Impaired base excision repair and accumulation of oxidative base lesions in CD4 T cells of HIV-infected patients

doi:10.1182/blood-2004-11-4272Prepublished online February 10, 2005;

and Magnar BjorasPal Aukrust, Luisa Luna, Thor Ueland, Rune F Johansen, Fredrik Muller, Stig S Froland, Erling C Seeberg in CD4+ T cells of HIV-infected patientsImpaired base excision repair and accumulation of oxidative base lesions

(5019 articles)Immunobiology �Articles on similar topics can be found in the following Blood collections

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

digital object identifier (DOIs) and date of initial publication. theindexed by PubMed from initial publication. Citations to Advance online articles must include

final publication). Advance online articles are citable and establish publication priority; they areappeared in the paper journal (edited, typeset versions may be posted when available prior to Advance online articles have been peer reviewed and accepted for publication but have not yet

Copyright 2011 by The American Society of Hematology; all rights reserved.20036.the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

http://bloodjournal.hematologylibrary.org/cgi/collection/immunobiology

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints

http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml

http://bloodjournal.hematologylibrary.org/subscriptions/ToS.dtl

http://bloodjournal.hematologylibrary.org/


1

Regular manuscript, Immunobiology

Impaired base excision repair and accumulation of oxidative base

lesions in CD4+ T cells of HIV-infected patients

Running head: Aukrust et al. Repair of oxidative DNA damage in HIV infection

Pål Aukrust1,2, Luisa Luna4,5, Thor Ueland2,3, Rune F. Johansen4,5, Fredrik Müller2, Stig

S. Frøland1,2, Erling C. Seeberg4,5, Magnar Bjørås4,5

1Section of Clinical Immunology and Infectious Diseases, 2Research Institute for Internal

Medicine, 3Section of Endocrinology, Medical Department, 4Department of Molecular

Biology, Institute of Medical Microbiology, 5Centre for Molecular Biology and

Neuroscience, University of Oslo, The National Hospital, N-0027, Oslo, Norway.

Total word counts: 3700

Abstract word counts: 199

Corresponding authors:

Pål Aukrust, Section of Clinical Immunology and Infectious Diseases, Medical

Department, Rikshospitalet, N-0027 Oslo, Norway.

Phone: 47-23070000, Fax: 47-23073630, e-mail: [email protected].

Magnar Bjørås, Department of Molecular Biology, Institute of Medical Microbiology,

University of Oslo, The National Hospital, N-0027, Oslo, Norway.

Phone: 47-23074060, Fax: 47-23074061, e-mail: [email protected]

This work was supported by the Norwegian Cancer Society and the Research Council of

Norway, Anders Jahre´s Foundation, Medinnova Foundation and Odd Kåre Rabben´s

Memorial Fund for AIDS Research.

Blood First Edition Paper, prepublished online February 10, 2005; DOI 10.1182/blood-2004-11-4272

Copyright © 2005 American Society of Hematology


mailto:[email protected]



2

Abstract

Several studies have reported enhanced oxidative stress in HIV infection. An important

pathophysiological consequence of increased oxidative stress is endogenous DNA

damage, and the base excision repair pathway is the most important mechanism to

withstand such deleterious effects. To investigate the role of base excision repair in HIV

infection we examined 8-oxoguanine (8-oxoG) levels, as a marker of oxidative DNA

damage, and DNA glycosylase activities in CD4+ and CD8+ T cells from HIV-infected

patients and controls. These results showed that HIV-infected patients, particularly those

with advanced disease, were characterized by increased accumulation of 8oxoG in CD4+

T cells accompanied by a marked decline in DNA glycosylase activity for repair of

oxidative base lesions in these cells. In contrast, CD8+ T cells from HIV-infected

patients, with 8-oxoG levels similar to those in healthy controls, showed enhanced

capacity to repair oxidative DNA damage. Finally, highly active antiretroviral therapy

induced increased glycosylase activity in CD4+ T cells accompanied by normalization of

8-oxoG levels. This imbalance between accumulation of oxidative DNA damage and the

capacity to repair such lesions in CD4+ T cells may represent a previous unrecognized

mechanism involved in the numerical and functional impairment of CD4+ T cells in HIV

infection.




3

Introduction

Highly reactive oxygen species (ROS) are formed as by-products during a variety of

biochemical reactions and this steady-state formation of pro-oxidants are normally

balanced by a similar rate of consumption by antioxidants. Oxidative stress results from

imbalance between formation and neutralization of pro-oxidants resulting in

accumulation of pro-oxidants with potential harmful consequences.1 Enhanced oxidative

stress has been implicated in the pathogenesis of several clinical disorders such as heart

and brain ischemic diseases, neurodegenerative disorders, various autoimmune diseases

and seems to be involved in carcinogenesis and aging.1-5 Several lines of evidence

suggest that enhanced oxidative stress also plays a pathogenic role in human

immunodeficiency virus (HIV) infection. Thus, a number of reports have found impaired

antioxidant defence, particularly manifested by disturbed glutathione metabolism in HIV-

infected patients.5-9 Moreover, enhanced oxidative stress may be involved in the

pathogenesis of impaired T cell responsiveness and enhanced T cell apoptosis during

