleic acid probes and their application inenvironmental microbiology. In: Garrity, G.M. (Ed.), Bergey's Manual ofSystematic Bacteriology. Springer, New York, pp. 67–82.

Amann, R.I., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R., Stahl,D.A., 1990. Combination of 16S rRNA-targeted oligonucleotide probeswith flow cytometry for analyzing mixed microbial populations. Appl.Environ. Microbiol. 56, 1919–1925.

Amann, R., Snaidr, J., Wagner, M., Ludwig, W., Schleifer, K.H., 1996. In situvisualization of high genetic diversity in a natural microbial community.J. Bacteriol. 178, 3496–3500.

Amann, R., Fuchs, B.M., Behrens, S., 2001. The identification of microorgan-isms by fluorescence in situ hybridisation. Curr. Opin. Biotechnol. 12,231–236.

Ashelford, K.E., Weightman, A.J., Fry, J.C., 2002. PRIMROSE: a computerprogram for generating and estimating the phylogenetic range of 16S rRNAoligonucleotide probes and primers in conjunction with the RDP-II database.Nucleic Acids Res. 30, 3481–3489.

Behrens, S., Ruhland, C., Inacio, J., Huber, H., Fonseca, A., Spencer-Martins, I.,Fuchs, B.M., Amann, R., 2003. In situ accessibility of small-subunit rRNAof members of the domains Bacteria, Archaea, and Eucarya to Cy3-labeledoligonucleotide probes. Appl. Environ. Microbiol. 69, 1748–1758.

Cole, J.R., Chai, B., Farris, R.J., Wang, Q., Kulam, S.A., McGarrell, D.M.,Garrity, G.M., Tiedje, J.M., 2005. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis. Nucleic AcidsRes. 33, 294–296.

Daims, H., Brühl, A., Amann, R., Schleifer, K.-H., Wagner, M., 1999. Thedomain-specific probe EUB338 is insufficient for the detection of all

bacteria: development and evaluation of a more comprehensive probe set.Syst. Appl. Microbiol. 22, 434–444.

Daims, H., Stoecker, K., Wagner, M., 2005. Fluorescence in situ hybridizationfor the detection of prokaryotes. Advanced Methods in Molecular MicrobialEcology. BIOS Scientific Publishers, Abingdon, UK, pp. 213–239.

Daims, H., Lücker, S., Wagner, M., 2006. daime, a novel image analysisprogram for microbial ecology and biofilm research. Environ. Microbiol. 8,200–213.

DeSantis, T.Z., Hugenholtz, P., Larsen, N., Rojas, M., Brodie, E.L., Keller, K.,Huber, T., Dalevi, D., Hu, P., Andersen, G.L., 2006. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB.Appl. Environ. Microbiol. 72, 5069–5072.

Fuchs, B.M., Glockner, F.O., Wulf, J., Amann, R., 2000. Unlabeled helperoligonucleotides increase the in situ accessibility to 16S rRNAof fluorescentlylabeled oligonucleotide probes. Appl. Environ. Microbiol. 66, 3603–3607.

Hamilton, W.A., 1985. Sulphate-reducing bacteria and anaerobic corrosion.Annu. Rev. Microbiol. 39, 195–217.

Jørgensen, B.B., 1982. Mineralization of organic matter in the sea-bed—the roleof sulphate reduction. Nature 296, 643–645.

Langendijk, P.S., Hanssen, J.T.J., van der Hoeven, J.S., 2000. Sulfate-reducingbacteria in association with human periodontitis. J. Clin. Periodontol. 27,943–950.

Lee, N., Nielsen, P.H., Andreasen, K.H., Juretschko, S., Nielsen, J.L., Schleifer,K.-H., Wagner, M., 1999. Combination of fluorescent in situ hybridizationand microautoradiography — a new tool for structure–function analyses inmicrobial ecology. Appl. Environ. Microbiol. 65, 1289–1297.

Leloup, J., Loy, A., Knab, N.J., Borowski, C., Wagner, M., Jørgensen, B.B.,2007. Diversity and abundance of sulfate-reducing microorganisms in thesulfate and methane zones of a marine sediment, Black Sea. Environ.Microbiol. 9, 131–142.

Loubinoux, J., Mory, F., Pereira, I.A., Le Faou, A.E., 2000. Bacteremia causedby a strain of Desulfovibrio related to the provisionally namedDesulfovibriofairfieldensis. J. Clin. Microbiol. 38, 931–934.

Loy, A., Lehner, A., Lee, N., Adamczyk, J., Meier, H., Ernst, J., Schleifer, K.-H.,Wagner, M., 2002. Oligonucleotide microarray for 16S rRNA gene-baseddetection of all recognized lineages of sulfate-reducing prokaryotes in theenvironment. Appl. Environ. Microbiol. 68, 5064–5081.

