IL-4 and TAL1 in T-cell acute lymphoblastic leukemia ...repositorio.ul.pt/bitstream/10451/4846/3/ulsd061709_td_tese.pdf · microenvironmental cues and cell-autonomous ... studies

UNIVERSIDADE DE LISBOA

FACULDADE DE MEDICINA

IL-4 and TAL1 in T-cell acute lymphoblastic

leukemia: studies on the participation of

microenvironmental cues and cell-autonomous

alterations in leukemogenesis

Bruno António Caetano Cardoso

Doutoramento em Ciências Biomédicas

Especialidade em Ciências Morfológicas

2011

iii

UNIVERSIDADE DE LISBOA

FACULDADE DE MEDICINA

IL-4 and TAL1 in T-cell acute lymphoblastic

leukemia: studies on the participation of

microenvironmental cues and cell-autonomous

alterations in leukemogenesis

by

Bruno António Caetano Cardoso

Doutoramento em Ciências Biomédicas

Especialidade em Ciências Morfológicas

Orientador: Doutor João Taborda Barata

Co-orientador: Professora Doutora Leonor Parreira

2011

iv

Preface

v

Preface

This thesis describes the research work under the scope of my PhD project

developed between January of 2006 and July of 2010 at the Instituto de Medicina

Molecular (Lisbon, Portugal) under the supervision of João T. Barata, PhD. During this

period, part of the research work was also carried at the Utrecht Medical Centre

(Utrecht, Netherlands) under the supervision of Prof. Paul J. Coffer.

This thesis is organized in 6 chapters, which are preceded of a summary written in

Portuguese and an abstract briefly describing the work developed. In chapter 1 an

introductory review and the aims of the work are provided. The chapters 2, 3, 4 and 5

the original results are described and discussed. The chapter 6 comprises a generalized

discussion and the biological implications of the data described in this thesis.

The results presented in this thesis are the result of my own research work and it is

clearly acknowledged in the text whenever results or reagents produced by others were

utilized. I was financially supported by a scholarship from Programa SFRH

(SFRH/BD/24722/2005), Fundação para a Ciência e Tecnologia, Portugal. This work

has not been submitted for any degree at this or any university.

The opinions expressed in this publication are from the exclusive responsibility of

the author.

The impression of this thesis was approved by Conselho Científico da Faculdade

de Medicina de Lisboa on the 26th

of October 2011.

Acknowledgements

vi

Acknowledgements

O meu primeiro agradecimento vai para o Doutor João Barata, meu orientador e amigo.

Gostaria de agradecer pela oportunidade que me deu de fazer o que gosto e que sei, pela

experiência e aprendizagem que me proporcionou, pela paciência demonstrada (várias

foram as vezes que vi os seus cabelos levantarem), pela motivação demonstrada mesmo

quando tudo parecia perdido (e não foram poucas as vezes), pela insistência em que me

tornasse um investigador melhor. Sem a sua perseverança este trabalho não seria

possível. Gostaria acima de tudo de agradecer a amizade retribuída ao longo destes

anos, uma amizade sincera que fica e que muito estimo. Mestre, OBRIGADO.

Gostaria também agradecer à minha co-orientadora, a Professora Leonor Parreira pela

supervisão e entusiasmo demonstrado ao longo do meu doutoramento.

I special thank to Prof. Paul Coffer, for receiving in its laboratory during my PhD. I also

like to thank to all the members of Prof. Paul Coffer laboratory, particularly to Jorg van

Loosdregt and to Miranda Buitenhuis for their help and friendship during my stay in

Utrecht.

Os meus colegas de laboratório merecem um agradecimento especial, sem eles não seria

possível conduzir este projecto a bom termo. OBRIGADO pelos momentos fantásticos

na salinha P3C48 e por terem aturado as Brunices diárias, não deve ter sido fácil.

Obrigado jovem Ana Silva pela tua amizade, dedicação e ajuda em tudo o que precisei,

a IP de PTEN foi mesmo o ponto de viragem. Obrigado Cristina, tu de facto és a maior,

sem palavras. Obrigado Leilita, Ana Gírio, Nádia, Daniel, Leonor, Inês, Alice pelo

vosso apoio e pelo vosso entusiasmo. UBCA RULES pessoal. Um agradecimento

especial à Ana Gírio, Inês e Leonor que me puderam ajudar a rever a tese.

Os colegas com quem partilhamos o laboratório do lado também merecem um

agradecimento especial, Isabel, Hélia, Andreia, Zé e Ricardo. OBRIGADO, por tudo,

foi fantástico trabalhar ao vosso lado. Zé… sem palavras. Continua de pé a proposta?

Gostaria também de agradecer ao Prof. João Gonçalves e aos membros do seu

laboratório, em particular à Sylvie e à Mariana, por toda a ajuda e dedicação.

Gostaria de agradecer aos colaboradores do IMM que de alguma forma me ajudaram,

quer nos conselhos, quer naquele pozinho ou solução mágica que faltava na altura da

Acknowledgements

vii

experiência (Marinho eras sempre tu), quer simplesmente naquela pausa para café

(Marco, Jorge, RP). Gostaria de agradecer em especial à Maria Soares, Ana Caetano e

Isabel Pinto pelos Sortings; à Inês Domingues pela ajuda com a Radioactividade e com

os géis grandes e ao Sérgio de Almeida pela ajuda com os Chips. Gostaria também de

agradecer ao GDIMM por proporcionar uns belos jogos de bola e a todos os que neles

participam. Gostaria ainda de agradecer aos rapazes da aldeia: Rp, Marco, Daniel,

Filipe, Malino, Manel. Já vos tinha dito, foi um enorme prazer tocar com vocês, muito

OBRIGADO por aqueles momentos.

Malta, West side coast to coast, ortogonal… o resto já não digo. OBRIGADO pessoal,

Jojó, Mica, Davids, Piu-Piu, Folhini, Tusu, Chico Fresca, Joana e Laranjinha pela vossa

amizade, pela vossa motivação, pela vossa dedicação e por estarem aqui, sempre tão

perto. Um abraço especial ao Jojó que me reviu parte da tese.

Sergito, Pipas, Gentil, vocês não percebem nada disto mas obrigado na mesma, um dia

explico-vos o que fiz. Obrigado pela amizade, pelas jogatanas de bola e pelos concertos

memoráveis daqueles moços que vocês sabem quem são. Sergito obrigado pela

dedicação, pela confiança e pela companhia nos jogos dos nossos moços que tantas

alegrias nos proporcionaram.

Gostaria também de agradecer a uma Instituição muito especial, que prova ano após ano

o verdadeiro significado da palavra trabalho, sacrifício e dedicação sem nunca pedir

nada em troca apenas um mais que justo reconhecimento. Obrigado.

Gostaria de agradecer à minha família por todo o apoio que me prestaram, avós, tios,

primos, sogrinhos e cunhadinha. Aos meus pais devo tudo, por isso não existem

palavras para vos agradecer, mas cá vai OBRIGADO TONINHOS! Este trabalho

também é vosso.

Por fim gostaria de agradecer a uma pessoa incansável em todo este processo, quando as

coisas pareciam sem retorno, quando o acordar era apenas mais um acordar, quando a

ciência deixava de ter piada, ela não me deixava parar. Não é fácil agradecer a uma

pessoa que nos dá tudo. OBRIGADO PUDJI, por estares aqui quando precisei, por não

me deixares desistir quando era o mais fácil, por não me deixares desiludir, pela força

que me fizeste ver que tinha, pelas palavras naqueles dias difíceis e por todos os grandes

Acknowledgements

viii

e fantásticos momentos juntos. OBRIGADO, simplesmente por estares aqui. Este

trabalho é para ti. OBRIGADO PUDJI, POR TUDO.

A TODOS os que tornaram este trabalho possível, o meu sincero OBRIGADO.

Resumo

ix

Resumo

A Leucemia Linfoblástica Aguda (LLA) é o cancro mais frequente em crianças,

resultando da expansão clonal maligna de precursores linfóides. Aproximadamente 15%

dos doentes com LLA apresentam marcadores de células T (LLA-T). Embora os

regimes quimioterápicos actualmente em uso sejam bastante eficazes, existe ainda um

número significativo de doentes que recidivam. Além disso, os regimes intensivos de

quimioterapia estão normalmente associados a efeitos secundários consideráveis a

médio e longo prazo. Para melhor perceber a biologia da LLA-T e determinar novos

alvos terapêuticos é necessário perceber em que medida factores microambientais e

mecanismos intra-celulares influenciam a génese e a progressão da leucemia. A presente

tese procura identificar os mecanismos pelos quais tanto um factor extracelular (IL-4)

como um factor de transcrição celular (TAL1) podem participar no desenvolvimento e

progressão da leucemia.

A Interleucina-4 (IL-4) é uma citocina da cadeia comum-γ, produzida na medula

óssea, que estimula a proliferação in vitro de células LLA-T. No capítulo 2,

demonstramos que a IL-4 induz a progressão do ciclo celular da fase G0/G1 para as

fases S e G2/M em células LLA-T primárias, devido ao aumento da expressão das

ciclinas D2, E e A e à diminuição de expressão do inibidor de cinases dependentes de

ciclinas p27Kip1

. A transfecção de células LLA-T com a proteína de fusão VP22-p27Kip1

,

que é capaz de translocar para o citoplasma e núcleo das células alvo, impede a

proliferação mediada por IL-4. Além disso, a IL-4 estimula a activação de mTOR, como

demonstra o aumento de fosforilação dos seus alvos p70S6K

, S6 e 4E-BP1. A inibição da

sinalização mediada por mTOR com rapamicina impede o crescimento celular, a

progressão do ciclo celular e a proliferação de células LLA-T estimuladas por IL-4.

Estes resultados identificam mTOR como um regulador dos efeitos moleculares e

celulares promovidos por IL-4 em células LLA-T e fortalecem a hipótese do uso de

inibidores farmacológicos de mTOR no tratamento de doentes com LLA-T (Capítulo 2;

Cardoso et al. Leukemia 2009).

O factor de transcrição hélice-volta-hélice TAL1 é aberrantemente expresso em

quase 65% dos doentes com LLA-T. A proteína “Lim-only domain” LMO2, é

geralmente co-expressa com TAL1 neste tipo de leucemia. Estes genes parecem

contribuir para a génese da leucemia, visto que ratinhos transgénicos para TAL1 e

LMO2 desenvolvem leucemia com fenótipo de células T. No entanto, não se confirmou

Resumo

x

até hoje se TAL1 estará envolvido na génese da leucemia em seres humanos, ou apenas

secundariamente activado como resultado do processo de transformação em LLA-T.

Para responder a esta questão, transduzimos progenitores hematopoiéticos com TAL1

e/ou LMO2 e co-cultivamos estes progenitores com células estromais OP9-Dll1, que

têm a capacidade de induzir a diferenciação de células T in vitro. Descobrimos que os

genes TAL1 e LMO2 desregulam a diferenciação de células T em co-cultura com

células estromais. A expressão coordenada destes dois genes leva a um pequeno

aumento de precursores T CD3+CD4

+CD8

+ de tamanho celular aumentado. Esta

observação é particularmente interessante visto que se sabe que os blastos de pacientes

com LLA-T que expressam TAL1 apresentam um imunofenótipo idêntico. Estes

resultados preliminares mostram que TAL1 e LMO2 podem perturbar o normal

desenvolvimento de células T humanas, possivelmente predispondo os timócitos para

transformação maligna (Capítulo 3).

Com o intuito de identificar e caracterizar os eventuais alvos transcricionais

através dos quais TAL1 poderá gerar leucemia de células T, desenvolvemos um sistema

indutível em que a fusão de TAL1 com o domínio de ligação a hormonas (DLH) do

receptor de estrogénio (RE) permite a regulação fina da actividade de TAL1 numa linha

celular T sem expressão de TAL1 endógeno. Após tratamento com 4-Hidróxi-

Tamoxifeno (4HT), a proteína de fusão RE-TAL1 consegue translocar para o núcleo

celular e consequentemente activar o seu programa de trancrição. O perfil de expressão

da linha celular HPB-ALL estavelmente transduzida com a fusão RE-TAL1 e tratada

com 4HT revelou um total de 26 genes cuja expressão aumentou ou diminuiu após

activação de TAL1, em pelo menos 2 experiências independentes. Seleccionámos sete

genes com base na sua função e potencial interesse em cancro e confirmámos a

expressão diferencial de três (CASZ1, DMGDH e OR5M3) por PCR quantitativo em

tempo real. A transfecção de TAL1 numa outra linha celular LLA-T sem expressão

deste gene (P12), resulta igualmente num aumento da expressão destes genes. O

possível envolvimento de CASZ1 nos efeitos anti-apoptóticos e proliferativos mediados

por TAL1 em células LLA-T também foi investigado. A diminuição da expressão de

TAL1 com siRNA na linha celular Jurkat, que expressa TAL1 abundantemente, diminui

significativamente a expressão de CASZ1, e a perda de expressão correlacionacom

perda de viabilidade celular. Acresce que a diminuição da expressão de CASZ1 em

células Jurkat tem efeitos funcionais semelhantes aos que ocorrem após redução da

expressão de TAL1, nomeadamente diminuição da viabilidade celular e proliferação.

Resumo

xi

No geral, estes estudos permitiram a identificação de três novos genes alvo de TAL1,

com possível relevância funcional no contexto do potencial poder oncogénico de TAL1

(Capítulo 4)

TAL1 parece ter não apenas um papel de regulador positivo mas também de

repressor da transcrição. Não é, portanto, de surpreender que tenha sido demonstrado

anteriormente que TAL1 se pode associar a complexos de cromatina repressivos,

nomeadamente HDAC1, e que a incubação com inibidores de HDAC (iHDAC) induz

apoptose em células leucémicas derivadas de ratinhos transgénicos para TAL1. No

capítulo 5, avaliamos o impacto dos iHDAC em TAL1 numa perspectiva diferente,

nomeadamente analisando o seu impacto na expressão de TAL1 e não no impacto na

actividade transcricional. Os nossos estudos revelam que a incubação de células LLA-T

com iHDAC diminui drasticamente a expressão da proteína TAL1. Este efeito é devido

à diminuição da transcrição do gene TAL1 em células que mantêm o locus TAL1 intacto,

mas também devido à diminui da tradução de mRNAs TAL1 em células que contêm a

delecção TAL1d. Igualmente importante é o facto da apoptose induzida pelos iHDAC

ser inibida pela sobre-expressão de TAL1. Os nossos resultados indicam que o

programa apoptótico promovido pelos iHDAC em LLA-T é parcialmente dependente da

diminuição da expressão de TAL1 e sugerem que a integração de iHDAC no protocolo

de tratamento de doentes LLA-T pode trazer benefícios terapêuticos (Cardoso et al,

Leukemia 2011, advance online publication).

O conjunto dos estudos descritos nesta dissertação destacam a importância que os

factores micro-ambientais, como IL-4, podem ter na progressão de LLA-T (por

exemplo, activando mTOR e promovendo a progressão no ciclo celular) e mostram a

importância que factores celulares como TAL1, e também LMO2, podem ter na

predisposição de células T para a transformação maligna e na sobrevivência das células

LLA-T. Finalmente, os resultados desta tese demonstram que tanto factores

extracelulares como lesões intracelulares podem constituir alvos promissores para

intervenção terapêutica em LLA-T.

Abstract

xii

Abstract

Acute lymphoblastic leukemia (ALL) is the most frequent cancer found in

children and results from the clonal expansion of transformed lymphoid precursors.

Approximately 15% of pediatric ALL patients present with a T-cell phenotype (T-

ALL). Despite the recent improvements in the treatment of T-ALL, there are still a high

number of relapses and the intensive chemotherapeutic regiments used are associated

with long-term severe complications. In order to develop new therapeutic strategies that

can further increase efficacy while reducing side effects, one needs to better understand

the pathobiology of T-ALL. In particular, it is necessary to understand how

microenvironmental and cell-autonomous mechanisms influence the initiation and the

progression of leukemia. The present thesis has the preocupation of exploring the

mechanisms by which both an extracellular cue (IL-4) and a cell-intrinsic transcription

factor (TAL1) may partake in leukemia development and maintenance.

Interleukin-4 (IL-4) is a γ-common chain cytokine produced within the bone

marrow microenvironment that is known to promote the in vitro proliferation of T-ALL

cells. In Chapter 2, we present evidence that IL-4 induces primary T-ALL cell cycle

progression from G0/G1 into S and G2/M, by up-regulating cyclin D2, E and A and

down-regulating the cyclin-dependent kinase inhibitor p27kip1

. Transfection of T-ALL

cells with the VP22-p27kip1

fusion protein, which is able to translocate into the

cytoplasm and nucleus of target cells, abrogates IL-4-mediated proliferation. This

indicates that p27kip1

downregulation is mandatory for cell cycle progression of T-ALL

cells stimulated with IL-4. Furthermore, IL-4 stimulates mTOR activation, as

determined by increased phosphorylation of its downstream targets p70S6K

, S6 and 4E-

BP1. Inhibition of mTOR signaling with rapamycin prevents IL-4-induced T-ALL cell

growth, cell cycle progression and proliferation. Our results identify mTOR as a critical

regulator of IL-4-mediated effects in T-ALL cells and support the rationale for using

mTOR pharmacological inhibitors in T-ALL therapy (Cardoso et al. Leukemia 2009).

The basic helix-loop-helix transcription factor TAL1 is aberrantly expressed in up

to 65% of T-ALL patients. LMO2, a Lim-only domain protein, is often co-expressed

ectopically with TAL1 in this malignancy. These genes appear to have leukemogenic

potential, since both TAL1 and LMO2 transgenic mice develop leukemias of T-cell

phenotype. However, it is still unclear whether TAL1 is effectively leukemogenic in

humans, or whether merely participates as a secondary event in the transformation

Abstract

xiii

process in T-ALL. To address this question, we transduced hematopoietic progenitors

with TAL1 and/or LMO2 and co-cultured them with OP9-Dll1 stromal cells, which have

the capacity to induce T-cell differentiation in vitro. We found that TAL1 and LMO2

genes deregulate human T-cell differentiation in stromal cell co-cultures. Interestingly,

the coordinated expression of both TAL1 and LMO2 led to a relative increase in

CD3+CD4

+CD8

+ T-cell precursors with increased cell size. This observation is

particularly interesting given that TAL1-expressing patients normally display a similar

phenotype. These preliminary results show that TAL1 and LMO2 can disrupt normal

human T-cell development, therefore likely predisposing thymocytes to malignant

transformation (Chapter 3).

In our effort to characterize the mechanisms by which TAL1 might promote T-

cell leukemogenesis, we developed a TAL1 inducible system, by fusing TAL1 with the

hormone binding domain (HBD) of the estrogen receptor (ER), which we expressed in a

TAL1-negative T-cell line. Upon 4-Hydroxi-Tamoxifen (4OHT) treatment, ER-TAL1

fusion protein is able to translocate into the nucleus and consequently trigger its

transcriptional program. Gene expression profiling of 4OHT-treated HPB-ALL cells

stably transduced with the ER-TAL1 fusion revealed a total of 26 genes up- or down-

regulated by TAL1 activation, in at least two independent experiments. We selected

seven of those genes on the basis of their function/potential interest in cancer and

confirmed the differential expression of three (CASZ1, DMGDH and OR5M3) by qRT-

PCR. Accordingly, transfection of another TAL1-negative T-ALL cell line, P12, with

TAL1, also led to increased expression of the validated TAL1 target genes. The possible

involvement of CASZ1 in TAL1-mediated anti-apoptotic and proliferative effects in T-

ALL cells was subsequently investigated. Knock-down of TAL1 with siRNA in the

TAL1-positive T-ALL cell line Jurkat decreased the expression of CASZ1, correlating

with loss of cell viability. Moreover, CASZ1 knockdown in Jurkat cells led to

functional effects similar to those of TAL1 knockdown, namely a decrease in survival

and proliferation. Overall, these studies allowed the identification of three novel TAL1

downstream targets, likely with functional relevance for TAL1-mediated leukemogenic

potential (Chapter 4).

TAL1 binds to repressive chromatin complexes, namely involving HDAC1, and

incubation with HDAC inhibitors (HDACis) promotes apoptosis of leukemia cells

derived from TAL1 transgenic mice. In Chapter 5, we evaluated the impact of HDACis

on TAL1 from a somewhat different perspective, namely by analyzing their impact on

Abstract

xiv

TAL1 expression rather than transcriptional activity. We found that incubation of T-

ALL cells with HDACis strikingly down-regulates TAL1 protein expression. This is

due to decreased TAL1 gene transcription in cells with an intact TAL1 locus, and to

impaired TAL1 mRNA translation in cells that harbor the TAL1d deletion. Importantly,

HDACi-induced apoptosis of T-ALL cells is significantly reversed by TAL1 forced

over-expression. Our results indicate that the HDACi-mediated apoptotic program in T-

ALL cells is partially dependent on the down-regulation of TAL1 expression, and

suggest that integration of HDACis into T-ALL treatment protocol may be of potential

therapeutic benefit (Cardoso et al, Leukemia 2011, advance online publication).

Taken together, the results described in this thesis highlight the importance that

microenviromental factors, such as IL-4, might have in the progression of T-ALL (for

instance, by activating mTOR and promoting cell cycle progression), and hint on the

importance that cell-autonomous factors, such as TAL1 and LMO2, may have in

predisposing T-cells for malignant transformation and promoting survival of T-ALL

cells. Importantly, our results further demonstrate that both extracellular cues and

intracellular molecular lesions can constitute targets for therapeutic intervention in T-

ALL.

Abbreviations

xv

Abbreviations

ABC ATP-Binding Cassette

Act D Actinomycin D

ALL Acute Lymphoblastic Leukemia

AML Acute Myeloid Leukemia

APC Allophycocyanin

B-ALL B-cell Acute Lymphoblastic Leukemia

bHLH basic Helix-Loop-Helix

BM Bone Marrow

BrdU Bromodeoxyuridine (5-bromo-2-deoxyuridine)

BSA Bovine Serum Albumin

CALM Clathrin Assembly protein-like Lymphoid-Myeloid

CBHA m-Carboxycinnamic Acid bis-Hydroxamide

CD Cluster of Differentiation

CDK Cyclin Dependent Kinase

cDNA Complementary Deoxyribonucleic Acid

CHIP Carboxyl terminus of Hsc70 Interacting Protein

ChIP Chromatin Immunoprecipitation

CHX Cycloheximide

CK2 Casein Kinase 2

CLP Common Lymphoid Precursor

CML Chronic Myeloid Leukemia

CMV Cytomegalovirus

CNS Central Nervous System

CSF Colony-Stimulating Factor

Dll1 Delta-like protein 1

DMEM Dubelco‟s Modified Eagle Medium

Abbreviations

xvi

DMGDH Dimethylglycine Dehydrogenase

DMSO Dimethyl Sulphoxide

DN Double Negative

DNA Deoxyribonucleic Acid

DNMT DNA methytransferase

DP Double Positive

eGFP Enhanced Green Fluorescent Protein

EGIL European Group for Immunological Characterization of

Leukemias

eIF4E Eukaryotic Initiation Factor 4E

EPO Erythropoietin

ER Estrogen Receptor

ERK Extracellular signal-Regulated Kinase

ETP Early Thymic Progenitors

FACS Flow Activated Cell Sorting

FBS Fetal Bovine Serum

FITC Fluorescein Isothiocyanate

FGF16 Fibroblast Growth Factor 16

FSC Forward Scattered Light

γC Gamma-Common chain

GFP Green Fluorescent Protein

GPA Glycophorin A

GPCRs G-Protein Coupled Receptors

HA Hemaglutinin

HAT Histone Acetyl Transferase

HBD Hormone Binding Domain

HDAC Histone Deacetylase

Abbreviations

xvii

HDACi(s) Histone Deacetylase Inhibitor(s)

HLH Helix Loop Helix

hPGK Human Phosphoglycerate Kinase promoter

HP1 Heterochromatin Protein 1

HRP Horseradish Peroxidase

HSC Hematopoietic Stem Cells

HSP Heat Shock Protein

HSP90 Heat Shock Protein 90

H3K9Ac Acetylated Histone H3 at Lysine 9

ICN Intracellular Notch

IFN Interferon

IL Interleukin

IMDM Iscove‟s Modified Dulbecco‟s Medium

IRES Internal Ribossomal Entry Site

IR4 Insulin-IL-4 Receptor motif

ISP Immature Single Positive

JAK Janus Kinase/ Just Another Kinase

KDa KiloDalton

LCK Lymphoid Cell Kinase

LTR Long Terminal Repeat

MAPK Mitogen-Activated Protein Kinase

MEK Mitogen activated and ERK related Kinase

MEM Minimum Essential Medium

MHC Major Histocompatibility Complex

MLL Mixed Lineage Leukemia

MRD Minimal-Residual-Disease

mTOR Mammalian Target of Rapamycin

Abbreviations

xviii

mTORC1 mTOR Complex 1

mTORC2 mTOR Complex 2

MW Molecular Weight

NAD Nicotinamide Adenine Dinucleotide

NLS Nuclear Localization Signal

ORs Olfactory Receptors

PARP Poly ADP Ribose Polymerase

PB Phenyl Butyrate

PBS Phosphate Buffered Saline

PCR Polimerase Chain Reaction

PDK1 Phosphoinositide-Dependent Kinase 1

PE Phycoerythrin

PerCP Peridinin Chlorophyll Protein

PFA Paraformaldehyde

PGS PBS Gelatin Saponin

PH Plecstrin Homology

PIP2 Phosphatidyl-Inositol-4,5-Biphosphate

PIP3 Phosphatidyl-Inositol-3, 4, 5-Triphosphate

PI3K Phospho-Inositol-3 Kinase

PKA Protein Kinase A

PKB Protein Kinase B (c-Akt)

PKC Protein Kinase C

PTEN Phosphatase and Tensin Homolog

RA Retinoic Acid

RAG Recombination Activation Gene

RALDH2 Retinaldehyde Dehydrogenase 2

RB Retinoblastoma protein

Abbreviations

xix

RNA Ribonucleic Acid

ROS Reactive Oxygen Species

RPMI Roswell Park Memorial Institute medium

RT-PCR Reverse Transcriptase PCR

RTK Receptor Tyrosine Kinase

SAHA Suberoylanilide Hydroxamic Acid

SB Sodium Butyrate

SCID Severe Combined Immunodefficiency

SCL Stem Cell Leukemia (TAL1)

SDS Sodium-Dodecyl-Sulfate

SDS-PAGE SDS Polyacrylamide Gel Electrophoresis

Ser Serine

SIL SCL-Interrupting Locus

SP Single Positive

SPB Sodium Phenyl Butyrate

SSC Side Scattered Light

STAT Signal Transducer and Activator of Transcription

T-ALL T-cell Acute Lymphoblastic Leukemia

TAL1 T-cell Acute Lymphocytic Leukemia protein 1 (SCL)

TAN1 Translocation Associated Notch1

TBP-2 Thioredoxin Binding Protein 2

TCR T-cell Receptor

TCRA/D T-cell Receptor α/δ gene

TCRB T-cell Receptor β gene

TCRG T-cell Receptor γ gene

TEC Thymic Epithelial Cells

TGF-β Transforming Growth Factor –β

Abbreviations

xx

Thr Threonine

TNF Tumor Necrosis Factor

TRX Thioredoxin

TSC Tuberous Sclerosis Complex

TSA Trichostatin A

UCB Umbilical Cord-Blood

UV Ultraviolet light

VPA Valproic Acid

VSVG Vesicular Stomatitis Virus protein G

ZAP70 Zeta-chain Associated Protein kinase 70

4EBP1 eIF4E Binding Protein 1

4OHT 4-Hydroxy-Tamoxifen

7-AAD 7-Amino-Actinomycin D

Table of Contents

xxi

Table of Contents

Preface v

Acknowledgements vi

Resumo ix

Abstract xii

Abbreviations xv

Table of Contents xxi

Index of Figures xxvi

Index of Tables xxx

Chapter 1. Introduction 1

Cancer 2

Leukemia 3

Acute Lymphoblastic Leukemia (ALL) 4

Diagnosis and Treatment 5

T-cell Acute Lymphoblastic Leukemia (T-ALL) 6

Normal T-cell development 7

T-ALL Immunophenotypical Classification 10

Extracellular factors and Microenvironment 10

Cytokine signaling in T-ALL 12

The IL-4/IL-4 receptor signaling axis 12

Genetic abnormalities in T-ALL 14

Cell cycle defects 14

Table of Contents

xxii

Aberrant signaling 15

The PI3K-mTOR pathway 18

An overview 18

Importance in T-ALL 21

Transcription factors 21

The TAL1/SCL oncogene 25

TAL1, more than a key player in leukemia 27

TAL1: structure and function 28

TAL1 target genes 30

Signaling to TAL1 32

TAL1 in normal development 33

Genome Organization 35

Nucleosomes and Histones 35

Histone Acetyl Transferases (HATs) and Histone Deacetylases

(HDACs) 36

HATs 37

HDACs 38

HDAC inhibitors (HDACis) 39

HDACis and gene expression 40

The effect of HDACis on cancer cells 43

Objectives 45

References 46

Chapter 2. Interleukin-4 stimulates proliferation and growth of

T-cell acute lymphoblastic leukemia cells by activating mTOR

signaling 84

Abstract 85

Introduction 85

Materials and Methods 86

Table of Contents

xxiii

Results and Discussion 88

IL-4 signaling promotes proliferation of T-ALL cells by inducing

cell cycle progression 88

IL4 down-regulates p27Kip1

and up-regulates cyclin expression, CDK

activity and Rb hyperphosphorylation 91

Activation of mTOR pathway is mandatory for IL4 induced

proliferation 92

References 94

Chapter 3. TAL1 and LMO2 ectopic expression in human T-

cell progenitors impacts T-cell development in vitro 96

Abstract 97

Introduction 97

Materials and Methods 99

Results 103

Establishment of a system to simultaneously transduce target cells

with three genes 103

Detection of TAL1 and LMO2 in cord-blood CD34+CD38

- cells

105

Forced TAL1 and LMO2 expression in CD34+CD38

- affect human T-

cell differentiation in vitro 106

High TAL1 and LMO2 expression in human thymic progenitors

increases cell proliferation and has a striking effect on T-cell

differentiation 108

Discussion 110

References 112

Table of Contents

xxiv

Chapter 4. Identification of novel TAL1 target genes with

potential impact on T-cell acute lymphoblastic leukemia 118

Abstract 119

Introduction 119

Materials and Methods 120

Results 125

TAL1 inducible system 125

TAL1 activity up-regulates genes associated with cancer 127

CASZ1, DMGDH and OR5M3 are potential TAL1 target genes 129

CASZ1 knock-down decreases T-ALL cell viability and

proliferation 130

Discussion 132

References 134

Chapter 5. TAL1 is down-regulated upon histone deacetylase

inhibition in T-cell acute lymphoblastic leukemia cells 139

Abstract 140

Introduction 140

Materials and Methods 141

Results 145

HDAC inhibition down-regulates TAL1 protein levels in T-ALL

cells 145

HDACi-mediated TAL1 protein down-regulation in T-ALL cells is

not due to increased apoptosis or protein degradation. 146

HDAC inhibition down-regulates TAL1 transcript levels without

affecting TAL1 splicing or mRNA stability 148

Table of Contents

xxv

HDAC inhibition abrogates TAL1 transcription in TAL1-positive

T-ALL cells with an intact TAL1 locus 150

HDAC inhibition up-regulates TAL1 transcripts in T-ALL cells with

TAL1d

151

HDAC inhibition down-regulates TAL1 protein levels by decreasing

translation in T-ALL cells with TAL1d

152

Forced TAL1 expression partially rescues T-ALL cell death induced

by HDAC inhibition 153

Discussion 153

References 156

Chapter 6. Discussion 169

Cytokine signaling in T-ALL: the role of IL-4 170

Is TAL1 a human oncogene? 172

Novel TAL1 target genes in T-ALL and beyond 174

HDAC inhibitors: a novel therapeutic approach in T-ALL? 176

Acetylation, a new clue on TAL1 regulation? 177

Concluding Remarks 178

References 181

Index of Figures

xxvi

Index of Figures

Chapter 1

Figure 1.1. Human T-cell differentiation 8

Figure 1.2. An overview of the PI3K-mTOR signaling pathway.

