Immunotherapy Antigens: Potential for Vaccine and Dendritic Cells ...

of April 12, 2018.This information is current as

ImmunotherapyAntigens: Potential for Vaccine andDendritic Cells Expressing Hepatitis C Virus Antigens NS3 or Core by AutologousResponses against Hepatitis C Virus-Derived Induction of Primary Human T Cell

Babita AgrawalWen Li, Deepa K. Krishnadas, Jie Li, D. Lorne J. Tyrrell and

http://www.jimmunol.org/content/176/10/6065doi: 10.4049/jimmunol.176.10.6065

2006; 176:6065-6075; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/176/10/6065.full#ref-list-1

, 15 of which you can access for free at: cites 39 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2006 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Induction of Primary Human T Cell Responses againstHepatitis C Virus-Derived Antigens NS3 or Core byAutologous Dendritic Cells Expressing Hepatitis C VirusAntigens: Potential for Vaccine and Immunotherapy1

Wen Li,* Deepa K. Krishnadas,* Jie Li,* D. Lorne J. Tyrrell,† and Babita Agrawal2*

Hepatitis C virus (HCV)-specific T cell responses have been suggested to play significant role in viral clearance. Dendritic cells(DCs) are professional APCs that play a major role in priming, initiating, and sustaining strong T cell responses against pathogen-derived Ags. DCs also have inherent capabilities of priming naive T cells against given Ags. Recombinant adenoviral vectorscontaining HCV-derived Core and NS3 genes were used to endogenously express HCV Core and NS3 proteins in human DCs.These HCV Ags expressing DCs were used to prime and stimulate autologous T cells obtained from uninfected healthy donors.The DCs expressing HCV Core or NS3 Ags were able to stimulate T cells to produce various cytokines and proliferate in HCVAg-dependent manner. Evidence of both CD4� and CD8� T cell responses against HCV Core and NS3 generated in vitro wereobtained by flow cytometry and Ab blocking experiments. Further, in secondary assays, the T cells primed in vitro exhibited HCVAg-specific proliferative responses against recombinant protein Ags and also against immunodominant permissive peptideepitopes from HCV Ags. In summary, we demonstrate that the dendritic cells expressing HCV Ags are able to prime the Ag-specific T cells from uninfected healthy individuals in vitro. These studies have implications in designing cellular vaccines, T celladoptive transfer therapy or vaccine candidates for HCV infection in both prophylactic and therapeutic settings. The Journal ofImmunology, 2006, 176: 6065–6075.

H epatitis C virus (HCV)3 infection is a serious healthproblem with an estimated 175 million chronically in-fected people worldwide. The majority of infected pa-

tients progress to persistent or chronic infection state. However,15–20% of the infected individuals get acute infections, followedwith clearance. Substantial evidence has accumulated to suggestthe role of adaptive host immune responses in viral clearance inHCV infection.

Currently, the most effective treatment for chronic HCV is the com-bination of peg-IFN-� and ribavirin, but �50–60% of treated peoplehave sustained benefit from antiviral therapy (1). In Western coun-tries, genotype 1, which infects 70–80% of patients, is associatedwith a poor response to IFN-� therapy (2, 3). There are several sideeffects associated with IFN-� treatment, such as psychiatric distur-bances, flu-like symptoms, leucopenia, or thrombocytopenia, and the

most frequent side effect of ribavirin is hemolytic anemia (4). Thesedata indicate the urgent need for alternate treatment strategies.

Patients with HCV infection fail to initiate, maintain, and sus-tain a strong Th1 response that is targeted against several immu-nodominant proteins (5). Although HCV genome is very variablewith hundreds of serotypes and six genotypes, several structural(Core) and nonstructural proteins are highly conserved among ge-notypes and subtypes (6). Interestingly, a vigorous multispecificCD4� T cells response against some of these conserved proteinepitopes have been suggested to be correlative of viral clearance(7). Generally, CD8� cytotoxic T cell responses against viral ortumor Ag-derived peptide epitopes are recognized to play majorrole in antiviral and antitumor immunity (8). However, in the caseof HCV, from studies with humans and chimpanzees, CD4� T cellresponses and IFN-� produced by CD4� T cells have been sug-gested to be important in viral clearance (9–13).

Interestingly, in a study with chimpanzees, it was shown thatanimal that most rapidly cleared circulating HCV displayed themost vigorous and sustained response of IFN-�-producing andproliferating CD4� T cells in the blood (14). Even in the peg-IFN-�- and ribavirin-treated chronic HCV patients, sustained re-sponse has been shown to be associated with significant increase infrequency, strength, and breadth of type-1 CD4� T cells (15).

However, the potential of normal uninfected human donors’ T cellsto respond against HCV Ags has not yet been explored. It is possiblethat, in the majority of HCV-infected patients, development of chro-nicity is, in fact, a reflection of inefficient presentation of HCV Ags,inefficient activation, and maintenance of T cell responses and/or ex-haustion of activated T cells in the early phase of infections (16). Theprotective T cells immunity reported to date is, therefore, a represen-tation of 15–30% of the patients who have cleared the virus.

*Department of Surgery, †Department of Medical Microbiology and Immunology,Faculty of Medicine and Dentistry, University of Alberta, Edmonton, Alberta, Can-ada, T6G 2S2

Received for publication July 29, 2005. Accepted for publication February 9, 2006.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by grants from the Canadian Institutes of Health Research(EOP 58194 to B.A.) and the National Center of Excellence–Canadian Vaccine Net-work (to B.A. and D.L.J.T.). B.A. is a recipient of the Alberta Heritage Foundationfor Medical Research Medical Scholar Award and Establishment Grant.2 Address correspondence and reprint requests to Dr. Babita Agrawal, Department ofSurgery, Faculty of Medicine and Dentistry, University of Alberta, 720 HeritageMedical Research Centre, Edmonton, Alberta, Canada T6G 2S2. E-mail address:[email protected] Abbreviations used in this paper: HCV, hepatitis C virus; DC, dendritic cell;MHC-I, MHC class I; MOI, multiplicity of infection; QR, quantum red; SOD, su-peroxide dismutase.

The Journal of Immunology

Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Dendritic cells (DCs) have been shown to be the most potentAPCs in the immune system, expressing high levels of MHC mol-ecules, costimulatory molecules, and adhesion molecules, to effi-ciently stimulate T cells (17). DCs also have been shown to suc-cessfully prime naive T cells in vitro against several known tumorAgs (18–24). By examining T cell responses of healthy individ-uals against tumor or viral Ags, one can determine not what acancer- or viral-infected patient recognizes but rather what ahealthy immune system recognizes and responds strongly to. Thisinformation would be potentially very significant in the design anddevelopment of vaccine candidates for various diseases.

In a number of studies, DCs pulsed with synthetic peptides havebeen used (25); however, in humans, this approach is limited to arelatively small numbers of previously identified peptides in thecontext of a specific MHC class I (MHC-I) or class II (MHC-II)molecules. The use of whole recombinant proteins Ag may belimiting due to the fact that it may not be efficiently uptaken andprocessed or presented by the APCs (26). In contrast, expression ofviral or tumor Ags in DCs eliminates these limitations and leads toefficient processing and presentation of various peptides in contextof both MHC-I and MHC-II molecules (27), displaying a completerepertoire of presentable peptides to the T cells.