HIV infection, and may also play a role in the development of certain HIV-related

clinical disorders such as malignancies and HIV-related encephalopathy.5,10,11

An important pathophysiological consequence of increased intracellular oxidative

stress is endogenous DNA damage.12 Several types of oxidative DNA lesions have been

reported, including strand breaks, baseless sugars (AP-sites) and oxidized base residues,

with 7,8-dihydro-8-oxoguanine (8-oxoG) and 5-hydroxycytosine (5-ohC) representing

the most frequent mutagenic base lesions.13-15 DNA repair mechanisms have evolved

specifically to counteract the biological effects of DNA damage. Of particular importance

for removal of oxidative damage is the base excision repair pathway, which is initiated by




4

the action of DNA glycosylases removing different types of modified bases by cleavage

of the N-glycosylic bond.16,17 Five DNA glycosylases for removal of oxidative base

residues, hNth1, hOgg1, Neil1, Neil2 and Neil3 (hFpg2) have been cloned and

characterized in human cells.18-28 hNth1, Neil1 and Neil2 remove oxidized pyrimidines

such as 5-ohC, whereas hOgg1 is removing oxidized purines such as 8-oxoG. However,

Neil1 appear to be a backup function for hOgg1 for removal of 8-oxoG. All five enzymes

have been shown to remove cytotoxic imidazole-ring fragmented formamidopyrimidine

(faPy) residues which represent blocks to replication.

Based on the potential pathogenic role of enhanced oxidative stress in HIV

infection we examined 8-oxoG levels, as a marker of oxidative DNA damage, in relation

to DNA glycosylase activity for repair of oxidative damage in T cell subsets from HIV-

infected patients and healthy controls. We found increased level of 8-oxoG in DNA in

CD4+ T cells from HIV-infected patients, along with a reduced capacity for repair of

oxidized base residues in these cells.

Materials and methods

Patients and controls

Fifteen HIV-infected patients were consecutively recruited for the study (Table 1). The

patients were clinically classified according to the revised criteria from Center for

Disease Control and Prevention (CDC) in AIDS patients (CDC group C, n=7) and non-

AIDS patients (CDC group A+B, n=8). Patients with ongoing acute or exacerbation of

chronic infection at the time of blood collection were not included. Eleven of the patients

received antiretroviral therapy with nucleoside analog(s), but except for one sub-study




5

(see below), none received highly active antiretroviral therapy (HAART). None had

initiated or changed therapy during the last 5 months. None of the patients had abnormal

liver or kidney function, were abusing drugs or alcohol or were taking any regular

medication except for nucleoside analog(s) as described above. Controls in the study

were 13 healthy HIV-seronegative sex- and age-matched healthy blood donors (Table 1).

Approval was obtained from the National Hospital in Oslo institutional review board for

these studies. Informed consent was provided according to the Declaration of Helsinki.

Isolation of cells

Peripheral blood mononuclear cells (PBMC) were obtained from heparinized blood by

Isopaque-Ficoll (Lymphoprep; Nycomed, Oslo, Norway) gradient centrifugation within

45 minutes, and further positive selection of CD4+ and CD8+ T cells was done at 4oC as

previously described.7 Briefly, PBMC were mixed with Dynabeads (Dynal, Oslo,

Norway) coated with appropriate antibodies (anti-CD4, Dynabeads M-450 CD4; anti-

CD8, Dynabeads M-450 CD8) in a cell-to-bead ratio of 1:10. The mixture was incubated

in a test tube on a rocking platform for 30 minutes and rosetting cells isolated by

application of a magnet. After five consecutive washes in cold phosphate-buffered

saline/bovine serum albumin (Calbiochem, La Jolla, CA), the positively selected cells

(cell pellet) were immediately stored in liquid nitrogen. Storage of cells with

immunomagnetic beads did not influence glycosylase or 8-oxoG levels. The purity of cell

populations was >98% as assessed by staining of cytospin preparations of positively

selected cells by the alkaline phosphatase-antialkaline phosphatase procedure.7




6

Preparation of nuclear DNA and analyses of 8-oxoG by high-performance liquid

chromatography-electrochemical detection (HPLC-ECD)

Extraction of DNA and hydrolyses to nucleosides by nucleaseP1 and alkaline phosphatase

were performed as described elsewhere.29 To reduce oxidation during the preparation of

DNA, TEMPO (2,2,6,6-tetramethylpiperidine-N-oxyl) was added to all solutions at 100

µM immediately before use. 8-Hydroxy-2'-deoxyguanosine and 2'-deoxyguanosine were

separated by HPLC and analyzed by ECD (+300 mV) and UV light (290 nm). Results

were expressed as the ratio of 8-oxoG/106 bp in each DNA sample.

Preparation of cellular extracts

Cell pellets were resuspended in 25 µl 84 % sucrose/10 mM ethyleneglycol tetraacetic

acid. After 10 minutes incubation on ice the cells were frozen and thawed three times

with subsequent centrifugation (15000g for 15 minutes) to remove cell debris.

Supernatant was stored at –20°C.