19

Figure 1.3. Structural comparison of the TAL1 locus and SIL-TAL1

gene rearrangements 27

.

Chapter 2

Figure 2.1. IL-4 stimulates cell cycle progression of primary T-ALL

cells. 90

Figure 2.2. IL-4-mediated activation of mTOR pathway is critical

for cell cycle progression of T-ALL cells. 93

Chapter 3

Figure 3.1.Transduction of MAT vectors into 293T and

CD34+CD38

- cord blood cells. 104

Figure 3.2. Coordinated expression of TAL1 and LMO2 in human

hematopoietic progenitors promotes cell growth and leads to the

differentiation of CD3+CD4

+CD8

+ cells. 107

Figure 3.3. High TAL1 and LMO2 expression in human T-cell

progenitors disrupts normal T-cell differentiation. 109

Index of Figures

xxvii

Chapter 4

Figure 4.1. Overview of the TAL1 inducible system. 126

Figure 4.2. Venn diagram of the number of genes differentially

expressed in each of three independent experiments upon TAL1

activity induction. 127

Figure 4.3. CASZ1, DMGDH and OR5M3 are potential TAL1-target

genes. 129

Figure 4.4 . CASZ1 knock-down decreases T-ALL cell viability and

proliferation 131

Chapter 5

Figure 5.1. HDACis down-regulate TAL1 protein in T-ALL cells.

145

Figure 5.2. HDACi-mediated TAL1 protein down-regulation is not

due to increased apoptosis or increased protein degradation. 147

Figure 5.3. HDACis down-regulate TAL1 through inhibition of

TAL1 gene transcription in TAL1wt

T-ALL cells lines. 149

Figure 5.4. HDACis down-regulate TAL1 by affecting TAL1

protein translation in TAL1d T-ALL cell lines. 151

Figure 5.5. Enforced TAL1 expression partially rescues HDACi-

mediated T-ALL cell death. 154

Index of Figures

xxviii

Supplementary Figure 5.1. HDACi-mediated down-regulation of

TAL1 mRNA is not due to increased apoptosis in TAL1wt

T-ALL cell

lines. 162

Supplementary Figure 5.2. HDACis up-regulate CDKN1A/p21

mRNA expression. 162

Supplementary Figure 5.3. Schematic representation of TAL1 locus

and the primers used to detect total and processed TAL1 mRNA.

163

Supplementary Figure 5.4. TAL1d-expressing T-ALL cells up-

regulated TAL1 mRNA upon HDACi treatment 164

Supplementary Figure 5.5. HDACis induce T-ALL cell death.

165

Supplementary Figure 5.6. Enforced TAL1 expression partially

rescues HDACi-mediated apoptosis of Jurkat cells. 166

Supplementary Figure 5.7 Model for HDACi-mediated TAL1

down-regulation in T-ALL cells. 167

Supplementary Figure 5.8. TAL1 expression is not affect by

inhibition of PI3K and mTOR. 168

Chapter 6

Figure 6.1. IL-4 signaling promotes the proliferation of T-ALL cells

through the activation of the mTOR pathway 171

Index of Figures

xxix

Figure 6.2. Several hypothetical mechanisms could explain TAL1-

mediated up-regulation of CASZ1, DMGDH and OR5M3. 176

Figure 6.3. The role of the extra-cellular cues and cell-autonomous

mechanisms in the progression of T-ALL. 180

Index of Tables

xxx

Index of Tables

Chapter 1

Table 1.1. T-cell receptor genes and their involvement in the

chromosomal translocations in T-ALL. 22

Table 1.2. Chromosomal aberrations involving the TAL1 gene in

T-ALL. 25

Table 1.3. List of the genes whose expression has been shown to be

directly regulated by TAL1. 30

Table 1.4. Charactheristics of human Histone Deacetylases

(HDACs). 38

Table 1.5. Classification of the commonly used HDAC inhibitors

(HDACis) 41

Chapter 2

Table 2.1. Immunophenotype, classification, and response to IL-4 of

primary T-ALL specimens 89

Index of Tables

xxxi

Chapter 3

Table 3.1. List of primers used in the cloning of the MAT plasmids

99

Table 3.2. List of primers used in semi-quantitative-PCR 103

Chapter 4

Table 4.1. List of primers used in the cloning procedures 121

Table 4.2. List of primers for quantitative and semi-quantitative-

PCR. 123

Table 4.3. List of genes identified in the microarray experiments

(similarly regulated in at least 2 of 3 experiments). 128

Chapter 5

Table 5.1. List of primers used in quantitative-PCR. 144

Table 5.2. List of primers used in Chromatin Immunoprecipitation

experiments. 144

Index of Tables

xxxii

Introduction

1

Chapter 1

INTRODUCTION

Introduction

2

Cancer

The first known reports describing cancer in human patients were written on

papyrus in the ancient Egypt. However, the term cancer was introduced later on by the

Greek physician Hippocrates, the father of Medicine. Hippocrates used the term

Karcinus to describe ulcer-forming tumors due to their projections that resemble the

shape of a crab. Later, the Roman physician Celsus translated the word Karcinus to the

latin word Cancer (1).

What exactly is a cancer? To better understand its definition, one should first

realize that it is not a synonym of tumor. The latter is a swelling or mass, and is one of

the four classical signs of inflammation (calor, dolor, rubor, and tumor: heat, pain,

redness, and swelling) as originally recorded by Celsus in the 1st century A.D.

However, a tumor can also arise from the process of neoplasia, which literally means

“new growth”. Neoplasia is the process by which cell proliferation occurs in an

uncontrolled fashion, exceeding normal growth and persisting at the expense of the

host. As a result, for example, of an accumulation of genomic and/or epigenomic

alterations, normal cells can alter their behavior and start an independent program that

does not obey to the rules imposed upon their surrounding neighbours. Consequently, a

population of cells, which started from a single clone, will grow abnormally and form a

mass of cells with an unstructured, simpler architure than that of a normal tissue. Such

an abnormal mass of cells within a normal tissue, not necessarily resulting from an

inflammatory process, is evidently also called a tumor (2, 3). Currently, the term is

often used as a synonym of neoplasia; however, as stated above, tumor refers to the

mass of abnormal cells while neoplasia refers to the process of tumor formation due to

uncontrolled cellular growth (2, 3).

Tumors can be classified as benign or malignant depending on the type of growth

and degree of aggressiveness to the organism. Benign tumors are charactherized by a

slower, localized growth, which occurs by expansion (encapsulated) and therefore does

not result in invasion of surrounding tissues, intravasation or metastasis. This type of

tumors is also generally indolent to their hosts, except when the expansion of benign

tumors interferes with vital organs or tissues. On the other hand, malignant tumors

generally grow rapidly; invade surrounding tissues with very significant impact on

overall architecture, and eventually metastize. Malignant tumors are generally life

Introduction

3

threatening since they colonize vital organs, thereby compromising the normal

physiology of a living organism (2-4).

Knowing what malignant tumors are, one can now properly introduce the

definition of cancer. Cancer is the general term to encompass a high number of diseases

that are caused by malignant tumors (3). Currently, cancer is commonly used as

synonym of malignant tumor (2, 4).

These definitions, useful as they are at the systemic level, do not allow us to fully

grasp the nature of the cells that originate cancer. This relates to the fact that one often

has far more knowledge concerning the consequences than insights into the etiology and

biology of the disease. Nonetheless, strong efforts have been made throughout the years

to identify the essential characteristics of cancer cells. Two seminal reviews by Douglas

Hanahan and Robert Weinberg, summarized decades of research into the proposal that

all cancer cells can be defined as displaying a common set of features that includes

abnormal and uncontrolled growth, high proliferative capacity, insensitivity to death

signals, capacity to promote angiogenesis, deregulated metabolism, genetic instability,

immune evasion capacity and also the ability to spread systemically to other tissues and

organs compromising their normal physiology (5, 6). Whether all cancer cells must

simulateously display all these features is a matter of debate. For some authors the

ability of cancer cells to form metastasis is the only true hallmark of cancer (7).

While cancer progression depends on many factors that extend well beyond the

cancer cell itself, cancer is mainly a genetic disease, caused by mutations in the DNA.

These genetic mutations are associated with the loss of function in tumor-suppressor

genes and gain-of-function in oncogenes (8), occuring in genes that control mechanisms

essential to the normal cellular physiology, such as components of the cell cycle

machinery, apoptosis, metabolism and also signaling pathways (5, 6).

Leukemia

The organism is constantly renewing the pool of blood cells. Hematopoiesis is the

process of formation and development of new blood cells. Leukemia results from the

deregulation of this process by malignant transformation (9, 10).

In 1845, a patient with a massive accumulation of white blood cells and advanced

chronic disease was reported by Dr. Rudolph Virchow, which termed the condition

“weisses blut”, the German expression for “white blood”. Two years later, Virchow

Introduction

4

renamed the term and called it Leukemia, derived from the Greek work “Leukämie”

(11).Leukemia is therefore the designation for blood cell cancer, and it is generally

characterized by the accumulation of immature cells from a particular hematopoietic

lineage. Currently, leukemia is classified according to the lineage of the transformed

cells (lymphoid versus myeloid) and to the proliferation state of the cells (acute versus

chronic) (12). Historically, “acute” and “chronic” referred to the relative time-span of

survival of patients when effective therapy was not available. However, therapeutic

improvements led to the redefinition of these terms, in such way that presently “acute”

is used to characterize leukemias displaying rapid proliferation of blast cells, whereas

“chronic” refers to leukemias with slower proliferation of malignant cells that are in

general relatively well differentiated (12).

Acute Lymphoblastic Leukemia (ALL)

The incidence of leukemia varies with age. In adults, chronic leukemias are more

frequent than acute leukemias (12). In contrast, acute lymphoblastic leukemia (ALL) is

not only the most common form of leukemia but also the most common cancer in

children, accounting for roughly 25% of all the pediatric cancers (12). ALL is a very

heterogeneous disease with variations at the level of the cellular morphology,

immunological markers and cytogenetic abnormalities. The disease results from the

clonal accumulation of immature cells with either B-cell or T-cell markers that are

developing in the bone marrow (BM) or in the thymus (13).

The precise biological mechanisms that lead to the development of ALL are still

largely unknown. Nevertheless, it is generally accepted that ALL malignant

transformation is a multistep process that involves the deregulation of genes that affect

lymphoid homeostasis (via regulation of cell cycle or apoptosis) and normal

hematopoietic development (13, 14).

Chromosomal translocations are the hallmark of ALL (15). The development of

lymphocytes is characterized by sequential gene rearrangements that produce functional

B and T-cell receptors, and the RAG1 and RAG2 enzymes are the proteins responsible

for this process (16). In several cases of ALL, deregulation of the activity of RAG

proteins appears to be responsible for the formation of chimeric proteins, such as TEL-

AML1 (17) but also for the aberrant expression of oncogenes such as TAL1/SCL (18).

These abnormal events are highly associated with ALL (15).

Introduction

5

The occurrence of ALL is higher in industrialized countries (e.g. Italy, USA, and

Switzerland), whereas in developing countries the incidence is significantly lower. The

exact reasons for this epidemiological observation remain a matter of debate. In

addition, the frequency of ALL varies with age. The occurrence is higher at early ages,

peaking at the age of 1 to 4 years with a frequency of 7 cases per 100.000 persons. ALL

frequency declines with time and stabilizes at the occurrence of 1-2 cases per 100.000

persons (19).

Diagnosis and Treatment

The majority of ALL symptoms are associated with the disruption of normal

hematopoiesis. These symptoms include fever, anemia and bone and joint pain. Other

manisfestations such as fatigue, shortness of breath and dizziness are associated with

anemia as a result of the decrease in red blood cell count. Enlargement of organs such as

spleen, liver, lymph nodes and appearance of mediastinal masses are manifestations that

occur upon the progression of the disease. The involvement of the central nervous

system (CNS) is also a common feature, resulting in the appearance of symptoms like

headache, nausea, vomiting, lethargy and cranial nerve dysfunction. The diagnostic of

ALL is achieved when the presence of these symptoms is associated with the molecular,

cytogenetic and immunophenotypic characterization of the leukemic blasts (19).

The treatment of ALL patients has been improving over time with the systematic

testing of new therapies in clinical trials. The use of risk adjusted and intensive

chemotherapy improved dramatically the overall survival rate of ALL patients.

Currently, the overall survival rate of ALL patients is about 80%, however, recent

clinical trials suggest that it can be above 90% (20). Since, as mentioned above, ALL is

a heterogeneous disease, several biological and clinical factors determine the design of

the therapy. The factors that influence the design include the age of the patient,

leukocyte count, genetic characteristics of the leukemic blasts and the early response to

the chemotherapeutic regiment (19).

With few exceptions, the treatment of ALL patients consists in a therapeutic

program that comprises three phases: the remission induction, the

consolidation/intensification phase and elimination of minimal-residual disease (MRD),

also known as continuation therapy. The treatment of ALL also includes therapy

directed to the CNS to prevent the accumulation of leukemic cells in the brain (19, 21).

Introduction

6

The objective of the remission induction phase is to reduce by 99% the initial leukemic

burden and restore normal hematopoiesis. During this initial stage, three drugs are

administrated: a glucocorticoid (prednisone or dexamethasone), vincristine and

asparaginase or an anthracycline such as doxorubicin or daunorubicin. This is a

common protocol for remission induction. However, several adaptations can be made.

Children at very-high risk and adult patients can be treated with additional drugs. ALL

patients of T-cell phenotype (which are frequently included in the high risk group) also

receive treatment with cyclophosphamide. With the current protocols remission is

achieved in 99% of children and 93% of adult ALL patients (21). When normal

hematopoiesis is restored, the intensification phase aims to eradicate the drug-resistant

leukemic cells (and/or leukemic stem cells). There is still no consensus regarding the

duration and the drugs used in the intensification/consolidation-phase. Nonetheless, the

common protocols include the use of several drugs in combination – for example,

combination of methotrexate and 6-mercaptopurine; L-asparginase; dexamethasone;

vincristine; doxorubicin; the combination of thioguanine and cyclophosphamide and

also an epipodophyllotoxin and cytarabine. Stem cell or bone marrow transplantation is

also an option of treatment, but it is usually only applied to high-risk ALL patients that

include patients with the t(9;22)(q34;q11) translocation and cases with initial poor

response to treatment (20).

The remarkable advances in the efficacy of the treatment of ALL are somewhat

hampered by the realization that the intensity of the chemotherapeutic strategies used to

guarantee success are associated with severe long-term side-effects, including

osteonecrosis (22), decreased bone mineral density (23), thrombocytic complications

(24) and cognitive impairment (25). Currently, efforts are still being made to develop

new therapeutic strategies to treat the incurable cases of ALL and to diminish the severe

side effects associated with the intensive treatments regiments.

T-cell Acute Lymphoblastic Leukemia (T-ALL)

Approximately 15% of pediatric ALL patients present with a T-cell phenotype

cases, and in adults the percentage increases up to 25% (15, 26). T-cell acute

lymphoblastic leukemia (T-ALL) is a highly aggressive malignancy (13), and

historically, T-ALL was associated with a poorer prognosis. However, intensive and

risk adjusted chemotherapy led to improved outcome in this disease (27-29). Currently,

Introduction

7

the overall survival rate of T-ALL cases is about 80% in childhood T-ALL and 40-60%

in the adult cases (30).

As described for ALL in general, the main molecular mechanisms behind the

origin of T-ALL are still largely unknown. It is currently accepted that T-cell

leukemogenesis is a stepwise process that culminates in the acquisition of a fully

malignant phenotype. These events include defects in the control of cell cycle

machinery, NOTCH1 mutations that confer self renewal capacity to thymic progenitors,

deregulated expression of pivotal transcription factors and also aberrant activation of

protein kinases (14).

Normal T-cell development

Whatever the exact molecular mechanisms that trigger T-ALL, the malignant

clones originate from precursor cells arrested at a certain T-cell developmental stage.

Thus, to better understand the „framework‟ in which T-ALL occurs, we will briefly

characterize the normal T-cell developmental process.

T-cell development occurs in specialized lymphoid organs. It starts in the bone

marrow and culminates in the thymus, where most of the differentiation occurs (Figure

1.1). The hematopoietic progenitor that gives rise to T-cells arises in the bone marrow

and expresses the CD34 surface marker, indicating that it still maintains some

hematopoietic stem cell (HSC) properties. In fact, evidence suggests that this progenitor

is a Common Lymphoid Progenitor (CLP) with the potential to become a B or a T-cell.

The CLP subsequently migrates to the thymus, the organ where mature T-cells are

produced (31, 32). The commitment to the T-cell lineage depends on the signals derived

from the thymic microenvironment where the Notch signaling has been shown to play

an important role (33-35). During this stage, the early T-cell progenitors also rely on

microenvironmental cues, most notably IL-7, to survive and proliferate (36). After some

rounds of division these early thymocytes start to rearrange the genes that code for the

T-cell receptor (TCR) chains. The TCR is a transmembrane heterodimer composed of

two chains, α and β chains in the αβ T-cell lineage, while T-cells from the δ lineage

contain and δ chains.

Introduction

8

Introduction

9

The δ T-cells are a peculiar and minor subpopulation of T-cells that are important

effectors of innate immunity (37, 38), whereas most T-cells display an αβ TCR and are

involved in adaptive immunity. Each αβ TCR is unique and only recognizes a specific

antigen that is presented by Major Histocompatibility Complex (MHC) molecules (14).

The genomic regions that contain the coding sequence for the different TCR

chains are organized in gene clusters that contain variable (V), diversity (D), joining (J)

and constant (C) gene segments. During T-cell differentiation the RAG1 and RAG2

enzymes are responsible for rearranging the different gene segments to produce a

functional TCR chain by random choice of the V, D and J gene segments. These

recombination events are highly regulated during T-cell differentiation and take place

during specific maturation stages (39). Notably, deregulation of these mechanisms has

been shown to account for the high frequency of translocations involving TCR loci in

T-ALL.

The first chains to be rearranged are the δ, and β (14, 31, 32). Concomitantly

with TCR β gene rearrangement, thymocytes up-regulate the expression of CD4 and

CD8 co-receptors while down-regulating the expression of CD34 (14, 32). Productive

Figure 1.1. Human T-cell differentiation. The majority of T-cell development processes

occur in the thymus. A common lymphoid progenitor with a CD34+ CD1a

- phenotype

migrates from the bone marrow to colonize the thymus. In the initial stage of

differentiation, the thymocyte precursors lack the expression of CD4 and CD8 markers and

are thus called double negative precursors (DN). DN thymocytes receive signals from the

thymic microenvironment to proliferate, particularly from the IL-7 cytokine. The

thymocytes begin the recombination of the genes encoding TCR , δ and β chains. The δ

lineage originates at this stage (Pre-T1). Thymocytes first acquire the expression of CD4

(intermediate single positive, ISP) and start the down-regulation of the CD34 marker, while

subsequently upregulating CD8 to become CD4+CD8

+ double positive (DP) precursors. At

the DP stage the thymocytes assemble the pre-TCR. The signals derived from this receptor

expand this thymocyte population dramatically. The rearrangement of TCR α chain

eventually produces a functional TCR at the cellular membrane. Thymocytes interact with

thymic epithelial cells (TECs) to select functional and competent T-cells. Upon the

selection process, thymocytes keep the expression of either CD4 or CD8, becoming single

positive cells (SP) and move to the peripheral lymphoid organs. Further details are

described in the text.

Introduction

10

rearrangement of the TCRβ gene results in the surface expression of a β-chain that

assembles at the cellular membrane with an invariant pTα chain and CD3 to form the

pre-TCR (40). The formation of a functional pre-TCR complex activates signaling

pathways that promote survival and proliferation of the developing T-cells (41), and

ultimately triggers the rearrangements in the TCRα gene locus, also inhibiting further

rearrangements at the β chain locus (14). The thymocytes with functional αβ TCR

undergo positive and negative selection processes that ultimely result in a pool of T-

cells that only react to foreign antigens presented by MHC molecules. Thymocytes with

an αβ TCR that recognizes with low affinity self antigens presented at MHC molecules

by thymic epithelial cells (TECs) are positively selected and escape apoptosis while

those that do not detect any antigen die by neglect and those with a high affinity are

eliminated by clonal delection (negative selection) to avoid self-reactivity (14). During

the process of positive selection, thymocytes that express both CD4 and CD8 co-

receptors are selected into single positive T-cells that express either CD4 (which

recognizes antigens presented by MHC class II molecules) or CD8 (which recognizes

antigens presented by MHC class I). Functionally mature single-positive thymocytes

subsequently migrate to peripheral lymphoid tissues and, upon recognition of

appropriate antigens, lead to the activation of CD4 helper T-cell and CD8 cytotoxic T-

cell responses (14, 31).

T-ALL Immunophenotypical Classification

Several classifications based on the thymocyte developmental stage at which the

leukemic cells are supposedly blocked have been proposed to divide T-ALL into

discrete immunophenotyic subgroups. In this thesis we adopted the classification by the

European Group for the Immunological Characterization of Leukemias (EGIL) (42),

which is arguably the most generally accepted. This classification divides T-ALL into

four groups according to the following criteria: pro-T-ALL (CD7+ only), pre-T-ALL

(CD7+, CD1

-, CD2 and/or CD5 and/or CD8

+, CD3

-), cortical T-ALL (CD1

+,

independently of the presence of other markers) and mature T-ALL (CD1-, CD3

+) (42).

Extracellular factors and Microenvironment

Cancer cells are not isolated, cells from both solid cancers and leukemias interact

with the surrounding environment. The microenvironment contributes to the proper

Introduction

11

development of the tissues by providing adequate signals to the developing cells,

including proliferation, survival or apoptotic and differentiation signals. The malignant

cells also perceive these signals but, due to their intrinsic proliferative and anti-

apoptotic capacities, do so in a manner that provides a competitive advantage over their

normal counterparts. Moreover, cancer cells can subvert the microenvironment to

produce factors that positively stimulate their growth.

T-ALL arises from the malignant transformation of lymphoid precursors that are

developing in the bone marrow and in the thymus (13). Both of these hematopoietic

niches have a clear role in the supporting T-ALL cells. Stromal support derived from

the BM (43) and the thymus (44) increase the survival and proliferation of T-ALL cells.

Interestingly, it was shown that the in vitro recovery of primary leukemic blasts cultured

with stromal support can predict treatment outcome in the T-ALL patients (43). The

increased survival of T-ALL blasts in the BM stroma is dependent, at least in part, on

the engagement of adhesion molecules and integrins like LFA-1 and ICAM-1(45).

These adhesion molecules were also implicated in resistance to drug-induced apoptosis

in multiple myeloma (46), raising the possibility that the same could occur in T-ALL

patients. Remarkably, the interaction between leukemic cells and specific areas in the

BM can provide a supportive niche that allows the development and proliferation of

malignant blasts (47) while disrupting the normal development of hematopoietic cells

(48).

Chemokines regulate hematopoietic development and lymphocyte biology.

Chemokines are small chemotactic proteins that regulate the homing of leukocytes to

the sites of inflammation, infection and also to the sites where development takes place

(49). Chemokines can, on the other hand, act as key regulators of the homing of cancer

cells to the place of metastasis (50). The chemokine SDF-1/CXCL12 and its receptor

CXCR4 are implicated in the metastatic process of several types of cancers, namely

acute leukemias, breast and lung (51). CXCR4 is expressed in several cancers (52),

including T-ALL (53-55). Interestingly, CXCR4 expression in Acute Myeloid

Leukemia is a prognostic factor associated with low survival rates (56). The SDF-1

/CXCR4 axis was shown to be responsible for the homing of leukemic cells (47) and

normal hematopoietic cells (57) to bone marrow niches, and binding of SDF-1 to

CXCR4 increases the chemotaxis of T-ALL cells (53). Other chemokines, such as

CXCL13 (58) and CCL25 (59), were shown to protect T-ALL cells from apoptosis.

Introduction

12

Furthermore, a recent report showed that the expression of CCR7 in leukemic cells was

essential for their homing to the CNS (60).

Cytokine signaling in T-ALL

Cytokines are another family of soluble proteins that regulate the development of

hematopoietic cells (61, 62). Similar to chemokines, cytokines are produced in the

lymphoid tissues where the hematopoietic cells develop. Cytokines include colony-

stimulating factors (CSFs), interleukins (ILs), interferons (IFNs) and other growth

factors(63). The binding of cytokines to their receptors engages a series of signaling

events that can result in increased proliferation, viability, differentiation and also

apoptosis of the target cells (62). Similar to normal hematopoietic cells, T-ALL blasts

can increase their viability, proliferation and maturation status in response to cytokine

signaling (64-67). Several cytokines were shown increase the proliferation of T-ALL

cells. Interleukin-2 (IL-2) was one of the first cytokines described to promote T-ALL

growth in vitro (64, 68, 69). Likewise, we and others established a clear role for

interleukin-7 (IL-7) in the biology of T-ALL (44, 65, 67, 70, 71). Scupoli and

colleagues demonstrated that IL-7 was the main effector of the T-ALL cell survival

induced by thymic microenviroment in vitro (44). Activation of IL7 signaling in T-ALL

cells in vitro inhibited spontaneous apoptosis through the up-regulation of BCL-2 (65,

67), but also increased the proliferation of the leukemic blasts through the down-

regulation of the cyclin-dependent kinase inhibitor p27Kip1

(65). In T-ALL cells, the PI3-

Kinase (PI3K) pathway is main effector of the IL-7-induced effects (70). In addition, we

showed that IL-4, IL-9 and IL-15 also induce T-ALL cell proliferation and that this

effect was dependent on the maturation status of the T-ALL cells (72). In contrast, other

cytokines can suppress the growth and induce apoptosis of leukemic cells. Interleukin-6

(IL-6) was shown to suppress the growth of T-ALL cells (73) and tumor necrosis factor

–α (TNF-α) was shown to induce apoptosis (74, 75).

The IL-4/IL-4 receptor signaling axis

IL-4 is a γ-common chain cytokine involved in the regulation of the host immune

response against helmintic pathogens (76). IL-4 is produced by several sources, which

include circulating leukocytes like mast cells, basophils and eosinophils (76, 77).

Introduction

13

Moreover, IL-4 expression was also detected in the bone marrow (78), indicating that it

can influence and regulate the development of lymphoid cells.

The IL-4 receptor complex is composed of two subunits, the IL-4 receptor α-chain

and the IL-2 Receptor γ-chain (79). The IL-4 receptor α-chain is a member of the type I

cytokine receptor superfamily (80). This family is characterized by the presence of four

positionally conserved cysteine residues and a conserved W-S-X-W-S motif (W-

tryptophane, S-serine and X-nonconserved aminoacid) in the extracellular regions (81).

In adition, the cytoplasmic tail contains a short conserved aminoacid sequence termed

Box 1. The IL-4 receptor α-chain also contains a region named insulin-IL-4 receptor

motif (IR4) that is responsible for cellular proliferation (82). The IL-2 Receptor γ-chain

also belongs to the type I cytokine receptor superfamily (83). This subunit is shared by

the heteromeric receptor complexes for IL-2 (83), IL-4 (79), IL-7 (84), IL-9 (85) and

also IL-15 (86).

Binding of the IL-4 to its receptor induces heterodimerization of the receptor

complex leading to its phosphorylation by the Janus kinases JAK1 and JAK3 (87).

Receptor phosphorylation by these kinases creates docking sites in the receptor

cytoplasmic tail that lead to the activation of downstream targets. In CD8+ T

lymphocytes, IL-4 stimulation activates several STAT (signal transducer and activator

of transcription) members that included STAT1, STAT3, STAT5 and STAT6 (88).

Furthermore, the PI3K and its downstream targets Protein Kinase B (PKB)/Akt and

p70S6K

were also shown to be activated upon IL-4 stimulation of primary lymphocytes

(88, 89).

IL-4 stimulation was shown to induce the proliferation of primary lymphocytes

(89), as well as pancreatic (90) and prostatic (91) cancer cells. Moreover, IL-4 signaling

also protects a B-cell lymphoma cell line from apoptosis, via PI3K-PKB/Akt pathway

activation (92). Similarly, IL-4 appears to have anti-apoptotic effects on colon cancer

cell lines (93). In contrast, and somewhat surprisingly, it has also been shown that IL-4

can induce apoptosis of B-cell Acute Lymphoblastic Leukemia (B-ALL) patient cells

(94). In T-ALL, IL-4 appears to be mostly pro-tumoral. IL-4 stimulation promotes the

proliferation of T-ALL patient samples (67, 72) and we showed that this effect is

dependent on the maturation stage of the T-ALL blasts (72).

Introduction

14

Genetic abnormalities in T-ALL

T-ALL is characterized by several genetic alterations that disturb normal

hematopoietic development and lead to the malignant transformation. These alterations

occur in genes that control diverse cellular processes, and include point mutations, gene

fusions, translocations, inversions and deletions (14, 95).

Reciprocal translocations between the T-cell receptor (TCR) chain genes (α, β and

δ) and several T-cell oncogenes are quite frequent occurring in up to 35% of the T-ALL

cases (96). The majority of these translocations lead to the aberrant expression of

transcriptional regulators resulting in impaired differentiation and loss of cellular

homeostasis of the developing thymocytes (14, 95). Furthermore, it was demonstrated

that more than 50% of the T-ALL patients display activating mutations in the NOTCH1

gene resulting in increased Notch signaling (97), which is highly associated with T-cell

malignancies (98, 99).

Cell cycle defects

Loss of cell cycle control is a common feature in cancers. Mutations affecting

genes that control cell cycle transitions and DNA damage response, such as RB1 (100)

and TP53 (101), are frequent in cancer. However, mutations affecting these genes are

rare in T-ALL, whereas deletions in the INK4/ARF locus (del 9p21), affecting the

CDKN2A/INK4A and CDKN2B/INK4B genes, are extremely frequent (102-105). The

CDKN2A gene encodes for the p14/p19 and p16 proteins, while the CDKN2B gene

encodes the p15 protein. The p15 and the p16 proteins are inhibitors of cyclin D-CDK4

complexes, thereby maintaining the cells in a quiescent state. The inactivation of these

CDK inhibitors leads to the activation of cyclin D-CDK4 complexes and consequent

phosphorylation of the retinoblastoma protein allowing cells to enter and progress in the

cell cycle. In addition, the INK4/ARF locus can encode for a p14/p19ARF

protein

resulting from transcription of an alternative reading frame (ARF). .p14/p19ARF

interacts

and sequesters the MDM2 protein, which is the negative regulator of the p53 protein,

leading to its up-regulation. The inactivation of the p14/p19ARF

down-regulates p53

protein, which is a critical cell cycle and genotoxic stress response regulator in the cell

(106, 107). Recently, it was also described that the cyclin D2 gene (CCND2), a key

regulator of the G1 to S phase transition, is ectopically expressed in T-ALL patients

Introduction

15

samples as a result of chromosomal translocations that juxtapose this gene to the

regulatory sequences of the TCRA/D or the TCRB loci (108).

Aberrant signaling

Genetic lesions not only lead to aberrant transcriptional activation in T-ALL but

also to aberrant activation of signaling pathways that are crucial for the proliferation and

viability of the leukemic blasts (109).

Tyrosine kinases play a critical role in the signaling events upon TCR

engagement, and are critical in the regulation of the T-cell viability, proliferation and

immune responses. Several of these kinases are aberrantly activated in T-ALL, either by

chromosomal translocations that activate the expression of the kinases or creation of

chimeric fusion genes that code for new proteins with enhanced kinase activity and de-

regulated expression. However, point mutations in key molecules and deletions of

negative regulators are also observed in T-ALL patients (14, 95).