Loy, A., Küsel, K., Lehner, A., Drake, H.L., Wagner, M., 2004. Microarray andfunctional gene analyses of sulfate-reducing prokaryotes in low sulfate,acidic fens reveal co-occurrence of recognized genera and novel lineages.Appl. Environ. Microbiol. 70, 6998–7009.

Loy, A., Maixner, F., Wagner, M., Horn, M., 2007. probeBase—an onlineresource for rRNA-targeted oligonucleotide probes: New features 2007.Nucleic Acids Res. 35, D800–D804.

Ludwig, W., Strunk, O., Westram, R., Richter, L., Meier, H., Buchner, A., Lai,T., Steppi, S., Jobb, G., Forster, W., Brettske, I., Gerber, S., Ginhart, A.W.,Gross, O., Grumann, S., Hermann, S., Jost, R., Konig, A., Liss, T.,Lussmann, R., May, M., Nonhoff, B., Reichel, B., Strehlow, R., Stamatakis,A., Stuckmann, N., Vilbig, A., Lenke, M., Ludwig, T., Bode, A., Schleifer,K.H., 2004. ARB: a software environment for sequence data. Nucleic AcidsRes. 32, 1363–1371.

Macalady, J.L., Lyon, E.H., Koffman, B., Albertson, L.K., Meyer, K., Galdenzi,S., Mariani, S., 2006. Dominant microbial populations in limestone-corroding stream biofilms, frasassi cave system, Italy. Appl. Environ.Microbiol. 72, 5596–5609.

Manz, W., Amann, R., Ludwig, W., Wagner, M., Schleifer, K.-H., 1992.Phylogenetic oligodeoxynucleotide probes for the major subclasses of Pro-teobacteria: problems and solutions. Syst. Appl. Microbiol. 15, 593–600.

Orphan, V.J., House, C.H., Hinrichs, K.U., McKeegan, K.D., DeLong, E.F.,2001. Methane-consuming archaea revealed by directly coupled isotopicand phylogenetic analysis. Science 293, 484–487.

Pernthaler, J., Pernthaler, A., Amann, R., 2003. Automated enumeration ofgroups of marine picoplankton after fluorescence in situ hybridization. Appl.Environ. Microbiol. 69, 2631–2637.

Rabus, R., Fukui, M., Wilkes, H., Widdle, F., 1996. Degradative capacities and16S rRNA-targeted whole-cell hybridization of sulfate-reducing bacteria inan anaerobic enrichment culture utilizing alkylbenzenes from crude oil.Appl. Environ. Microbiol. 62, 3605–3613.

528 S. Lücker et al. / Journal of Microbiological Methods 69 (2007) 523–528

Ramsing, N.B., Kühl, M., Jørgensen, B.B., 1993. Distribution of sulfate-reducing bacteria, O2, and H2S in photosynthetic biofilms determined byoligonucleotide probes and microelectrodes. Appl. Environ. Microbiol. 59,3840–3849.

Rappe, M.S., Giovannoni, S.J., 2003. The uncultured microbial majority. Annu.Rev. Microbiol. 57, 369–394.

Scheid, D., Stubner, S., 2001. Structure and diversity of Gram-negative sulfate-reducing bacteria on rice roots. FEMS Microbiol. Ecol. 36, 175–183.

Schramm, A., Amann, R., 1999. Nucleic acid based techniques for analyzing thediversity, structure, and dynamics of microbial communities in wastewatertreatment. In: Rehm, H.-J., Reed, G., Pühler, A., Stadler, P. (Eds.),Environmental Processes—Wastewater and Waste Treatment. Wiley-VCH,Weinheim, pp. 85–108.

Schramm, A., Fuchs, B.M., Nielsen, J.L., Tonolla, M., Stahl, D.A., 2002.Fluorescence in situ hybridization of 16S rRNA gene clones (Clone-FISH)

for probe validation and screening of clone libraries. Environ. Microbiol. 4,713–720.

Stahl, D.A., Loy, A., Wagner, M., in press. Molecular strategies for studies ofnatural populations of sulphate-reducing microorganisms. In: Barton, L.L.,Hamilton, W.A. (Eds.), Sulfate-Reducing Bacteria: Environmental andEngineered Systems. Cambridge University Press.

Tee, W., Dyall-Smith, M., Woods, W., Eisen, D., 1996. Probable new species ofDesulfovibrio isolated from a pyogenic liver abscess. J. Clin. Microbiol. 34,1760–1764.

Wagner, M., Horn, M., Daims, H., 2003. Fluorescence in situ hybridisation forthe identification and characterisation of prokaryotes. Curr. Opin. Microbiol.6, 302–309.

Yilmaz, L.S., Okten, H.E., Noguera, D.R., 2006. Making all parts of the 16SrRNA of Escherichia coli accessible in situ to single DNA oligonucleotides.Appl. Environ. Microbiol. 72, 733–744.