In our earlier studies (28), we have demonstrated that DCs ob-tained from normal healthy donors’ PBMCs, upon infection withrecombinant adenoviral vectors containing HCV Core or NS3genes express these proteins in the cells and still have normalphenotype and functions. In the present study, we have examinedwhether DCs expressing HCV Core or NS3 Ags are able to prime/stimulate CD4� and CD8� T cell responses from normal healthyHCV-naive individuals in vitro. We have obtained preliminary butfirst conclusive evidence of in vitro priming of mostly CD4� T cellresponses against HCV Ags Core and NS3, as determined by cy-tokine production, T cell proliferation, phenotype analysis, andsecondary T cell proliferative response of in vitro primed T cellsagainst relevant recombinant proteins Ags and immunodominantpeptide epitopes derived from these Ags.

Materials and MethodsCell line and culture

Monolayer of 293A cell line (Qbiogene), an adenovirus-transformed hu-man embryonic cell line that provides phenotypic complementation of theE1 genes, was used for recombinant adenovirus plaque assays, amplifica-tion, and virus titration (Fig. 1). QBI-293A cells were grown at 37°C and5% CO2 in high-glucose DMEM (Invitrogen Life Technologies) contain-ing 4.5 g/L glucose and 110 mg/L NaPyuvate supplemented with 2 mMglutamine and FBS (Invitrogen Life Technologies). The percentage of se-rum varies from 2 to 10% to adapt the speed of cell growth to the exper-imental requirements.

Plasmid construction

The Core (aa 1–191) and NS3 (aa 1027–1657) genes of HCV-1 strain(genotype 1a) were PCR amplified from the full-length clones of HCV(29). pCVH77C was provided by Dr. J. Bukh (National Institutes ofHealth, National Institute of Allergy and Infectious Diseases, Bethesda,MD). Primers used in this study for Core and NS3 contain a BamHI site.The PCR products were cloned into the commercial pCR 2.1 vector (In-vitrogen Life Technologies) to create pCR 2.1 Core and pCR 2.1 NS3.Cloned fragments were verified by sequencing. Both plasmids were di-gested with BamHI, and the purified cDNA fragments were cloned intoAdenoVator Transfer vector (pAdenoVator-CMV5-IRES-GFP; Qbiogene)generating CMV5/GFP/Core and CMV5/GFP/NS3.

Recombinant adenovirus vectors

Recombinant adenoviruses were propagated, purified, and stored as per thestandard method provided in the manual (QBiogene). pAdenoVator �E1/�E3 is a replication-deficient adenovirus vector based on the adenovirusserotype 5 (Ad5), E1/E3 deletion mutant. The transfer vector CMV5/GFP/Core and CMV5/GFP/NS3 were linearized with PmeI. Cotransformationwas performed with each linearized transfer vector and pAdenoVator �E1/E3DNA into BJ5183-competent cells. One of the best positive recombi-nants was selected for the transfer and propagation in DH5a cells. Therecombinant DNA was purified with the Qiagen Plasmid Midi kit accord-ing to the manufacturer’s instructions. Both AdenoVator recombinants ofrAd/Core and rAd/NS3 were digested with pacI and were transfected to293A cells using Effectene transfection reagent (Qiagen). Virus plaqueswere isolated and amplified in 293A cells. The recombinant adenoviralvectors were stored in aliquots at �80°C. Viral particles of Ad5/CMV-LacZ (with no gene insert) were provided by QBiogene and used as acontrol adenoviral vector (denoted as CV throughout the manuscript). We

FIGURE 1. A, The cDNA of Core or NS3 of HCV and its coding region are shown. The end positions of the amino acids also are indicated. B, Thescheme of recombinant adenovirus with gene insertion. The control viruses lacking the insert were used as control vectors (CV)

6066 HUMAN T CELL RESPONSES AGAINST HCV Ags

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

have previously reported efficient expression of HCV Core and NS3 Ags in293 A as well as human dendritic cells as detected by Western blotting andimmunofluorescence staining (28).

Preparation and infection of human PBMC-derived DCs

DCs were generated from human PBMCs. Briefly, PBMCs were isolatedfrom peripheral blood of healthy individuals by Ficoll-Hypaque (Amer-sham Biosciences) density gradient centrifugation (30) and resuspended at5 � 106 cells/ml in RPMI 1640 medium (Invitrogen Life Technologies),supplemented with L-glutamine, 1% human AB serum (Sigma-Aldrich),1% sodium pyruvate (Invitrogen Life Technologies), 500 U/ml penicillin-streptomycin (Invitrogen Life Technologies). The PBMCs were plated insix-well plates (5 ml/well) and incubated at 37°C (5% CO2) for 2 h foradherence. After 2-h incubation, the nonadherent cells were removed, andfresh RPMI medium containing recombinant human GM-CSF (50 ng/ml)(PeproTech) and recombinant human IL-4 (10 ng/ml) (PeproTech) wasadded to the adherent cells. The adherent cells were incubated for 5 days.In flow cytometry experiments, the coexpression of HLA-DR with CD11cwas determined in the DC populations obtained from the 5-day cultures ofadherent cells in the presence of GM-CSF and IL-4 and observed that�90% of the cells obtained from these cultures were double positive forCD11c and HLA-DR, further providing the evidence of generation of DCpopulation in the cultures.

Infection with adenovirus

DCs harvested on days 5–7 of the culture with GM-CSF and IL-4 wereinfected with recombinant defective adenoviruses expressing HCV Core orNS3 or control LacZ gene at a multiplicity of infection (MOI) of 100,unless otherwise mentioned in the figures. In the experiments where LPSstimulation was performed, the LPS (Sigma-Aldrich) was added at 100ng/ml 24 h postinfection and allowed to further incubate for 24 h to maturethe DCs. In the experiments, where immature DCs were used, LPS was notadded.

RNA isolation, cDNA synthesis, and reverse transcription

Total RNA was prepared (Roche), according to the manufacturer’s instruc-tions from 1 to 2 � 106 T cells. cDNA was synthesized from 0.5 to 1 �gof total RNA. One microliter of oligo(dT)12–18 (500 �g/ml; Invitrogen LifeTechnologies) was added, incubated for 10 min at 70°C, and chilled on ice.After mixing with 4 �l of first-strand buffer, 2 �l of 0.1 M DTT, and 1 �lof 10 mM dNTP mix, it was incubated for 2 min at 42°C. One microliterof Superscript II reverse transcriptase (200 U/�l; Invitrogen Life Technol-ogies) was added to the samples and incubated for 50 min at 42°C. Thereaction was inactivated by heating at 70°C for 15 min.

Real-time PCR for cytokines

Cytokine gene expression was quantified by real-time PCR on the Light-Cycler (Roche) according to the manufacturer’s instructions. Primers usedin this study are shown in Table I (31, 32). Real-time PCR was performed

in a total volume of 20 �l in the presence of 2 �l of 10� reaction buffer(Taq polymerase, dNTPs, MgCl2, and SYBR Green) (Roche Diagnostics),and 2 �l of cDNA(or water as negative control, which was always in-cluded). MgCl2 was added to a final concentration of 2.5–4 mM, and 0.3–1pmol of each oligo(dT) primer was added. To determine cytokine inductionby T cells, iDCs were infected with 100 MOI of recombinant adenoviralvectors for 12 h. These were added with (4-h incubation with 100 ng/mlLPS) or without maturation to autologous T cells in 24-well plates (DCs105/well, and T cells 2 � 106/well) for 24 h. At this time, cells wereharvested and mRNA extracted followed by real-time RT-PCR analyses ofvarious cytokines. In experiments with purified cells, cells were harvestedafter 24-h stimulation, and CD4� or CD8� T cells were purified (�99%)by magnetic bead columns (MACS columns; Miltenyi Biotech) followingthe manufacturer’s protocol, and mRNA was extracted followed by real-time RT-PCR analyses of IFN-� or TNF-�.