The ABL1 gene codes for a ubiquitously expressed cytoplasmic tyrosine kinase

that plays a role in TCR signaling (110, 111). The t(9;22)(q43;q11) translocation that

creates the BCR-ABL fusion protein is highly common in CML and in B-ALL (15,

112).However, its frequency is very rare in T-ALL (113). In contrast, the NUP214-

ABL1 is found in 6% of the patients as a result of episomal amplification. This gene

fusion is also associated with the expression of other oncogenes, such as HOX11 and

HOX11L2, as well as with the deletion of the CDKN2A locus (114). Other fusions

affecting the ABL1 gene identified in T-ALL are relatively rare, these include the ETV6-

ABL1 gene fusion (115) and the EML1-ABL1 gene fusion that was detected in a single

T-ALL patient (116).

The LCK kinase is a member of SRC family of tyrosine kinases highly expressed

in T-cells which plays a central role in delivering the signals that emanate from TCR-

signaling (117). In rare cases of T-ALL, LCK was found to be ectopically activated as a

result of the t(1;7)(p34;q34) translocation that places the LCK gene under the control of

the TCRB locus (118, 119).

The conserved family of the JAK kinases participates in the coupling of cytokine

receptors to intracellular signaling events thereby regulating important biological

processes such as apoptosis, differentiation, proliferation and immune responses (120).

In T-ALL, the translocation t(9;12)(p24;p13) results in the ETV6-JAK2 gene fusion

Introduction

16

resulting in constitutively active JAK2 signaling (121, 122). The leukemogenic effect of

this gene fusion was demonstrated in a transgenic mouse model that resulted in the

development of fatal leukemia with a selective expansion of CD8+ T-cells (123).

Recently, the occurrence of mutations in the JAK1 gene was reported in 18% of adult

and 2% of pediatric patients with T-ALL. These mutations are associated with poor

response to treatment and overall survival (124).

The FLT3 gene encodes for a receptor tyrosine kinase that is crucial for the

development of hematopoietic stem cells (125). Activating mutations in this gene are

frequent in Acute Myeloid Leukemia (AML) (125), but in contrast, are rare in T-ALL

patients and are restricted to lymphoblasts with a very early phenotype that still

maintain the expression of LYL1, LMO2 and also the KIT receptor (126, 127). The

FLT3 mutations that occur in AML and T-ALL patients are, in both instances, internal

tandem duplications in the juxtamembrane domain or point mutations in the activation

loop of the kinase domain that lead to the activation of the receptor in the absence of the

ligand (125, 126).

The RAS family (N-RAS, K-RAS and H-RAS) of small GTPases is critical to the

transmission of numerous stimuli from the membrane and their integration into

downstream signaling pathways (128). Activating mutations in the genes that code for

these proteins are described in several types of malignancies (129, 130). In T-ALL,

activating mutations in RAS are described in up to 10% of the patients (131-133).

Moreover, in 2% of the T-ALL patients, inactivating mutations were found in NF1, a

negative regulator of the RAS pathway (133). However, there is evidence that RAS

protein activation may occur in around half of the T-ALL patients (134), raising the

possibility that RAS activation (possibly due to stimulation by extracellular cues in the

absence of RAS gene lesions) may play a central role in the pathogenesis of T-ALL.

The Transforming Growth Factor-β (TGF-β) signaling pathway regulates cell

growth, senescence, differentiation and apoptosis (135). Several lines of evidence

implicate TGF-β signaling pathway in cancer, either as a tumor suppressor or tumor

promoter (136). Upon activation of the pathway, the main cytoplasmatic adaptors,

SMAD2 and SMAD3, are translocated to the nucleus where they regulate gene

transcription (137). The link between the TGF-β pathway and T-cell malignancy was

realized not long ago (138, 139). Lucas and colleagues described that decreased TGF-β

signaling in a mouse model results in the expansion of CD8+ memory T-cells leading to

the establishment of T-cell leukemia (138). Moreover, it was demonstrated that T-ALL

Introduction

17

patients display loss of SMAD3 protein in the absence of MADH3 (which encondes for

SMAD3) gene mutations (139). The loss of SMAD3 protein synergized with other

oncogenic events, particularly with the loss of p27Kip1

, to induce T-cell leukemia in

mice (139). The hypothesis that the TGF-β signaling pathway acts to suppress T-cell

leukemogenesis is further supported by the high percentage of T-ALL patients (34%)

that display genomic alterations in members of this pathway (140). These genomic

alterations include deletions in the activators and amplifications in the inhibitors of the

pathway (140).

Recently, LEF1/TCF1, a member of WNT signaling pathway, was shown to be

deleted in a variety of T-ALL patients (141). LEF1 interacts with β-Catenin to promote

gene transcription (142), but also with SMAD4 a pivotal mediator of TGF-β signaling

(143). In T-ALL, Gutierrez and colleages showed that the LEF1 gene is deleted in 11%

of the samples analyzed and identified non-synonymous mutations that produce

premature stop codons in 7% of the cases analyzed. Importantly, LEF1 inactivation in

T-ALL correlates with increased MYC expression, NOTCH1 activating mutations and

early cortical stage of T-cell differentiation (141).

The Notch signaling is critical for the regulation of cell fate decisions in stem cell

maintenance, neurogenesis and T-cell differentiation (35, 144, 145). The Notch

receptors are heterodimeric proteins composed of an extracellular subunit and a

transmembrane subunit that are non-covalently bound through a heterodimerization

domain (109, 146). Activation of the Notch signaling pathway occurs upon binding of

the ligand to the extracellular subunit of the Notch receptor, resulting in serial

proteolytic cleavages. The final cleavage is catalyzed by the γ-secretase complex that

releases the intracellular Notch (ICN) receptor, which activates the transcription of

Notch target genes (109, 146). The involvement of the Notch receptor in T-ALL was

first found in three patients that presented the t(7;9)(q43;q34.4) translocation that

juxtaposed the region that codes for the intracellular NOTCH1 gene (TAN1) to the

regulatory sequence of the TCRB locus (147). Notably, transplantation of bone marrow

transduced with the TAN1 gene into recipient mice led to the development of T-cell

leukemia (98). Recently, it was discovered that the majority of the T-ALL patients

(56%) display NOTCH1 activating mutations. The mutations were found in two distinct

regions of the NOTCH1 gene, in the heterodimerization domain (44%) and in the PEST

domain located in the C-terminus (30%), with a significant percentage of the patients

(17%) displaying mutations in both regions. Increased Notch signaling resulted from

Introduction

18

either the destabilization of the heterodimerization domain or from increased ICN half-

life. Importantly, patients with both types of mutations have synergistic activation of the

Notch signaling pathway (97). Furthermore, another type of NOTCH1 activating

mutations were described by Sulis et al, these mutations are internal duplication

insertions occurring at the vicinity of the exon 28 of the NOTCH1 allele that encode the

extracellular juxtamembrane region of the receptor. These insertations lead to aberrant

NOTCH1 signaling by promoting the final cleavage of the receptor by the γ-secretase

complex. Interstingly, the level of aberrant NOTCH1 signaling depends on the number

of aminoacid residues introduced in the juxtamembrane region of the receptor (148).

The NOTCH1 activating mutations occur in the all the major molecular subtypes of the

T-ALL patients (TAL1+; LYL1

+; HOX11

+; MLL-ENL

+; CALM-AF10

+), which may

indicate that they occur very early in T-cell differentiation (97, 149).

The PI3K-mTOR pathway

The signal transduction pathway involving Phospho-Inositol-3 Kinase (PI3K) and

the mammalian Target of Rapamycin (mTOR) regulates cellular processes such as

viability, proliferation, and differentiation, and have been extensively associated with

hematological malignancies (150-152). In this section, we will briefly describe this

pathway, and discuss the evidence for its involvement in the pathogenesis of T-ALL.

An overview

Surface receptors frequently activate the PI3K-mTOR pathway (Figure 1.2). The

PI3K complex consists of the p110 catalytic subunit and the p85 regulatory subunit. The

activation of this complex leads to the phosphorylation of the Phosphatidyl-Inositol 4,5-

Bisphosphate (PIP2) lipid creating Phosphatidyl-Inositol 3,4,5-Trisphosphate (PIP3).

The PTEN (Phosphatase and Tensin Homologue) tumor suppressor catalyzes the

inverse reaction. Upon formation of PIP3, the PI3K downstream targets Protein Kinase

B (PKB) and PDK1 are recruited to the plasma membrane through their Plecstrin

Homology (PH) domains that anchor them to the PIP3. The PDK1 kinase

phosphorylates PKB in the Thr308 residue. The full activation of PKB is achived upon

phosphorylation in the Ser473 residue by PDK2, which was recently demonstrated to be

the mTORC2 complex (150, 151, 153).

Introduction

19

Activated PKB is known to phosphorylate a variety of cellular targets (154, 155).

PKB downstream targets include the FOXO family of transcription factors (156, 157),

Figure 1.2. An overview of the PI3K-mTOR signaling pathway. Growth factors and

cytokines bind to surface receptor leading to PI3K-mediated signaling. The activation of PI3K

and subsequent phosphorylation of PIP2 to PIP3 are key steps in this signaling pathway.

Activation of PI3K-mTOR results in increased viability, proliferation of cancer cells. Further

details can be found in the main text.

Introduction

20

the GSK-3α/β kinase (158), the pro-apoptotic protein BAD (159, 160) and TSC2, the

negative regulator of the mTORC1 complex (161). FOXOs are critical in the negative

regulation of cell cycle progression and in promoting the apoptotic process (162). The

genes regulated by this family of transcription factors include CDN1A (p21CIP1

),

CDN1B (p27KIP1

), FASL and BIM (163). PKB phosphorylates the FOXO3a transcription

factor in three conserved residues Ser32, Ser215 and Ser315 leading to its inactivation

and subsequent proteasomal degradation (163).

PKB activates mTOR downstream signaling by direct phosphorylation of mTOR

kinase in the Ser 2448 residue (151) and by phosphorylation and inactivation of the

TSC2/TSC1 complex, the negative regulator of the mTORC1 complex (161). The TSC2

protein is phoshorylated by PKB which disrupts the TSC1/TSC2 complex. As a result

the small GTPase Rheb activates the mTORC1 complex (164). The mTORC1 complex

is composed of mTOR, Raptor, PRAS40 and LSt8 proteins and is sensitive to inhibition

by Rapamycin (150, 151, 153). The mTORC1 complex increases protein translation by

directly regulating the p70S6K

kinase and 4EBP1 (165). p70S6K

is activated by direct

phosphorylation mediated by mTORC1 (166, 167). Subsequently, p70S6K

leads to

increased protein translation by phosphorylating the ribosomal protein S6 (168) and

PDCD4 (169). These events result in active translation of 5‟CAP mRNAs (153). In

contrast, the phosphorylation of 4EBP1 by mTORC1 inhibits its activity. Upon

inhibition, 4EBP1 dissociates from eIF4E releasing it to participate in the assembly of

the translation initiation complex (150, 151, 153). Interestingly, it was demonstrated

that the mTORC1 complex in association with p70S6K

kinase also inhibits PI3K

signaling by creating a negative feedback loop to shutdown signaling (170). mTOR is

also a component of the mTORC2 protein complex, which also contains Rictor, SIN1

and mLSt8 (150, 151, 153). This complex is insensitive to Rapamycin and responsible

for the phosphorylation of the PKB kinase in the Ser473 residue, as described above

(165, 171).

Importantly, the PI3K-mTOR axis controls several steps in protein translation and

enhances the production of several oncogenic proteins that include c-Myc, cyclin D1

and Rb. By regulating protein translation, the PI3K-mTOR pathway controls cell

growth and cellular metabolism, which are important processes for tumorigenesis (172).

Introduction

21

Importance in T-ALL

Despite the fact that the PI3K-mTOR pathway and its downstream target PKB are

implicated in several malignancies, until recently very few abnormalities were detected

in this signaling pathway in T-ALL.

Until recently, the notion that the PI3K pathway was implicated in T-ALL came

essentially from the knowledge that T-ALL PTEN-null cell lines exist that display

uncontrolled proliferation (173, 174), and restoration of PTEN activity (175) or

pharmacological blockade of the PI3K pathway (176) resulted in apoptosis of these cell

lines. Avellino and colleagues further extended these analyses to a few T-ALL patient

samples and showed that the PI3K-mTOR axis was crucial for maintenance of viability

of the T-ALL blasts. The incubation with Rapamycin (mTOR inhibitor) and

Wortmannin (PI3K inhibitor) stimulated the apoptosis of the T-ALL samples (177).

Importantly, we subsequently demonstrated that aberrant PI3K signaling is a very

frequent alteration in T-ALL, with 87.5% of the patients tested presenting

hyperactivation of this pathway when compared to normal controls (178). PI3K

pathway constitutive hyperactivation resulted from inactivation of PTEN, by PTEN

gene alterations (present at relatively low frequency) and by PTEN protein inactivation

due to CK2-mediated C-terminal phosphorylation and ROS-dependent oxidation at the

catalytic centre (178). Recently, two additional reports confirmed the relevance of PI3K

signaling in T-ALL, describing genomic abnormalities in members of the PI3K pathway

or in predicted upstream regulators of the pathway in around 40% of the patients

analyzed (133, 140). Importantly, T-ALL patients with mutations in the PTEN gene are

associated with a poorer prognosis than patients that present an intact PTEN locus (133,

179).

Transcription factors

Transcriptional deregulation is a common feature in Acute Leukemias. Unlike

AML and B-ALL, where the formation of chimeric fusion proteins is common, in T-

ALL the most common feature is the aberrant expression of full length transcription

factors and other proteins (180). Recurrent chromosomal translocations are responsible

for the aberrant expression of transcription factors and other key proteins in

differentiating thymocytes altering their transcriptional program (13, 14, 95). The Table

1.1 summarizes the most common chromosomal translocations associated with T-ALL.

Introduction

22

The Homeobox (HOX) genes are a class of transcription factors that are pivotal in

several differentiation processes – including fly patterning (181), axial morphogenesis

(182), neural development (183) and also hematopoiesis (184). These transcription

factors contain a characteristic homeodomain motif of 61 aminoacids that is responsible

for the binding to the DNA (185) and are divided in two classes. The HOX genes that

belong to the class I comprise a complex network of transcriptional regulators that are

organized in four clusters, HOXA-D. A chromosomal inversion [inv(7)(p15q34)] was

reported in 5% of the T-ALL patients that results in the aberrant expression of the

HOXA10 and HOXA11 genes, members of the HOXA gene cluster (186). Another

member of the HOXA gene cluster, the HOXA13 gene was reported to be highly

expressed in T-ALL patients as a result of a complex tranlocation that places it under

the control of the BCL11B locus (187).

The HOX11 (TLX1) and HOX11L2 (TLX3) genes belong to the class II of HOX

genes and have been extensively associated with T-ALL. HOX11 ectopic expression is

mainly due to two chromosomal translocations (see Table 1.1), the t(10;14)(q24;q11)

and the rare variant t(7;10)(q35;q24) that juxtapose the coding sequence of this gene to

the strong regulatory sequences of the TCRA/D and TCRB locus, respectively (188,

189). Furthermore, HOX11 aberrant expression can also occur in the absence of these

chromosomal translocations (149, 190, 191). The HOX11 gene is not normally

T-cell receptor gene Chromosome

location Partner gene

Chromosome

location

T-cell receptor α/δ (TCRA/D) 14q11

HOX11 10q24

TAL1 1p32

LMO1 11p15

LMO2 11p13

CCND2 12p13.3

T-cell receptor β (TCRB) 7q34-35

HOX11 10q24

HOXA cluster 7p15

LYL1 19p13

TAL2 9q32

LCK 1p34

NOTCH1 9q34

CCND2 12p13.3

T-cell receptor У (TCRG) 7p15 no known chromosomal translocations

Table 1.1. T-cell receptor genes and their involvement in the chromosomal translocations in

T-ALL.

Introduction

23

expressed in T-cells (192) and its ectopic expression in hematopoietic precursors and

thymocytes is oncogenic (188, 193). The expression of HOX11 in T-ALL is associated

with an early cortical phenotype (CD3low

/CD4+/CD8

+) and a good prognosis (149, 194).

HOX11 expression in T-ALL correlates with the expression of genes associated with

increased cell cycle progression and proliferation (149, 195). The HOX11L2 gene is

also associated with T-ALL (149) and its expression is detected in up 20% of childhood

T-ALL and 13% in adult cases (14). Ectopic HOX11L2 expression in T-ALL is mainly

due to the cryptic translocation t(5;14)(q53;q32). This translocation places the

HOX11L2 gene under the control of the BCL11B gene, which is highly expressed

during T-cell development (196, 197). Other translocations, namely t(5;14)(q53;q11)

and t(5;7)(q35;q21), also explain the aberrant expression of HOX11L2 in T-ALL (198,

199). Despite the fact that the expression profiles of T-ALL patients with HOX11L2 and

HOX11 aberrant activation share similarities (149), patients with HOX11L2 expression

are associated with a poorer prognosis than patients that express the HOX11 gene (149,

200).

The basic Helix-Loop-Helix (bHLH) family of transcription factors is

characterized by a Helix-Loop-Helix (HLH) motif of 60 aminoacids used to dimerize

with other bHLH transcription factors and by binding to DNA via a basic region N-

terminal to this motif (201). This family is divided in two main classes. The class I (or

A) bHLH transcription factors are ubiquitously expressed and form homo- or

heterodimers. The class II (or B) bHLH transcription factors are expressed in a tissue

specific manner and only form heterodimers with class I bHLH proteins. The E2A gene

codes for two proteins by alternative splicing, E47 and E12, and is the classical class I

bHLH transcription factor. The E2A gene plays a critical role in T-cell differentiation

(202-204). E2A proteins have been shown to activate V(D)J recombination (205) and

regulate the expression of several genes crucial of T-cell differentiation, including the

surrogate pTα chain (206, 207). Importantly, E2A acts as a tumor suppressor gene in T-

cells since down-regulation of E2A expression in T-cells leads to leukemogenesis (208,

209). The class II (or B) bHLH transcription factors were shown to be highly associated

with T-ALL (149, 210-212). The LYL1, TAL1 (its involvement in T-ALL will be

discussed later) and the closely related TAL2 and BHLH1 genes were identified due to

the involvement in recurrent chromosomal translocations in T-ALL (211-215). The

LYL1 gene is down-regulated during T-cell differentiation (190) and is aberrantly

expressed in T-ALL as a result of the chromosomal translocation t(7;19)(q35;p13) (213)

Introduction

24

and other unknown mechanisms (149, 190). The gene expression profile of T-ALL

patients with ectopic LYL1 gene activation correlates with the profile of early T-cell

precursors and its associated with a poor prognosis (190). The TAL2 and BHLH1 genes

are expressed in T-ALL as result of the chromosomal translocations t(7;9)(q34;q32) and

t(14;11)(q11;q22), respectively (211, 212).

The genes that code for the LIM-domain only family of proteins are also

ectopically expressed in T-ALL patients (149). These proteins contain cystiene-rich

motifs in the LIM domains, which are responsible for protein-protein interactions (216),

and act as bridging molecules assembling complexes of transcription factors that

include GATA1, TAL1 and E2A (216, 217). The LMO1 and LMO2 genes are activated

in T-ALL as a result of the chromosomal translocations t(11;14)(p15;q11) and

t(11;14)(p15;q13) that juxtapose the coding regions of these genes to the regulatory

regions of the TCRA and TCRD loci, respectively (218, 219). Ectopic activation of these

genes without known genetic alterations can also occur in T-ALL (149). Recently it was

shown that the deletion del(11)(p12p13) also accounts for LMO2 gene expression in T-

ALL (220). The LMO (LMO1 and LMO2) genes are down-regulated when normal

hematopoietic precursors commit to the lymphoid lineage (190, 221). In contrast, their

expression is detected in up to 45% of the T-ALL patients and is frequently associated

with other oncogenes like the TAL1 and LYL1 (149). Furthermore, LMO1 and LMO2

transgenic mice develop T-cell leukemia (222-225) and synergistically cooperate with

the TAL1 gene (226-228). Recently, it was described that during a gene therapy trial to

correct severe combined immunodeficiency (SCID), several patients developed T-cell

lymphoproliferative disorders similar to T-ALL. The retrovirus that carried the IL2RG

gene integrated near the LMO2 locus leading to its aberrant expression in the

hematopoietic precursors of the transplanted patients (229-233).

The MLL gene (Mixed-lineage leukemia) is known to rearrange with more than 50

partners in lymphoid and in myeloid leukemias (234). The MLL gene is a transcription

regulator functionally homologous to the Drosophila Trithorax gene and regulates the

expression of HOX genes (235, 236). In T-ALL, fusions involving the MLL gene are

described in up to 8% of the patients (237-239). The usual partner in these fusions is the

ENL (MLLT1) gene as a result of the translocation t(11;19)(q23;p13.3) (240). The other

fusion partners of the MLL gene are the AF10, AF6, AF4 and AFX1 genes (14). Gene

expression profile of T-ALL patients with MLL gene fusions shows up-regulated

expression of several HOX genes, such as HOXA10, HOXA9 and HOXC6 and also

Introduction

25

MES1, a HOX gene co-regulator (238). Furthermore, T-ALL patients with MLL gene

fusions represent a clear distinct molecular subtype associated with a specific gene

signature (HOX gene activation) (238).

The translocation t(10;11)(p13;q14) is recurrent in T-ALL, and as a result, the

CALM (Clathrin Assembly protein-like Lymphoid-Myeloid gene, or PICALM) gene is

fused to the AF10 gene (Acute Lymphoblastic Leukemia 1 fused gene on chromosome

10, or MLLT10) (241). The CALM-AF10 fusion occurs in up to 10% of the T-ALL

patients with the γδ phenotype (242) and is associated with poor prognosis (243). T-

ALL patients with the CALM-AF10 fusion protein express a subset of HOX genes that

include HOXA5, HOXA9 and HOXA10 and also the BMI1 oncogene (244).

Interestingly, the MLL fusions and the CALM-AF10 fusion seem to share a common

feature, the up-regulation of several HOX genes, particularly members of the HOXA

gene cluster.

The TAL1/SCL oncogene

TAL1 (T-cell Acute Lymphocytic protein 1) aberrant gene expression is the most

common genetic alteration in T-ALL being detected in up to 65% of the patients (149,

210). T-ALL patients with TAL1 aberrant expression are generally associated with poor

prognosis and with a late cortical phenotype (CD3+CD4

+CD8

+) (149). However, the

first TAL1 positive cases described in the literature presented with early T-cell

phenotype (CD2+CD7

+CD3

-CD4

-CD8

-) (245). TAL1 aberrant gene expression in T-

ALL patients occurs due to several chromosomal aberrations (Table 1.2) such as

translocations and deletions (214, 215, 246-249).

Type Designation Incidence Partner gene

translocation t(1;14)(p32;q11) 3% T-cell receptor δ (TCRA/D)

translocation t(1;7)(p32;q35) n.d. T-cell receptor β (TCRB)

translocation t(1;3)(p32;p21 n.d. TCT1A

translocation t(1;5)(p32;q31) n.d. Unknown

deletion/fusion 1p32 (TAL1d) 26% SIL

Table 1.2. Chromosomal aberrations involving the TAL1 gene in T-ALL.

Introduction

26

Moreover, there is a high number of T-ALL patients with detectable TAL1 gene

expression without rearrangements in the respective locus. The precise molecular

mechanisms leading to ectopic TAL1 expression in these cases remain unknown (190).

The most common translocation t(1;14)(p32;q11) juxtaposes the TAL1 gene to the

strong regulatory elements that control the expression of the TCR δ chain (214) and is

detected in up to 3% of the T-ALL cases.

The other translocations (Table 1.2) are rare and are documented as case-study

reports (247-249). However, the most common chromosomal alteration leading to

aberrant TAL1 gene expression in T-ALL is the SIL-TAL1 gene fusion (246) that is

detected in up to 26% of the T-ALL patients. This gene fusion results from a micro-

deletion of 90 kb in the TAL1 locus removing the regulatory elements that control the

TAL1 gene expression and fusing the TAL1 coding region to the SIL regulatory elements

(Figure 1.3) (246). Although this gene fusion gives rise to three different

rearrangements, the end result at the protein level is always the same (Figure 1.3) (246).

The clear involvement of TAL1 in the pathology of T-ALL is established by the

fact that transgenic mice expressing this oncogene develop T-cell leukemia, although

with a long latency period (250-252). This fact could suggest that an additional

oncogenic event should occur for the establishment of full blown leukemia. Obvious

candidates for the second hit in TAL1-induced leukemogenesis are the LMO genes. The

expression of LMO genes cooperates with TAL1 to accelerate the onset of T-cell

leukemia in transgenic mice (226-228, 253). Importantly, LMO proteins are also co-

expressed with TAL1 in a significant number of T-ALL patients (149) Other oncogenic

events may cooperate with TAL1 in promoting leukemia. For example, expression of

CK2 kinase cooperates with TAL1 to reduce the latency period of T-cell leukemia in

double transgenic mice (250, 251). Despite the fact that TAL1 expression in T-ALL

patients is associated with a differentiated phenotype (149), the establishment of

leukemia in TAL1 transgenic mice is preceded by an early, partial block in T-cell

differentiation (226, 250-252).

TAL1 exerts its leukemogenic activity, at least in part, by interfering with E2A

activity (252), preventing the expression of E2A target genes that include CD4 and pTα

(207, 254). Interestingly, TAL1 overexpression in T-ALL cell lines was shown to

protect them from apoptosis (255, 256), whereas E2A ectopic expression promotes cell

death (257).

Introduction

27

These two facts appear to be linked, as demonstrated by the fact that restoration of

E2A activity in a T-ALL cell line specifically associated with TAL1 and promoted

apoptosis and growth arrest (258).

TAL1, more than a key player in leukemia

As discussed above, TAL1 ectopic expression is extremely frequent in T-ALL

(149) and transgenic expression of TAL1 in mice leads to the development of T-cell

Figure 1.3. Structural comparison of the TAL1 locus and SIL-TAL1 gene

rearrangements. (A) The SIL locus is located at the 5‟ and the MAP17 locus is located at the

3‟ end of the TAL1 locus. Exons are represented as boxes. The white boxes represent exons

that are not translated, while the black boxes show exons that are translated. (B) The three SIL-

TAL1 gene rearrangements are represented as A, B and C. As above, exons are represented as

boxes. The white boxes represent exons that are not translated, while the black boxes show

exons that are translated. The SIL exons are represented in grey and are not translated.

Introduction

28

malignancies (250, 251). However, physiologically, TAL1 is a pivotal transcription

factor in early hematopoiesis and erythropoiesis (259). In this section we will discuss

how TAL1 is regulated and how it exerts its function in normal development.

TAL1: structure and function

The TAL1 oncogene was identified due to its recurrent involvement in

chromosomal translocations that place the TAL1 coding sequences under the control of

the regulatory elements of the genes that code for T-cell receptor chains (214, 215). As

shown in Figure 1.3A, the TAL1 locus is located in the small arm of the chromosome 1

(1p32) surrounded by the SIL locus in the 5‟ end and the MAP17 locus at the 3‟ end

(260, 261). The TAL1 locus contains eight exons (Ia, Ib, IIa, IIb, III, IV, V and VI)

(Figure 1.3A) dispersed over 16 kb, in which exon IV, V and VI code for the TAL1

protein while the others are non-coding exons (260). The splicing events that occur

within the TAL1 gene are highly complex and several TAL1 transcripts have been

described (260). In addition, several regulatory elements have been shown to regulate

TAL1 gene expression, namely three promoters (262, 263), a silencer (264, 265) and

several enhacers (266, 267).

The promoters Ia and Ib are controlled in a tissue-specific manner. The promoter

Ia is located upstream of the Ia exon, it is active in the myeloid lineage (erythroid,

megakayocytes and mast cells), and it is controlled by GATA1 and SP1 (268, 269). The

promoter Ib localizes upstream to the exon Ib, it is active in CD34+ progenitors and in

mast cells, and it is regulated by PU.1 in association with SP1 and SP3 (270, 271).

Interestingly, it was shown that the HTLV1 protein Tax can increase TAL1 gene

expression by activating the Ib promoter through the CREB and NF-κB pathways (272).

The promoter IV is located within the exon IV and is specifically active in human T-

ALL. Transcription driven from this promoter produces a truncated transcript (263),

whose functional impact on leukemia progression has not been characterized, however

it was demonstrated that TAL1 truncated transcripts cooperate with LMO1 to induce

leukemia in transgenic mice (253). The activity of this promoter is regulated by the

binding of PU.1 to a silencer in the 3‟UTR, which is also regulated in a tissue-specific

manner (264, 265).

The expression of the TAL1 gene is also regulated by enhancers (266, 267, 273).

Two enhancers have been identified to direct TAL1 gene expression in endothelial cells

Introduction

29

and during hematopoiesis: the +19 enhancer (3‟) (266) and the -3.9 enhancer (5‟) (267).

The activity of the +19 enhancer was shown to be regulated by GATA2, Fli-1 and Elf-1

(267) (274). A third enhancer that directs TAL1 gene expression in erythroid primitive

precursors is located 40 Kb downstream of the TAL1 Ia exon (273). The regulation of

TAL1 expression is highly complex, due to the existence of these regulatory circuits that

control TAL1 expression in several lineages. Recently, using a genomic tilling array

approach to investigate the regulation of the human TAL1 locus, six more TAL1

regulatory sequences were described dispersed over a genomic area that covers 88 kb,

which included elements with enhancer and (-7, -10, -31) repressor activity (-13), as

well as insulator enhancer-blockers (+53, +57) (261).

The TAL1 gene encodes for two proteins, the full-length protein with 331

aminoacids with approximately 42 KDa (275) and an N-terminal truncated version with

155 aminoacids with approximately 22 KDa (276). The TAL1 protein contains a

proline-rich transactivation domain and a bHLH motif that associates with other bHLH

transcription factors (277). As mentioned above, TAL1 is a class II bHLH transcription

factor, heterodimerizing with class I bHLH transcription factors such as E2A and HEB

to bind DNA (277, 278) in specific sequences called E-boxes (CANNTG), particularly

to the consensus sequence CAGATG (279). TAL1 can act both as transcriptional

repressor and as activator (280). In the context of normal erythropoiesis TAL1 induces

terminal differentiation through the up-regulation of several genes (281-283). TAL1

interacts with transcriptional co-activators like p300 (284) and with the RNA

polymerase II transcriptional machinery, including the p44 subunit of the TFIIH

transcription factor (285). In contrast, in the context of T-cell leukemia TAL1 was

shown to inhibit E2A-mediated transcription (258) and this inhibition appears to be the

trigger for the development of T-cell malignancies in a TAL1 transgenic mouse (252).

Furthermore, TAL1 was shown to interact with repressive chromatin complexes that

include HDAC1 (252, 286), HDAC2 (287) mSIN3A (252, 286), HP1 (288), Suv39h1

(288) and LSD1 (287). Importantly, TAL1 recruits these repressive complexes to inhibit

gene transcription (252, 287). TAL1 was also shown to interact with several binding

partners that include LMO proteins (LMO1 and LMO2), LDB1 and GATA proteins

(289, 290). This multimeric complex recognizes regions in the DNA that contain an E-

box and an adjacent GATA site, which locate in the regulatory regions of genes that are

co-regulated by TAL1 and GATA1 proteins during erythroid development and in

hematopoietic stem cells (290, 291). In T-cell leukemia, TAL1 also interacts with these

Introduction

30

binding partners to up-regulate the expression of TAL1 target genes (292). It is

interesting to note that in a high percentage of T-ALL patients TAL1 gene expression is

associated with LMO genes (LMO1 or LMO2) (149), and these genes also cooperate to

induce aggressive T-cell leukemia in transgenic mice (226, 227).

TAL1 target genes

TAL1 plays a pivotal role in early hematopoiesis (293), erythropoiesis, (281,

294), vasculogenesis (295), and neurogenesis (296). Despite the involvement of TAL1

in all these developmental processes, few TAL1 target genes were so far identified and

clearly validated. Table 1.3 summarizes the TAL1 target genes that have been described

so far.