Assays for DNA glycosylase activity

All enzyme activities were assayed in a reaction buffer containing 70 mM

morpholinopropanesulfonic acid (MOPS), pH 7.5, 1 mM ethylenediamide tetra-acetic

acid (EDTA), 5% glycerol and 1 mM dithiothreitol, and the mixtures were incubated at

37oC for 30 minutes. For analyzing faPy removal N-[3H]methyl-N´-nitrosourea

(18Ci/mmol) was used to prepare poly(dG-dC) DNA containing faPy residues (5000

dpm/µg DNA).30 FaPy DNA glycosylase activity was measured in a total volume of 50

µl containing 0.4 µg faPy-DNA substrate. For analyzing DNA glycosylase activity for

repair of alkylating damage the cell extracts were mixed with 0.3 µg of [methyl 3H]

methylated DNA (containing 5-10 pmol of methylated bases) in a total volume of 50 µl.




7

Assays for cleavage of 8-oxoguanine and 5-hydroxycytosine containing DNA.

Duplex DNA containing a single 8-oxoG residue at position 10 (5’-ATCACCGGC[8-

oxoG]CCACACGAGCTG) opposite C and duplex DNA containing a single 5-OHC

residue at position 22 (AATTGCGATCTAGCTCGCCAG [5OHC]AGCGACCTTA

TCTGATGA) were purified by 20% non denaturing polyacrylamide gel electrophoresis.

For all substrates, the 5’ends were 32P-labeled by T4 polynucleotide kinase and [γ-

32P]adenosine triphosphate (3000Ci/mmol; Amersham, Aylesbury, UK). The reaction

mixtures contained 50 fmol substrates and protein extracts as indicated in a total volume

of 10 µl. After incubation at 37°C for 30 minutes, the reaction products were separated on

20 % polyacrylamide/7 M urea denaturing gels (Hydrolink, FMC, AT Biochem, Malvern,

PA) with 1xTris-Borate-EDTA and radiolabeled fragments finally visualized by

PhosphorImaging [Molecular Dynamics (model 445 SI), Sunnyvale, CA].

Miscellaneous

HIV RNA levels were measured in EDTA plasma by quantitative reverse PCR (Amplicor

HIV Monitor, Roche Diagnostic Systems, Brancburg, NY; detection limit 50 copies/mL).

Plasma levels of tumor necrosis factor (TNF)α were measured by enzyme immunoassay

(BioSource, Camarillo, CA).

Statistical analysis

When comparing three groups of individuals, the Kruskal-Wallis test was used a priori.

If a significant difference was found, Mann-Whitney U test (two-tailed) was used to

determine the differences between each pair of groups. For comparisons within the same

individuals, the Wilcoxon matched pairs test was used. Coefficients of correlation were




8

calculated by the Spearman´s rank test. If not otherwise quoted, data are given as medians

and 25th-75th percentiles. P-values (two-sided) are considered significant when <0.05.

Results

Accumulation of 8-oxoG in the DNA of CD4+ and CD8+ T cells from HIV-infected

patients

We have previously reported markedly disturbed intracellular redox balance in CD4+ T

cells from HIV-infected patients.7 To examine if such disturbances were associated with

enhanced oxidative DNA damage, we analysed 8-oxoG levels in genomic DNA of CD4+

and CD8+ T cells from 5 AIDS patients, 4 non-AIDS HIV-infected patients and 7 healthy

controls. As shown in Figure 1, CD4+ T cells from HIV-infected patients were

characterized by significantly raised 8-oxoG contents, with particularly high levels in

AIDS patients (~6-fold increase). In contrast, 8-oxoG levels were similar in CD8+ T cells

from HIV-infected patients and controls (Figure 1). In fact, rather than increased, the 8-

oxoG level in the CD8 subset tended to decrease in the non-AIDS patients compared with

healthy controls, although the difference did not reach statistical significance (p=0.07,

Figure 1). In HIV-infected patients, 8-oxoG levels in CD4+ T cells were inversely

correlated with numbers of HIV RNA copies (r=-0.77, p<0.03) and positively correlated

with TNFα (r= 0.70, p<0.05) levels in plasma.

DNA glycosylase activity in CD4+ and CD8+ T cells during HIV infection

We next analysed if accumulation of 8-oxoG in CD4+ T cells was accompanied by any

alterations in DNA glycosylase activity for repair of oxidative damage. FaPy is a

common substrate for DNA glycosylases involved in repair of oxidative DNA lesions and




9

removal of faPy was measured in CD4+ and CD8+ T cells from 15 HIV-infected patients

and 13 healthy controls. Notably, while a slight but significant decrease in removal of

faPy was found in CD4+ T cells from non-AIDS patients, CD4+ T cells in AIDS patients

had profoundly decreased faPy activity reaching only ~20% of activity in healthy

controls (Figure 2). In contrast, faPy excision in CD8+ T cells were either markedly

raised (~3.5-fold increase, non-AIDS patients) or similar (AIDS patients) to levels in

healthy controls (Figure 2). In HIV-infected patients, the decrease in faPy activity in

CD4+ T cells was inversely correlated with numbers of HIV RNA copies (r=-0.53,

p<0.05) and positively correlated with TNFα (r=0.61, p<0.01) levels in plasma. In

contrast to faPy excision, DNA glycosylase activity for repair of alkylating damage

showed no significant differences in these T cell subsets between HIV-infected patients

and controls (Figure 2), suggesting a specific down-regulation of DNA glycosylases

repairing oxidative DNA damage in HIV-infected patients.