Antibody staining and FACscan analysis

The following mAbs conjugated to FITC, PE, or quantum red (QR) wereused to assess the cell surface phenotype of T cells. Control IgG1-PE (BDPharmingen), control IgG2a-FITC (BD Biosciences), CD4-QR (IgG1,clone Q4120; Sigma-Aldrich), CD8-QR (IgG 2a, clone UCHT-4; Sigma-Aldrich), CD69-PE (IgG1; BD Pharmingen), CD25PE (IgG1; BD Pharm-ingen), and CD3-FITC (IgG1, clone UCHT-1; Sigma-Aldrich). Corre-sponding isotype-matched control mAbs were used to establishbackground fluorescence.

T cells were harvested on day 5 after coculture with virus-infected DCs.Approximately 3–10 � 105 cells were washed in FACS wash buffer (1%FBS and 1% sodium azide in PBS) and incubated on ice with conjugatedAb in dark. After 30 min, cells were washed with FACS wash buffer andresuspended in 500 �l of FACS wash solution. One hundred microliters ofFACS fixation solution (1% sodium azide and 2% paraformaldehydeamino acids in PBS) was added to the cell suspension. The cells wereanalyzed using a FACscan flow cytometer (BD Biosciences). Isotype con-trol Ab stained �3% of cells.

Recombinant HCV proteins

All recombinant HCV proteins, control superoxide dismutase (SOD) pro-tein, SDS lysate, and Escherichia coli lysate were provided by Dr. M.Houghton (Chiron). The HCV proteins were genotype 1a and had �99%homology with H77 sequence, These proteins were c200(aa 1192–1931,NS3), c33c (aa 1192–1457, NS3), c22–3 (aa 2–120, Core), and c100–3 (aa1569–1931, part of NS3 and NS4).

T cell proliferation assay

Proliferative responses of T cells were measured in triplicate cultures inflat-bottom 96-well microtiter plates (Costar). A total of 2 � 105 autolo-gous T cells was cultured with different concentrations of infected or non-infected DCs (103 to 2 � 104) in 200 �l of AIM-V medium (InvitrogenLife Technologies) at 37°C for 5 days. Nonadherent cells isolated afterremoving adherent cells were used as T cells. Nonadherent cells comprised

Table I. Primer sequences for human cytokines for real-time PCR

mRNA Target Sequence (5� to 3�) Product Size (bp) Position Accession No.c

B-actina FW GGATGCAGAAGGAGATCACTG 90 976 X00351RV CGATCCACACGGAGTACTTG 1065

IFN-�a FW CTAATTATTCGGTAACTGACTTGA 75 464 NM000619RV ACAGTTCAGCCATCACTTGGA 538

TNF-�a FW CCCAGGGACCTCTCTCTAATC 84 275 M10988RV ATGGGCTACAGGCTTGTCACT 358

IL-2 FW CACAGCTACAACTGGAGCATTA 445 136 S77834RV AGAAATTCTACAATGGTTGCTGTC 460

IL-6 FW CTCACCTCTTCAGAACGAATTGACA 283 188 BC015511RV TGGCTTGTTCCTCACTAVTCTC 470

IL-4 FW AGAAGACTCTGTGCACCGAGTTGA 306 194 M13982RV CTCTCATGATCGTCTTTAGCCTTT 499

IL-10a FW CATCGATTTCTTCCCTGTGAA 74 409 NM000572RV TCTTGGAGCTTATTAAAGGCATTC 482

IL-12p40b FW TGGAGTGCCAGGAGGACAGT 147 578 AF180563RV TCTTGGGTGGGTCAGGTTTG 724

FW, forward primer; RV, reverse primer.a Previously described in 2002 (31).b Previously described in 2001 (32).c The GenBank accession number of cDNA and corresponding gene is available at www.ncbi.nlm.nih.gov.

6067The Journal of Immunology

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

of �80% CD3� T cells (data not shown). The assay included negative (noAg) and positive (phytohemagglutin, 1 �g/ml) controls. The cells werepulsed with 0.5 �Ci/well [3H]thymidine (Amersham Biosciences) for 16 hand harvested on filter papers (PerkinElmer). The levels of [3H]thymidineincorporation into the cellular DNA were counted in a liquid scintillationcounter (MicroBeta Trilux; PerkinElmer). Tests were run in replicates ofthree to five wells. To determine the IFN-� secreted in the supernatant ofcultured T cells, supernatant was collected before adding [3H]thymidineand used to perform ELISA using commercial ELISA kits (BioSourceInternational). For the Ab blocking experiments, anti-class I (W6/32) oranti-class II (HB151) Abs were added to the wells at 1 �g/ml finalconcentrations.

To determine the secondary T cell responses against recombinant pro-tein Ags, replica plating assays were performed. Initially, �21 wells of96-well plates were plated with NS3, Core, or control adenoviral-infectedDCs (104/well) together with 2 � 105 autologous T cells in total 200 �l ofAIM-V medium for 6 days. On day 6, each well was split into three equalwells on three different 96-well plates. On the first plate, no Ag was added;on the second plate, the relevant recombinant protein (NS3 protein for NS3group and Core protein for Core group) were added at 20 �g/ml. On thethird plate, irrelevant Ag (Core for NS3 group and NS3 for Core group),control Ags, SOD, SDS extract, and E. coli extract, etc., were added in fiveto six replicates. Each well was fed with irradiated autologous PBMCs(1 � 105/well) and cultured for another 5 days. At the end of the 5 days,0.5 �Ci/well [3H]thymidine was added, followed by harvesting the cells onthe day 6 and counting the levels of [3H]thymidine incorporation into thecellular DNA.

To determine the immunodominant peptide-specific responses, T cellsfrom primary cultures were restimulated with immunodominant peptidesCore 21–40 (DVKFPGGGQIVGGVYLLPRR) or NS3 1248–1271(GYKVLVLNPSVAATLGFGAYMSKA) (Dalton Chemical) at 20 �g/mlin the presence of autologous irradiated PBMCs (2 � 105/well) as APCs in96-well plates for 5 days. The proliferation of T cells was measured by[3H]thymidine incorporation assay.

Statistical analyses

Statistical analyses were done by Tukey’s test using SPSS software (ver-sion 11.5; SPSS).