Gene Context TAL1 action Reference

c-KIT Hematopoiesis up-regulate 291; 297

Runx1 Embryogenesis up-regulate 298

Runx3 Embryogenesis up-regulate 298

GPA Erythropoiesis up-regulate 282

P4.2 Erythropoiesis up-regulate 283

UBE2H Erythropoiesis up-regulate 301

pTα T-cell differentiation down-regulate 207; 254; 302

CD4 T-cell differentiation down-regulate 252

RALDH2 T-ALL up-regulate 292

NFKB1 T-ALL down-regulate 304

NKX3.1 T-ALL up-regulate 305

TALLA1 T-ALL up-regulate 303

TAL1 is fundamental for the biology of HSCs. The receptor tyrosine kinase

encoded by the c-KIT gene is required for proper hematopoietic development and was

identified as a TAL1 target gene (291, 297). It was demonstrated that TAL1 and

interacting partners that include E2A, LMO2, LDB1 and GATA assemble in the

promoter of the KIT gene together with SP1 to activate its expression in hematopoietic

cells (291). During embryonic development, TAL1 positively regulates the expression

of Runx genes, in particular Runx1 and Runx3 genes (298).

The role of TAL1 during red blood cell differentiation is well established. For

instance, enforced expression of TAL1 directs terminal maturation of undifferentiated

MEL cells in the absence of a chemical inducer (281). Moreover, TAL1 was shown to

Table 1.3. List of the genes whose expression has been shown to be directly regulated by TAL1

Introduction

31

regulate the expression of components of the red blood cell membrane, such as

Glycophorin A (GPA) and protein P4.2 (P4.2) (282, 283), during erythropoiesis.

Glycophorin A is highly expressed at the cellular membrane of erythrocytes (299) and

protein P4.2 is part of the erythrocyte membrane cytoskeleton (282, 300). The

expression of these genes is determined by the assembly of a multimeric complex

containing TAL1 and its binding partners in the proximal promoter of these genes

through E-boxes and GATA sites (282, 283). Moreover, during red blood cell

development, TAL1 was also shown to regulate the ubiquitination machinery by

inducing the transcription of the UBE2H gene that encodes for the E2-ubiquitin

conjugase (301).

TAL1 is not expressed in T-cells (190, 221, 254). However, in the context of

TAL1 overexpression in T-cell progenitors and other cell lines, TAL1 has been

associated to the regulation of genes that are important for T-cell development (149,

207, 252, 302). Several lines of evidence suggest that TAL1 regulates the expression of

the pTα gene (207, 254, 302), which is a pivotal protein in normal T-cell differentiation

(41). Reporter assays also show that TAL1 inhibit pTα gene promoter activation in vitro

(302) and in vivo (207, 254). Moreover, TAL1 was also shown to bind to the CD4

enhancer in vivo and inhibit its expression in a TAL1 transgenic mouse model (252).

In the T-ALL context, TAL1 was shown to regulate the expression of several

genes that include TALLA1, RALDH2, NFKB1 and NKX3.1 (292, 303-305). TALLA1 is

considered a highly specific marker of T-ALL (306), whereas RALDH2 is the enzyme

that synthesizes retinoic acid (RA) (307), and NKX3.1 is a homeobox transcription

factor involved in the development of prostate tissue (308) that was shown to mediate

cellular proliferation in T-ALL (305). TAL1 interacts with LMO proteins and GATA3

to up-regulate the expression of these genes in T-ALL (292, 303, 305). Interestingly, it

seems that in the context of T-ALL, TAL1 still interacts with E2A and LMO proteins

but with GATA3 protein instead of GATA1, similar to the regulation of the GPA and

P4.2 genes during terminal erythroid differentiation (282, 283). In contrast to the other

genes described above, NFKB1 expression was shown to be directly repressed by TAL1

(304). The NFKB1 gene encodes p50, a member o the NF-κB/c-Rel family of

transcription factors (309). In T-ALL, the expression levels of p50 are generally low,

since TAL1 together with LMO1 occupies its promoter and recruits HDAC1 to repress

the transcription of the NFKB1 gene (304). The down-regulation of the NFKB1 gene by

TAL1 contributes to the formation of the atypical p65/c-Rel dimer, consequently

Introduction

32

changing the transcriptional program of the NF-κB pathway in T-ALL (304) and

possibly promoting resistance to chemotherapeutic drugs (310).

In the attempt to identify genes that could explain how TAL1 could contribute to

T-cell leukemia, Palomero and colleagues performed a genome wide screen in a human

T-ALL cell line to identify genes whose promoters were bound by TAL1. As one would

expect, TAL1 occupies promoters of genes that are involved in different cellular

functions that include signaling, transcriptional regulation, membrane transport,

vesicular trafficking and metabolism. The authors also identified six genes that changed

their expression upon decrease of TAL1 levels, indicating that they could be directly

regulated by TAL1. TRAF3, RAB40B and EPHB1 were down-regulated, whereas

PTPRU, TTC3 and RPS3A increased their expression upon TAL1 knock-down (311).

Signaling to TAL1

Activation of signaling pathways by external factors or by cell-autonomous

lesions, as described in T-ALL, leads to changes in the phosphorylation status of the

pathway components and consequent alterations in gene expression. Not only TAL1

transcript levels (312), but also the transcriptional activity of TAL1 (313, 314) have

both been shown to be regulated by external signals. So far, three residues in the TAL1

protein were shown to be phosphorylated by different protein kinases: Serines 122

(Ser122) (276) and 172 (Ser172) (313) and Threonine 90 (Thr90) (315).

The Ser122 residue was shown to be phosphorylated in vitro by the extracellular

related kinase 1 (ERK1), a member of the Mitogen-activated Protein Kinase (MAPK)

family (276). Stimulation of proerythroblasts with Erythropoietin (EPO) also appears to

lead to increased phosphorylation of TAL1 Ser122 mediated by ERK1 (316). Talora

and colleagues demonstrated that phosphorylation of this residue by ERK1 kinase, as a

result of increased Pre-TCR signaling, results in increased interaction of TAL1 with

SP1 and subsequent activation of cyclin D1 expression (314). Interestingly, the outcome

of TAL1 protein phosphorylation in this residue is dependent on the cellular

environment. In endothelial cells, hypoxia-induced phosphorylation of TAL1 Ser122

residue drives the ubiquitination and subsequent proteasomal degradation of TAL1

protein (317).

The Ser172 residue was shown to be phosphorylated by Protein kinase A (PKA).

This phosphorylation has no effect on the ability of TAL1 to bind E2A or in its

Introduction

33

subcellular localization. Nevertheless, the phosphorylation in this residue affects the

DNA binding properties of the TAL1/E2A heterodimers in a target-dependent manner.

In other words, phosphorylation of TAL1 Ser172 regulates the binding of TAL1/E2A

heterodimers to specific E-boxes with different core and flanking sequences, thereby

influencing TAL1 transcriptional activity (313).

The Thr90 residue was shown to be phosphorylated by PKB, resulting in TAL1

decreased repressor activity (315). Curiously, Thr90 was also reported to be involved in

TAL1 protein stability. Terme and collaborators showed that treatment of T-ALL cells

with TGF-β activates PKB, which phosphorylates TAL1 in this residue, promoting the

association of TAL1 with the E3-ubiquitin ligase CHIP and consequent TAL1 poly-

ubiquitination and proteasomal degradation. Interestingly, the association between

TAL1 and CHIP is reduced by over-expressing an E2A isoform (E47) indicating that

the formation of TAL1-E2A heterodimers exerts a protective effect (318). Taken

together, these studies may indicate that phosphorylation of Thr90 negatively regulates

the dynamic interaction between TAL1 and E2A proteins, shifting TAL1 away from its

association with E2A (via which TAL1 exerts its transcriptional repressor activity) and

targeting TAL1 for degradation.

As mentioned above, TAL1 cooperates with the ubiquitous protein kinase CK2 to

induce T-cell malignancies in transgenic mice (250, 251). This could suggest that CK2

directly phosphorylates TAL1. However, this has not been demonstrated yet.

Nonetheless, E2A, the main heterodimerization partner of TAL1, was shown to be

phosphorylated (319) by CK2 (320) and p38 kinase (321, 322). The phosphorylation of

E2A by CK2 increases the heterodimerization and transcriptional activity of MyoD

(320), which is another class II bHLH transcription factor highly homologous to TAL1

(323). These reports suggest that CK2 could regulate TAL1 activity indirectly by

interfering with E2A phosphorylation levels.

TAL1 in normal development

As mentioned above, TAL1 in an important player in hematopoiesis (259, 324),

vascular development (295) and, as demonstrated more recently, neurogenesis (296).

The first indication that TAL1 could play a critical role in development came from its

pattern of expression in hematopoietic, vascular and neural tissues (325).

Introduction

34

TAL1 is important for the establishment of early hematopoiesis (326). TAL1

starts to be be expressed very early in embryonic development (327) and it is important

for the differentiation of the hemangioblast (328-330), the progenitor cell that gives rise

to both hematopoietic and endothelial cells (331). A role in the development of the

hemangioblast is attributed to TAL1 due to the fact that ablation of its expression

resulted in complete absence of primitive blood cells in the mouse (326). Furthermore,

the reconstitution of hematopoiesis in TAL1-deficient embryos failed to restore the

angiogenic remodeling that normally occurs in the yolk-sac, implicating TAL1 in the

regulation of primitive vasculogenesis (295). In addition, a role in neo-angiogenesis was

also established using an in vitro vasculature model. TAL1 was shown to regulate the

migration, proliferation and differentiation of adult endothelial cells (332).

TAL1 is also critical in adult hematopoiesis (333, 334). TAL1 is expressed in

HSCs (259) and decreases upon differentiation to most of the hematopoietic lineages

(335). However, erythroid, megakaryocytic and mastocytic lineages still retain its

expression (259) and TAL1 was shown to positively regulate the differentiation of these

hematopoietic lineages (336). The involvement of TAL1 in adult HSC biology is

considerable. Several studies showed that TAL1 is required for HSC function, including

short-term repopulation activity (337), engraftment and self-renewal capacity (338). In

contrast, by deleting TAL1 expression in conditional knock-out mice, Mikkola and

colleagues found that the HSCs still maintained their properties, namely self-renewal,

engraftment and differentiation into lymphoid and myeloid lineages. The authors

attributed this effect to the fact that TAL1 expression is important for the early

specification and development of HSCs but not for their subsequent functions (339).

More recently, it was demonstrated that TAL1 regulates the quiescence of HSCs by

controlling the expression levels of p21 and Id1, thereby preserving HSC long-term

integrity (340).

Several studies highlighted the importance of TAL1 during the development of

erythroid and megakaryocytic lineages (336, 339, 341). Two independent reports

described that specific inactivation of TAL1 gene expression had a severe negative

impact on erythropoiesis and megakaryopoiesis (336, 339). A third report showed that

knock-down of TAL1 expression in human CD34+ HSCs impacted the erythroid and

myeloid lineages (341). Importantly, ectopic TAL1 expression in human CD34+ HSCs

led to an increase in the formation of erythroid and megakaryocytic colonies in culture

(294). A role for TAL1 in red blood cell differentiation is indeed well established (342).

Introduction

35

TAL1 enforced expression was shown to increase red blood cell differentiation (281)

and TAL1 expression and activity is induced by EPO stimulation of erythroblasts (312,

316). Furthermore, TAL1 regulates the expression of P4.2 (282) and GPA (283), genes

that are important for erythrocyte physiology.

TAL1 is also detected in neural tissues (343), namely in neurons of the lateral and

caudal thalamic region, midbrain and hindbrain (344). Inactivation of TAL1 expression

in the brain resulted growth retardation, altered brain morphology and also abnormal

neuron development, implicating TAL1 in the regulation of brain development (296).

Moreover, TAL1 was also described to play a role in differentiation of astrocytes and

V2b interneurons in the p2 domain of the spinal cord (345).

Genome Organization

Tight control of gene expression is necessary to maintain a healthy and

physiological cellular environment. Due to space constrains the genome is tightly

packed inside the cell nucleus. However, this has to be somehow balanced by processes

that allow for access to the transcriptional machinery for gene expression purposes.

Therefore the mechanisms responsible for the genome organization in the nucleus are

also tightly controlled to insure proper gene expression.

Nucleosomes and Histones

In the nucleus, the DNA is tightly condensed, packed and, in conjugation with

proteins such as histones, constitutes the major component of the chromatin. The

chromatin exists in two forms, the heterochromatin which is highly packed and

transcriptionally inactive and euchromatin that is composed of loosely packed DNA and

is a region where active transcription occurs (346). The nucleosomes are protein

complexes that are highly associated with genomic DNA. These structures are

composed of 146 base pair long stretches of DNA that wrap around a histone core

(347). Histones, which are the most abundant proteins in the nucleus, are small weight

proteins (around 11 to 20 KDa) and contain a high percentage of positively charged

residues that are responsible for the strong interaction with the DNA. In eukaryotic cells

five histone proteins were identified. The histone H1 is the linker that binds

nucleosomes together and thereby regulates further packaging of the DNA. The other

histones H2A, H2B, H3 and H4 assemble in the nucleosome core forming an octamer

Introduction

36

composed of two copies of each of these histones. These proteins share a similar

structure.They are composed of a center fold domain and N- and C-terminal tails. The

fold domain participates in the structure of the nucleosome core, whereas the tails are

pivotal for the normal function of cellular processes such as DNA replication and gene

transcription (346, 348-351).

Several post-translational modifications have been identified in the N-terminal

tails of histones, which include acetylation, methylation, phosphorylation,

ubiquitination and ADP-ribosylation (352). Acetylation and methylation of histones are

highly associated with gene expression levels (348). In particular, acetylation of the N-

terminal tail of histones neutralizes the positively charged lysine residues and therefore

reduces the interaction between histones and DNA. This leads to the relaxion of the

packaging of DNA, facilitating the recruitment of transcription factors and the assembly

of RNA polymerase complexes, ultimately promoting gene transcription (346, 349,

350).

Histone Acetyl Transferases (HATs) and Histone Deacetylases (HDACs)

As described above, the level of histone N-terminal acetylation at the nucleosome

core impacts gene transcription. Two classes of enzymes regulate the amount of

acetylation in the N-terminal tail of histones: the Histone Acetyl Transferases (HATs)

and Histone Deacetylases (HDACs). HATs mediate the transfer of acetyl groups from

Acetyl-CoA to lysine residues, decreasing the binding of histones to the DNA (353).

This event opens the chromatin configuration, allowing the recruitment of transcription

factors for activation of gene expression. In opposition, HDACs remove acetyl groups

from the N-terminal tail of histones, resulting in increased DNA-histone interaction.

This closes the chromatin configuration and inhibits the binding of transcription factors

to the DNA. The fine balance between the activities of these enzymes dictates the level

of histone acetylation, thereby regulating gene transcription (346, 350).

Due to its association with gene expression, deregulation of HAT/HDAC

activities can lead to tumorigenesis (354, 355). For example, increased acetylation in

promoters of proto-oncogenes that are normally expressed at low levels would increase

their expression and potentiate the tumorigenic process. In contrast, decreased

acetylation in promoters of tumor suppressor genes would lead to their down-regulation

and possibly contribute to aberrant proliferation of tumor cells (346).

Introduction

37

HATs

The role for acetylation in the regulation of gene expression was suggested 45

years ago (356). However, the molecules responsible for this phenomenon only recently

have been identified (357, 358). HATs regulate gene expression by the mechanisms

described above, but do not bind directly to the DNA. Instead they are recruited by

transcription factors such as TAL1 (286) and other co-factors to acetylate histones that

are in the vicinity of gene promoters (357). The HAT enzymes also participate in DNA

repair (359-361). The p300/CBP complex was shown to acetylate histones at double

strand breaks, thereby facilitating chromatin remodeling and recruitment of non-

homologous end-joining factors such as Ku70 and Ku80 proteins (361).

Several HATs have been identified so far, which are chategorized in two types.

Type A HATs are located in the nucleus and acetylate nucleosomal histones and

chromatin associated proteins, whereas type B HATs are located in the cytoplasm and

acetylate newly translated histones (357). Type A HATs are further divided into three

main groups: the GNAT group includes, among others, the GCN5 and P/CAF members;

the MYST group, and the p300 and CBP acetyltransferases that form their own separate

group (349). It is well established that HATs acetylate histones that form the

nucleosome core (H2A, H2B, H3 and H4). However, it has been shown that HATs can

also acetylate other proteins and modify their activity. Examples of HAT target proteins

include transcription factors such as GATA1, E2F, p53, TAL1 and E2A (349, 362-364).

Of note, TAL1 is acetylated in vivo by P/CAF, increasing its DNA binding activity

(363). E2A proteins were shown to be acetylated by three different HATs: P/CAF, p300

and CBP. Acetylation of E2A increases its transcriptional activity and nuclear

localization (364).

As described above, deregulation of HAT activity can promote the development

of cancer and alterations in the genes that code the HAT enzymes are common in

cancer. These alterations include overexpression, amplification, translocations and also

mutations in these genes. Missense mutations and truncations in the p300 gene were

identified in colon and gastric cancer and other epithelial cancers. Loss of p300

heterozygosity has also been described in 80% of the patients with glioblastomas. Loss

of heterozygosity was also described for the CBP gene in hepatocellular carcinomas. In

AML, the CBP gene was shown to fuse with several partners that include MLL, MOZ,

MYST4 and MORF (349-351).

Introduction

38

HDACs

As described above, Histone Deacetylases (HDACs) enzymes remove acetyl

groups from acetylated histones, and thus are linked to gene repression by creating a

more compact chromatin (346, 349, 350). Similar to HATs, HDACs also do not bind to

DNA and are recruited by large multi-protein complexes that include transcription

factors and general repressors – e.g. Sin3 and N-CoR (346, 365, 366).

Mammalian HDACs are divided in four classes (Table 1.4), based on homology

with yeast HDACs and structure of the catalytic domain. The classe I HDACs (1, 2, 3

and 8) are orthologues of the yeast HDAC Rpd3 protein and are small nuclear proteins

with generalized expression. The HDACs 4, 5, 6, 7, 9 and 10 belong to the class II and

are orthologues of the yeast HDAC Hda1 protein. The class II HDACs are high

molecular weight proteins that shuttle between the cytoplasm and the cellular nucleus

and have tissue specific expression (351, 367, 368). HDAC6 and 10 are classified as IIb

due to the fact that they contain two catalylic domains, whereas HDAC4, 5, 7 and 9 are

IIa. The shuttling of class IIa HDACs was shown to be regulated by N-terminal

phosphorylation and subsequent association with 14-3-3 proteins (369, 370). The

HDAC11 is the only member of the class IV due to the presence of a different catalytic

domain (367). The HDACs that belong to classes I, II and IV contain Zinc in the active

site of the catalytic domain. Contrarily, class III HDACs (Sirtuins 1-7) are homologous

to the yeast Sirt2 and have a unique catalytic domain that is dependent of NAD+

molecules for its activity and lacks Zinc in the catalytic site. This latter characteristic is

highly important, since class III HDACs are not inhibited by any of the conventional

HDAC inhibitors (349, 365, 366).

Similar to HATs, HDACs are also capable of deacetylating other proteins

besides histones, including the transcription factors E2F (371, 372), GATA (373) and c-

Myc (371), the protein chaperone HSP90 (374) and the cytoskeleton protein α-tubulin

(375, 376).

HDACs Class Zn2+

dependency MW (KDa) Localization Expression

HDAC1-3, 8 I Yes 20-55 Nucleus Ubiquitous

HDAC4-7, 9-10 II Yes 70-135 Nucleus Tissue specific

SIRT1-7 III No - Variable Variable

HDAC11 IV Yes 40 Nucleus Ubiquitous

Table 1.4. Charactheristics of Histone Deacetylases (HDACs).

Introduction

39

Although mutations in the genes that code for HDACs are very rare, deregulated

HDAC activity is frequently found in human cancers. Several reports indicate that

HDAC proteins are up-regulated in cancer cells when compared with normal tissues.

Increased HDAC1 expression was demonstrated in prostate (377), gastric (378), colon

(379) and breast carcinomas (380). Moreover, HDAC2 was also shown to have

increased expression in colorectal (76, 379) and gastric (381) carcinomas, whereas

HDAC3 is increased in colon tumors (379). There are also reports indicating that

HDAC4 and HDAC6 activity are up-regulated in breast cancer patients (382, 383).

Recently, Moreno and colleagues found that ALL patients display increased expression

of several HDAC proteins (HDAC2, HDAC3, HDAC6, HDAC7 and HDAC8) and T-

ALL patients showed increased expression of HDAC1 and HDAC4 (384). Cancer cells

not only upregulate HDACs but also show aberrant recruitment of HDACs to promoters

due to the interaction with oncogenic transcription factors (367). For example, the

fusion proteins PML-RARα, PLZF-RARα and AML-ETO1 were shown to induce AML

by recruiting HDAC-containing complexes to repress the expression of specific genes

(385-387). The BCL6 transcription factor is highly associated with B-cell lymphomas

and was shown to recruit HDAC2 to repress the expression of genes that negatively

regulate cell cycle progression (388, 389). As described above, TAL1 interacts with

HDAC1 (286) and was shown recruit HDAC1-containing complexes to repress the

expression of E2A target-genes and induce leukemia in a TAL1 transgenic mouse

model (252).

HDAC inhibitors (HDACis)

The fact that human cancers display abnormal HDAC expression and activity

provides a rationale for the design of inhibitors to target these chromatin regulators in

cancer therapy. In fact, inhibition of HDAC activity was shown to release the repressive

block of genes that lead to cell cycle arrest, apoptosis, differentiation and inhibition of

angiogenesis (346, 351, 353, 367).

Several HDACis have been identified and synthesized. Table 1.5 summarizes the

different HDACis that are currently under use and are involved in clinical trials for

cancer therapy (351, 367). As shown in Table 1.5, HDACis are divided into different

classes according with their chemical structures, which include short-chain fatty acids,

hydroxamic acids, cyclic peptides, benzamides and ketones. Butyrate, Phenylbutyrate,

Introduction

40

Valproic Acid and other short-chain fatty acids are relative weak inhibitors of HDACs.

However, a derivative of Butyrate, the AN-9 compound has a higher in vitro efficacy

than the other fatty acids.

TSA was the first Hydroxamic Acid shown to inhibit HDAC proteins, and it is

highly effective in vitro. However, it was shown to be too toxic to be used in the clinic.

Other Hydroxamic Acids such as SAHA (Vorinostat) and LBH589 (Panobinostat) are

derivatives of TSA that maintain its effectiveness with reduced toxicity. Cyclic peptides

are a complex structurally group of HDACis that includes the naturally occurring

product FK-228, Apicidin and Trapoxin A. These HDACis are highly effective in vitro

and FK-228 is already being tested for clinical purposes. Benzamides are synthetic

products with high in vitro HDAC inhibitory activity that include the compounds MS-

275 and CI-994. Ketones have powerfull in vitro activity but their in vivo toxicity

precludes their use for clinical purposes. Other HDACis include Dupedecin and

MGCD-0103. A common feature to the currently available HDACis is the lack of

specificity. As shown in Table 1.5, most of the HDACis used, inhibit the activity of

several HDACs belonging to one or more classes. Despite displying different chemical

properties, most HDACis contain three structural components that are necessary to

inhibit the activity of HDAC enzymes: a hydrophobic cap, a polar site and a Zinc

binding site. The mechanism of inhibition involves the binding of the HDACi to the

Zinc ion in the HDAC catalytic site, preventing its binding to acetylated proteins (346,

351, 353, 367).

HDACis and gene expression

As mentioned before, incubation with HDACis results in the up-regulation of

genes related to apoptosis and cell cycle arrest (367). A gene that is consistently up-

regulated by HDACis is the CDKN1A which codes for the cyclin-dependent kinase

inhibitor p21CIP1

. Several HDACis described in Table 1.5 (SB; TSA; SAHA;

Depsipetide; MS-275 and Oxamflatin) were shown to induce the expression of this cell

cycle regulator (346, 350, 390). HDACis were also shown to induce the expression of

members of the TNF family and of the mitochondrial apoptotic pathway (367).

Introduction

41

HDAC inhibitors (HDACi) Class Specificity In vitro potency Clinical trials Clinical Trial Reference***

Sodium Butyrate (SB)

Short-chain fatty acids

Class I and IIa mM Phase II -

Phenyl-Butyrate (PB) Class I and IIa mM Phase II -

Valproic Acid (VPA) Class I and IIa mM Phase II NCT00525135

AN9 (Pivanex) n.d. µM Phase II NCT00083473; NCT00087477

Trichostatin A (TSA)

Hydroxamic Acids

Class I and II nM - -

Suberoylanilide Hydroxamic Acid (SAHA) Class I and II µM Phase III NCT00473889; NCT00773747; NCT00128102

M-carboxycinnamic Acid bis-Hydroxamide

(CBHA) n.d. µM - -

NVP-LAQ824 Class I and II nM Phase I -

Panobinostat (LBH589) Class I and II nM Phase III NCT00449761; NCT00425555; NCT00490776

Pyroxamide Class I µM Phase I NCT00042900

PDX101 Class I and II µM Phase I NCT00589290

Depsipeptide (FK228, FR901228)

Cyclic Peptides

Class I nM Phase II NCT00106431; NCT00383565; NCT00077337;

Apicidin Class I** nM - -

Trapoxin A Class I and IIa nM - -

MS-275 Benzamides

Class I µM Phase II NCT00185302; NCT00866333; NCT00828854

N-Acetyldanilide (CI-994) n.d. µM Phase III NCT00005093

Trifluoromethyl Ketone Ketones n.d. µM - -

Dupedecin Other synthetic compounds

Class I µM - -

MGCD-0103 Class I µM Phase II NCT00431873; NCT00358982; NCT00324220

Table 1.5. Classification of the commonly used HDAC inhibitors (HDACis)*

n.d. not determined. * This information was collected from the references 341, 346, 348 and 360. ** inhibits HDAC1, HDAC2 and HDAC3 but not

HDAC8. *** From http://clinicaltrials.gov

Introduction

42

Although several genes have been reported to be up-regulated upon response to HDACi

treatment, microarray studies show that HDACi treatment only affects a slight fraction

of cellular genes. This may, in part, relate to the knowledge that HDACis regulate gene

expression not only by affecting transcription but also by regulating mRNA and protein

stability (346), the latter not being accounted for in microarray analyses.

Interestingly, whereas HDACi treatment up-regulates the expression of genes

associated with apoptosis and cell cycle arrest, it decreases the levels of genes that are

involved in promoting proliferation (391-393). The fact that HDAC inhibition also leads

to down-regulation of gene expression suggests that some of the effects of HDACis are

not due to changes in chromatin conformation, but rather in acetylation levels of other

HDAC targets in the cell (351, 366).

HDACis were also shown to decrease the expression of oncogenes, such as c-Myc

(394, 395), BCL-2 (396), COX-2 (397, 398), DNMT1 (399, 400), Claudin-1 (401), and

BCR-ABL (395, 402). The effect of HDACis does not occur strictly at the level of

transcription. For example, the transcription of DNMT1 (399), which codes for a DNA

methyltransferase associated with cellular transformation (403), was shown to be

inhibited by treatment with Apicidin in cervix cancer cells (399). However, in T-ALL

cells HDAC inhibition induced the degradation of DNMT1 transcripts (400). In fact,

mounting evidence implicates HDACis in the regulation of mRNA stability. Incubation

of endometrial cancer cells with TSA decreased the stability of the DNMT3B transcripts

leading to the down-regulation of this DNA methyltransferase (404). Recently,

Krishnan and colleagues demonstrated that the same mechanism was implicated in the

down-regulation of the tight junction protein Claudin-1 in colon cancer cells

(401).BCR-ABL is the fusion protein created by the t(9;22)(q43;q11) translocation

highly common in CML patients (112). Treatment of CML cells with HDACis induces

the proteasomal degradation of BCR-ABL (402), via acetylation of HSP90 (402) and

activation of the ubiquitin pathway (405). Several other proteins were show to be

degradated upon HDACi exposure, including key regulators of signaling pathways such

as ERK (406) and c-RAF (407). Furthermore, HDACi treatment of renal cancer cells

also led to the proteasomal degradation of Aurora A and B, two kinases that are

involved in the regulation of cell cycle progression in the G2-M stage. The degradation

of these kinases not only induced cell cycle arrest but also increased apoptosis (408).

Introduction

43

HDACi treatment can also affect protein translation. SAHA was shown to

suppress the translation of cyclin D1 in mantle cell lymphoma cells through the direct

inhibition of PI3K (409).

Interestingly, HDACis can also down-regulate the expression of HDACs. In CML

cells, SAHA treatment decreased HDAC3 protein levels (395), whereas VPA induced

proteasomal degradation of HDAC2 (410).

HDACis have a clear pleotropic effect on gene expression and can affect not only

gene transcription, but also mRNA stability, translation and protein stability, which

makes HDACis unique compounds in targeting diseases, such as cancer, that are highly

associated with gene deregulation.

The effect of HDACis on cancer cells

The cytotoxic and cytostatic effects of HDACis seem to be restricted to cancer

cells, since normal tissues are relative resistant to HDACi treatment (411, 412). Two

lines of evidence may explain the resistance of normal tissue to HDAC inhibition.

Warrener and collegues suggest that cancer cells are sensitive to HDACis because they

are defective in cell cycle checkpoints that are triggered upon exposure to HDACis in

normal cells. Normal cells activate these checkpoints, preventing them from further

progressing in the cell cycle, whereas cancer cells without these checkpoints progress

through the cycle with major mitotic defects and eventually die by apoptosis (411, 413).

An alternative line of evidence indicates that it may be the expression and activity of the

ROS scavenger Thioredoxin (TRX) that determines the resistance of normal cells to

HDACi (412). Exposure to HDACis increases ROS to levels that are cytotoxic (414).

However, normal cells up-regulate TRX expression in response to HDACis, which may

protect them from ROS-induced death (412). In contrast, cancer cells decrease TRX

expression upon HDACi exposure, and up-regulate Thioredoxin Binding Protein-2

(TBP-2), which binds TRX and inhibits its reducing activity (415). These two

mechanisms strongly contribute to abrogation of TRX activity in cancer cells and

should make them highly sensitive to HDACis (416). Whatever the exact mechanisms

that make cancer cells particularly sensitive to HDACis, the fact that these drugs

selectively eliminate cancer cells makes them highly appealing to treat cancer patients.

The efficacy of HDACis against tumor cells was demonstrated in vitro in several

cancer cell lines that include neuroblastoma, melanoma, leukemia, breast, ovarian,

Introduction

44

colon, lung, and prostate, amongst others (346, 349, 351, 367). In vivo studies also

showed that HDACis are effective in the treatment of cancer mouse models of breast,

lung, prostate, and gastric cancer, neuroblastoma and leukemia (349). Notably, the few

studies that have addressed the role of HDACis in T-ALL showed that exposure to

HDACis results in leukemic blast apoptosis (417, 418).

Due to their high in vitro efficacy, HDACis were tested in clinical trials for

several types of cancer that included solid tumors and hematological malignancies

(346). One of the most promising HDACis is SAHA, which was tested in phase III

clinical trials for several types of tumors that include lung cancer

(http://clinicaltrials.gov/ NCT00473889), multiple myeloma (NCT00773747) and

malignant pleural mesenthelioma (NCT00128102). Importantly, SAHA was also tested

in phase II clinical trials for cutaneous T-cell lymphoma with a good response in the

treated patients (368). Other promising HDACis are the Hydroxamic Acid LBH589 and

the Benzimide CI-994. LBH589 is currently being tested in phase II clinical trials to

treat hematological malignancies such as Cutaneous T-cell Lymphoma (NCT00425555

and NCT00490776). CI-994 is being tested in phase II clinical trials for pancreatic

cancer (NCT00004861) and multiple myeloma (NCT00005624), and a phase III trial for

lung cancer (NCT00005093).