Levels of DNA glycosylase activity for repair of 8-oxoG and 5-ohC in T cell subsets

during HIV infection

While the assay for measuring DNA glycosylase activity for repair of alkylating damage

is specific for the human Aag DNA glycosylase, the faPy assay may detect activity of

five different DNA glycosylases for repair of oxidative damage; hOgg1, hNth1, Neil1,

Neil2 and Neil3. We therefore examined removal of 8-oxoG and 5-ohC to further

distinguish between these DNA glycosylases. Notably, the removal of 8-oxoG in CD4+ T

cells of AIDS patients showed only ~15% of the activity in CD4+ T cells from healthy

controls suggesting a decrease in the major 8-oxoG DNA glycosylase activity (i.e.,

hOgg1)(Figure 3). Excision of 5-ohC in CD4+ T cells was also decreased in AIDS




10

patients (~70% of activity in healthy controls) suggesting a moderate reduction also in

one or more of the three glycosylases reported to remove 5-ohC (hNth1, Neil1 and

Neil2). Furthermore and in accordance with our findings for faPy activity, CD8+ T cells

from non-AIDS patients showed a 3-fold increase in 8-oxoG removal and a 4-fold

increase in 5ohC removal comparing CD8+ T cells from healthy controls, indicating an

enhancement of hOgg1 activity and an up-regulation of one or several of the DNA

glycosylases excising oxidized pyrimidines (hNth1, Neil1 and Neil2). In contrast,

although CD8+ T cells from AIDS patients showed no changes in faPy removal, we

found a 3-fold increase in 5-ohC excision comparing healthy controls (Figure 3). This

could indicate a DNA glycosylase activity with affinity for 5-ohC but not faPy. The 8-

oxoG activity in CD8+ T cells from AIDS patients was not altered (Figure 3).

Except for 11 patients who were receiving nucleoside analog(s) (see Methods),

none of the patients were taken any regular medications. Although these 11 patients did

not differ from the other patients with regard to the measured parameters (data not

shown), we can not exclude some influence from the use of these medications.

DNA glycosylase activity during HAART

HAART strongly reduces levels of plasma HIV RNA with concomitant increases in T

cell counts and beneficial effects on clinical symptoms and mortality.31 To further

examine the relationship between HIV infection, oxidative DNA damage and DNA

glycosylases, we examined DNA glycosylase activity for removal of faPy and alkylating

DNA damage in CD4+ and CD8+ T cells from 7 HIV-infected patients before and 6

months after initiating HAART. All patients received an HIV protease inhibitor

(indinavir, 800 mg thrice a day) in combination with two nucleoside analogs [zidovudine




11

(250 mg) and lamivudine (150 mg), twice a day]. In response to HAART there was a

marked fall in HIV RNA copies in plasma [maximal decrease: 3.02(1.92-3.98)log10,

p<0.05] and a marked increase in CD4+ [maximal increase: 150(50-215)x106/L, p<0.05]

and CD8+ T cell [maximal increase: 260(30-415)x106/L, p<0.05] counts in peripheral

blood. Concomitantly, there was a significant rise in faPy activity in CD4+ T cells (Figure

4), inversely correlated with the decrease in plasma viral load (r=0.68, p<0.05). However,

there was no normalization compared with faPy activity in healthy controls (Figure 4).

Moreover, even if faPy activity in CD8+ T cells was raised before initiating therapy,

HAART induced a further increase in activity with particularly enhancing effect in those

with the lowest faPy levels at baseline (Figure 4). In comparison, DNA glycosylase

activity for repair of alkylating damage showed no changes during HAART in either

CD4+ or CD8+ T cells (data not shown). Finally, we analysed 8-oxoG levels in T cell

subsets of 4 AIDS patients who had received HAART for 1 year. Notably, while CD4+ T

cells in AIDS patients not receiving HAART had markedly enhanced levels of 8-oxoG in

genomic DNA (Figure 1), CD4+ T cells from AIDS patients on successful HAART had 8-

oxoG levels within the range of healthy controls [34.0(29.5-36.0) 8-oxoG per 106 dG

versus 40.5(27.8-48.0) 8-oxoG per 106 dG, patients and controls, respectively].

Discussion

Several studies have reported enhanced oxidative stress in HIV infection possibly playing

a pathogenic role in this disorder.10 In the present study we show that HIV-infected

patients, and particularly those with advanced disease, are characterized by enhanced

oxidative DNA damage in CD4+ T cells as assessed by increased 8-oxoG accumulation.




12

Notably, this increase in oxidative DNA damage was accompanied by a marked decline

in DNA glycosylase activity for repair of oxidative base lesion in CD4+ T cells. In

contrast, CD8+ T cells of HIV-infected patients, with 8-oxoG levels similar or decreased

compared with those in healthy controls, showed enhanced capacity to repair oxidative

damage. Finally, during HAART there was a rise in glycosylase activity in CD4+ T cells

accompanied by a near normalisation of 8-oxoG levels in these cells. Although we can

not totally exclude some influence from any undiagnosed and clinical asymptomatic co-

infection on our results, our data suggest that impaired base excision repair of oxidative

damage, with subsequent accumulation of oxidative DNA base lesions in CD4+ T cells,

may play a pathogenic role in HIV infection.