ResultsDCs expressing HCV-derived Core or NS3 Ags stimulate theinduction of various cytokines in autologous T cells from HCV-naive individuals

We have previously reported normal function and phenotype ofhuman DCs expressing HCV-Core or NS3 Ags (28). In these stud-ies, we also demonstrated that, by infection with recombinant ad-enoviral vectors, we can achieve �100% transduction efficiencywithout toxicity to the cells (28). The DCs expressing NS3, Core,control vector, or uninfected were used in limiting numbers tostimulate autologous T cells from HCV-naive individuals to ex-amine in vitro priming of T cells against HCV Ags. After 24-hcoculture, the cells were harvested and used to isolate mRNA fol-lowed by reverse transcription to cDNA, which was then used torun real-time PCR (Fig. 2) to quantitate the message for variouscytokines such as IFN-�, IL-2, IL-12-p40, IL-6, TNF-�, IL-4, andIL-10. The DCs plus T cell cocultures were performed in twoconditions: immature DCs stimulated or mature DCs stimulated(by 100 ng/ml LPS). Data from three representative donors areshown in Fig. 2. In the first donor, strong IFN-� and TNF-� mRNAwere induced in T cells upon stimulation with mature DCs expressing

FIGURE 2. A, Induction of cytokine mRNA in T cells primed in vitro by autologous DCs expressing HCV-NS3, Core, or no Ag. For these experiments,iDCs were infected with 100 MOI of recombinant adenoviral vectors for 12 h. These were added with (4-h incubation with 100 ng/ml LPS) or withoutmaturation to autologous T cells in 24-well plates (DCs 105/well, and T cells 2 � 106/well) for 24 h. At this time, cells were harvested and mRNA extracted,followed by real-time RT-PCR analyses of various cytokines. The x axis represents the following DC-stimulating groups: one to four immature DC-stimulated T cells (1, uninfected DCs; 2, rAd-NS3, 100 MOI; 3, rAd-Core, 100 MOI; 4, rAd-LacZ, 100 MOI) and five to eight mature DC-stimulated(LPS-matured DCs) T cells (5, uninfected DCs; 6, rAd-NS3, 100 MOI; 7, rAd-Core, 100 MOI; 8, rAd-LacZ, 100 MOI). B, Induction of cytokine mRNAin purified CD4� or CD8� T cells primed in vitro by autologous DCs expressing HCV-NS3, Core, or control vector. For these experiments, iDCs wereinfected with 100 MOI of recombinant adenoviral vectors for 12 h. These were added after maturation (4-h incubation with 100 ng/ml LPS) to autologousnonadherent cells in 24-well plates (DCs 105/well, and non adherent cells 2 � 106/well) for 24 h. At this time, cells were harvested, CD4� or CD8� Tcells were purified by magnetic bead columns and mRNA was extracted followed by real-time RT-PCR analyses of IFN-� or TNF-�.

6068 HUMAN T CELL RESPONSES AGAINST HCV Ags

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

HCV Core or NS3 but not against uninfected or control vector-in-fected DCs. IL-4 mRNA was not detected above background. Simi-larly, in the second donor’s T cells, strong IFN-� and TNF-�mRNA were identified in response to mature DCs expressing HCVCore or NS3 Ags, but IL-4 message was shown moderately (�200copies in response to HCV Core or NS3 Ags, compared with �50copies for control). In contrast, in the third donor, low IFN-� orTNF-� mRNA (50–150 and 45–70 copies, respectively) were in-duced, whereas high IL-4 message (�4000–7000 copies) was iden-tified in response to NS3 or Core Ags (Fig. 2). In all three donors’ Tcells, IL-6 message was induced to a significantly high degree, andIL-12p40 was induced at a lower level (3–30 copies) in HCVAg-specific manner, as the control vector-infected DCs inducedsignificantly lower levels of IL-12p40 and IL-6 ( p � 0.05).Induction of IL-2 message was observed only in T cells stimulatedwith immature DCs expressing HCV Core or NS3 but not bymature DCs (Fig. 2, donors 1–3) in all three donors. In contrast,with all other cytokines, stronger mRNA level was induced uponstimulation with mature DCs expressing HCV Core or NS3,compared with immature DCs. In donors 2 and 3, significantHCV-Ag-dependent IL-10 mRNA was induced, whereas in thedonor 1, moderate levels of IL-10 was induced (�350 copies) inresponse to HCV Core, compared with �200–250 copies inresponse to HCV NS3 and control vector-infected DCs. To deter-mine the source of induced IFN-� and TNF-� mRNA, CD4� orCD8� T cells were purified after 24-h coculture of non adherentcells with autologous DCs expressing control vector, HCV NS3 orCore (Fig. 2B), followed by mRNA purification and real-time RT-PCR analyses of cytokines. Both IFN-� and TNF-� mRNA wereinduced by CD4� T cells in response to HCV Core as well as NS3;however, the response was higher in Core-stimulated T cells. Incomparison, IFN-� and TNF-� mRNA produced by CD8� T cellswas �10-fold lower than that produced by CD4� T cells. We alsodetermined the levels of IFN-� being secreted in the supernatant by Tcells stimulated for 4 days with autologous DCs expressing HCVCore or NS3 Ags. In three donors, the level of IFN-� secreted in thesupernatant corresponded to the pattern of IFN-� mRNA (Table II). Intwo donors, high IFN-� levels were detected in response to Core orNS3, whereas in one donor, low levels of IFN-� was detected. TheDCs cultured alone at similar numbers did not produce detectablecytokines in the supernatant (data not shown).

Normal donors’ T cells proliferate upon stimulation withautologous DCs endogenously expressing HCV-derived Core orNS3 Ags

To examine whether naive T cells from normal donors can bestimulated to proliferate against HCV-derived NS3 or Core Ags,the immature or mature (with 100 ng/ml LPS) DCs expressingNS3 or Core Ags were cultured with autologous T cells for 5 days

at various DC:T cells ratios (200:1 to 20:1). As controls, unin-fected DCs or control vector-infected DCs were used as Ag-neg-ative DCs (Fig. 3). T cell proliferation was determined as a mea-sure of T cell stimulation. The data from three representativedonors are shown individually in Fig. 3. Even after 5–6 days ofculture, in vitro Core-specific proliferation seemed to be signifi-cantly high in all of the donors, compared with negative controlgroups (uninfected DCs or control vector infected). Upon stimu-lation with mature DCs expressing Core, proliferation was higherthan upon stimulation with immature DCs expressing HCV Core.However, with both mature and immature DCs, the proliferationagainst Core was significantly higher than against control vector-infected DCs ( p �0.05). The Ag-specific proliferative responseagainst NS3 appeared to be much lower than that against Core Ag.In most instances, NS3-specific proliferative response was not ap-parent when immature DCs were used to stimulate T cells. How-ever, upon using NS3 expressing mature DCs, T cell proliferationwas observed above background but was not statistically signifi-cant ( p �0.1 at all DC:T ratios).