HDAC inhibitors synergize with several other pharmacological agents resulting in

increased apoptosis of target cells (346, 367, 419). Such drugs include DNA

methyltransferase inhibitors (e.g. 5-Aza- 2‟Deoxycitidine) that activate the transcription

of hyper-methylated genes (420), standard chemotherapeutic drugs (e.g. Doxorubucin)

(421) and BCR-ABL (402), PI3K (406), MEK (422) and PKC (423) kinase inhibitors.

In addition, HDACis induce HSP90 acetylation, promoting degradation of HSP90 client

proteins. Thus, combined incubation with HSP90 inhibitors may also be synergistic

(424). Importantly, combinatorial therapeutic strategies may constitute efficient ways to

overcome the resistance to HDACi that has sometimes been reported. For example, a

mutation in HDAC2 was identified in colon and endometrial tumor cell lines resistant to

TSA (425), and HDAC1 overexpression confers resistance to Butyrate treatment in

melanoma cancer cells (426). Furthermore, it was recently demonstrated that HDACi

treatment in AML cells induces the expression of ABC multidrug transporters,

increasing the efflux of cytotoxic drugs from AML cells and providing a mechanism for

resistance to chemotherapy (427). Despite the occurrence of resistance in cancer cells,

the clinical trials where HDACis participated, either as mono-therapy or in conjunction

Introduction

45

with other drugs, have been so far largely successful, highlighting their promise as

effective tools for the treatment of cancer patients.

Objectives

Despite the significant advances in the treatment of T-ALL (27, 28), around 20%

of the cases remain incurable. In order to define new molecular targets for improved

therapeutic intervention, it is crucial to understand the biology and pathophysiology of

this disease. The fundamental goal of the present thesis was to contribute to a better

understanding of T-ALL and possibly to identify novel targets for therapeutic

intervention. Therefore, we not only analyzed the role of cell-intrinsic mechanisms

(related to TAL1 function) in the biology of T-ALL, but also the possible involvement

of the micro-environment (illustrated by study of IL-4) in the function of leukemia cells.

We had previously shown that c cytokines can increase the proliferation of

primary T-ALL cells in vitro (72). Particularly, IL-7 was able to increase the

proliferation and viability of primary T-ALL cells through the activation of PI3K

pathway. Importantly, pharmacological inhibition of PI3K pathway completely reversed

the effects of IL-7 (70). Here, we used primary T-ALL samples to analyze the

downstream events activated by IL-4. These results have been published (428) and are

described in Chapter 2.

Aberrant expression of the TAL1 gene is considered the most common alteration

in T-ALL, frequently in combination with LMO proteins (LMO1 and LMO2) (149).

However, it is still unknown whether the expression of the TAL1 is the actual cause of

leukemia or, alternatively, is a merely secondary event in the transformation process.

One of the key early steps in leukemogenesis is the blockade of normal T-cell

differentiation that results in the accumulation of malignant T-cell lymphoblasts

arrested at different stages of development (227, 251-253). To test whether TAL1, alone

or in association with LMO2, could impair normal T-cell development, we made use of

in vitro co-culture systems that allow the differentiation of human T-cells from

hematopoietic and thymic progenitors (33, 34, 429). The preliminary results obtained

during this part of the project are described in Chapter 3.

Despite the fact that TAL1 is a transcription factor (246), very few TAL1 target

genes have been identified in the context of T-ALL (292, 303-305). To identify novel

TAL1 targets, we used the 4-OH-Tamoxifen system (430) to induce TAL1 activity in a

Introduction

46

regulated manner, and analyzed the gene expression profile using microarray

technology. The genes identified, validated and partially characterized in this study are

shown in Chapter 4.

TAL1 was shown to interact with HDAC complexes during red blood cell

development (286) and in T-ALL cells (252). Moreover, incubation of tumors derived

from TAL1 transgenic mice with HDACis was reported to selectively kill these tumors

without affecting normal thymocytes or TAL1-negative leukemia cell lines (252).

Interestingly, HDACis decrease the expression of several oncogenes in cancer cells,

either by mRNA or protein degradation or by transcriptional inhibition (399, 401, 402).

To understand whether inhibition of HDAC function could impact on TAL1 expression,

we treated T-ALL cells with different HDACis and analyzed TAL1 expression. The

characterization of the mechanisms by which HDACis affect TAL1 expression are

described in Chapter 5 and were recently published.

References

1. Ackerknecht, E.H. 1958. Historical notes on cancer. Med Hist 2:114-119.

2. Weinberg, R.A. 2007. The Nature of Cancer. In: Weinberg R-A, ed. The Biology of

Cancer. Garland Science 25-57.

3. Dictionary of Cancer Terms at: http://www.cancer.gov/dictionary.

4. Silverstein, A.S., Virginia; Nunn, Laura Silverstein. 2006. The cells gone wild. In:

Silverstein A, ed Cancer. Twenty-First Century Books 7-12.

5. Hanahan, D., and R.A. Weinberg. 2000. The hallmarks of cancer. Cell 100:57-70.

6. Hanahan, D., and R.A. Weinberg. 2011. Hallmarks of cancer: the next generation. Cell

144:646-674.

7. Lazebnik, Y. 2010. What are the hallmarks of cancer? Nat Rev Cancer 10:232-233.

8. Collins, K., T. Jacks, and N.P. Pavletich. 1997. The cell cycle and cancer. Proc Natl

Acad Sci U S A 94:2776-2778.

9. Eaves, C.J.E., A C. 1999. Anatomy and phisiology of hematopoiesis. In: Pui C-H, ed.

Childhood Leukemias. Cambrigde University Press 69-105.

10. Pui, C.H. 1995. Childhood leukemias. N Engl J Med 332:1618-1630.

11. Pinkel, D. 1999. Historical Perspective. In: Pui. C-H, ed. Childhood Leukemias.

Cambrigde University Press 3-18.

12. Onciu M, P.C. 1999. Diagnosis and Classification. In: Pui C-H, ed. Childhood

Leukemias. Cambrigde University Press 21-47.

Introduction

47

13. Uckun, F.M., M.G. Sensel, L. Sun, P.G. Steinherz, M.E. Trigg, N.A. Heerema, H.N.

Sather, G.H. Reaman, and P.S. Gaynon. 1998. Biology and treatment of childhood T-

lineage acute lymphoblastic leukemia. Blood 91:735-746.

14. Graux, C., J. Cools, L. Michaux, P. Vandenberghe, and A. Hagemeijer. 2006.

Cytogenetics and molecular genetics of T-cell acute lymphoblastic leukemia: from

thymocyte to lymphoblast. Leukemia 20:1496-1510.

15. Pui, C.H., M.V. Relling, and J.R. Downing. 2004. Acute lymphoblastic leukemia. N

Engl J Med 350:1535-1548.

16. Notarangelo, L.D., S. Santagata, and A. Villa. 2001. Recombinase activating gene

enzymes of lymphocytes. Curr Opin Hematol 8:41-46.

17. Numata, M., S. Saito, and K. Nagata. 2010. RAG-dependent recombination at cryptic

RSSs within TEL-AML1 t(12;21)(p13;q22) chromosomal translocation region.

Biochem Biophys Res Commun 402:718-724.

18. Aplan, P.D., D.P. Lombardi, A.M. Ginsberg, J. Cossman, V.L. Bertness, and I.R.

Kirsch. 1990. Disruption of the human SCL locus by "illegitimate" V-(D)-J

recombinase activity. Science 250:1426-1429.

19. Redaelli, A., B.L. Laskin, J.M. Stephens, M.F. Botteman, and C.L. Pashos. 2005. A

systematic literature review of the clinical and epidemiological burden of acute

lymphoblastic leukaemia (ALL). Eur J Cancer Care (Engl) 14:53-62.

20. Pui, C.H., and W.E. Evans. 2006. Treatment of acute lymphoblastic leukemia. N Engl J

Med 354:166-178.

21. Pui, C.H., L.L. Robison, and A.T. Look. 2008. Acute lymphoblastic leukaemia. Lancet

371:1030-1043.

22. Mattano, L.A., Jr., H.N. Sather, M.E. Trigg, and J.B. Nachman. 2000. Osteonecrosis as

a complication of treating acute lymphoblastic leukemia in children: a report from the

Children's Cancer Group. J Clin Oncol 18:3262-3272.

23. Kaste, S.C., D. Jones-Wallace, S.R. Rose, J.M. Boyett, R.H. Lustig, G.K. Rivera, C.H.

Pui, and M.M. Hudson. 2001. Bone mineral decrements in survivors of childhood acute

lymphoblastic leukemia: frequency of occurrence and risk factors for their

development. Leukemia 15:728-734.

24. Nowak-Gottl, U., C. Wermes, R. Junker, H.G. Koch, R. Schobess, G. Fleischhack, D.

Schwabe, and S. Ehrenforth. 1999. Prospective evaluation of the thrombotic risk in

children with acute lymphoblastic leukemia carrying the MTHFR TT 677 genotype, the

prothrombin G20210A variant, and further prothrombotic risk factors. Blood 93:1595-

1599.

Introduction

48

25. Hill, D.E., K.T. Ciesielski, L. Sethre-Hofstad, M.H. Duncan, and M. Lorenzi. 1997.

Visual and verbal short-term memory deficits in childhood leukemia survivors after

intrathecal chemotherapy. J Pediatr Psychol 22:861-870.

26. Downing, J.R., and K.M. Shannon. 2002. Acute leukemia: a pediatric perspective.

Cancer Cell 2:437-445.

27. Schrappe, M., A. Reiter, W.D. Ludwig, J. Harbott, M. Zimmermann, W. Hiddemann, C.

Niemeyer, G. Henze, A. Feldges, F. Zintl, B. Kornhuber, J. Ritter, K. Welte, H. Gadner,

and H. Riehm. 2000. Improved outcome in childhood acute lymphoblastic leukemia

despite reduced use of anthracyclines and cranial radiotherapy: results of trial ALL-

BFM 90. German-Austrian-Swiss ALL-BFM Study Group. Blood 95:3310-3322.

28. Silverman, L.B., R.D. Gelber, V.K. Dalton, B.L. Asselin, R.D. Barr, L.A. Clavell, C.A.

Hurwitz, A. Moghrabi, Y. Samson, M.A. Schorin, S. Arkin, L. Declerck, H.J. Cohen,

and S.E. Sallan. 2001. Improved outcome for children with acute lymphoblastic

leukemia: results of Dana-Farber Consortium Protocol 91-01. Blood 97:1211-1218.

29. Goldberg, J.M., L.B. Silverman, D.E. Levy, V.K. Dalton, R.D. Gelber, L. Lehmann,

H.J. Cohen, S.E. Sallan, and B.L. Asselin. 2003. Childhood T-cell acute lymphoblastic

leukemia: the Dana-Farber Cancer Institute acute lymphoblastic leukemia consortium

experience. J Clin Oncol 21:3616-3622.

30. DeAngelo, D.J. 2005. The treatment of adolescents and young adults with acute

lymphoblastic leukemia. Hematology Am Soc Hematol Educ Program 123-130.

31. Bommhardt, U., M. Beyer, T. Hunig, and H.M. Reichardt. 2004. Molecular and cellular

mechanisms of T cell development. Cell Mol Life Sci 61:263-280.

32. Staal, F.J., F. Weerkamp, A.W. Langerak, R.W. Hendriks, and H.C. Clevers. 2001.

Transcriptional control of t lymphocyte differentiation. Stem Cells 19:165-179.

33. Jaleco, A.C., H. Neves, E. Hooijberg, P. Gameiro, N. Clode, M. Haury, D. Henrique,

and L. Parreira. 2001. Differential effects of Notch ligands Delta-1 and Jagged-1 in

human lymphoid differentiation. J Exp Med 194:991-1002.

34. Schmitt, T.M., and J.C. Zuniga-Pflucker. 2002. Induction of T cell development from

hematopoietic progenitor cells by delta-like-1 in vitro. Immunity 17:749-756.

35. Radtke, F., A. Wilson, and H.R. MacDonald. 2004. Notch signaling in T- and B-cell

development. Curr Opin Immunol 16:174-179.

36. Plum, J., M. De Smedt, G. Leclercq, B. Verhasselt, and B. Vandekerckhove. 1996.

Interleukin-7 is a critical growth factor in early human T-cell development. Blood

88:4239-4245.

37. Bukowski, J.F., C.T. Morita, and M.B. Brenner. 1999. Human gamma delta T cells

recognize alkylamines derived from microbes, edible plants, and tea: implications for

innate immunity. Immunity 11:57-65.

Introduction

49

38. Ferrick, D.A., D.P. King, K.A. Jackson, R.K. Braun, S. Tam, D.M. Hyde, and B.L.

Beaman. 2000. Intraepithelial gamma delta T lymphocytes: sentinel cells at mucosal

barriers. Springer Semin Immunopathol 22:283-296.

39. Tonegawa, S. 1983. Somatic generation of antibody diversity. Nature 302:575-581.

40. von Boehmer, H., and H.J. Fehling. 1997. Structure and function of the pre-T cell

receptor. Annu Rev Immunol 15:433-452.

41. Aifantis, I., M. Mandal, K. Sawai, A. Ferrando, and T. Vilimas. 2006. Regulation of T-

cell progenitor survival and cell-cycle entry by the pre-T-cell receptor. Immunol Rev

209:159-169.

42. Bene, M.C., G. Castoldi, W. Knapp, W.D. Ludwig, E. Matutes, A. Orfao, and M.B.

van't Veer. 1995. Proposals for the immunological classification of acute leukemias.

European Group for the Immunological Characterization of Leukemias (EGIL).

Leukemia 9:1783-1786.

43. Winter, S.S., J. Sweatman, J.J. Shuster, M.P. Link, M.D. Amylon, J. Pullen, B.M.

Camitta, and R.S. Larson. 2002. Bone marrow stroma-supported culture of T-lineage

acute lymphoblastic leukemic cells predicts treatment outcome in children: a Pediatric

Oncology Group study. Leukemia 16:1121-1126.

44. Scupoli, M.T., F. Vinante, M. Krampera, C. Vincenzi, G. Nadali, F. Zampieri, M.A.

Ritter, E. Eren, F. Santini, and G. Pizzolo. 2003. Thymic epithelial cells promote

survival of human T-cell acute lymphoblastic leukemia blasts: the role of interleukin-7.

Haematologica 88:1229-1237.

45. Winter, S.S., J.J. Sweatman, M.B. Lawrence, T.H. Rhoades, A.L. Hart, and R.S.

Larson. 2001. Enhanced T-lineage acute lymphoblastic leukaemia cell survival on bone

marrow stroma requires involvement of LFA-1 and ICAM-1. Br J Haematol 115:862-

871.

46. Damiano, J.S., A.E. Cress, L.A. Hazlehurst, A.A. Shtil, and W.S. Dalton. 1999. Cell

adhesion mediated drug resistance (CAM-DR): role of integrins and resistance to

apoptosis in human myeloma cell lines. Blood 93:1658-1667.

47. Sipkins, D.A., X. Wei, J.W. Wu, J.M. Runnels, D. Cote, T.K. Means, A.D. Luster, D.T.

Scadden, and C.P. Lin. 2005. In vivo imaging of specialized bone marrow endothelial

microdomains for tumour engraftment. Nature 435:969-973.

48. Colmone, A., M. Amorim, A.L. Pontier, S. Wang, E. Jablonski, and D.A. Sipkins. 2008.

Leukemic cells create bone marrow niches that disrupt the behavior of normal

hematopoietic progenitor cells. Science 322:1861-1865.

49. Olson, T.S., and K. Ley. 2002. Chemokines and chemokine receptors in leukocyte

trafficking. Am J Physiol Regul Integr Comp Physiol 283:R7-28.

Introduction

50

50. Kakinuma, T., and S.T. Hwang. 2006. Chemokines, chemokine receptors, and cancer

metastasis. J Leukoc Biol 79:639-651.

51. Burger, J.A., and T.J. Kipps. 2006. CXCR4: a key receptor in the crosstalk between

tumor cells and their microenvironment. Blood 107:1761-1767.

52. Balkwill, F. 2004. The significance of cancer cell expression of the chemokine receptor

CXCR4. Semin Cancer Biol 14:171-179.

53. Matsumoto, T., S. Jimi, S. Hara, Y. Takamatsu, J. Suzumiya, and K. Tamura. 2010.

Am80 inhibits stromal cell-derived factor-1-induced chemotaxis in T-cell acute

lymphoblastic leukemia cells. Leuk Lymphoma 51:507-514.

54. Dialynas, D.P., M.J. Lee, D.P. Gold, L. Shao, A.L. Yu, M.J. Borowitz, and J. Yu. 2001.

Preconditioning with fetal cord blood facilitates engraftment of primary childhood T-

cell acute lymphoblastic leukemia in immunodeficient mice. Blood 97:3218-3225.

55. Dialynas, D.P., L. Shao, G.F. Billman, and J. Yu. 2001. Engraftment of human T-cell

acute lymphoblastic leukemia in immunodeficient NOD/SCID mice which have been

preconditioned by injection of human cord blood. Stem Cells 19:443-452.

56. Spoo, A.C., M. Lubbert, W.G. Wierda, and J.A. Burger. 2007. CXCR4 is a prognostic

marker in acute myelogenous leukemia. Blood 109:786-791.

57. Sharma, M., F. Afrin, N.K. Satija, R.K. Thripati, and G.U. Gangenahalli. 2011. SDF-

1/CXCR4 Signaling: Indispensable role in Homing and Engraftment of Hematopoietic

Stem Cells in Bone Marrow. Stem Cells Dev 20:933-946.

58. Qiuping, Z., X. Jie, J. Youxin, W. Qun, J. Wei, L. Chun, W. Jin, L. Yan, H. Chunsong,

Y. Mingzhen, G. Qingping, L. Qun, Z. Kejian, S. Zhimin, L. Junyan, and T. Jinquan.

2005. Selectively frequent expression of CXCR5 enhances resistance to apoptosis in

CD8(+)CD34(+) T cells from patients with T-cell-lineage acute lymphocytic leukemia.

Oncogene 24:573-584.

59. Qiuping, Z., L. Qun, H. Chunsong, Z. Xiaolian, H. Baojun, Y. Mingzhen, L.

Chengming, H. Jinshen, G. Qingping, Z. Kejian, S. Zhimin, Z. Xuejun, L. Junyan, and

T. Jinquan. 2003. Selectively increased expression and functions of chemokine receptor

CCR9 on CD4+ T cells from patients with T-cell lineage acute lymphocytic leukemia.

Cancer Res 63:6469-6477.

60. Buonamici, S., T. Trimarchi, M.G. Ruocco, L. Reavie, S. Cathelin, B.G. Mar, A.

Klinakis, Y. Lukyanov, J.C. Tseng, F. Sen, E. Gehrie, M. Li, E. Newcomb, J. Zavadil,

D. Meruelo, M. Lipp, S. Ibrahim, A. Efstratiadis, D. Zagzag, J.S. Bromberg, M.L.

Dustin, and I. Aifantis. 2009. CCR7 signalling as an essential regulator of CNS

infiltration in T-cell leukaemia. Nature 459:1000-1004.

61. Bociek, R.G., and J.O. Armitage. 1996. Hematopoietic growth factors. CA Cancer J

Clin 46:165-184.

Introduction

51

62. Miyajima, A., Y. Ito, and T. Kinoshita. 1999. Cytokine signaling for proliferation,

survival, and death in hematopoietic cells. Int J Hematol 69:137-146.

63. Moqattash, S., and J.D. Lutton. 2004. Leukemia cells and the cytokine network:

therapeutic prospects. Exp Biol Med (Maywood) 229:121-137.

64. Mentz, F., F. Ouaaz, A. Michel, C. Blanc, P. Herve, G. Bismuth, P. Debre, H. Merle-

Beral, and M.D. Mossalayi. 1994. Maturation of acute T-lymphoblastic leukemia cells

after CD2 ligation and subsequent treatment with interleukin-2. Blood 84:1182-1192.

65. Barata, J.T., A.A. Cardoso, L.M. Nadler, and V.A. Boussiotis. 2001. Interleukin-7

promotes survival and cell cycle progression of T-cell acute lymphoblastic leukemia

cells by down-regulating the cyclin-dependent kinase inhibitor p27(kip1). Blood

98:1524-1531.

66. Masuda, M., M. Takanashi, T. Motoji, K. Oshimi, and H. Mizoguchi. 1991. Effects of

interleukins 1-7 on the proliferation of T-lineage acute lymphoblastic leukemia cells.

Leuk Res 15:1091-1096.

67. Karawajew, L., V. Ruppert, C. Wuchter, A. Kosser, M. Schrappe, B. Dorken, and W.D.

Ludwig. 2000. Inhibition of in vitro spontaneous apoptosis by IL-7 correlates with bcl-2

up-regulation, cortical/mature immunophenotype, and better early cytoreduction of

childhood T-cell acute lymphoblastic leukemia. Blood 96:297-306.

68. Touw, I., R. Delwel, G. van Zanen, and B. Lowenberg. 1986. Acute lymphoblastic

leukemia and non-Hodgkin's lymphoma of T lineage: colony-forming cells retain

growth factor (interleukin 2) dependence. Blood 68:1088-1094.

69. Georgoulias, V., M. Allouche, A. Salvatore, C. Clemenceau, and C. Jasmin. 1987.

Interleukin 2 responsiveness of immature T-cell colony-forming cells (T-CFC) from

patients with acute T-cell lymphoblastic leukemias. Cell Immunol 105:317-331.

70. Barata, J.T., A. Silva, J.G. Brandao, L.M. Nadler, A.A. Cardoso, and V.A. Boussiotis.

2004. Activation of PI3K is indispensable for interleukin 7-mediated viability,

proliferation, glucose use, and growth of T cell acute lymphoblastic leukemia cells. J

Exp Med 200:659-669.

71. Scupoli, M.T., O. Perbellini, M. Krampera, F. Vinante, F. Cioffi, and G. Pizzolo. 2007.

Interleukin 7 requirement for survival of T-cell acute lymphoblastic leukemia and

human thymocytes on bone marrow stroma. Haematologica 92:264-266.

72. Barata, J.T., T.D. Keenan, A. Silva, L.M. Nadler, V.A. Boussiotis, and A.A. Cardoso.

2004. Common gamma chain-signaling cytokines promote proliferation of T-cell acute

lymphoblastic leukemia. Haematologica 89:1459-1467.

73. Regis, G., L. Icardi, L. Conti, R. Chiarle, R. Piva, M. Giovarelli, V. Poli, and F. Novelli.

2009. IL-6, but not IFN-gamma, triggers apoptosis and inhibits in vivo growth of

human malignant T cells on STAT3 silencing. Leukemia 23:2102-2108.

Introduction

52

74. Jia, L., R.R. Dourmashkin, A.C. Newland, and S.M. Kelsey. 1997. Mitochondrial

ultracondensation, but not swelling, is involved in TNF alpha-induced apoptosis in

human T-lymphoblastic leukaemic cells. Leuk Res 21:973-983.

75. Jia, L., S.M. Kelsey, M.F. Grahn, X.R. Jiang, and A.C. Newland. 1996. Increased

activity and sensitivity of mitochondrial respiratory enzymes to tumor necrosis factor

alpha-mediated inhibition is associated with increased cytotoxicity in drug-resistant

leukemic cell lines. Blood 87:2401-2410.

76. Min, B., M. Prout, J. Hu-Li, J. Zhu, D. Jankovic, E.S. Morgan, J.F. Urban, Jr., A.M.

Dvorak, F.D. Finkelman, G. LeGros, and W.E. Paul. 2004. Basophils produce IL-4 and

accumulate in tissues after infection with a Th2-inducing parasite. J Exp Med 200:507-

517.

77. Gessner, A., K. Mohrs, and M. Mohrs. 2005. Mast cells, basophils, and eosinophils

acquire constitutive IL-4 and IL-13 transcripts during lineage differentiation that are

sufficient for rapid cytokine production. J Immunol 174:1063-1072.

78. Piccinni, M.P., D. Macchia, P. Parronchi, M.G. Giudizi, D. Bani, R. Alterini, A. Grossi,

M. Ricci, E. Maggi, and S. Romagnani. 1991. Human bone marrow non-B, non-T cells

produce interleukin 4 in response to cross-linkage of Fc epsilon and Fc gamma

receptors. Proc Natl Acad Sci U S A 88:8656-8660.

79. Russell, S.M., A.D. Keegan, N. Harada, Y. Nakamura, M. Noguchi, P. Leland, M.C.

Friedmann, A. Miyajima, R.K. Puri, W.E. Paul, and et al. 1993. Interleukin-2 receptor

gamma chain: a functional component of the interleukin-4 receptor. Science 262:1880-

1883.

80. Idzerda, R.L., C.J. March, B. Mosley, S.D. Lyman, T. Vanden Bos, S.D. Gimpel, W.S.

Din, K.H. Grabstein, M.B. Widmer, L.S. Park, and et al. 1990. Human interleukin 4

receptor confers biological responsiveness and defines a novel receptor superfamily. J

Exp Med 171:861-873.

81. Bazan, J.F. 1990. Structural design and molecular evolution of a cytokine receptor

superfamily. Proc Natl Acad Sci U S A 87:6934-6938.

82. Keegan, A.D., K. Nelms, M. White, L.M. Wang, J.H. Pierce, and W.E. Paul. 1994. An

IL-4 receptor region containing an insulin receptor motif is important for IL-4-mediated

IRS-1 phosphorylation and cell growth. Cell 76:811-820.

83. Takeshita, T., H. Asao, K. Ohtani, N. Ishii, S. Kumaki, N. Tanaka, H. Munakata, M.

Nakamura, and K. Sugamura. 1992. Cloning of the gamma chain of the human IL-2

receptor. Science 257:379-382.

84. Noguchi, M., Y. Nakamura, S.M. Russell, S.F. Ziegler, M. Tsang, X. Cao, and W.J.

Leonard. 1993. Interleukin-2 receptor gamma chain: a functional component of the

interleukin-7 receptor. Science 262:1877-1880.

Introduction

53

85. Russell, S.M., J.A. Johnston, M. Noguchi, M. Kawamura, C.M. Bacon, M. Friedmann,

M. Berg, D.W. McVicar, B.A. Witthuhn, O. Silvennoinen, and et al. 1994. Interaction

of IL-2R beta and gamma c chains with Jak1 and Jak3: implications for XSCID and

XCID. Science 266:1042-1045.

86. Giri, J.G., M. Ahdieh, J. Eisenman, K. Shanebeck, K. Grabstein, S. Kumaki, A. Namen,

L.S. Park, D. Cosman, and D. Anderson. 1994. Utilization of the beta and gamma

chains of the IL-2 receptor by the novel cytokine IL-15. Embo J 13:2822-2830.

87. Miyazaki, T., A. Kawahara, H. Fujii, Y. Nakagawa, Y. Minami, Z.J. Liu, I. Oishi, O.

Silvennoinen, B.A. Witthuhn, J.N. Ihle, and et al. 1994. Functional activation of Jak1

and Jak3 by selective association with IL-2 receptor subunits. Science 266:1045-1047.

88. Acacia de Sa Pinheiro, A., A. Morrot, S. Chakravarty, M. Overstreet, J.H. Bream, P.M.

Irusta, and F. Zavala. 2007. IL-4 induces a wide-spectrum intracellular signaling

cascade in CD8+ T cells. J Leukoc Biol 81:1102-1110.

89. Stephenson, L.M., D.S. Park, A.L. Mora, S. Goenka, and M. Boothby. 2005. Sequence

motifs in IL-4R alpha mediating cell-cycle progression of primary lymphocytes. J

Immunol 175:5178-5185.

90. Prokopchuk, O., Y. Liu, D. Henne-Bruns, and M. Kornmann. 2005. Interleukin-4

enhances proliferation of human pancreatic cancer cells: evidence for autocrine and

paracrine actions. Br J Cancer 92:921-928.

91. Lee, S.O., E. Pinder, J.Y. Chun, W. Lou, M. Sun, and A.C. Gao. 2008. Interleukin-4

stimulates androgen-independent growth in LNCaP human prostate cancer cells.

Prostate 68:85-91.

92. Carey, G.B., E. Semenova, X. Qi, and A.D. Keegan. 2007. IL-4 protects the B-cell

lymphoma cell line CH31 from anti-IgM-induced growth arrest and apoptosis:

contribution of the PI-3 kinase/AKT pathway. Cell Res 17:942-955.

93. Li, B.H., X.Z. Yang, P.D. Li, Q. Yuan, X.H. Liu, J. Yuan, and W.J. Zhang. 2008. IL-

4/Stat6 activities correlate with apoptosis and metastasis in colon cancer cells. Biochem

Biophys Res Commun 369:554-560.

94. Manabe, A., E. Coustan-Smith, M. Kumagai, F.G. Behm, S.C. Raimondi, C.H. Pui, and

D. Campana. 1994. Interleukin-4 induces programmed cell death (apoptosis) in cases of

high-risk acute lymphoblastic leukemia. Blood 83:1731-1737.

95. De Keersmaecker, K., P. Marynen, and J. Coolsi. 2005. Genetic insights in the

pathogenesis of T-cell acute lymphoblastic leukemia. Haematologica 90:1116-1127.

96. Cauwelier, B., N. Dastugue, J. Cools, B. Poppe, C. Herens, A. De Paepe, A.

Hagemeijer, and F. Speleman. 2006. Molecular cytogenetic study of 126 unselected T-

ALL cases reveals high incidence of TCRbeta locus rearrangements and putative new

T-cell oncogenes. Leukemia 20:1238-1244.

Introduction

54

97. Weng, A.P., A.A. Ferrando, W. Lee, J.P.t. Morris, L.B. Silverman, C. Sanchez-Irizarry,

S.C. Blacklow, A.T. Look, and J.C. Aster. 2004. Activating mutations of NOTCH1 in

human T cell acute lymphoblastic leukemia. Science 306:269-271.

98. Pear, W.S., J.C. Aster, M.L. Scott, R.P. Hasserjian, B. Soffer, J. Sklar, and D.

Baltimore. 1996. Exclusive development of T cell neoplasms in mice transplanted with

bone marrow expressing activated Notch alleles. J Exp Med 183:2283-2291.

99. Bellavia, D., A.F. Campese, E. Alesse, A. Vacca, M.P. Felli, A. Balestri, A.

Stoppacciaro, C. Tiveron, L. Tatangelo, M. Giovarelli, C. Gaetano, L. Ruco, E.S.

Hoffman, A.C. Hayday, U. Lendahl, L. Frati, A. Gulino, and I. Screpanti. 2000.

Constitutive activation of NF-kappaB and T-cell leukemia/lymphoma in Notch3

transgenic mice. Embo J 19:3337-3348.

100. Knudsen, E.S., and K.E. Knudsen. 2006. Retinoblastoma tumor suppressor: where

cancer meets the cell cycle. Exp Biol Med (Maywood) 231:1271-1281.

101. Greenblatt, M.S., W.P. Bennett, M. Hollstein, and C.C. Harris. 1994. Mutations in the

p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis.

Cancer Res 54:4855-4878.

102. Hebert, J., J.M. Cayuela, J. Berkeley, and F. Sigaux. 1994. Candidate tumor-suppressor

genes MTS1 (p16INK4A) and MTS2 (p15INK4B) display frequent homozygous

deletions in primary cells from T- but not from B-cell lineage acute lymphoblastic

leukemias. Blood 84:4038-4044.

103. Bertin, R., C. Acquaviva, D. Mirebeau, C. Guidal-Giroux, E. Vilmer, and H. Cave.

2003. CDKN2A, CDKN2B, and MTAP gene dosage permits precise characterization of

mono- and bi-allelic 9p21 deletions in childhood acute lymphoblastic leukemia. Genes

Chromosomes Cancer 37:44-57.

104. Omura-Minamisawa, M., M.B. Diccianni, A. Batova, R.C. Chang, L.J. Bridgeman, J.

Yu, J. Pullen, W.P. Bowman, and A.L. Yu. 2000. Universal inactivation of both p16

and p15 but not downstream components is an essential event in the pathogenesis of T-

cell acute lymphoblastic leukemia. Clin Cancer Res 6:1219-1228.