The mechanisms leading to enhanced oxidative stress in CD4+ T cells during HIV

infection are complex. Increased activity of inflammatory cytokines (e.g. TNFα) and

altered intracellular glutathione redox status, characterizing HIV-infected patients,9 may

promote oxidative DNA damage in these cells. However, our findings of an inverse

correlation between viral load and glycosylase activity and near normalization of repair

capacity during HAART, suggest that direct HIV-related mechanisms may be involved in

the dysregulation of oxidative DNA damage/repair activity during HIV infection. Thus,

TNFα and ROS can increase transcription of viral proteins by activating the nuclear

factor κB.32 The HIV proteins Tat and gp120 may again directly enhance oxidative stress

in T cells possibly involving TNF dependent mechanisms,33 representing a pathogenic

loop promoting inflammation, enhanced oxidative stress and HIV replication. Moreover,

the HIV protein vpr, which may arrest T cells and induce subsequent apoptosis, has been

found to incorporate catalytically active uracil DNA glycosylase into HIV viron particle




13

further supporting a link between HIV replication and DNA repair mechanisms.34 In fact,

this glycosylase, which initiates base excision repair of deaminated cytosine, is important

for modulation of the virus mutation rate.35 It is therefore tempting to hypothesize that the

dysbalance between glycosylase activity and oxidative DNA damage in CD4+ T cells

during HIV infection could reflect potent interactions between viral proteins, enhanced

oxidative stress and increased activity of inflammatory cytokines overwhelming DNA

repair mechanisms.

The regulation of the various DNA glycosylases involved in repair of oxidative

damage in man has not been fully clarified. However, hNth1 transcription was shown to

increase during early and mid S-phase of cell cycle36 suggesting that increased 5ohC

DNA glycosylase activity in CD8+ T cells during HIV infection may correlate with the

enhanced spontaneous T cell proliferation observed in these patients.37 In CD4+ T cells

such a stimulus may be counteracted and overshadowed by mechanisms as discussed

above. In contrast to hNth1, the hOgg1 gene lacks TATA or CAAT boxes suggesting that

Ogg1 is a housekeeping gene with stable expression during cell cycle.38 However, the

results are somewhat conflicting, possibly reflecting different regulation in different cell

types. Thus, raised 8-oxoG levels and ischemia have been reported to enhance Ogg1

activity in human colorectal carcinoma cells and in mouse brain, respectively.39,40

Moreover, while acute ischemia and oxidative stress may promote up-regulation of DNA

glycosylase activity, persistently enhanced oxidative stress and inflammation as in HIV

infection, may potentially down-regulate or “consume” the activity of these enzymes.

Nevertheless, the mechanisms for regulation of DNA glycosylases for repair of oxidative

base lesions in T cell subsets during HIV infection are at present unclear.




14

In the present study we show that DNA glycosylases for repair of oxidative base

lesions are differently regulated in CD4+ and CD8+ T cells during HIV infection. In fact,

rather than decreased activity, CD8+ T cells in non-AIDS patients were characterized by

enhanced faPy, 5-ohC and 8-oxoG DNA glycosylase activity, accompanied by a non-

significant decrease in 8-oxoG level in these cells. This phenomenon could possibly

reflect that while HIV infection is characterized by a functional and numerical decline in

CD4+ T cells, the CD8+ T cells is characterized by increased numbers and enhanced

activity at least in non-AIDS patients.41

Our findings suggest that CD4+ T cells in HIV-infected patients may lack the

ability to sufficiently repair DNA damage induced by oxidative stress that may have

several consequences. Mutant forms of hOgg1 have been found in lung and kidney

tumors.42 A very recent report suggests that reduced Neil1 activity arising from mutations

and reduced expression may be involved in pathogenesis of a subset of gastric cancers.43

It is possible that the imbalance between oxidative DNA damage and repair activity in

CD4+ T cells from AIDS patients might contribute to the increased frequency of

malignancies in these patients. Moreover, while long-time exposure to moderately

increased oxidative DNA damage may pre-dispose to malignancies, markedly enhanced

oxidative DNA damage combined with decreased repair activity as found in CD4+ T cells

from HIV-infected patients, may lead to functional impairment of these cells by slowing

cell cycle progression upon activation and by enhancing apoptosis, possibly contributing

to the pathogenesis of T cell deficiency in these patients. Finally, the HIV genome is

characterized by a high frequency of mutation that at least partly is due to the high rate of

HIV replication and the low fidelity of the reverse transcriptase gene. These mutations




15

which involve a high frequency of base misincorporations, may lead to a several-fold

decrease in sensitivity to one or more antiretroviral drugs and is at present an increasing

challenge in HAART.44 Several oxidative base lesions are strongly premutagenic if they

remain in DNA during replication. 5-ohC and 8-oxoG are stable oxidation products with

strong miscoding properties, which produce G→T transversions45 and C→T

transitions/C→A transversions,46 respectively. Therefore, it is possible that accumulation

of mutagenic base lesions as a result of enhanced oxidative stress and impaired capacity

for repair of oxidative DNA damage in CD4+ T cells in HIV-infected patients, also may

pre-dispose for elevated mutation frequency in the HIV genome of these cells.