Both CD4� and CD8� T cells are stimulated in response toautologous DCs expressing HCV-derived Core or NS3 Ags

To determine whether DCs expressing HCV Core or NS3 Ags areleading to selective CD4� or CD8� T cell activation, we examinedthe expression of CD4 or CD8 along with activation moleculesCD25 or CD69 (Fig. 4). In these flow cytometry experiments, ma-ture DCs were used to stimulate naive T cells for 5 days followedby staining with a combination of Abs. In primary 5-day cultures,both CD4� and CD8� T cells were present at �65–70 and 17–18% of the total T cell population, respectively. However, in re-sponse to both NS3 and Core, selective activation of CD4� T cellswas observed as determined by CD25 or CD69 expression. In theCore expressing DC activated T cells, �21 and 14% of the CD4�

T cells expressed CD25 or CD69, respectively, whereas in theNS3-DC expressing DC -ctivated cells, 15.7 and 11% of the CD4� Tcells were expressing CD25 or CD69. However, in the CD8� T cells,only 5.7 or 6.1% of the total CD8� T cells were positive for CD25 orCD69 expression in Core Ag-stimulated groups. In the control groupswith uninfected DC-stimulated T cells or the control vector-express-ing DC-stimulated T cell cultures, 13–14 or 10–11% of the CD4� Tcells were CD25� or CD69�, respectively. Among the CD8� T cellsin the control vector or uninfected DCs groups, 2–5% CD8� T cellsshowed CD25 or CD69 expression (Fig. 4). To determine the type ofcells proliferating in the cultures stimulated with HCV Ags expressingDCs, blocking experiments were performed (Fig. 5). Both anti-MHC-I and anti-MHC-II Abs partially blocked HCV Core- or NS3-specific proliferative responses (Fig. 5).

T cells primed in vitro by autologous DCs expressing HCV Coreor NS3 Ags proliferate in Ag-specific manner in secondarycultures

The T cells primed in vitro in limiting dilution cultures by autol-ogous DCs expressing HCV Core or NS3 were restimulated withautologous irradiated PBMCs and the respective Core or NS3 re-combinant protein Ags. These experiments were done in replicaplating manner, so we were able to examine the Core- or NS3-specific response, compared with no Ag or irrelevant Ags or thevehicle controls. In addition, recombinant Core protein was usedas negative specificity control Ag in NS3-stimulated cultures andvice versa. As shown in Fig. 6, the second restimulation showedCore- or NS3-specific responses in individual wells, which wasstatistically significant for both NS3 and Core Ags ( p �0.05).As controls, we also stimulated T cells with untransduced or con-trol vector-treated DCs in the first week, followed by restimulation

Table II. T cells stimulated with DCs expressing HCV NS3 or coreproduce IFN-� in the supernatant

Group

�-IFN in Supernatant (pg/ml)a

Donor 1 Donor 2 Donor 3

DCs plus T cells 0 0 0Control vector DCs plus T cells 682 147 288Core-expressing DCs plus T cells 4834 5655 556NS3-expressing DCs plus T cells 1657 5643 349

a Supernatant was collected from DCs (104/well) and T cell (2 � 105/well) co-culture in 96-well microtiter wells after 4 days of incubation. The supernatant was runat 1/2 and 1/10 dilution for ELISA. The standards for ELISA were in the range(15–2000 pg/ml).

6069The Journal of Immunology

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

FIGURE 3. HCV Ags NS3- and Core-specific pri-mary T cell proliferative response upon stimulationwith autologous DCs expressing Core or NS3 Ags. TheDC T cells were cocultured for 5 days, followed byaddition of [3H]thymidine (0.5 �Ci/well) for 18 h andharvesting the cells, followed by counting the [3H]thy-midine incorporation. The data are shown with threeindividual donors’ T cells. A and B, Core-specific re-sponse with immature and mature DCs. C and D, NS3-specific responses with immature and mature DCs, re-spectively. A and B, Uninfected DCs (�) and Core (Œ;panels A and B). C and D, NS3-expressing DCs stim-ulated T cells, and control vector-infected DCs stimu-lated T cells (F).

6070 HUMAN T CELL RESPONSES AGAINST HCV Ags

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

with no Ag, Core, NS3, or control Ags (data not shown). In bothof these control cultures, the proliferation in response to HCV Coreor NS3 recombinant proteins were lower than the control no Ag orvehicle control wells, and the average cpm of all of the wells wasalso lower than the no Ag or vehicle control groups. As controls,we also stimulated naive T cells in primary cultures with DCsloaded with recombinant proteins Ags and did not observe Ag-specific proliferation (data not shown).

In addition to determining Ag-specific T cell response against re-combinant protein Ags, we determined the specificity of responseagainst immunodominant permissive T cell peptide epitopes for HCV

Core and NS3 Ags 21–40 and 1248–1271, respectively. Both of thesepeptides have been shown previously to be permissive TH epitopes,i.e., they are able to be presented in context of multiple HLA class IImolecules to CD4� T cells (7, 10). As shown in Fig. 7, the T cellsprimed with HCV Core or NS3-expressing DCs showed peptide-spe-cific proliferation response against Core-21–40 and NS3–1248-1271,respectively. The peptide-specific responses were statistically signif-icant for both Core and NS3 Ags ( p �0.05). As controls, thecontrol vector-infected DC-primed T cells also were cultured withCore or NS3 peptide, but no proliferative response above backgroundwas observed (data not shown).

FIGURE 4. Flow cytometry analyses of T cell cultured with DCs expressing control, HCV-NS3, or HCV-Core for 5 days, followed by staining forCD3/CD4, CD8/CD25, or CD69 in triple color formats. For the analyses, CD3� T cells were gated and analyzed for CD25 or CD69 expression on CD4�

or CD8� T cells. The table summarizes the percentage of CD4� or CD8� T cells expressing CD25 or CD69 as activation markers. The data arerepresentative of three repeated experiments.

6071The Journal of Immunology

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

DiscussionIn this paper, we describe the in vitro induction of HCV Ags NS3and Core reactive human T cell responses from HCV-naive (un-infected) individuals. These studies have advantages over previousreports (9–13) in that these seek to explore anti-HCV T cell re-sponses that can be generated in healthy, immunocompetent indi-viduals to HCV Ags presented by professional APCs. This studyeliminates the use of T cells from HCV-infected people, whichcould be defective and modulated (33). In addition, by using Tcells and DCs from healthy individuals, we are examining the po-tential of T cell repertoire that has not been affected by long-termpresence of HCV in the body. These studies have huge potentialfor the investigation and development of prophylactic as well im-munotherapeutic vaccines for HCV infection.

CD4� T cell responses have been suggested to be important inHCV viral clearance (13). In addition, IFN-� production by CD4�

T cells in response to HCV Ags has been suggested to correlatewith HCV clearance in chimpanzees that cleared HCV (14). In ourearlier studies, we have reported efficient expression of HCV NS3and Core proteins in human DCs (28). In the present study, theseHCV Ags expressing DCs were used to stimulate autologous Tcells in vitro. As an initial measure of T cell response, we exam-ined the mRNA induction of various cytokines (IL-2, IL-4, IL-6,IL-10, IFN-�, TNF-� and IL-12p40) by real-time RT-PCR (Fig.2). Significant numbers of cytokines mRNA copies were detectedafter 24 h stimulation of T cells with immature or mature autolo-gous DCs expressing HCV NS3 or Core. Interestingly, the imma-ture DCs did not stimulate high quantities of cytokines’ mRNAexcept IL-2. In all of the donors’ T cells, mRNA for IL-2 wasinduced in response to HCV Core, and in two donors’ T cells, inresponse to NS3 upon stimulation with autologous DCs expressingthese Ags. With the control vector-infected or uninfected controlimmature DCs, no or very little IL-2 was induced. Surprisingly,message for mRNA for IL-2 was not detected upon stimulation ofT cells with mature DCs expressing NS3 or Core. It is possiblethat, with immature DCs expressing HCV NS3 or Core, the naiveT cells are moderately stimulated to produce low levels of IL-2(only 12–25 copies of mRNA), whereas upon stimulation withmature DCs expressing HCV Ags lineage committed T cells lostthe ability to produce IL-2. With all of the cytokines tested, therewere clearly more cytokines induced in response to HCV Core- orNS3-containing DCs, compared with uninfected or control vector-

expressing DCs, despite the fact that they were all used at thesame MOI.