105. Cayuela, J.M., A. Madani, L. Sanhes, M.H. Stern, and F. Sigaux. 1996. Multiple tumor-

suppressor gene 1 inactivation is the most frequent genetic alteration in T-cell acute

lymphoblastic leukemia. Blood 87:2180-2186.

106. Sherr, C.J. 2001. The INK4a/ARF network in tumour suppression. Nat Rev Mol Cell

Biol 2:731-737.

107. Sherr, C.J., and F. McCormick. 2002. The RB and p53 pathways in cancer. Cancer Cell

2:103-112.

Introduction

55

108. Clappier, E., W. Cuccuini, J.M. Cayuela, D. Vecchione, A. Baruchel, H. Dombret, F.

Sigaux, and J. Soulier. 2006. Cyclin D2 dysregulation by chromosomal translocations to

TCR loci in T-cell acute lymphoblastic leukemias. Leukemia 20:82-86.

109. Cardoso, B.A., A. Girio, C. Henriques, L.R. Martins, C. Santos, A. Silva, and J.T.

Barata. 2008. Aberrant signaling in T-cell acute lymphoblastic leukemia: biological and

therapeutic implications. Braz J Med Biol Res 41:344-350.

110. Zipfel, P.A., W. Zhang, M. Quiroz, and A.M. Pendergast. 2004. Requirement for Abl

kinases in T cell receptor signaling. Curr Biol 14:1222-1231.

111. Wange, R.L. 2004. TCR signaling: another Abl-bodied kinase joins the cascade. Curr

Biol 14:R562-564.

112. Melo, J.V. 1996. The diversity of BCR-ABL fusion proteins and their relationship to

leukemia phenotype. Blood 88:2375-2384.

113. Quentmeier, H., J. Cools, R.A. Macleod, P. Marynen, C.C. Uphoff, and H.G. Drexler.

2005. e6-a2 BCR-ABL1 fusion in T-cell acute lymphoblastic leukemia. Leukemia

19:295-296.

114. Graux, C., J. Cools, C. Melotte, H. Quentmeier, A. Ferrando, R. Levine, J.R.

Vermeesch, M. Stul, B. Dutta, N. Boeckx, A. Bosly, P. Heimann, A. Uyttebroeck, N.

Mentens, R. Somers, R.A. MacLeod, H.G. Drexler, A.T. Look, D.G. Gilliland, L.

Michaux, P. Vandenberghe, I. Wlodarska, P. Marynen, and A. Hagemeijer. 2004.

Fusion of NUP214 to ABL1 on amplified episomes in T-cell acute lymphoblastic

leukemia. Nat Genet 36:1084-1089.

115. Van Limbergen, H., H.B. Beverloo, E. van Drunen, A. Janssens, K. Hahlen, B. Poppe,

N. Van Roy, P. Marynen, A. De Paepe, R. Slater, and F. Speleman. 2001. Molecular

cytogenetic and clinical findings in ETV6/ABL1-positive leukemia. Genes

Chromosomes Cancer 30:274-282.

116. De Keersmaecker, K., C. Graux, M.D. Odero, N. Mentens, R. Somers, J. Maertens, I.

Wlodarska, P. Vandenberghe, A. Hagemeijer, P. Marynen, and J. Cools. 2005. Fusion

of EML1 to ABL1 in T-cell acute lymphoblastic leukemia with cryptic

t(9;14)(q34;q32). Blood 105:4849-4852.

117. Palacios, E.H., and A. Weiss. 2004. Function of the Src-family kinases, Lck and Fyn, in

T-cell development and activation. Oncogene 23:7990-8000.

118. Burnett, R.C., M.J. Thirman, J.D. Rowley, and M.O. Diaz. 1994. Molecular analysis of

the T-cell acute lymphoblastic leukemia-associated t(1;7)(p34;q34) that fuses LCK and

TCRB. Blood 84:1232-1236.

119. Tycko, B., S.D. Smith, and J. Sklar. 1991. Chromosomal translocations joining LCK

and TCRB loci in human T cell leukemia. J Exp Med 174:867-873.

Introduction

56

120. Rawlings, J.S., K.M. Rosler, and D.A. Harrison. 2004. The JAK/STAT signaling

pathway. J Cell Sci 117:1281-1283.

121. Peeters, P., S.D. Raynaud, J. Cools, I. Wlodarska, J. Grosgeorge, P. Philip, F. Monpoux,

L. Van Rompaey, M. Baens, H. Van den Berghe, and P. Marynen. 1997. Fusion of

TEL, the ETS-variant gene 6 (ETV6), to the receptor-associated kinase JAK2 as a result

of t(9;12) in a lymphoid and t(9;15;12) in a myeloid leukemia. Blood 90:2535-2540.

122. Lacronique, V., A. Boureux, V.D. Valle, H. Poirel, C.T. Quang, M. Mauchauffe, C.

Berthou, M. Lessard, R. Berger, J. Ghysdael, and O.A. Bernard. 1997. A TEL-JAK2

fusion protein with constitutive kinase activity in human leukemia. Science 278:1309-

1312.

123. Carron, C., F. Cormier, A. Janin, V. Lacronique, M. Giovannini, M.T. Daniel, O.

Bernard, and J. Ghysdael. 2000. TEL-JAK2 transgenic mice develop T-cell leukemia.

Blood 95:3891-3899.

124. Flex, E., V. Petrangeli, L. Stella, S. Chiaretti, T. Hornakova, L. Knoops, C. Ariola, V.

Fodale, E. Clappier, F. Paoloni, S. Martinelli, A. Fragale, M. Sanchez, S. Tavolaro, M.

Messina, G. Cazzaniga, A. Camera, G. Pizzolo, A. Tornesello, M. Vignetti, A.

Battistini, H. Cave, B.D. Gelb, J.C. Renauld, A. Biondi, S.N. Constantinescu, R. Foa,

and M. Tartaglia. 2008. Somatically acquired JAK1 mutations in adult acute

lymphoblastic leukemia. J Exp Med 205:751-758.

125. Gilliland, D.G., and J.D. Griffin. 2002. The roles of FLT3 in hematopoiesis and

leukemia. Blood 100:1532-1542.

126. Paietta, E., A.A. Ferrando, D. Neuberg, J.M. Bennett, J. Racevskis, H. Lazarus, G.

Dewald, J.M. Rowe, P.H. Wiernik, M.S. Tallman, and A.T. Look. 2004. Activating

FLT3 mutations in CD117/KIT(+) T-cell acute lymphoblastic leukemias. Blood

104:558-560.

127. Van Vlierberghe, P., J.P. Meijerink, R.W. Stam, W. van der Smissen, E.R. van Wering,

H.B. Beverloo, and R. Pieters. 2005. Activating FLT3 mutations in CD4+/CD8-

pediatric T-cell acute lymphoblastic leukemias. Blood 106:4414-4415.

128. Campbell, S.L., R. Khosravi-Far, K.L. Rossman, G.J. Clark, and C.J. Der. 1998.

Increasing complexity of Ras signaling. Oncogene 17:1395-1413.

129. Bos, J.L. 1989. ras oncogenes in human cancer: a review. Cancer Res 49:4682-4689.

130. Neubauer, A., R.K. Dodge, S.L. George, F.R. Davey, R.T. Silver, C.A. Schiffer, R.J.

Mayer, E.D. Ball, D. Wurster-Hill, C.D. Bloomfield, and et al. 1994. Prognostic

importance of mutations in the ras proto-oncogenes in de novo acute myeloid leukemia.

Blood 83:1603-1611.

131. Yokota, S., M. Nakao, S. Horiike, T. Seriu, T. Iwai, H. Kaneko, H. Azuma, T. Oka, T.

Takeda, A. Watanabe, A. Kikuta, K. Asami, I. Sekine, T. Matsushita, T. Tsuhciya, J.

Introduction

57

Mimaya, S. Koizumi, M. Miyake, K. Nishikawa, Y. Takaue, Y. Kawano, A. Iwai, Y.

Ishida, K. Matsumoto, and T. Fujimoto. 1998. Mutational analysis of the N-ras gene in

acute lymphoblastic leukemia: a study of 125 Japanese pediatric cases. Int J Hematol

67:379-387.

132. Kawamura, M., A. Kikuchi, S. Kobayashi, R. Hanada, K. Yamamoto, K. Horibe, T.

Shikano, K. Ueda, K. Hayashi, T. Sekiya, and et al. 1995. Mutations of the p53 and ras

genes in childhood t(1;19)-acute lymphoblastic leukemia. Blood 85:2546-2552.

133. Gutierrez, A., T. Sanda, R. Grebliunaite, A. Carracedo, L. Salmena, Y. Ahn, S.

Dahlberg, D. Neuberg, L.A. Moreau, S.S. Winter, R. Larson, J. Zhang, A. Protopopov,

L. Chin, P.P. Pandolfi, L.B. Silverman, S.P. Hunger, S.E. Sallan, and A.T. Look. 2009.

High frequency of PTEN, PI3K, and AKT abnormalities in T-cell acute lymphoblastic

leukemia. Blood 114:647-650.

134. von Lintig, F.C., I. Huvar, P. Law, M.B. Diccianni, A.L. Yu, and G.R. Boss. 2000. Ras

activation in normal white blood cells and childhood acute lymphoblastic leukemia.

Clin Cancer Res 6:1804-1810.

135. Shi, Y., and J. Massague. 2003. Mechanisms of TGF-beta signaling from cell

membrane to the nucleus. Cell 113:685-700.

136. Derynck, R., R.J. Akhurst, and A. Balmain. 2001. TGF-beta signaling in tumor

suppression and cancer progression. Nat Genet 29:117-129.

137. Derynck, R., and Y.E. Zhang. 2003. Smad-dependent and Smad-independent pathways

in TGF-beta family signalling. Nature 425:577-584.

138. Lucas, P.J., N. McNeil, E. Hilgenfeld, B. Choudhury, S.J. Kim, M.A. Eckhaus, T. Ried,

and R.E. Gress. 2004. Transforming growth factor-beta pathway serves as a primary

tumor suppressor in CD8+ T cell tumorigenesis. Cancer Res 64:6524-6529.

139. Wolfraim, L.A., T.M. Fernandez, M. Mamura, W.L. Fuller, R. Kumar, D.E. Cole, S.

Byfield, A. Felici, K.C. Flanders, T.M. Walz, A.B. Roberts, P.D. Aplan, F.M. Balis, and

J.J. Letterio. 2004. Loss of Smad3 in acute T-cell lymphoblastic leukemia. N Engl J

Med 351:552-559.

140. Remke, M., S. Pfister, C. Kox, G. Toedt, N. Becker, A. Benner, W. Werft, S. Breit, S.

Liu, F. Engel, A. Wittmann, M. Zimmermann, M. Stanulla, M. Schrappe, W.D.

Ludwig, C.R. Bartram, B. Radlwimmer, M.U. Muckenthaler, P. Lichter, and A.E.

Kulozik. 2009. High-resolution genomic profiling of childhood T-ALL reveals frequent

copy-number alterations affecting the TGF-beta and PI3K-AKT pathways and deletions

at 6q15-16.1 as a genomic marker for unfavorable early treatment response. Blood

114:1053-1062.

141. Gutierrez, A., T. Sanda, W. Ma, J. Zhang, R. Grebliunaite, S. Dahlberg, D. Neuberg, A.

Protopopov, S.S. Winter, R.S. Larson, M.J. Borowitz, L.B. Silverman, L. Chin, S.P.

Introduction

58

Hunger, C. Jamieson, S.E. Sallan, and A.T. Look. 2010. Inactivation of LEF1 in T-cell

acute lymphoblastic leukemia. Blood 115:2845-2851.

142. van Noort, M., and H. Clevers. 2002. TCF transcription factors, mediators of Wnt-

signaling in development and cancer. Dev Biol 244:1-8.

143. Nawshad, A., D. Medici, C.C. Liu, and E.D. Hay. 2007. TGFbeta3 inhibits E-cadherin

gene expression in palate medial-edge epithelial cells through a Smad2-Smad4-LEF1

transcription complex. J Cell Sci 120:1646-1653.

144. Lai, E.C. 2004. Notch signaling: control of cell communication and cell fate.

Development 131:965-973.

145. Duncan, A.W., F.M. Rattis, L.N. DiMascio, K.L. Congdon, G. Pazianos, C. Zhao, K.

Yoon, J.M. Cook, K. Willert, N. Gaiano, and T. Reya. 2005. Integration of Notch and

Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol 6:314-322.

146. Miele, L. 2006. Notch signaling. Clin Cancer Res 12:1074-1079.

147. Ellisen, L.W., J. Bird, D.C. West, A.L. Soreng, T.C. Reynolds, S.D. Smith, and J. Sklar.

1991. TAN-1, the human homolog of the Drosophila notch gene, is broken by

chromosomal translocations in T lymphoblastic neoplasms. Cell 66:649-661.

148. Sulis, M.L., O. Williams, T. Palomero, V. Tosello, S. Pallikuppam, P.J. Real, K.

Barnes, L. Zuurbier, J.P. Meijerink, and A.A. Ferrando. 2008. NOTCH1 extracellular

juxtamembrane expansion mutations in T-ALL. Blood 112:733-740.

149. Ferrando, A.A., D.S. Neuberg, J. Staunton, M.L. Loh, C. Huard, S.C. Raimondi, F.G.

Behm, C.H. Pui, J.R. Downing, D.G. Gilliland, E.S. Lander, T.R. Golub, and A.T.

Look. 2002. Gene expression signatures define novel oncogenic pathways in T cell

acute lymphoblastic leukemia. Cancer Cell 1:75-87.

150. Park, S., N. Chapuis, J. Tamburini, V. Bardet, P. Cornillet-Lefebvre, L. Willems, A.

Green, P. Mayeux, C. Lacombe, and D. Bouscary. 2010. Role of the PI3K/AKT and

mTOR signaling pathways in acute myeloid leukemia. Haematologica 95:819-828.

151. Steelman, L.S., S.L. Abrams, J. Whelan, F.E. Bertrand, D.E. Ludwig, J. Basecke, M.

Libra, F. Stivala, M. Milella, A. Tafuri, P. Lunghi, A. Bonati, A.M. Martelli, and J.A.

McCubrey. 2008. Contributions of the Raf/MEK/ERK, PI3K/PTEN/Akt/mTOR and

Jak/STAT pathways to leukemia. Leukemia 22:686-707.

152. Panwalkar, A., S. Verstovsek, and F.J. Giles. 2004. Mammalian target of rapamycin

inhibition as therapy for hematologic malignancies. Cancer 100:657-666.

153. Guertin, D.A., and D.M. Sabatini. 2007. Defining the role of mTOR in cancer. Cancer

Cell 12:9-22.

154. Lawlor, M.A., and D.R. Alessi. 2001. PKB/Akt: a key mediator of cell proliferation,

survival and insulin responses? J Cell Sci 114:2903-2910.

Introduction

59

155. Hay, N. 2005. The Akt-mTOR tango and its relevance to cancer. Cancer Cell 8:179-

183.

156. Nakae, J., B.C. Park, and D. Accili. 1999. Insulin stimulates phosphorylation of the

forkhead transcription factor FKHR on serine 253 through a Wortmannin-sensitive

pathway. J Biol Chem 274:15982-15985.

157. Brunet, A., A. Bonni, M.J. Zigmond, M.Z. Lin, P. Juo, L.S. Hu, M.J. Anderson, K.C.

Arden, J. Blenis, and M.E. Greenberg. 1999. Akt promotes cell survival by

phosphorylating and inhibiting a Forkhead transcription factor. Cell 96:857-868.

158. Cross, D.A., D.R. Alessi, P. Cohen, M. Andjelkovich, and B.A. Hemmings. 1995.

Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B.

Nature 378:785-789.

159. del Peso, L., M. Gonzalez-Garcia, C. Page, R. Herrera, and G. Nunez. 1997.

Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt. Science

278:687-689.

160. Scheid, M.P., and V. Duronio. 1998. Dissociation of cytokine-induced phosphorylation

of Bad and activation of PKB/akt: involvement of MEK upstream of Bad

phosphorylation. Proc Natl Acad Sci U S A 95:7439-7444.

161. Inoki, K., Y. Li, T. Zhu, J. Wu, and K.L. Guan. 2002. TSC2 is phosphorylated and

inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 4:648-657.

162. Burgering, B.M., and G.J. Kops. 2002. Cell cycle and death control: long live

Forkheads. Trends Biochem Sci 27:352-360.

163. Greer, E.L., and A. Brunet. 2005. FOXO transcription factors at the interface between

longevity and tumor suppression. Oncogene 24:7410-7425.

164. Long, X., Y. Lin, S. Ortiz-Vega, K. Yonezawa, and J. Avruch. 2005. Rheb binds and

regulates the mTOR kinase. Curr Biol 15:702-713.

165. Sarbassov, D.D., D.A. Guertin, S.M. Ali, and D.M. Sabatini. 2005. Phosphorylation and

regulation of Akt/PKB by the rictor-mTOR complex. Science 307:1098-1101.

166. Holz, M.K., B.A. Ballif, S.P. Gygi, and J. Blenis. 2005. mTOR and S6K1 mediate

assembly of the translation preinitiation complex through dynamic protein interchange

and ordered phosphorylation events. Cell 123:569-580.

167. Holz, M.K., and J. Blenis. 2005. Identification of S6 kinase 1 as a novel mammalian

target of rapamycin (mTOR)-phosphorylating kinase. J Biol Chem 280:26089-26093.

168. Park, I.H., R. Bachmann, H. Shirazi, and J. Chen. 2002. Regulation of ribosomal S6

kinase 2 by mammalian target of rapamycin. J Biol Chem 277:31423-31429.

169. Dorrello, N.V., A. Peschiaroli, D. Guardavaccaro, N.H. Colburn, N.E. Sherman, and M.

Pagano. 2006. S6K1- and betaTRCP-mediated degradation of PDCD4 promotes protein

translation and cell growth. Science 314:467-471.

Introduction

60

170. Harrington, L.S., G.M. Findlay, A. Gray, T. Tolkacheva, S. Wigfield, H. Rebholz, J.

Barnett, N.R. Leslie, S. Cheng, P.R. Shepherd, I. Gout, C.P. Downes, and R.F. Lamb.

2004. The TSC1-2 tumor suppressor controls insulin-PI3K signaling via regulation of

IRS proteins. J Cell Biol 166:213-223.

171. Hresko, R.C., and M. Mueckler. 2005. mTOR.RICTOR is the Ser473 kinase for

Akt/protein kinase B in 3T3-L1 adipocytes. J Biol Chem 280:40406-40416.

172. Giles, F.J., and M. Albitar. 2005. Mammalian target of rapamycin as a therapeutic target

in leukemia. Curr Mol Med 5:653-661.

173. Sakai, A., C. Thieblemont, A. Wellmann, E.S. Jaffe, and M. Raffeld. 1998. PTEN gene

alterations in lymphoid neoplasms. Blood 92:3410-3415.

174. Shan, X., M.J. Czar, S.C. Bunnell, P. Liu, Y. Liu, P.L. Schwartzberg, and R.L. Wange.

2000. Deficiency of PTEN in Jurkat T cells causes constitutive localization of Itk to the

plasma membrane and hyperresponsiveness to CD3 stimulation. Mol Cell Biol 20:6945-

6957.

175. Xu, Z., D. Stokoe, L.P. Kane, and A. Weiss. 2002. The inducible expression of the

tumor suppressor gene PTEN promotes apoptosis and decreases cell size by inhibiting

the PI3K/Akt pathway in Jurkat T cells. Cell Growth Differ 13:285-296.

176. Uddin, S., A. Hussain, K. Al-Hussein, L.C. Platanias, and K.G. Bhatia. 2004. Inhibition

of phosphatidylinositol 3'-kinase induces preferentially killing of PTEN-null T

leukemias through AKT pathway. Biochem Biophys Res Commun 320:932-938.

177. Avellino, R., S. Romano, R. Parasole, R. Bisogni, A. Lamberti, V. Poggi, S. Venuta,

and M.F. Romano. 2005. Rapamycin stimulates apoptosis of childhood acute

lymphoblastic leukemia cells. Blood 106:1400-1406.

178. Silva, A., J.A. Yunes, B.A. Cardoso, L.R. Martins, P.Y. Jotta, M. Abecasis, A.E.

Nowill, N.R. Leslie, A.A. Cardoso, and J.T. Barata. 2008. PTEN posttranslational

inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell

leukemia viability. J Clin Invest 118:3762-3774.

179. Jotta, P.Y., M.A. Ganazza, A. Silva, M.B. Viana, M.J. da Silva, L.J. Zambaldi, J.T.

Barata, S.R. Brandalise, and J.A. Yunes. 2010. Negative prognostic impact of PTEN

mutation in pediatric T-cell acute lymphoblastic leukemia. Leukemia 24:239-242.

180. Look, A.T. 1997. Oncogenic transcription factors in the human acute leukemias.

Science 278:1059-1064.

181. Lawrence, P.A., and G. Morata. 1994. Homeobox genes: their function in Drosophila

segmentation and pattern formation. Cell 78:181-189.

182. Deschamps, J., and J. van Nes. 2005. Developmental regulation of the Hox genes

during axial morphogenesis in the mouse. Development 132:2931-2942.

Introduction

61

183. Favier, B., and P. Dolle. 1997. Developmental functions of mammalian Hox genes. Mol

Hum Reprod 3:115-131.

184. van Oostveen, J., J. Bijl, F. Raaphorst, J. Walboomers, and C. Meijer. 1999. The role of

homeobox genes in normal hematopoiesis and hematological malignancies. Leukemia

13:1675-1690.

185. Gehring, W.J., Y.Q. Qian, M. Billeter, K. Furukubo-Tokunaga, A.F. Schier, D.

Resendez-Perez, M. Affolter, G. Otting, and K. Wuthrich. 1994. Homeodomain-DNA

recognition. Cell 78:211-223.

186. Speleman, F., B. Cauwelier, N. Dastugue, J. Cools, B. Verhasselt, B. Poppe, N. Van

Roy, J. Vandesompele, C. Graux, A. Uyttebroeck, M. Boogaerts, B. De Moerloose, Y.

Benoit, D. Selleslag, J. Billiet, A. Robert, F. Huguet, P. Vandenberghe, A. De Paepe, P.

Marynen, and A. Hagemeijer. 2005. A new recurrent inversion, inv(7)(p15q34), leads to

transcriptional activation of HOXA10 and HOXA11 in a subset of T-cell acute

lymphoblastic leukemias. Leukemia 19:358-366.

187. Su, X., H. Drabkin, E. Clappier, E. Morgado, M. Busson, S. Romana, J. Soulier, R.

Berger, O.A. Bernard, and C. Lavau. 2006. Transforming potential of the T-cell acute

lymphoblastic leukemia-associated homeobox genes HOXA13, TLX1, and TLX3.

Genes Chromosomes Cancer 45:846-855.

188. Hatano, M., C.W. Roberts, M. Minden, W.M. Crist, and S.J. Korsmeyer. 1991.

Deregulation of a homeobox gene, HOX11, by the t(10;14) in T cell leukemia. Science

253:79-82.

189. Kennedy, M.A., R. Gonzalez-Sarmiento, U.R. Kees, F. Lampert, N. Dear, T. Boehm,

and T.H. Rabbitts. 1991. HOX11, a homeobox-containing T-cell oncogene on human

chromosome 10q24. Proc Natl Acad Sci U S A 88:8900-8904.

190. Ferrando, A.A., S. Herblot, T. Palomero, M. Hansen, T. Hoang, E.A. Fox, and A.T.

Look. 2004. Biallelic transcriptional activation of oncogenic transcription factors in T-

cell acute lymphoblastic leukemia. Blood 103:1909-1911.

191. Kees, U.R., N.A. Heerema, R. Kumar, P.M. Watt, D.L. Baker, M.K. La, F.M. Uckun,

and H.N. Sather. 2003. Expression of HOX11 in childhood T-lineage acute

lymphoblastic leukaemia can occur in the absence of cytogenetic aberration at 10q24: a

study from the Children's Cancer Group (CCG). Leukemia 17:887-893.

192. Yamamoto, H., M. Hatano, Y. Iitsuka, N.S. Mahyar, M. Yamamoto, and T. Tokuhisa.

1995. Two forms of Hox11 a T cell leukemia oncogene, are expressed in fetal spleen

but not in primary lymphocytes. Mol Immunol 32:1177-1182.

193. Hawley, R.G., A.Z. Fong, M. Lu, and T.S. Hawley. 1994. The HOX11 homeobox-

containing gene of human leukemia immortalizes murine hematopoietic precursors.

Oncogene 9:1-12.

Introduction

62

194. Bergeron, J., E. Clappier, I. Radford, A. Buzyn, C. Millien, G. Soler, P. Ballerini, X.

Thomas, J. Soulier, H. Dombret, E.A. Macintyre, and V. Asnafi. 2007. Prognostic and

oncogenic relevance of TLX1/HOX11 expression level in T-ALLs. Blood 110:2324-

2330.

195. Riz, I., and R.G. Hawley. 2005. G1/S transcriptional networks modulated by the

HOX11/TLX1 oncogene of T-cell acute lymphoblastic leukemia. Oncogene 24:5561-

5575.

196. Bernard, O.A., M. Busson-LeConiat, P. Ballerini, M. Mauchauffe, V. Della Valle, R.

Monni, F. Nguyen Khac, T. Mercher, V. Penard-Lacronique, P. Pasturaud, L. Gressin,

R. Heilig, M.T. Daniel, M. Lessard, and R. Berger. 2001. A new recurrent and specific

cryptic translocation, t(5;14)(q35;q32), is associated with expression of the Hox11L2

gene in T acute lymphoblastic leukemia. Leukemia 15:1495-1504.

197. Su, X.Y., V. Della-Valle, I. Andre-Schmutz, C. Lemercier, I. Radford-Weiss, P.

Ballerini, M. Lessard, M. Lafage-Pochitaloff, F. Mugneret, R. Berger, S.P. Romana, O.

Bernard, and V. Penard-Lacronique. 2006. HOX11L2/TLX3 is transcriptionally

activated through T-cell regulatory elements downstream of BCL11B as a result of the

t(5;14)(q35;q32). Blood

198. Su, X.Y., M. Busson, V. Della Valle, P. Ballerini, N. Dastugue, P. Talmant, A.A.

Ferrando, D. Baudry-Bluteau, S. Romana, R. Berger, and O.A. Bernard. 2004. Various

types of rearrangements target TLX3 locus in T-cell acute lymphoblastic leukemia.

Genes Chromosomes Cancer 41:243-249.

199. Hansen-Hagge, T.E., M. Schafer, H. Kiyoi, S.W. Morris, J.A. Whitlock, P. Koch, I.

Bohlmann, C. Mahotka, C.R. Bartram, and J.W. Janssen. 2002. Disruption of the

RanBP17/Hox11L2 region by recombination with the TCRdelta locus in acute

lymphoblastic leukemias with t(5;14)(q34;q11). Leukemia 16:2205-2212.

200. Ballerini, P., A. Blaise, M. Busson-Le Coniat, X.Y. Su, J. Zucman-Rossi, M. Adam, J.

van den Akker, C. Perot, B. Pellegrino, J. Landman-Parker, L. Douay, R. Berger, and

O.A. Bernard. 2002. HOX11L2 expression defines a clinical subtype of pediatric T-

ALL associated with poor prognosis. Blood 100:991-997.

201. Jones, S. 2004. An overview of the basic helix-loop-helix proteins. Genome Biol 5:226.

202. Bain, G., M.W. Quong, R.S. Soloff, S.M. Hedrick, and C. Murre. 1999. Thymocyte

maturation is regulated by the activity of the helix-loop-helix protein, E47. J Exp Med

190:1605-1616.

203. Engel, I., C. Johns, G. Bain, R.R. Rivera, and C. Murre. 2001. Early thymocyte

development is regulated by modulation of E2A protein activity. J Exp Med 194:733-

745.

Introduction

63

204. Ikawa, T., H. Kawamoto, A.W. Goldrath, and C. Murre. 2006. E proteins and Notch

signaling cooperate to promote T cell lineage specification and commitment. J Exp Med

203:1329-1342.

205. Bain, G., W.J. Romanow, K. Albers, W.L. Havran, and C. Murre. 1999. Positive and

negative regulation of V(D)J recombination by the E2A proteins. J Exp Med 189:289-

300.

206. Takeuchi, A., S. Yamasaki, K. Takase, F. Nakatsu, H. Arase, M. Onodera, and T. Saito.

2001. E2A and HEB activate the pre-TCR alpha promoter during immature T cell

development. J Immunol 167:2157-2163.

207. Tremblay, M., S. Herblot, E. Lecuyer, and T. Hoang. 2003. Regulation of pT alpha gene

expression by a dosage of E2A, HEB, and SCL. J Biol Chem 278:12680-12687.

208. Bain, G., I. Engel, E.C. Robanus Maandag, H.P. te Riele, J.R. Voland, L.L. Sharp, J.

Chun, B. Huey, D. Pinkel, and C. Murre. 1997. E2A deficiency leads to abnormalities

in alphabeta T-cell development and to rapid development of T-cell lymphomas. Mol

Cell Biol 17:4782-4791.

209. Yan, W., A.Z. Young, V.C. Soares, R. Kelley, R. Benezra, and Y. Zhuang. 1997. High

incidence of T-cell tumors in E2A-null mice and E2A/Id1 double-knockout mice. Mol

Cell Biol 17:7317-7327.

210. Bash, R.O., S. Hall, C.F. Timmons, W.M. Crist, M. Amylon, R.G. Smith, and R. Baer.

1995. Does activation of the TAL1 gene occur in a majority of patients with T-cell

acute lymphoblastic leukemia? A pediatric oncology group study. Blood 86:666-676.

211. Xia, Y., L. Brown, C.Y. Yang, J.T. Tsan, M.J. Siciliano, R. Espinosa, III, M.M. Le

Beau, and R.J. Baer. 1991. TAL2, a helix-loop-helix gene activated by the

(7;9)(q34;q32) translocation in human T-cell leukemia. Proc Natl Acad Sci U S A

88:11416-11420.

212. Wang, J., S.N. Jani-Sait, E.A. Escalon, A.J. Carroll, P.J. de Jong, I.R. Kirsch, and P.D.

Aplan. 2000. The t(14;21)(q11.2;q22) chromosomal translocation associated with T-cell

acute lymphoblastic leukemia activates the BHLHB1 gene. Proc Natl Acad Sci U S A

97:3497-3502.

213. Mellentin, J.D., S.D. Smith, and M.L. Cleary. 1989. lyl-1, a novel gene altered by

chromosomal translocation in T cell leukemia, codes for a protein with a helix-loop-

helix DNA binding motif. Cell 58:77-83.

214. Chen, Q., J.T. Cheng, L.H. Tasi, N. Schneider, G. Buchanan, A. Carroll, W. Crist, B.

Ozanne, M.J. Siciliano, and R. Baer. 1990. The tal gene undergoes chromosome

translocation in T cell leukemia and potentially encodes a helix-loop-helix protein.

Embo J 9:415-424.

Introduction

64

215. Begley, C.G., P.D. Aplan, M.P. Davey, K. Nakahara, K. Tchorz, J. Kurtzberg, M.S.

Hershfield, B.F. Haynes, D.I. Cohen, T.A. Waldmann, and et al. 1989. Chromosomal

translocation in a human leukemic stem-cell line disrupts the T-cell antigen receptor

delta-chain diversity region and results in a previously unreported fusion transcript.

Proc Natl Acad Sci U S A 86:2031-2035.

216. Rabbitts, T.H. 1998. LMO T-cell translocation oncogenes typify genes activated by

chromosomal translocations that alter transcription and developmental processes. Genes

Dev 12:2651-2657.

217. Nam, C.H., and T.H. Rabbitts. 2006. The role of LMO2 in development and in T cell

leukemia after chromosomal translocation or retroviral insertion. Mol Ther 13:15-25.