. In conclusion, the present study further supports a role for oxidative stress in the

pathogenesis of HIV infection by demonstrating a marked imbalance between

accumulation of oxidative DNA damage and the capacity to repair such lesions in CD4+

T cells (favouring enhanced DNA damage). These findings may represent a previous

unrecognised mechanism involved in the numerical and functional impairment of CD4+ T

cells during HIV infection.




16

References

1. Halliwell B. Antioxidant defence mechanisms: from the beginning to the end (of the

beginning). Free Radic Res. 1999;31:261-272.

2. Ames BN, Gold LS, Willet WC. The causes and prevention of cancer. Proc Nat Acad

Sci USA. 1195;92:5258-5265.

3. Hensley K, Robinson KA, Gabbita SP, Salsman S, Floyd RA. Reactive oxygen

species, cell signaling, and cell injury. Free Radic Biol Med. 2000;28:1456-1462.

4. Cooke MS, Evans MD, Dizdaroglu M, Lunec J. Oxidative DNA

damage:mechanisms, mutation, and disease. FASEB J. 2003;17:1195-1214.

5. Olinski R, Gackowski D, Foksinski M, Rozalski R, Roszkowski K, Jaruga P.

Oxidative DNA damage: assessment of the role in carcinogenesis, atherosclerosis,

and acquired immunodeficiency syndrome. Free Radic Biol Med. 2002;33:192-200.

6. Dröge W, Eck HP, Mihm S. Oxidant-antioxidant status in human immunodeficiency

virus infection. Methods Enzymol. 1994;233:594-601.

7. Aukrust P, Svardal AM, Müller F, et al. Increased levels of oxidized glutathione in

CD4+ lymphocytes associated with disturbed intracellular redox balance in human

immunodeficiency virus type 1 infection. Blood. 1995;86:258-267.

8. Roederer M, Staal FJ, Osada H, Herzenberg LA, Herzenberg LA. CD4 and CD8 T

cells with high intracellular glutathione levels are selectively lost as the HIV infection

progresses. Int Immunol. 1991;3:933-937.

9. Aukrust P, Muller F, Svardal AM, Ueland T, Berge RK, Froland SS. Disturbed

glutathione metabolism and decreased antioxidant levels in human immunodeficiency




17

virus-infected patients during highly active antiretroviral therapy--potential

immunomodulatory effects of antioxidants. J Infect Dis. 2003;188:232-238.

10. Aukrust P, Müller F. Glutathione redox disturbances in HIV infection - immunologic

and therapeutical consequences. Nutrition. 1999;15:165-167.

11. Buttke TM, Sandstrom PA. Oxidative stressas a mediator of apoptosis. Immunol

Today. 1994;15:7-10.

12. Demple B, Harrison L. Repair of oxidative damage to DNA: Enzymology and

biology. Ann Rev Biochem. 1994;63:915-948.

13. Feig DI, Sowers LC, Loeb LA. Reverse chemical mutagenesis: Identification of the

mutagenic lesions resulting from reactive oxygen species-mediated damage to DNA.

Proc Natl Acad Sci USA. 1994;91:6609-6613.

14. Kasai H, Crain PF, Kuchino Y, Nishimura S, Ootsuyama A, Tanooka H. Formation

of 8-hydroxyguanine moiety in cellular DNA by agents producing oxygen radicals

and evidence for its repair. Carcinogenesis. 1986;7:1849-1851.

15. Wagner R.J, Hu C, Ames B. Endogenous oxidative damage of deoxycytidine in

DNA. Proc Natl Acad Sci USA. 1992;89:3380-3384.

16. Seeberg E, Eide L, Bjørås M. The base excision repair pathway. Trends Biochem Sci.

1995;20:391-397.

17. Lindahl T, Wood RD. Quality control by DNA repair. Science. 1999;286:1897-1905.

18. Aspinwall R, Rothwell DG, Roldan-Arjona T, et al. Cloning and characterization of a

functional human homolog of Escherichia coli endonuclease III. Proc Natl Acad Sci

USA. 1997;94:109-114.




18

19. Aburatani H, Hippo Y, Ishida T, et al. Cloning and characterization of mammalian 8-

hydroxyguanine-specific DNA glycosylase/apurinic, apyrimidinic lyase, a functional

mutM homologue. Cancer Res. 1997;57:2151-2156.

20. Arai K, Morishita K, Shinmura K, et al. Cloning of a human homolog of the yeast

OGG1 gene that is involved in the repair of oxidative DNA damage. Oncogene.

1997;14:2857-61.

21. Bjørås M, Luna L, Hoff E, Haug T, Rognes T, Seeberg E. Opposite base-dependent

reactions of a human base excision repair enzyme on DNA containing 7,8-dihydro-8-

oxoguanine and abasic sites. EMBO J. 1997;16:6314-6322.