The induction of IFN-�, TNF-�, and IL-4 in response to HCVCore or NS3 Ags provided a very interesting pattern. In two ofthree donors, high IFN-� and TNF-� were induced against bothCore and NS3 Ags (Fig. 2), whereas no or modest IL-4 was in-duced. In the third donor, clearly a significantly high amounts ofIL-4 mRNA was induced with very low levels of IFN-� andTNF-� mRNA. These results demonstrate an inherent ability ofindividuals to respond to HCV Core and NS3 Ags in Th1/Th0 andTh2 type of responses. In these studies, a quantitative difference inthe amount of cytokine mRNA was observed upon stimulationwith NS3 or Core Ags expressing DCs, but in almost all cases,both NS3 and Core Ags induced qualitatively similar cytokine re-sponse, suggesting that Core does not differentially stimulate Th2cytokine patterns, or suppress T cells from expressing cytokinemRNA. Upon examining the IFN-� secreted in the supernatant ofT cells stimulated with DCs expressing HCV Core or NS3 Agsafter 5-day culture, a pattern similar to mRNA was observed, i.e.,two donors induced significant IFN-� production, whereas thethird donor showed very low levels of IFN-� secretion specific toHCV Core or NS3 Ags (Table II). In the control groups whereuninfected or control vector-infected DCs were used to stimulateautologous T cells, this specific pattern of cytokine response wasnot seen (Fig. 2). These results suggested that HCV Ags presentedby DCs have an inherent ability to induce Th1/Th0 or Th2 typeresponses in normal T cells. It is not yet clear whether it is relatedto HLA diversity, previous or ongoing status of donors, or an in-herent property of human T cells to respond to HCV Ags in twodistinct patterns. Also, it is not clear whether two distinct responsepatterns of naive T cells to HCV Ags is what determines the out-come of immune response and disease status upon infection withHCV. From studies of HCV patients, however, Th1 and Th0 re-sponses against various HCV Ags have been suggested to providea favorable outcome to viremia and disease, whereas Th2 re-sponses have been correlated to persistent viremia (34). HCVCore- and NS3-induced expression of IL-12p40, IL-6, and IL-10was not much different in different individuals, exemplifying theirstatus as neither Th1 nor Th2 cytokines. However, induction ofIL-10 in response to Core and NS3 does suggest stimulation ofTreg-like cells. For these cytokines as well, we observed HCV Ags

FIGURE 5. Blocking of HCVCore- or NS3-specific primary T cellresponses by Abs against MHC-I andMHC-II. The primary HCV-NS3 orCore-specific T cell cultures were es-tablished (as described in Fig. 3) butin the presence or absence of anti-MHC-I or anti-MHC-II Abs and iso-type control Abs at 1 �g/well. Shownare Core-expressing DCs (top panel)and NS3-expressing DCs (bottompanel). Both anti-class I (left) and anti-class II (right) Abs partially block theprimary T cell proliferative responses.

6072 HUMAN T CELL RESPONSES AGAINST HCV Ags

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Core- or NS3-specific response distinct from uninfected or controlvector-infected DC-stimulated T cell responses.

The induction of cytokine mRNAs in T cells upon stimulationwith HCV Core or NS3 expressing autologous DCs was related toincreased T cell proliferation (Fig. 3). Overall HCV Core Ag-ex-pressing DC-stimulated T cells showed increased proliferationcompared with NS3-stimulated T cells (Fig. 3). Mature DC-stim-ulated T cells proliferate more than immature DCs expressingHCV Ags Core- or NS3-stimulated T cells. The differential pro-liferation of T cells in response to HCV Core- or NS3-expressingimmature or mature DCs corresponded to inflammatory cytokinesbeing induced in T cells (Fig. 3). In all three donors, we observedhigher HCV Core-specific proliferation, compared with NS3-spe-cific proliferation. HCV-derived NS3 has been shown previouslyto alter IRF-3 activation downstream of TLR signaling, leading toalteration of Ag presentation, NF-�B activation, and inefficient ac-tivation of T cells. It is possible that a lower primary proliferationof T cells in response to NS3 could be a reflection of reducedinnate response due to expression of NS3 in the DCs. The blockingexperiment using anti-MHC-I and anti-MHC-II Abs suggested therole of both CD4� and CD8� T cells in the observed proliferation.

Interestingly, upon examining the phenotype of T cells respond-ing in the primary cultures, it was observed that more CD4� T

cells show activated phenotype, compared with CD8� in bothNS3- and Core-stimulated T cell cultures (Fig. 4). The percentageof CD4� T cells expressing CD25 or CD69 was significantlyhigher in the HCV Ag-stimulated T cells, compared with the no Agor control vector-expressing DC-activated T cells. This observa-tion is contradictory to other reports with tumor Ags where tumorAgs expressing DCs were shown to primarily stimulate CD8�

CTL from naive T cells (35–37). However, our observations mayexplain the previously reported CD4� T cell responses in HCV-infected individuals and support the suggestion that CD4� T cellsare important for viral clearance (13). It is not clear why, in theprimary cultures, we did not see high CD8� T cell activation. Ourprevious studies demonstrated that the DCs expressing Core orNS3 Ags express normal levels of class I and class II molecules(28), suggesting that the differential expression of class I vs classII molecules in HCV Core- or NS3-expressing DCs did not lead tothe observed differences in CD4� vs CD8� T cell activation. It ispossible that NS3- and Core-expressing DCs selectively suppressthe activation of CD8� T cells or, in fact, naturally stimulate lessCD8� T cells from normal individuals. It is possible that, afterseveral rounds of in vitro stimulation, a significantly higher num-ber of activated CD8 T cells will be observed. More detailed phe-notype and functional analysis would help clarify this question.

FIGURE 6. NS3 or Core-specific proliferation in secondary cultures. Initially, 21 wells of a 96-well plates were plated with NS3-, Core-, or controladenovirus-infected DCs (104/well) together with 2 � 105 autologous T cells in total 200 �l of AIM-V medium for 6 days. On day 6, each well was splitinto three equal wells on three different 96-well plates. On the first plate, no Ag was added; on the second plate, the relevant recombinant protein (NS3protein for NS3 group and Core protein for Core group) were added at 20 �g/ml. On the third plate, irrelevant Ag (Core for NS3 group and NS3 for Coregroup), control Ags, SOD, SDS extract, and E. coli extract, etc., were added in five to six replicates. Each well was fed with irradiated autologous PBMCs(1 � 105/well) and cultured for another 5 days. At the end of the 5 days, 0.5 �Ci/well [3H]thymidine was added, followed by harvesting the cells on day6 and counting the levels of [3H]thymidine incorporation into the cellular DNA. The bottom two panels are average cpm from 21 wells of the top two graphs.The data are representative of two repeated experiments from two different donors.