218. McGuire, E.A., R.D. Hockett, K.M. Pollock, M.F. Bartholdi, S.J. O'Brien, and S.J.

Korsmeyer. 1989. The t(11;14)(p15;q11) in a T-cell acute lymphoblastic leukemia cell

line activates multiple transcripts, including Ttg-1, a gene encoding a potential zinc

finger protein. Mol Cell Biol 9:2124-2132.

219. Royer-Pokora, B., U. Loos, and W.D. Ludwig. 1991. TTG-2, a new gene encoding a

cysteine-rich protein with the LIM motif, is overexpressed in acute T-cell leukaemia

with the t(11;14)(p13;q11). Oncogene 6:1887-1893.

220. Van Vlierberghe, P., M. van Grotel, H.B. Beverloo, C. Lee, T. Helgason, J. Buijs-

Gladdines, M. Passier, E.R. van Wering, A.J. Veerman, W.A. Kamps, J.P. Meijerink,

and R. Pieters. 2006. The cryptic chromosomal deletion del(11)(p12p13) as a new

activation mechanism of LMO2 in pediatric T-cell acute lymphoblastic leukemia. Blood

108:3520-3529.

221. Pike-Overzet, K., D. de Ridder, F. Weerkamp, M.R. Baert, M.M. Verstegen, M.H.

Brugman, S.J. Howe, M.J. Reinders, A.J. Thrasher, G. Wagemaker, J.J. van Dongen,

and F.J. Staal. 2007. Ectopic retroviral expression of LMO2, but not IL2Rgamma,

blocks human T-cell development from CD34+ cells: implications for leukemogenesis

in gene therapy. Leukemia 21:754-763.

222. McGuire, E.A., C.E. Rintoul, G.M. Sclar, and S.J. Korsmeyer. 1992. Thymic

overexpression of Ttg-1 in transgenic mice results in T-cell acute lymphoblastic

leukemia/lymphoma. Mol Cell Biol 12:4186-4196.

223. Larson, R.C., P. Fisch, T.A. Larson, I. Lavenir, T. Langford, G. King, and T.H.

Rabbitts. 1994. T cell tumours of disparate phenotype in mice transgenic for Rbtn-2.

Oncogene 9:3675-3681.

224. Larson, R.C., H. Osada, T.A. Larson, I. Lavenir, and T.H. Rabbitts. 1995. The

oncogenic LIM protein Rbtn2 causes thymic developmental aberrations that precede

malignancy in transgenic mice. Oncogene 11:853-862.

Introduction

65

225. Neale, G.A., J.E. Rehg, and R.M. Goorha. 1995. Ectopic expression of rhombotin-2

causes selective expansion of CD4-CD8- lymphocytes in the thymus and T-cell tumors

in transgenic mice. Blood 86:3060-3071.

226. Larson, R.C., I. Lavenir, T.A. Larson, R. Baer, A.J. Warren, I. Wadman, K. Nottage,

and T.H. Rabbitts. 1996. Protein dimerization between Lmo2 (Rbtn2) and Tal1 alters

thymocyte development and potentiates T cell tumorigenesis in transgenic mice. Embo

J 15:1021-1027.

227. Chervinsky, D.S., X.F. Zhao, D.H. Lam, M. Ellsworth, K.W. Gross, and P.D. Aplan.

1999. Disordered T-cell development and T-cell malignancies in SCL LMO1 double-

transgenic mice: parallels with E2A-deficient mice. Mol Cell Biol 19:5025-5035.

228. Tremblay, M., C.S. Tremblay, S. Herblot, P.D. Aplan, J. Hebert, C. Perreault, and T.

Hoang. 2010. Modeling T-cell acute lymphoblastic leukemia induced by the SCL and

LMO1 oncogenes. Genes Dev 24:1093-1105.

229. Hacein-Bey-Abina, S., C. Von Kalle, M. Schmidt, M.P. McCormack, N. Wulffraat, P.

Leboulch, A. Lim, C.S. Osborne, R. Pawliuk, E. Morillon, R. Sorensen, A. Forster, P.

Fraser, J.I. Cohen, G. de Saint Basile, I. Alexander, U. Wintergerst, T. Frebourg, A.

Aurias, D. Stoppa-Lyonnet, S. Romana, I. Radford-Weiss, F. Gross, F. Valensi, E.

Delabesse, E. Macintyre, F. Sigaux, J. Soulier, L.E. Leiva, M. Wissler, C. Prinz, T.H.

Rabbitts, F. Le Deist, A. Fischer, and M. Cavazzana-Calvo. 2003. LMO2-associated

clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science

302:415-419.

230. Hacein-Bey-Abina, S., A. Garrigue, G.P. Wang, J. Soulier, A. Lim, E. Morillon, E.

Clappier, L. Caccavelli, E. Delabesse, K. Beldjord, V. Asnafi, E. MacIntyre, L. Dal

Cortivo, I. Radford, N. Brousse, F. Sigaux, D. Moshous, J. Hauer, A. Borkhardt, B.H.

Belohradsky, U. Wintergerst, M.C. Velez, L. Leiva, R. Sorensen, N. Wulffraat, S.

Blanche, F.D. Bushman, A. Fischer, and M. Cavazzana-Calvo. 2008. Insertional

oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1. J Clin

Invest 118:3132-3142.

231. Schmidt, M., S. Hacein-Bey-Abina, M. Wissler, F. Carlier, A. Lim, C. Prinz, H. Glimm,

I. Andre-Schmutz, C. Hue, A. Garrigue, F. Le Deist, C. Lagresle, A. Fischer, M.

Cavazzana-Calvo, and C. von Kalle. 2005. Clonal evidence for the transduction of

CD34+ cells with lymphomyeloid differentiation potential and self-renewal capacity in

the SCID-X1 gene therapy trial. Blood 105:2699-2706.

232. Deichmann, A., S. Hacein-Bey-Abina, M. Schmidt, A. Garrigue, M.H. Brugman, J. Hu,

H. Glimm, G. Gyapay, B. Prum, C.C. Fraser, N. Fischer, K. Schwarzwaelder, M.L.

Siegler, D. de Ridder, K. Pike-Overzet, S.J. Howe, A.J. Thrasher, G. Wagemaker, U.

Abel, F.J. Staal, E. Delabesse, J.L. Villeval, B. Aronow, C. Hue, C. Prinz, M. Wissler,

Introduction

66

C. Klanke, J. Weissenbach, I. Alexander, A. Fischer, C. von Kalle, and M. Cavazzana-

Calvo. 2007. Vector integration is nonrandom and clustered and influences the fate of

lymphopoiesis in SCID-X1 gene therapy. J Clin Invest 117:2225-2232.

233. Howe, S.J., M.R. Mansour, K. Schwarzwaelder, C. Bartholomae, M. Hubank, H.

Kempski, M.H. Brugman, K. Pike-Overzet, S.J. Chatters, D. de Ridder, K.C. Gilmour,

S. Adams, S.I. Thornhill, K.L. Parsley, F.J. Staal, R.E. Gale, D.C. Linch, J. Bayford, L.

Brown, M. Quaye, C. Kinnon, P. Ancliff, D.K. Webb, M. Schmidt, C. von Kalle, H.B.

Gaspar, and A.J. Thrasher. 2008. Insertional mutagenesis combined with acquired

somatic mutations causes leukemogenesis following gene therapy of SCID-X1 patients.

J Clin Invest 118:3143-3150.

234. Meyer, C., B. Schneider, S. Jakob, S. Strehl, A. Attarbaschi, S. Schnittger, C. Schoch,

M.W. Jansen, J.J. van Dongen, M.L. den Boer, R. Pieters, M.G. Ennas, E. Angelucci,

U. Koehl, J. Greil, F. Griesinger, U. Zur Stadt, C. Eckert, T. Szczepanski, F.K. Niggli,

B.W. Schafer, H. Kempski, H.J. Brady, J. Zuna, J. Trka, L.L. Nigro, A. Biondi, E.

Delabesse, E. Macintyre, M. Stanulla, M. Schrappe, O.A. Haas, T. Burmeister, T.

Dingermann, T. Klingebiel, and R. Marschalek. 2006. The MLL recombinome of acute

leukemias. Leukemia 20:777-784.

235. Schumacher, A., and T. Magnuson. 1997. Murine Polycomb- and trithorax-group genes

regulate homeotic pathways and beyond. Trends Genet 13:167-170.

236. Milne, T.A., S.D. Briggs, H.W. Brock, M.E. Martin, D. Gibbs, C.D. Allis, and J.L.

Hess. 2002. MLL targets SET domain methyltransferase activity to Hox gene

promoters. Mol Cell 10:1107-1117.

237. Hayette, S., I. Tigaud, V. Maguer-Satta, L. Bartholin, X. Thomas, C. Charrin, M.

Gadoux, J.P. Magaud, and R. Rimokh. 2002. Recurrent involvement of the MLL gene

in adult T-lineage acute lymphoblastic leukemia. Blood 99:4647-4649.

238. Ferrando, A.A., S.A. Armstrong, D.S. Neuberg, S.E. Sallan, L.B. Silverman, S.J.

Korsmeyer, and A.T. Look. 2003. Gene expression signatures in MLL-rearranged T-

lineage and B-precursor acute leukemias: dominance of HOX dysregulation. Blood

102:262-268.

239. Armstrong, S.A., J.E. Staunton, L.B. Silverman, R. Pieters, M.L. den Boer, M.D.

Minden, S.E. Sallan, E.S. Lander, T.R. Golub, and S.J. Korsmeyer. 2002. MLL

translocations specify a distinct gene expression profile that distinguishes a unique

leukemia. Nat Genet 30:41-47.

240. Rubnitz, J.E., B.M. Camitta, H. Mahmoud, S.C. Raimondi, A.J. Carroll, M.J. Borowitz,

J.J. Shuster, M.P. Link, D.J. Pullen, J.R. Downing, F.G. Behm, and C.H. Pui. 1999.

Childhood acute lymphoblastic leukemia with the MLL-ENL fusion and

t(11;19)(q23;p13.3) translocation. J Clin Oncol 17:191-196.

Introduction

67

241. Dreyling, M.H., J.A. Martinez-Climent, M. Zheng, J. Mao, J.D. Rowley, and S.K.

Bohlander. 1996. The t(10;11)(p13;q14) in the U937 cell line results in the fusion of the

AF10 gene and CALM, encoding a new member of the AP-3 clathrin assembly protein

family. Proc Natl Acad Sci U S A 93:4804-4809.

242. Asnafi, V., I. Radford-Weiss, N. Dastugue, C. Bayle, D. Leboeuf, C. Charrin, R.

Garand, M. Lafage-Pochitaloff, E. Delabesse, A. Buzyn, X. Troussard, and E.

Macintyre. 2003. CALM-AF10 is a common fusion transcript in T-ALL and is specific

to the TCRgammadelta lineage. Blood 102:1000-1006.

243. Dreyling, M.H., K. Schrader, C. Fonatsch, B. Schlegelberger, D. Haase, C. Schoch, W.

Ludwig, H. Loffler, T. Buchner, B. Wormann, W. Hiddemann, and S.K. Bohlander.

1998. MLL and CALM are fused to AF10 in morphologically distinct subsets of acute

leukemia with translocation t(10;11): both rearrangements are associated with a poor

prognosis. Blood 91:4662-4667.

244. Dik, W.A., W. Brahim, C. Braun, V. Asnafi, N. Dastugue, O.A. Bernard, J.J. van

Dongen, A.W. Langerak, E.A. Macintyre, and E. Delabesse. 2005. CALM-AF10+ T-

ALL expression profiles are characterized by overexpression of HOXA and BMI1

oncogenes. Leukemia 19:1948-1957.

245. Hershfield, M.S., J. Kurtzberg, E. Harden, J.O. Moore, J. Whang-Peng, and B.F.

Haynes. 1984. Conversion of a stem cell leukemia from a T-lymphoid to a myeloid

phenotype induced by the adenosine deaminase inhibitor 2'-deoxycoformycin. Proc

Natl Acad Sci U S A 81:253-257.

246. Aplan, P.D., D.P. Lombardi, G.H. Reaman, H.N. Sather, G.D. Hammond, and I.R.

Kirsch. 1992. Involvement of the putative hematopoietic transcription factor SCL in T-

cell acute lymphoblastic leukemia. Blood 79:1327-1333.

247. Aplan, P.D., S.C. Raimondi, and I.R. Kirsch. 1992. Disruption of the SCL gene by a

t(1;3) translocation in a patient with T cell acute lymphoblastic leukemia. J Exp Med

176:1303-1310.

248. Fitzgerald, T.J., G.A. Neale, S.C. Raimondi, and R.M. Goorha. 1991. c-tal, a helix-

loop-helix protein, is juxtaposed to the T-cell receptor-beta chain gene by a reciprocal

chromosomal translocation: t(1;7)(p32;q35). Blood 78:2686-2695.

249. Francois, S., E. Delabesse, L. Baranger, M. Dautel, C. Foussard, M. Boasson, O.

Blanchet, O. Bernard, E.A. Macintyre, and N. Ifrah. 1998. Deregulated expression of

the TAL1 gene by t(1;5)(p32;31) in patient with T-cell acute lymphoblastic leukemia.

Genes Chromosomes Cancer 23:36-43.

250. Kelliher, M.A., D.C. Seldin, and P. Leder. 1996. Tal-1 induces T cell acute

lymphoblastic leukemia accelerated by casein kinase IIalpha. Embo J 15:5160-5166.

Introduction

68

251. O'Neil, J., M. Billa, S. Oikemus, and M. Kelliher. 2001. The DNA binding activity of

TAL-1 is not required to induce leukemia/lymphoma in mice. Oncogene 20:3897-3905.

252. O'Neil, J., J. Shank, N. Cusson, C. Murre, and M. Kelliher. 2004. TAL1/SCL induces

leukemia by inhibiting the transcriptional activity of E47/HEB. Cancer Cell 5:587-596.

253. Aplan, P.D., C.A. Jones, D.S. Chervinsky, X. Zhao, M. Ellsworth, C. Wu, E.A.

McGuire, and K.W. Gross. 1997. An scl gene product lacking the transactivation

domain induces bony abnormalities and cooperates with LMO1 to generate T-cell

malignancies in transgenic mice. Embo J 16:2408-2419.

254. Herblot, S., A.M. Steff, P. Hugo, P.D. Aplan, and T. Hoang. 2000. SCL and LMO1

alter thymocyte differentiation: inhibition of E2A-HEB function and pre-T alpha chain

expression. Nat Immunol 1:138-144.

255. Leroy-Viard, K., M.A. Vinit, N. Lecointe, H. Jouault, U. Hibner, P.H. Romeo, and D.

Mathieu-Mahul. 1995. Loss of TAL-1 protein activity induces premature apoptosis of

Jurkat leukemic T cells upon medium depletion. Embo J 14:2341-2349.

256. Bernard, M., E. Delabesse, S. Novault, O. Hermine, and E.A. Macintyre. 1998.

Antiapoptotic effect of ectopic TAL1/SCL expression in a human leukemic T-cell line.

Cancer Res 58:2680-2687.

257. Engel, I., and C. Murre. 1999. Ectopic expression of E47 or E12 promotes the death of

E2A-deficient lymphomas. Proc Natl Acad Sci U S A 96:996-1001.

258. Park, S.T., G.P. Nolan, and X.H. Sun. 1999. Growth inhibition and apoptosis due to

restoration of E2A activity in T cell acute lymphoblastic leukemia cells. J Exp Med

189:501-508.

259. Lecuyer, E., and T. Hoang. 2004. SCL: from the origin of hematopoiesis to stem cells

and leukemia. Exp Hematol 32:11-24.

260. Aplan, P.D., C.G. Begley, V. Bertness, M. Nussmeier, A. Ezquerra, J. Coligan, and I.R.

Kirsch. 1990. The SCL gene is formed from a transcriptionally complex locus. Mol Cell

Biol 10:6426-6435.

261. Dhami, P., A.W. Bruce, J.H. Jim, S.C. Dillon, A. Hall, J.L. Cooper, N. Bonhoure, K.

Chiang, P.D. Ellis, C. Langford, R.M. Andrews, and D. Vetrie. 2010. Genomic

approaches uncover increasing complexities in the regulatory landscape at the human

SCL (TAL1) locus. PLoS One 5:e9059.

262. Begley, C.G., L. Robb, S. Rockman, J. Visvader, E.O. Bockamp, Y.S. Chan, and A.R.

Green. 1994. Structure of the gene encoding the murine SCL protein. Gene 138:93-99.

263. Bernard, O., O. Azogui, N. Lecointe, F. Mugneret, R. Berger, C.J. Larsen, and D.

Mathieu-Mahul. 1992. A third tal-1 promoter is specifically used in human T cell

leukemias. J Exp Med 176:919-925.

Introduction

69

264. Courtes, C., N. Lecointe, L. Le Cam, F. Baudoin, C. Sardet, and D. Mathieu-Mahul.

2000. Erythroid-specific inhibition of the tal-1 intragenic promoter is due to binding of

a repressor to a novel silencer. J Biol Chem 275:949-958.

265. Le Clech, M., E. Chalhoub, C. Dohet, V. Roure, S. Fichelson, F. Moreau-Gachelin, and

D. Mathieu. 2006. PU.1/Spi-1 binds to the human TAL-1 silencer to mediate its

activity. J Mol Biol 355:9-19.

266. Sanchez, M., B. Gottgens, A.M. Sinclair, M. Stanley, C.G. Begley, S. Hunter, and A.R.

Green. 1999. An SCL 3' enhancer targets developing endothelium together with

embryonic and adult haematopoietic progenitors. Development 126:3891-3904.

267. Gottgens, B., C. Broccardo, M.J. Sanchez, S. Deveaux, G. Murphy, J.R. Gothert, E.

Kotsopoulou, S. Kinston, L. Delaney, S. Piltz, L.M. Barton, K. Knezevic, W.N. Erber,

C.G. Begley, J. Frampton, and A.R. Green. 2004. The scl +18/19 stem cell enhancer is

not required for hematopoiesis: identification of a 5' bifunctional hematopoietic-

endothelial enhancer bound by Fli-1 and Elf-1. Mol Cell Biol 24:1870-1883.

268. Lecointe, N., O. Bernard, K. Naert, V. Joulin, C.J. Larsen, P.H. Romeo, and D.

Mathieu-Mahul. 1994. GATA-and SP1-binding sites are required for the full activity of

the tissue-specific promoter of the tal-1 gene. Oncogene 9:2623-2632.

269. Bockamp, E.O., F. McLaughlin, A.M. Murrell, B. Gottgens, L. Robb, C.G. Begley, and

A.R. Green. 1995. Lineage-restricted regulation of the murine SCL/TAL-1 promoter.

Blood 86:1502-1514.

270. Bockamp, E.O., J.L. Fordham, B. Gottgens, A.M. Murrell, M.J. Sanchez, and A.R.

Green. 1998. Transcriptional regulation of the stem cell leukemia gene by PU.1 and Elf-

1. J Biol Chem 273:29032-29042.

271. Bockamp, E.O., F. McLaughlin, B. Gottgens, A.M. Murrell, A.G. Elefanty, and A.R.

Green. 1997. Distinct mechanisms direct SCL/tal-1 expression in erythroid cells and

CD34 positive primitive myeloid cells. J Biol Chem 272:8781-8790.

272. Terme, J.M., M. Wencker, A. Favre-Bonvin, F. Bex, L. Gazzolo, M. Duc Dodon, and P.

Jalinot. 2008. Cross talk between expression of the human T-cell leukemia virus type 1

Tax transactivator and the oncogenic bHLH transcription factor TAL1. J Virol 82:7913-

7922.

273. Delabesse, E., S. Ogilvy, M.A. Chapman, S.G. Piltz, B. Gottgens, and A.R. Green.

2005. Transcriptional regulation of the SCL locus: identification of an enhancer that

targets the primitive erythroid lineage in vivo. Mol Cell Biol 25:5215-5225.

274. Gottgens, B., A. Nastos, S. Kinston, S. Piltz, E.C. Delabesse, M. Stanley, M.J. Sanchez,

A. Ciau-Uitz, R. Patient, and A.R. Green. 2002. Establishing the transcriptional

programme for blood: the SCL stem cell enhancer is regulated by a multiprotein

complex containing Ets and GATA factors. Embo J 21:3039-3050.

Introduction

70

275. Goldfarb, A.N., S. Goueli, D. Mickelson, and J.M. Greenberg. 1992. T-cell acute

lymphoblastic leukemia--the associated gene SCL/tal codes for a 42-Kd nuclear

phosphoprotein. Blood 80:2858-2866.

276. Cheng, J.T., M.H. Cobb, and R. Baer. 1993. Phosphorylation of the TAL1 oncoprotein

by the extracellular-signal-regulated protein kinase ERK1. Mol Cell Biol 13:801-808.

277. Hsu, H.L., I. Wadman, and R. Baer. 1994. Formation of in vivo complexes between the

TAL1 and E2A polypeptides of leukemic T cells. Proc Natl Acad Sci U S A 91:3181-

3185.

278. Bernard, M., E. Delabesse, L. Smit, C. Millien, I.R. Kirsch, J.L. Strominger, and E.A.

Macintyre. 1998. Helix-loop-helix (E2-5, HEB, TAL1 and Id1) protein interaction with

the TCRalphadelta enhancers. Int Immunol 10:1539-1549.

279. Hsu, H.L., L. Huang, J.T. Tsan, W. Funk, W.E. Wright, J.S. Hu, R.E. Kingston, and R.

Baer. 1994. Preferred sequences for DNA recognition by the TAL1 helix-loop-helix

proteins. Mol Cell Biol 14:1256-1265.

280. Hsu, H.L., I. Wadman, J.T. Tsan, and R. Baer. 1994. Positive and negative

transcriptional control by the TAL1 helix-loop-helix protein. Proc Natl Acad Sci U S A

91:5947-5951.

281. Aplan, P.D., K. Nakahara, S.H. Orkin, and I.R. Kirsch. 1992. The SCL gene product: a

positive regulator of erythroid differentiation. Embo J 11:4073-4081.

282. Xu, Z., S. Huang, L.S. Chang, A.D. Agulnick, and S.J. Brandt. 2003. Identification of a

TAL1 target gene reveals a positive role for the LIM domain-binding protein Ldb1 in

erythroid gene expression and differentiation. Mol Cell Biol 23:7585-7599.

283. Lahlil, R., E. Lecuyer, S. Herblot, and T. Hoang. 2004. SCL assembles a multifactorial

complex that determines glycophorin A expression. Mol Cell Biol 24:1439-1452.

284. Huang, S., Y. Qiu, R.W. Stein, and S.J. Brandt. 1999. p300 functions as a

transcriptional coactivator for the TAL1/SCL oncoprotein. Oncogene 18:4958-4967.

285. Zhao, X.F., and P.D. Aplan. 1999. The hematopoietic transcription factor SCL binds the

p44 subunit of TFIIH. J Biol Chem 274:1388-1393.

286. Huang, S., and S.J. Brandt. 2000. mSin3A regulates murine erythroleukemia cell

differentiation through association with the TAL1 (or SCL) transcription factor. Mol

Cell Biol 20:2248-2259.

287. Hu, X., X. Li, K. Valverde, X. Fu, C. Noguchi, Y. Qiu, and S. Huang. 2009. LSD1-

mediated epigenetic modification is required for TAL1 function and hematopoiesis.

Proc Natl Acad Sci U S A 106:10141-10146.

288. Wen, J., S. Huang, S.D. Pack, X. Yu, S.J. Brandt, and C.T. Noguchi. 2005. Tal1/SCL

binding to pericentromeric DNA represses transcription. J Biol Chem 280:12956-12966.

Introduction

71

289. Osada, H., G. Grutz, H. Axelson, A. Forster, and T.H. Rabbitts. 1995. Association of

erythroid transcription factors: complexes involving the LIM protein RBTN2 and the

zinc-finger protein GATA1. Proc Natl Acad Sci U S A 92:9585-9589.

290. Wadman, I.A., H. Osada, G.G. Grutz, A.D. Agulnick, H. Westphal, A. Forster, and T.H.

Rabbitts. 1997. The LIM-only protein Lmo2 is a bridging molecule assembling an

erythroid, DNA-binding complex which includes the TAL1, E47, GATA-1 and

Ldb1/NLI proteins. Embo J 16:3145-3157.

291. Lecuyer, E., S. Herblot, M. Saint-Denis, R. Martin, C.G. Begley, C. Porcher, S.H.

Orkin, and T. Hoang. 2002. The SCL complex regulates c-kit expression in

hematopoietic cells through functional interaction with Sp1. Blood 100:2430-2440.

292. Ono, Y., N. Fukuhara, and O. Yoshie. 1998. TAL1 and LIM-only proteins

synergistically induce retinaldehyde dehydrogenase 2 expression in T-cell acute

lymphoblastic leukemia by acting as cofactors for GATA3. Mol Cell Biol 18:6939-

6950.

293. Barton, L.M., B. Gottgens, and A.R. Green. 1999. The stem cell leukaemia (SCL) gene:

a critical regulator of haemopoietic and vascular development. Int J Biochem Cell Biol

31:1193-1207.

294. Elwood, N.J., H. Zogos, D.S. Pereira, J.E. Dick, and C.G. Begley. 1998. Enhanced

megakaryocyte and erythroid development from normal human CD34(+) cells:

consequence of enforced expression of SCL. Blood 91:3756-3765.

295. Visvader, J.E., Y. Fujiwara, and S.H. Orkin. 1998. Unsuspected role for the T-cell

leukemia protein SCL/tal-1 in vascular development. Genes Dev 12:473-479.

296. Bradley, C.K., E.A. Takano, M.A. Hall, J.R. Gothert, A.R. Harvey, C.G. Begley, and

J.A. van Eekelen. 2006. The essential haematopoietic transcription factor Scl is also

critical for neuronal development. Eur J Neurosci 23:1677-1689.

297. Krosl, G., G. He, M. Lefrancois, F. Charron, P.H. Romeo, P. Jolicoeur, I.R. Kirsch, M.

Nemer, and T. Hoang. 1998. Transcription factor SCL is required for c-kit expression

and c-Kit function in hemopoietic cells. J Exp Med 188:439-450.

298. Landry, J.R., S. Kinston, K. Knezevic, M.F. de Bruijn, N. Wilson, W.T. Nottingham,

M. Peitz, F. Edenhofer, J.E. Pimanda, K. Ottersbach, and B. Gottgens. 2008. Runx

genes are direct targets of Scl/Tal1 in the yolk sac and fetal liver. Blood 111:3005-3014.

299. Chasis, J.A., and N. Mohandas. 1992. Red blood cell glycophorins. Blood 80:1869-

1879.

300. Branton, D., C.M. Cohen, and J. Tyler. 1981. Interaction of cytoskeletal proteins on the

human erythrocyte membrane. Cell 24:24-32.

Introduction

72

301. Lausen, J., O. Pless, F. Leonard, O.N. Kuvardina, B. Koch, and A. Leutz. 2010. Targets

of the Tal1 transcription factor in erythrocytes: E2 ubiquitin conjugase regulation by

Tal1. J Biol Chem 285:5338-5346.

302. Hansson, A., C. Manetopoulos, J.I. Jonsson, and H. Axelson. 2003. The basic helix-

loop-helix transcription factor TAL1/SCL inhibits the expression of the p16INK4A and

pTalpha genes. Biochem Biophys Res Commun 312:1073-1081.

303. Ono, Y., N. Fukuhara, and O. Yoshie. 1997. Transcriptional activity of TAL1 in T cell

acute lymphoblastic leukemia (T-ALL) requires RBTN1 or -2 and induces TALLA1, a

highly specific tumor marker of T-ALL. J Biol Chem 272:4576-4581.

304. Chang, P.Y., K. Draheim, M.A. Kelliher, and S. Miyamoto. 2006. NFKB1 is a direct

target of the TAL1 oncoprotein in human T leukemia cells. Cancer Res 66:6008-6013.

305. Kusy, S., B. Gerby, N. Goardon, N. Gault, F. Ferri, D. Gerard, F. Armstrong, P.

Ballerini, J.M. Cayuela, A. Baruchel, F. Pflumio, and P.H. Romeo. 2010. NKX3.1 is a

direct TAL1 target gene that mediates proliferation of TAL1-expressing human T cell

acute lymphoblastic leukemia. J Exp Med 207:2141-2156.

306. Takagi, S., K. Fujikawa, T. Imai, N. Fukuhara, K. Fukudome, M. Minegishi, S.

Tsuchiya, T. Konno, Y. Hinuma, and O. Yoshie. 1995. Identification of a highly

specific surface marker of T-cell acute lymphoblastic leukemia and neuroblastoma as a

new member of the transmembrane 4 superfamily. Int J Cancer 61:706-715.

307. Zhao, D., P. McCaffery, K.J. Ivins, R.L. Neve, P. Hogan, W.W. Chin, and U.C. Drager.

1996. Molecular identification of a major retinoic-acid-synthesizing enzyme, a

retinaldehyde-specific dehydrogenase. Eur J Biochem 240:15-22.

308. Shen, M.M., and C. Abate-Shen. 2003. Roles of the Nkx3.1 homeobox gene in prostate

organogenesis and carcinogenesis. Dev Dyn 228:767-778.

309. Hayden, M.S., and S. Ghosh. 2004. Signaling to NF-kappaB. Genes Dev 18:2195-2224.

310. Chang, P.Y., and S. Miyamoto. 2006. Nuclear factor-kappaB dimer exchange promotes

a p21(waf1/cip1) superinduction response in human T leukemic cells. Mol Cancer Res

4:101-112.

311. Palomero, T., D.T. Odom, J. O'Neil, A.A. Ferrando, A. Margolin, D.S. Neuberg, S.S.

Winter, R.S. Larson, W. Li, X.S. Liu, R.A. Young, and A.T. Look. 2006.

Transcriptional regulatory networks downstream of TAL1/SCL in t-cell acute

lymphoblastic leukemia. Blood 986.

312. Prasad, K.S., J.E. Jordan, M.J. Koury, M.C. Bondurant, and S.J. Brandt. 1995.

Erythropoietin stimulates transcription of the TAL1/SCL gene and phosphorylation of

its protein products. J Biol Chem 270:11603-11611.

313. Prasad, K.S., and S.J. Brandt. 1997. Target-dependent effect of phosphorylation on the

DNA binding activity of the TAL1/SCL oncoprotein. J Biol Chem 272:11457-11462.

Introduction

73

314. Talora, C., S. Cialfi, C. Oliviero, R. Palermo, M. Pascucci, L. Frati, A. Vacca, A.

Gulino, and I. Screpanti. 2006. Cross talk among Notch3, pre-TCR, and Tal1 in T-cell

development and leukemogenesis. Blood 107:3313-3320.

315. Palamarchuk, A., A. Efanov, V. Maximov, R.I. Aqeilan, C.M. Croce, and Y. Pekarsky.

2005. Akt phosphorylates Tal1 oncoprotein and inhibits its repressor activity. Cancer

Res 65:4515-4519.

316. Tang, T., K.S. Prasad, M.J. Koury, and S.J. Brandt. 1999. Mitogen-activated protein

kinase mediates erythropoietin-induced phosphorylation of the TAL1/SCL transcription

factor in murine proerythroblasts. Biochem J 343 Pt 3:615-620.

317. Tang, T., J.L. Arbiser, and S.J. Brandt. 2002. Phosphorylation by mitogen-activated

protein kinase mediates the hypoxia-induced turnover of the TAL1/SCL transcription

factor in endothelial cells. J Biol Chem 277:18365-18372.

318. Terme, J.M., L. Lhermitte, V. Asnafi, and P. Jalinot. 2009. TGF-beta induces

degradation of TAL1/SCL by the ubiquitin-proteasome pathway through AKT-

mediated phosphorylation. Blood 113:6695-6698.

319. Sloan, S.R., C.P. Shen, R. McCarrick-Walmsley, and T. Kadesch. 1996.

Phosphorylation of E47 as a potential determinant of B-cell-specific activity. Mol Cell

Biol 16:6900-6908.