22. Bandaru V, Sunkara S, Wallace SS, Bond JP. A novel human DNA glycosylase that

removes oxidative DNA damage and is homologous to Escherichia coli endonuclease

VIII. DNA Repair. 2002;17:;517-529.

23. Kuo FC, Sklar J. Augmented expression of a human gene for 8-oxoguanine DNA

glycosylase (MutM) in B lymphocytes of the dark zone in lymph node germinal

centers. J Exp Med. 1997;186:1547-1556.

24. Lu R, Nash HM, Verdine GL. A mammalian DNA repair enzyme that excises

oxidatively damaged guanines maps to a locus frequently lost in lung cancer. Curr

Biol. 1997;7:397-407.

25. Radicella JP, Dherin C, Desmaze C, Fox MS, Boiteux S. Cloning and

characterization of hOGG1, a human homolog of the OGG1 gene of Saccharomyces

cerevisiae. Proc Natl Acad Sci USA. 1997;94:8010-8015.




19

26. Hazra TK, Izumi T, Boldogh I, et al. Identification and characterization of a human

DNA glycosylase for repair of modified bases in oxidatively damaged DNA. Proc

Natl Acad Sci USA. 2002;99:3523-3528.

27. Hazra TK, Kow YW, et al. Identification and characterization of a novel human DNA

glycosylase for repair of cytosine-derived lesions. J Biol Chem. 2002;277:30417-

3020.

28. Morland I, Rolseth V, Luna L, Rognes T, Bjoras M, Seeberg E. Human DNA

glycosylases of the bacterial Fpg/MutM superfamily: an alternative pathway for the

repair of 8-oxoguanine and other oxidation products in DNA. Nucleic Acids Res.

2002;30:4926-4936.

29. Hofer T, Moller L. Reduction of oxidation during the preparation of DNA and

analysis of 8-hydroxy-2'-deoxyguanosine. Chem Res Toxicol. 1998;11:882-887.

30. Boiteux S, Belleney J, Roques BP, Laval J. Two rotyameric forms of open ring 7-

methylguanine are present in alkylated polynucleotides. Nucleic Acids Res.

1984;12:5429-3549.

31. Yeni PG, Hammer SM, Hirsch MS, et al. Treatment for adult HIV infection: 2004

recommendations of the International AIDS Society-USA Panel. JAMA.

2004;292:251-265.

32. Greenspan HC, Aruoma OI, Arouma O. Could oxidative stress initiate programmed

cell death in HIV infection? A role for plant derived metabolites having synergistic

antioxidant activity. Chem Biol Interact. 1994;91:187-197.




20

33. Westendorp MO, Shatrov VA, Schulze-Osthoff K, et al. HIV-1 Tat potentiates TNF-

induced NF-κ B activation and cytotoxicity by altering the cellular redox state.

EMBO J. 1995;14:546-554.

34. Willetts KE, Rey F, Agostini I, et al. DNA repair enzyme uracil DNA glycosylase is

specifically incorporated into human immunodeficiency virus type 1 viral particles

through a Vpr-independent mechanism. J Virol. 1999;73:1682-1688.

35. Chen R, Le Rouzic E, Kearney JA, Mansky LM, Benichou S. Vpr-mediated

incorporation of UNG2 into HIV-1 particles is required to modulate the virus

mutation rate and for replication in macrophages. J Biol Chem. 2004;279:28419-

28425.

36. Luna L, Bjoras M, Hoff E, Rognes T, Seeberg E. Cell-cycle regulation, intracellular

sorting and induced overexpression of the human NTH1 DNA glycosylase involved

in removal of formamidopyrimidine residues from DNA. Mutat Res. 2000;460:95-

104.

37. Badley AD, Pilon AA, Landay A, Lynch DH. Mechanisms of HIV-associated

lymphocyte apoptosis. Blood. 2000;96:2951-2964.

38. Dhenaut A, Boiteux S, Radicella JP. Characterization of the hOGG1 promoter and its

expression during the cell cycle. Mutat Res. 2000;461:109-118.

39. Lin LH, Cao S, Yu L, Cui J, Hamilton WJ, Liu PK. Up-regulation of base excision

repair activity for 8-hydroxy-2'-deoxyguanosine in the mouse brain after forebrain

ischemia-reperfusion. J Neurochem. 2000;74:1098-1105.




21

40. Kim JI, Park YJ, Kim KH, et al. hOGG1 Ser326Cys polymorphism modifies the

significance of the environmental risk factor for colon cancer. World J Gastroenterol.

2003;5:956-960.

41. Levy JA. Pathogenesis of human immunodeficiency virus infection. Microbiol Rev.

1993;57:183-289.

42. Chevillard S, Radicella JP, Levalois C, et al. Mutations in OGG1, a gene involved in

the repair of oxidative DNA damage, are found in human lung and kidney tumours.

Oncogene. 1998;16:3083-3086.

43. Shinmura K, Tao H, Goto M, et al. Inactivating mutations of the human base excision

repair gene NEIL1 in gastric cancer. Carcinogenesis. 2004, in press.