6073The Journal of Immunology

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

In our next experiments, we determined whether we can identifyAg-specific T cell proliferation in secondary cultures (Fig. 6 and7). For these experiments, the DCs expressing HCV Core or NS3Ags were used in the priming cultures and the irradiated autolo-gous PBMCs along with recombinant proteins or control Ags wereused as APCs in the secondary cultures. Because, it is expectedthat the frequency of Ag-specific T cells would be very low inHCV-naive individuals, we performed these experiments in replicaplating cultures (38). The format of replica plating experimentsallows one to identify individual Ag-specific proliferation re-sponses in individual wells and at the same time examine the re-sponse of those cells against no Ag or irrelevant Ag-stimulatedcultures. For the first week in the priming cultures all of the T cellsin multiple wells were stimulated with limiting number of DCsexpressing Core or NS3 Ags. Before the second stimulation withirradiated PBMCs as APCs with or without Ags, each well of theprimary culture was split into three identical (replica) wells. Thefirst replica well was stimulated with APCs without Ag, the secondreplica well was stimulated with APCs plus the respective proteinAg, and the third replica well was stimulated with APCs plus con-trol Ags. The results of this experiment are shown in Fig. 6. Theproliferative responses of T cells in replica plating experimentsprovided conclusive evidence of HCV Ag Core- and NS3-specificT cell proliferation in the primary in vitro cultures and also in vitropriming of T cells against HCV Ags Core and NS3 using autologusDCs expressing these HCV Ags. These results were further cor-roborated by the proliferative response of HCV Core or NS3-primed T cells against immunodominant peptides from both Coreand NS3 Ags (Fig. 7).

In conclusion, our studies demonstrated that, by using DCs ex-pressing HCV Ags, it is possible to prime and stimulate naive Tcells against HCV Ags. HCV is a worldwide health problem, andtherefore protective and immunotherapeutic vaccines need to bedeveloped as soon as possible (39, 40). By using the DCs express-ing HCV Ags endogenously to stimulate T cells, a complete rep-ertoire of class I- and class II-restricted peptides from HCV Ags

can be presented to T cells. This system can be used to elucidatethe role of various HCV proteins in the induction of T cell re-sponses that are involved in virus control or clearance. Experi-ments are underway in our laboratory to identify epitopes derivedfrom HCV Ags Core and NS3, which are recognized by T cellsobtained from healthy individuals. Also detailed phenotypic andfunctional characterization of the responding primary T cells iscurrently underway. An added advantage in studying the T cellrepertoire of healthy individuals to identify HCV Ag-specific re-sponses is that in HCV-infected individuals, the T cells may besuboptimally primed in vivo with tolerizing DCs, or the hepato-cytes expressing HCV Ags, rather that professional activated andmature DCs. In addition, because the DCs expressing HCV Agsare able to prime the Ag-specific T cells in vitro, they will have thepotential to be used as cellular vaccines or as T cell adoptive trans-fer therapy in vivo in both prophylactic and therapeutic setting.

AcknowledgmentsWe thank Dr. J. Bukh for providing H77 HCV plasmid which was used toPCR out the Core and NS3 genes.

DisclosuresThe authors have no financial conflict of interest.

References1. Manns, M. P., J. G. McHutchison, S. C. Gordon, V. K. Rustgi, M. Shiffman,

R. Reindollar, Z. D. Goodman, K. Koury, M. Ling, and J. K. Albrecht. 2001.Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus riba-virin for initial treatment of chronic hepatitis C: a randomised trial. Lancet 358:958–965.

2. European Association for the Study of the Liver International Consensus Con-ference on Hepatitis C. February 26–28, 1999. Paris, France. Consensus state-ment. J. Hepatol. 30: 956–961.

3. National Institutes of Health Consensus Development Conference on Management ofHepatitis C: 2002. June 10–12, 2002. Bethesda, MD. Consensus statement.

4. Hugle, T., and A. Cerny. 2003. Current therapy and new molecular approaches toantiviral treatment and prevention of hepatitis C. Rev. Med. Virol. 13: 361–371.

5. Thimme, R., D. Oldach, K. M. Chang, C. Steiger, S. C. Ray, and F. V. Chisari.2001. Determinants of viral clearance and persistence during acute hepatitis Cvirus infection. J. Exp. Med. 194: 1395–1406.

6. Rispeter, K., M. Lu, S. E. Behrens, C. Fumiko, T. Yoshida, and M. Roggendorf.2000. Hepatitis C virus variability: sequence analysis of an isolate after 10 yearsof chronic infection. Virus Genes 21: 179–188.

7. Day, C. L., G. M. Lauer, G. K. Robbins, B. McGovern, A. G. Wurcel,R. T. Gandhi, R. T. Chung, and B. D. Walker. 2002. Broad specificity of virus-specific CD4� T-helper-cell responses in resolved hepatitis C virus infection.J. Virol. 76: 12584–12595.

8. Doherty, P. C. 1996. Cytotoxic T cell effector and memory function in viralimmunity. Curr. Top Microbiol. Immunol. 206: 1–14.

9. Harcourt, G. C., M. Lucas, I. Sheridan, E. Barnes, R. Phillips, and P. Klenerman.2004. Longitudinal mapping of protective CD4� T cell responses against HCV:analysis of fluctuating dominant and subdominant HLA-DR11 restrictedepitopes. J. Viral Hepat. 11: 324–331.

10. Shoukry, N. H., J. Sidney, A. Sette, and C. M. Walker. 2004. Conserved hier-archy of helper T cell responses in a chimpanzee during primary and secondaryhepatitis C virus infections. J. Immunol. 172: 483–492.

11. Rico, M. A., S. Ruiz, D. Subira, G. Barril, S. Cigarran, S. Castanon,J. A. Quiroga, R. Selgas, and V. Carreno. 2004. Virus-specific effector CD4�

T-cell responses in hemodialysis patients with hepatitis C virus infection. J. Med.Virol. 72: 66–74.

12. Barbakadze, G., G. Kamkamidze, M. Butsashvili, M. Kiladze, and D. Jatchvliani.2003. The role of specific CD4� T helper cell response in the course of hepatitisC virus infection. Sb Lek. 104: 79–83.

13. Grakoui, A., N. H. Shoukry, D. J. Woollard, J. H. Han, H. L. Hanson, J. Ghrayeb,K. K. Murthy, C. M. Rice, and C. M. Walker. 2003. HCV persistence and im-mune evasion in the absence of memory T cell help. Science 302: 659–662.

14. Nascimbeni, M., E. Mizukoshi, M. Bosmann, M. E. Major, K. Mihalik,C. M. Rice, S. M. Feinstone, and B. Rehermann. 2003. Kinetics of CD4� andCD8� memory T-cell responses during hepatitis C virus rechallenge of previ-ously recovered chimpanzees. J. Virol. 77: 4781–4793.

15. Kamal, S. M., J. Fehr, B. Roesler, T. Peters, and J. W. Rasenack. 2002. Pegin-terferon alone or with ribavirin enhances HCV-specific CD4 T-helper 1 responsesin patients with chronic hepatitis C. Gastroenterology 123: 1070–1083.

16. Neumann-Haefelin, C., H. E. Blum, F. V. Chisari, and R. Thimme. 2005. T cellresponse in hepatitis C virus infection. J. Clin. Virol. 32: 75–85.

17. Knight, S. C., F. Burke, and P. A. Bedford. 2002. Dendritic cells, antigen dis-tribution and the initiation of primary immune responses to self and non-selfantigens. Semin. Cancer Biol. 12: 301–308.

FIGURE 7. HCV NS3- or Core Ag-primed T cells respond to immu-nodominant permissive peptide epitopes in secondary cultures. The datarepresent three repeated experiments from different donors.

6074 HUMAN T CELL RESPONSES AGAINST HCV Ags

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

18. Celis, E., V. Tsai, C. Crimi, R. DeMars, P. A. Wentworth, R. W. Chesnut,H. M. Grey, A. Sette, and H. M. Serra. 1994. Induction of anti-tumor cytotoxicT lymphocytes in normal humans using primary cultures and synthetic peptideepitopes. Proc. Natl. Acad. Sci. USA 91: 2105–2109.

19. Tsai, V., S. Southwood, J. Sidney, K. Sakaguchi, Y. Kawakami, E. Appella,A. Sette, and E. Celis. 1997. Identification of subdominant CTL epitopes of theGP100 melanoma-associated tumor antigen by primary in vitro immunizationwith peptide-pulsed dendritic cells. J. Immunol. 158: 1796–1802.

20. Kawashima, I., S. J. Hudson, V. Tsai, S. Southwood, K. Takesako, E. Appella,A. Sette, and E. Celis. 1998. The multi-epitope approach for immunotherapy forcancer: identification of several CTL epitopes from various tumor-associated an-tigens expressed on solid epithelial tumors. Hum. Immunol. 59: 1–14.

21. Brossart, P., G. Stuhler, T. Flad, S. Stevanovic, H. G. Rammensee, L. Kanz,W. Brugger. 1998. Her-2/neu-derived peptides are tumor-associated antigens ex-pressed by human renal cell and colon carcinoma lines and are recognized by invitro induced specific cytotoxic T lymphocytes. Cancer Res. 58: 732–736.

22. Hiltbold, E. M., M. D. Alter, P. Ciborowski, and O. J. Finn. 1999. Presentationof MUC1 tumor antigen by class I MHC and CTL function correlate with theglycosylation state of the protein taken Up by dendritic cells. Cell Immunol. 194:143–149.

23. Hiltbold, E. M., P. Ciborowski, and O. J. Finn. 1998. Naturally processed classII epitope from the tumor antigen MUC1 primes human CD4� T cells. CancerRes. 58: 5066–5070.

24. Chaux, P., R. Luiten, N. Demotte, V. Vantomme, V. Stroobant, C. Traversari,V. Russo, E. Schultz, G. R. Cornelis, T. Boon, and P. van der Bruggen. 1999.Identification of five MAGE-A1 epitopes recognized by cytolytic T lymphocytesobtained by in vitro stimulation with dendritic cells transduced with MAGE-A1.J. Immunol. 163: 2928–2936.

25. Morse, M. A., T. Clay, K. Colling, and H. K. Lyerly. 2003. Preparation of pep-tide-loaded dendritic cells for cancer immunotherapy. Mol. Biotechnol. 25:95–99.

26. Ludewig, B., K. McCoy, M. Pericin, A. F. Ochsenbein, T. Dumrese, B. Odermatt,R. E. Toes, C. J. Melief, H. Hengartner, and R. M. Zinkernagel. 2001. Rapidpeptide turnover and inefficient presentation of exogenous antigen critically limitthe activation of self-reactive CTL by dendritic cells. J. Immunol. 166:3678–3687.

27. Gogolak, P., B. Rethi, G. Hajas, and E. Rajnavolgyi. 2003. Targeting dendriticcells for priming cellular immune responses. J. Mol. Recognit. 16: 299–317.

28. Li, W., J. Li, D. L. J. Tyrrell and B. Agrawal. 2006. Expression of hepatitis Cvirus (HCV) derived Core or NS3 antigens in human dendritic cells leads toinduction in pro-inflammatory cytokines and normal T cell stimulation capabil-ities. J. Gen. Virol. 87: 61–72.

29. Yanagi, M., R. H. Purcell, S. U. Emerson, and J. Bukh. 1997. Transcripts froma single full-length cDNA clone of hepatitis C virus are infectious when directlytransfected into the liver of a chimpanzee. Proc. Natl. Acad. Sci. USA 94:8738–8743.

30. Iwatani, Y., N. Amino, H. Mori, S. Asari, K. Ina, K. Ennyu, and K. Miyai. 1982.Effects of various isolation methods for human peripheral lymphocytes on T cellsubsets determined in a fluorescence activated cell sorter (FACS), and demon-stration of a sex difference of suppressor/cytotoxic T cells. J. Immunol. Methods54: 31–42.

31. Stordeur, P., L. F. Poulin, L. Craciun, L. Zhou, L., Schandene, A. de Lavareille,A., S. Goriely, and M. Goldman. 2002. Cytokine mRNA quantification by real-time PCR. J. Immunol. Methods 259: 55–64.

32. Giulietti, A., L. Overbergh, D. Valckx, B. Decallonne, R. Bouillon, andC. Mathieu. 2001. An overview of real-time quantitative PCR: applications toquantify cytokine gene expression. Methods 25: 386–401.

33. Wedemeyer, H., X. S. He, M. Nascimbeni, A. R. Davis, H. B. Greenberg,J. H. Hoofnagle, T. J. Liang, H. Alter, and B. Rehermann. 2002. Impaired effectorfunction of hepatitis C virus-specific CD8� T cells in chronic hepatitis C virusinfection. J. Immunol. 169: 3447–3458.

34. Fan, X. G., W. E. Liu, C. Z. Li, Z. C. Wang, L. X. Luo, D. M. Tan, G. L. Hu,and Z. Zhang. 1998. Circulating Th1 and Th2 cytokines in patients with hepatitisC virus infection. Mediators Inflamm. 7: 295–297.

35. Chan, R. C., X. W. Pang, Y. D. Wang, W. F. Chen, and Y. Xie. 2004. Trans-duction of dendritic cells with recombinant adenovirus encoding HCA661 acti-vates autologous cytotoxic T lymphocytes to target hepatoma cells. Br. J. Cancer.90: 1636–1643.

36. Kao, H., A. A. Amoscato, P. Ciborowski, and O. J. Finn. 2001. A new strategyfor tumor antigen discovery based on in vitro priming of naive T cells withdendritic cells. Clin. Cancer Res. 7(Suppl. 3): S773–S780.

37. Kaplan, J. M., Q. Yu, S. T. Piraino, S. E. Pennington, S. Shankara,L. A. Woodworth, and B. L. Roberts. 1999. Induction of antitumor immunitywith dendritic cells transduced with adenovirus vector-encoding endogenous tu-mor-associated antigens. J. Immunol. 163: 699–707.

38. Agrawal, B., M. A. Reddish, M. J. Krantz, B. M. Longenecker. 1995. Doespregnancy immunize against breast cancer? Cancer Res. 55: 2257–2261.

39. Amelia, P., G. Missale, V. Lamonaca, P. Massimo, C. Mori, P. Zanelli,A. Cavalli, G. Elia, C. Ferrari. 2002. Intrahepatic and circulatin HLA class II-restricted hepatitis C virus-specific T cells: functional characterization in patientswith chronic hepatitis C. Hepatology 35: 1225–1236.

40. Gale, M., Jr., and E. M. Foy. 2005. Evasion of intracellular host defense byhepatitis C virus. Nature 438: 939–945.

6075The Journal of Immunology

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from