44. Deeks SG Treatment of antiretroviral-drug-resistant HIV-1 infection. Lancet.

2003;362:2002-2011.

45. Cheng KC, Cahill DS, Kasai H, Nishimura S, Loeb LA. 8-Hydroxyguanine, an

abundant form of oxidative DNA damage, causes G →T and A→C substitutions. J

Biol Chem. 1992;267:166-172.

46. Hatahet Z, Purmal AA, Wallace SS. A novel method for site specific introduction of

single model oxidative DNA lesions into oligodeoxyribonucleotides. Nucleic Acids

Res. 1993;21:1563-1568.




22

Figure legends

Figure 1. Accumulation of 8-oxoG in (A) CD4+ and (B) CD8+ T cells from HIV-infected

patients. Nuclear DNA was isolated from T cell subsets of AIDS patients (n=5), non-

AIDS HIV-infected patients (n=4) and healthy controls (n=7). Levels of 8-oxoG were

quantified by HPLC-ECD after enzymatic DNA hydrolysis. * p<0.05 versus healthy

controls; # p<0.05 versus non-AIDS patients. Data are given as medians and 25th-75th

percentiles.

Figure 2. FaPy DNA glycosylase activity (A and B) and alkylbase DNA glycosylase

activity (C and D) in extracts (ng) of CD4+ and CD8+ T cells from HIV-infected patients

and controls. Extracts (ng) isolated from AIDS patients (n=7), non-AIDS HIV-infected

patients (n=8) and healthy controls (n=13) were incubated with 0,4 µg 3H-labelled faPy-

poly(dG-dC) DNA or alkylated calf thymus DNA. Horizontal lines represent median

values.

Figure 3. 5-ohC DNA glycosylase activity (A) and 8-oxoG DNA glycosylase activity (B)

in CD4+ and CD8+ T cells from HIV-infected patients. Extracts (ng), isolated from AIDS-

patients (n=7), non-AIDS HIV-infected patients (n=8) and healthy controls (n=13), were

incubated with 50 fmol duplex oligo containing a single 8-oxoG or 5-ohC residue. The

cleavage products were analysed by 20% denaturing PAGE and PhosphoImager

scanning. * p<0.05 and ** p<0.01 versus healthy controls. # p<0.05 versus AIDS

patients. Data are given as medians and 25th-75th percentiles.

Figure 4. Fapy DNA glycosylase activity in CD4+ (A) and CD8+ (B) T cells from HIV-

infected patients during HAART. Extracts (ng), isolated from 7 HIV-infected patients




23

before and after 6 months of HAART, were incubated with 0,4 µg 3H-labelled faPy-

poly(dG-dC) DNA. The shaded area indicates ranges in 13 healthy controls.




24

Table 1. Characteristics of the study group.

Non-AIDS HIV-infected patients

(n=8)

AIDS patients(n=7)

Controls(n=13)

Age (years), median and

ranges

38(32-52) 37(34-56) 37(29-61)

Males/females 6/2 5/2 9/4

CD4+ T cells(106/l)

280(95-430)

45(10-110)

760(540-980)

CD8+ T cells(106/l)

710(410-1170)

280(110-430)

400(210-550)

TNFα(pg/ml)

25(12-37)

65(40-98)

8(0-12)

HIV RNA copies/ml

plasma (x103)44.2

(22.9-108.6)510.9

(210.0-1200.0) -Data are given as medians and 25th-75th percentiles if not otherwise stated.

T cell subset counts were analysed in peripheral blood and TNFα levels in plasma.




25

Figure 1.

CD4+

Controls non-AIDS AIDS0

50

100

150

200*#A

*

8-ox

oG p

er 1

06 d

G

CD8+


25

50

75B

8-ox

oG p

er 1

06 d

G




26

Figure 2.

CD4+


1

2

3A

P<0.001

P<0.001

P<0.001

Rea

leas

ed f

aPy

base

s (f

mol

) CD8+

Controls non-AIDS AIDS0.0

2.5

5.0

7.5

10.0 B P<0.001

P<0.002

Rea

leas

ed f

aPy

base

s (f

mol

)

CD4+


0.5

1.0

1.5 C

Rel

ease

d al

kyla

ted

base

s(f

mol

)

CD8+


0.5

1.0

1.5 D

Rel

ease

d al

kyla

ted

base

s(f

mol

)




27

Figure 3.

5-ohC

CD4 CD80

5

10

15

20 Controlsnon-AIDSAIDS

*

**#

**

A

CD4+ T cells CD8 + T cells

Rel

ease

d ba

ses

(fm

ol)

8-oxoG

CD4 CD80.0

0.1

0.2

0.3

0.4

0.5 B

*

**

#

CD4+ T cells CD8 + T cells

Rel

ease

d ba

ses

(fm

ol)




28

Figure 4.

CD4+

0 6 months0.0

0.5

1.0

1.5

2.0A

P<0.02

Rea

leas

ed f

aPy

base

s (f

mol

)

CD8+

0 6 months0.0

2.5

5.0

7.5

10.0B P<0.02

Rea

leas

ed f

aPy

base

s (f

mol

)




Impaired base excision repair and accumulation of oxidative base lesions in CD4 T cells of HIV-infected patients

Documents