320. Johnson, S.E., X. Wang, S. Hardy, E.J. Taparowsky, and S.F. Konieczny. 1996. Casein

kinase II increases the transcriptional activities of MRF4 and MyoD independently of

their direct phosphorylation. Mol Cell Biol 16:1604-1613.

321. Lluis, F., E. Ballestar, M. Suelves, M. Esteller, and P. Munoz-Canoves. 2005. E47

phosphorylation by p38 MAPK promotes MyoD/E47 association and muscle-specific

gene transcription. Embo J 24:974-984.

322. Page, J.L., X. Wang, L.M. Sordillo, and S.E. Johnson. 2004. MEKK1 signaling through

p38 leads to transcriptional inactivation of E47 and repression of skeletal myogenesis. J

Biol Chem 279:30966-30972.

323. Hsu, H.L., J.T. Cheng, Q. Chen, and R. Baer. 1991. Enhancer-binding activity of the

tal-1 oncoprotein in association with the E47/E12 helix-loop-helix proteins. Mol Cell

Biol 11:3037-3042.

324. Begley, C.G., and A.R. Green. 1999. The SCL gene: from case report to critical

hematopoietic regulator. Blood 93:2760-2770.

325. Elefanty, A.G., C.G. Begley, D. Metcalf, L. Barnett, F. Kontgen, and L. Robb. 1998.

Characterization of hematopoietic progenitor cells that express the transcription factor

SCL, using a lacZ "knock-in" strategy. Proc Natl Acad Sci U S A 95:11897-11902.

Introduction

74

326. Robb, L., I. Lyons, R. Li, L. Hartley, F. Kontgen, R.P. Harvey, D. Metcalf, and C.G.

Begley. 1995. Absence of yolk sac hematopoiesis from mice with a targeted disruption

of the scl gene. Proc Natl Acad Sci U S A 92:7075-7079.

327. Kallianpur, A.R., J.E. Jordan, and S.J. Brandt. 1994. The SCL/TAL-1 gene is expressed

in progenitors of both the hematopoietic and vascular systems during embryogenesis.

Blood 83:1200-1208.

328. Gering, M., Y. Yamada, T.H. Rabbitts, and R.K. Patient. 2003. Lmo2 and Scl/Tal1

convert non-axial mesoderm into haemangioblasts which differentiate into endothelial

cells in the absence of Gata1. Development 130:6187-6199.

329. Patterson, L.J., M. Gering, C.E. Eckfeldt, A.R. Green, C.M. Verfaillie, S.C. Ekker, and

R. Patient. 2007. The transcription factors Scl and Lmo2 act together during

development of the hemangioblast in zebrafish. Blood 109:2389-2398.

330. Chung, Y.S., W.J. Zhang, E. Arentson, P.D. Kingsley, J. Palis, and K. Choi. 2002.

Lineage analysis of the hemangioblast as defined by FLK1 and SCL expression.

Development 129:5511-5520.

331. Lancrin, C., P. Sroczynska, A.G. Serrano, A. Gandillet, C. Ferreras, V. Kouskoff, and

G. Lacaud. 2010. Blood cell generation from the hemangioblast. J Mol Med 88:167-

172.

332. Lazrak, M., V. Deleuze, D. Noel, D. Haouzi, E. Chalhoub, C. Dohet, I. Robbins, and D.

Mathieu. 2004. The bHLH TAL-1/SCL regulates endothelial cell migration and

morphogenesis. J Cell Sci 117:1161-1171.

333. Robb, L., N.J. Elwood, A.G. Elefanty, F. Kontgen, R. Li, L.D. Barnett, and C.G.

Begley. 1996. The scl gene product is required for the generation of all hematopoietic

lineages in the adult mouse. Embo J 15:4123-4129.

334. Porcher, C., W. Swat, K. Rockwell, Y. Fujiwara, F.W. Alt, and S.H. Orkin. 1996. The T

cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic

lineages. Cell 86:47-57.

335. Zhang, Y., K.J. Payne, Y. Zhu, M.A. Price, Y.K. Parrish, E. Zielinska, L.W. Barsky,

and G.M. Crooks. 2005. SCL expression at critical points in human hematopoietic

lineage commitment. Stem Cells 23:852-860.

336. Hall, M.A., D.J. Curtis, D. Metcalf, A.G. Elefanty, K. Sourris, L. Robb, J.R. Gothert,

S.M. Jane, and C.G. Begley. 2003. The critical regulator of embryonic hematopoiesis,

SCL, is vital in the adult for megakaryopoiesis, erythropoiesis, and lineage choice in

CFU-S12. Proc Natl Acad Sci U S A 100:992-997.

337. Curtis, D.J., M.A. Hall, L.J. Van Stekelenburg, L. Robb, S.M. Jane, and C.G. Begley.

2004. SCL is required for normal function of short-term repopulating hematopoietic

stem cells. Blood 103:3342-3348.

Introduction

75

338. Reynaud, D., E. Ravet, M. Titeux, F. Mazurier, L. Renia, A. Dubart-Kupperschmitt,

P.H. Romeo, and F. Pflumio. 2005. SCL/TAL1 expression level regulates human

hematopoietic stem cell self-renewal and engraftment. Blood 106:2318-2328.

339. Mikkola, H.K., J. Klintman, H. Yang, H. Hock, T.M. Schlaeger, Y. Fujiwara, and S.H.

Orkin. 2003. Haematopoietic stem cells retain long-term repopulating activity and

multipotency in the absence of stem-cell leukaemia SCL/tal-1 gene. Nature 421:547-

551.

340. Lacombe, J., S. Herblot, S. Rojas-Sutterlin, A. Haman, S. Barakat, N.N. Iscove, G.

Sauvageau, and T. Hoang. 2010. Scl regulates the quiescence and the long-term

competence of hematopoietic stem cells. Blood 115:792-803.

341. Brunet de la Grange, P., F. Armstrong, V. Duval, M.C. Rouyez, N. Goardon, P.H.

Romeo, and F. Pflumio. 2006. Low SCL/TAL1 expression reveals its major role in

adult hematopoietic myeloid progenitors and stem cells. Blood

342. Green, A.R., E. Salvaris, and C.G. Begley. 1991. Erythroid expression of the 'helix-

loop-helix' gene, SCL. Oncogene 6:475-479.

343. Green, A.R., T. Lints, J. Visvader, R. Harvey, and C.G. Begley. 1992. SCL is

coexpressed with GATA-1 in hemopoietic cells but is also expressed in developing

brain. Oncogene 7:653-660.

344. van Eekelen, J.A., C.K. Bradley, J.R. Gothert, L. Robb, A.G. Elefanty, C.G. Begley,

and A.R. Harvey. 2003. Expression pattern of the stem cell leukaemia gene in the CNS

of the embryonic and adult mouse. Neuroscience 122:421-436.

345. Muroyama, Y., Y. Fujiwara, S.H. Orkin, and D.H. Rowitch. 2005. Specification of

astrocytes by bHLH protein SCL in a restricted region of the neural tube. Nature

438:360-363.

346. Acharya, M.R., A. Sparreboom, J. Venitz, and W.D. Figg. 2005. Rational development

of histone deacetylase inhibitors as anticancer agents: a review. Mol Pharmacol 68:917-

932.

347. Kornberg, R.D., and Y. Lorch. 1999. Twenty-five years of the nucleosome,

fundamental particle of the eukaryote chromosome. Cell 98:285-294.

348. Hadnagy, A., R. Beaulieu, and D. Balicki. 2008. Histone tail modifications and

noncanonical functions of histones: perspectives in cancer epigenetics. Mol Cancer

Ther 7:740-748.

349. Marks, P., R.A. Rifkind, V.M. Richon, R. Breslow, T. Miller, and W.K. Kelly. 2001.

Histone deacetylases and cancer: causes and therapies. Nat Rev Cancer 1:194-202.

350. Marks, P.A., V.M. Richon, and R.A. Rifkind. 2000. Histone deacetylase inhibitors:

inducers of differentiation or apoptosis of transformed cells. J Natl Cancer Inst

92:1210-1216.

Introduction

76

351. Dokmanovic, M., C. Clarke, and P.A. Marks. 2007. Histone deacetylase inhibitors:

overview and perspectives. Mol Cancer Res 5:981-989.

352. Strahl, B.D., and C.D. Allis. 2000. The language of covalent histone modifications.

Nature 403:41-45.

353. Pan, L.N., J. Lu, and B. Huang. 2007. HDAC inhibitors: a potential new category of

anti-tumor agents. Cell Mol Immunol 4:337-343.

354. Cress, W.D., and E. Seto. 2000. Histone deacetylases, transcriptional control, and

cancer. J Cell Physiol 184:1-16.

355. Mahlknecht, U., and D. Hoelzer. 2000. Histone acetylation modifiers in the

pathogenesis of malignant disease. Mol Med 6:623-644.

356. Allfrey, V.G. 1966. Structural modifications of histones and their possible role in the

regulation of ribonucleic acid synthesis. Proc Can Cancer Conf 6:313-335.

357. Roth, S.Y., J.M. Denu, and C.D. Allis. 2001. Histone acetyltransferases. Annu Rev

Biochem 70:81-120.

358. Kouzarides, T. 2000. Acetylation: a regulatory modification to rival phosphorylation?

Embo J 19:1176-1179.

359. Cohen, H.Y., S. Lavu, K.J. Bitterman, B. Hekking, T.A. Imahiyerobo, C. Miller, R.

Frye, H. Ploegh, B.M. Kessler, and D.A. Sinclair. 2004. Acetylation of the C terminus

of Ku70 by CBP and PCAF controls Bax-mediated apoptosis. Mol Cell 13:627-638.

360. Blander, G., N. Zalle, Y. Daniely, J. Taplick, M.D. Gray, and M. Oren. 2002. DNA

damage-induced translocation of the Werner helicase is regulated by acetylation. J Biol

Chem 277:50934-50940.

361. Ogiwara, H., A. Ui, A. Otsuka, H. Satoh, I. Yokomi, S. Nakajima, A. Yasui, J. Yokota,

and T. Kohno. 2011. Histone acetylation by CBP and p300 at double-strand break sites

facilitates SWI/SNF chromatin remodeling and the recruitment of non-homologous end

joining factors. Oncogene 30:2135-2146.

362. Lee, K.K., and J.L. Workman. 2007. Histone acetyltransferase complexes: one size

doesn't fit all. Nat Rev Mol Cell Biol 8:284-295.

363. Huang, S., Y. Qiu, Y. Shi, Z. Xu, and S.J. Brandt. 2000. P/CAF-mediated acetylation

regulates the function of the basic helix-loop-helix transcription factor TAL1/SCL.

Embo J 19:6792-6803.

364. Bradney, C., M. Hjelmeland, Y. Komatsu, M. Yoshida, T.P. Yao, and Y. Zhuang. 2003.

Regulation of E2A activities by histone acetyltransferases in B lymphocyte

development. J Biol Chem 278:2370-2376.

365. Stimson, L., V. Wood, O. Khan, S. Fotheringham, and N.B. La Thangue. 2009. HDAC

inhibitor-based therapies and haematological malignancy. Ann Oncol 20:1293-1302.

Introduction

77

366. Carey, N., and N.B. La Thangue. 2006. Histone deacetylase inhibitors: gathering pace.

Curr Opin Pharmacol 6:369-375.

367. Bolden, J.E., M.J. Peart, and R.W. Johnstone. 2006. Anticancer activities of histone

deacetylase inhibitors. Nat Rev Drug Discov 5:769-784.

368. Lane, A.A., and B.A. Chabner. 2009. Histone deacetylase inhibitors in cancer therapy. J

Clin Oncol 27:5459-5468.

369. Grozinger, C.M., and S.L. Schreiber. 2000. Regulation of histone deacetylase 4 and 5

and transcriptional activity by 14-3-3-dependent cellular localization. Proc Natl Acad

Sci U S A 97:7835-7840.

370. Parra, M., H. Kasler, T.A. McKinsey, E.N. Olson, and E. Verdin. 2005. Protein kinase

D1 phosphorylates HDAC7 and induces its nuclear export after T-cell receptor

activation. J Biol Chem 280:13762-13770.

371. Glozak, M.A., N. Sengupta, X. Zhang, and E. Seto. 2005. Acetylation and deacetylation

of non-histone proteins. Gene 363:15-23.

372. Martinez-Balbas, M.A., U.M. Bauer, S.J. Nielsen, A. Brehm, and T. Kouzarides. 2000.

Regulation of E2F1 activity by acetylation. Embo J 19:662-671.

373. Watamoto, K., M. Towatari, Y. Ozawa, Y. Miyata, M. Okamoto, A. Abe, T. Naoe, and

H. Saito. 2003. Altered interaction of HDAC5 with GATA-1 during MEL cell

differentiation. Oncogene 22:9176-9184.

374. Bali, P., M. Pranpat, J. Bradner, M. Balasis, W. Fiskus, F. Guo, K. Rocha, S.

Kumaraswamy, S. Boyapalle, P. Atadja, E. Seto, and K. Bhalla. 2005. Inhibition of

histone deacetylase 6 acetylates and disrupts the chaperone function of heat shock

protein 90: a novel basis for antileukemia activity of histone deacetylase inhibitors. J

Biol Chem 280:26729-26734.

375. Tran, A.D., T.P. Marmo, A.A. Salam, S. Che, E. Finkelstein, R. Kabarriti, H.S. Xenias,

R. Mazitschek, C. Hubbert, Y. Kawaguchi, M.P. Sheetz, T.P. Yao, and J.C. Bulinski.

2007. HDAC6 deacetylation of tubulin modulates dynamics of cellular adhesions. J

Cell Sci 120:1469-1479.

376. Hubbert, C., A. Guardiola, R. Shao, Y. Kawaguchi, A. Ito, A. Nixon, M. Yoshida, X.F.

Wang, and T.P. Yao. 2002. HDAC6 is a microtubule-associated deacetylase. Nature

417:455-458.

377. Halkidou, K., L. Gaughan, S. Cook, H.Y. Leung, D.E. Neal, and C.N. Robson. 2004.

Upregulation and nuclear recruitment of HDAC1 in hormone refractory prostate cancer.

Prostate 59:177-189.

378. Choi, J.H., H.J. Kwon, B.I. Yoon, J.H. Kim, S.U. Han, H.J. Joo, and D.Y. Kim. 2001.

Expression profile of histone deacetylase 1 in gastric cancer tissues. Jpn J Cancer Res

92:1300-1304.

Introduction

78

379. Wilson, A.J., D.S. Byun, S. Nasser, L.B. Murray, K. Ayyanar, D. Arango, M. Figueroa,

A. Melnick, G.D. Kao, L.H. Augenlicht, and J.M. Mariadason. 2008. HDAC4 promotes

growth of colon cancer cells via repression of p21. Mol Biol Cell 19:4062-4075.

380. Zhang, Z., H. Yamashita, T. Toyama, H. Sugiura, Y. Ando, K. Mita, M. Hamaguchi, Y.

Hara, S. Kobayashi, and H. Iwase. 2005. Quantitation of HDAC1 mRNA expression in

invasive carcinoma of the breast*. Breast Cancer Res Treat 94:11-16.

381. Song, J., J.H. Noh, J.H. Lee, J.W. Eun, Y.M. Ahn, S.Y. Kim, S.H. Lee, W.S. Park, N.J.

Yoo, J.Y. Lee, and S.W. Nam. 2005. Increased expression of histone deacetylase 2 is

found in human gastric cancer. Apmis 113:264-268.

382. Duong, V., C. Bret, L. Altucci, A. Mai, C. Duraffourd, J. Loubersac, P.O. Harmand, S.

Bonnet, S. Valente, T. Maudelonde, V. Cavailles, and N. Boulle. 2008. Specific activity

of class II histone deacetylases in human breast cancer cells. Mol Cancer Res 6:1908-

1919.

383. Zhang, Z., H. Yamashita, T. Toyama, H. Sugiura, Y. Omoto, Y. Ando, K. Mita, M.

Hamaguchi, S. Hayashi, and H. Iwase. 2004. HDAC6 expression is correlated with

better survival in breast cancer. Clin Cancer Res 10:6962-6968.

384. Moreno, D.A., C.A. Scrideli, M.A. Cortez, R. de Paula Queiroz, E.T. Valera, V. da

Silva Silveira, J.A. Yunes, S.R. Brandalise, and L.G. Tone. 2010. Differential

expression of HDAC3, HDAC7 and HDAC9 is associated with prognosis and survival

in childhood acute lymphoblastic leukaemia. Br J Haematol 150:665-673.

385. Lin, R.J., T. Sternsdorf, M. Tini, and R.M. Evans. 2001. Transcriptional regulation in

acute promyelocytic leukemia. Oncogene 20:7204-7215.

386. Wang, J., T. Hoshino, R.L. Redner, S. Kajigaya, and J.M. Liu. 1998. ETO, fusion

partner in t(8;21) acute myeloid leukemia, represses transcription by interaction with the

human N-CoR/mSin3/HDAC1 complex. Proc Natl Acad Sci U S A 95:10860-10865.

387. Wang, J., Y. Saunthararajah, R.L. Redner, and J.M. Liu. 1999. Inhibitors of histone

deacetylase relieve ETO-mediated repression and induce differentiation of AML1-ETO

leukemia cells. Cancer Res 59:2766-2769.

388. Dhordain, P., R.J. Lin, S. Quief, D. Lantoine, J.P. Kerckaert, R.M. Evans, and O.

Albagli. 1998. The LAZ3(BCL-6) oncoprotein recruits a SMRT/mSIN3A/histone

deacetylase containing complex to mediate transcriptional repression. Nucleic Acids Res

26:4645-4651.

389. Pasqualucci, L., O. Bereschenko, H. Niu, U. Klein, K. Basso, R. Guglielmino, G.

Cattoretti, and R. Dalla-Favera. 2003. Molecular pathogenesis of non-Hodgkin's

lymphoma: the role of Bcl-6. Leuk Lymphoma 44 Suppl 3:S5-12.

390. Ocker, M., and R. Schneider-Stock. 2007. Histone deacetylase inhibitors: signalling

towards p21cip1/waf1. Int J Biochem Cell Biol 39:1367-1374.

Introduction

79

391. Glaser, K.B., M.J. Staver, J.F. Waring, J. Stender, R.G. Ulrich, and S.K. Davidsen.

2003. Gene expression profiling of multiple histone deacetylase (HDAC) inhibitors:

defining a common gene set produced by HDAC inhibition in T24 and MDA carcinoma

cell lines. Mol Cancer Ther 2:151-163.

392. Peart, M.J., G.K. Smyth, R.K. van Laar, D.D. Bowtell, V.M. Richon, P.A. Marks, A.J.

Holloway, and R.W. Johnstone. 2005. Identification and functional significance of

genes regulated by structurally different histone deacetylase inhibitors. Proc Natl Acad

Sci U S A 102:3697-3702.

393. Mitsiades, C.S., N.S. Mitsiades, C.J. McMullan, V. Poulaki, R. Shringarpure, T.

Hideshima, M. Akiyama, D. Chauhan, N. Munshi, X. Gu, C. Bailey, M. Joseph, T.A.

Libermann, V.M. Richon, P.A. Marks, and K.C. Anderson. 2004. Transcriptional

signature of histone deacetylase inhibition in multiple myeloma: biological and clinical

implications. Proc Natl Acad Sci U S A 101:540-545.

394. Li, H., and X. Wu. 2004. Histone deacetylase inhibitor, Trichostatin A, activates

p21WAF1/CIP1 expression through downregulation of c-myc and release of the

repression of c-myc from the promoter in human cervical cancer cells. Biochem Biophys

Res Commun 324:860-867.

395. Xu, Y., S. Voelter-Mahlknecht, and U. Mahlknecht. 2005. The histone deacetylase

inhibitor suberoylanilide hydroxamic acid down-regulates expression levels of Bcr-abl,

c-Myc and HDAC3 in chronic myeloid leukemia cell lines. Int J Mol Med 15:169-172.

396. Duan, H., C.A. Heckman, and L.M. Boxer. 2005. Histone deacetylase inhibitors down-

regulate bcl-2 expression and induce apoptosis in t(14;18) lymphomas. Mol Cell Biol

25:1608-1619.

397. Tong, X., L. Yin, and C. Giardina. 2004. Butyrate suppresses Cox-2 activation in colon

cancer cells through HDAC inhibition. Biochem Biophys Res Commun 317:463-471.

398. Yamaguchi, K., A. Lantowski, A.J. Dannenberg, and K. Subbaramaiah. 2005. Histone

deacetylase inhibitors suppress the induction of c-Jun and its target genes including

COX-2. J Biol Chem 280:32569-32577.

399. You, J.S., J.K. Kang, E.K. Lee, J.C. Lee, S.H. Lee, Y.J. Jeon, D.H. Koh, S.H. Ahn,

D.W. Seo, H.Y. Lee, E.J. Cho, and J.W. Han. 2008. Histone deacetylase inhibitor

apicidin downregulates DNA methyltransferase 1 expression and induces repressive

histone modifications via recruitment of corepressor complex to promoter region in

human cervix cancer cells. Oncogene 27:1376-1386.

400. Januchowski, R., M. Dabrowski, H. Ofori, and P.P. Jagodzinski. 2007. Trichostatin A

down-regulate DNA methyltransferase 1 in Jurkat T cells. Cancer Lett 246:313-317.

401. Krishnan, M., A.B. Singh, J.J. Smith, A. Sharma, X. Chen, S. Eschrich, T.J. Yeatman,

R.D. Beauchamp, and P. Dhawan. 2010. HDAC inhibitors regulate claudin-1

Introduction

80

expression in colon cancer cells through modulation of mRNA stability. Oncogene

29:305-312.

402. Nimmanapalli, R., L. Fuino, P. Bali, M. Gasparetto, M. Glozak, J. Tao, L. Moscinski,

C. Smith, J. Wu, R. Jove, P. Atadja, and K. Bhalla. 2003. Histone deacetylase inhibitor

LAQ824 both lowers expression and promotes proteasomal degradation of Bcr-Abl and

induces apoptosis of imatinib mesylate-sensitive or -refractory chronic myelogenous

leukemia-blast crisis cells. Cancer Res 63:5126-5135.

403. Wu, J., J.P. Issa, J. Herman, D.E. Bassett, Jr., B.D. Nelkin, and S.B. Baylin. 1993.

Expression of an exogenous eukaryotic DNA methyltransferase gene induces

transformation of NIH 3T3 cells. Proc Natl Acad Sci U S A 90:8891-8895.

404. Xiong, Y., S.C. Dowdy, K.C. Podratz, F. Jin, J.R. Attewell, N.L. Eberhardt, and S.W.

Jiang. 2005. Histone deacetylase inhibitors decrease DNA methyltransferase-3B

messenger RNA stability and down-regulate de novo DNA methyltransferase activity in

human endometrial cells. Cancer Res 65:2684-2689.

405. Wu, P., Y. Tian, G. Chen, B. Wang, L. Gui, L. Xi, X. Ma, Y. Fang, T. Zhu, D. Wang,

L. Meng, G. Xu, S. Wang, D. Ma, and J. Zhou. 2010. Ubiquitin B: an essential mediator

of trichostatin A-induced tumor-selective killing in human cancer cells. Cell Death

Differ 17:109-118.

406. Rahmani, M., C. Yu, E. Reese, W. Ahmed, K. Hirsch, P. Dent, and S. Grant. 2003.

Inhibition of PI-3 kinase sensitizes human leukemic cells to histone deacetylase

inhibitor-mediated apoptosis through p44/42 MAP kinase inactivation and abrogation of

p21(CIP1/WAF1) induction rather than AKT inhibition. Oncogene 22:6231-6242.

407. Yu, X., Z.S. Guo, M.G. Marcu, L. Neckers, D.M. Nguyen, G.A. Chen, and D.S.

Schrump. 2002. Modulation of p53, ErbB1, ErbB2, and Raf-1 expression in lung cancer

cells by depsipeptide FR901228. J Natl Cancer Inst 94:504-513.

408. Cha, T.L., M.J. Chuang, S.T. Wu, G.H. Sun, S.Y. Chang, D.S. Yu, S.M. Huang, S.K.

Huan, T.C. Cheng, T.T. Chen, P.L. Fan, and P.W. Hsiao. 2009. Dual degradation of

aurora A and B kinases by the histone deacetylase inhibitor LBH589 induces G2-M

arrest and apoptosis of renal cancer cells. Clin Cancer Res 15:840-850.

409. Kawamata, N., J. Chen, and H.P. Koeffler. 2007. Suberoylanilide hydroxamic acid

(SAHA; vorinostat) suppresses translation of cyclin D1 in mantle cell lymphoma cells.

Blood 110:2667-2673.

410. Kramer, O.H., P. Zhu, H.P. Ostendorff, M. Golebiewski, J. Tiefenbach, M.A. Peters, B.

Brill, B. Groner, I. Bach, T. Heinzel, and M. Gottlicher. 2003. The histone deacetylase

inhibitor valproic acid selectively induces proteasomal degradation of HDAC2. Embo J

22:3411-3420.

Introduction

81

411. Qiu, L., A. Burgess, D.P. Fairlie, H. Leonard, P.G. Parsons, and B.G. Gabrielli. 2000.

Histone deacetylase inhibitors trigger a G2 checkpoint in normal cells that is defective

in tumor cells. Mol Biol Cell 11:2069-2083.

412. Ungerstedt, J.S., Y. Sowa, W.S. Xu, Y. Shao, M. Dokmanovic, G. Perez, L. Ngo, A.

Holmgren, X. Jiang, and P.A. Marks. 2005. Role of thioredoxin in the response of

normal and transformed cells to histone deacetylase inhibitors. Proc Natl Acad Sci U S

A 102:673-678.

413. Warrener, R., H. Beamish, A. Burgess, N.J. Waterhouse, N. Giles, D. Fairlie, and B.

Gabrielli. 2003. Tumor cell-selective cytotoxicity by targeting cell cycle checkpoints.

Faseb J 17:1550-1552.

414. Ruefli, A.A., M.J. Ausserlechner, D. Bernhard, V.R. Sutton, K.M. Tainton, R. Kofler,

M.J. Smyth, and R.W. Johnstone. 2001. The histone deacetylase inhibitor and

chemotherapeutic agent suberoylanilide hydroxamic acid (SAHA) induces a cell-death

pathway characterized by cleavage of Bid and production of reactive oxygen species.

Proc Natl Acad Sci U S A 98:10833-10838.

415. Nishiyama, A., M. Matsui, S. Iwata, K. Hirota, H. Masutani, H. Nakamura, Y. Takagi,

H. Sono, Y. Gon, and J. Yodoi. 1999. Identification of thioredoxin-binding protein-

2/vitamin D(3) up-regulated protein 1 as a negative regulator of thioredoxin function

and expression. J Biol Chem 274:21645-21650.

416. Butler, L.M., X. Zhou, W.S. Xu, H.I. Scher, R.A. Rifkind, P.A. Marks, and V.M.

Richon. 2002. The histone deacetylase inhibitor SAHA arrests cancer cell growth, up-

regulates thioredoxin-binding protein-2, and down-regulates thioredoxin. Proc Natl

Acad Sci U S A 99:11700-11705.

417. Tsapis, M., M. Lieb, F. Manzo, P. Shankaranarayanan, R. Herbrecht, P. Lutz, and H.

Gronemeyer. 2007. HDAC inhibitors induce apoptosis in glucocorticoid-resistant acute

lymphatic leukemia cells despite a switch from the extrinsic to the intrinsic death

pathway. Int J Biochem Cell Biol 39:1500-1509.

418. Balasubramanian, S., J. Ramos, W. Luo, M. Sirisawad, E. Verner, and J.J. Buggy. 2008.

A novel histone deacetylase 8 (HDAC8)-specific inhibitor PCI-34051 induces apoptosis

in T-cell lymphomas. Leukemia 22:1026-1034.

419. Bots, M., and R.W. Johnstone. 2009. Rational combinations using HDAC inhibitors.

Clin Cancer Res 15:3970-3977.

420. Cameron, E.E., K.E. Bachman, S. Myohanen, J.G. Herman, and S.B. Baylin. 1999.

Synergy of demethylation and histone deacetylase inhibition in the re-expression of

genes silenced in cancer. Nat Genet 21:103-107.

Introduction

82

421. Kim, M.S., M. Blake, J.H. Baek, G. Kohlhagen, Y. Pommier, and F. Carrier. 2003.

Inhibition of histone deacetylase increases cytotoxicity to anticancer drugs targeting

DNA. Cancer Res 63:7291-7300.

422. Yu, C., G. Dasmahapatra, P. Dent, and S. Grant. 2005. Synergistic interactions between

MEK1/2 and histone deacetylase inhibitors in BCR/ABL+ human leukemia cells.

Leukemia 19:1579-1589.

423. Bali, P., P. George, P. Cohen, J. Tao, F. Guo, C. Sigua, A. Vishvanath, A. Scuto, S.

Annavarapu, W. Fiskus, L. Moscinski, P. Atadja, and K. Bhalla. 2004. Superior activity

of the combination of histone deacetylase inhibitor LAQ824 and the FLT-3 kinase

inhibitor PKC412 against human acute myelogenous leukemia cells with mutant FLT-3.

Clin Cancer Res 10:4991-4997.

424. George, P., P. Bali, S. Annavarapu, A. Scuto, W. Fiskus, F. Guo, C. Sigua, G.

Sondarva, L. Moscinski, P. Atadja, and K. Bhalla. 2005. Combination of the histone

deacetylase inhibitor LBH589 and the hsp90 inhibitor 17-AAG is highly active against

human CML-BC cells and AML cells with activating mutation of FLT-3. Blood

105:1768-1776.

425. Ropero, S., M.F. Fraga, E. Ballestar, R. Hamelin, H. Yamamoto, M. Boix-Chornet, R.

Caballero, M. Alaminos, F. Setien, M.F. Paz, M. Herranz, J. Palacios, D. Arango, T.F.

Orntoft, L.A. Aaltonen, S. Schwartz, Jr., and M. Esteller. 2006. A truncating mutation

of HDAC2 in human cancers confers resistance to histone deacetylase inhibition. Nat

Genet 38:566-569.

426. Bandyopadhyay, D., A. Mishra, and E.E. Medrano. 2004. Overexpression of histone

deacetylase 1 confers resistance to sodium butyrate-mediated apoptosis in melanoma

cells through a p53-mediated pathway. Cancer Res 64:7706-7710.

427. Hauswald, S., J. Duque-Afonso, M.M. Wagner, F.M. Schertl, M. Lubbert, C. Peschel,

U. Keller, and T. Licht. 2009. Histone deacetylase inhibitors induce a very broad,

pleiotropic anticancer drug resistance phenotype in acute myeloid leukemia cells by

modulation of multiple ABC transporter genes. Clin Cancer Res 15:3705-3715.

428. Cardoso, B.A., L.R. Martins, C.I. Santos, L.M. Nadler, V.A. Boussiotis, A.A. Cardoso,

and J.T. Barata. 2009. Interleukin-4 stimulates proliferation and growth of T-cell acute

lymphoblastic leukemia cells by activating mTOR signaling. Leukemia 23:206-208.

429. La Motte-Mohs, R.N., E. Herer, and J.C. Zuniga-Pflucker. 2005. Induction of T-cell

development from human cord blood hematopoietic stem cells by Delta-like 1 in vitro.

Blood 105:1431-1439.

430. Littlewood, T.D., D.C. Hancock, P.S. Danielian, M.G. Parker, and G.I. Evan. 1995. A

modified oestrogen receptor ligand-binding domain as an improved switch for the

regulation of heterologous proteins. Nucleic Acids Res 23:1686-1690.

Introduction

83

Interleukin-4 stimulates proliferation and growth of T-ALL cells

84

Chapter 2

Interleukin-4 stimulates proliferation and growth of T-

cell acute lymphoblastic leukemia cells by activating

mTOR signaling

Bruno A. Cardoso*, Leila R. Martins*, Cristina I. Santos*, Lee M. Nadler, Vassiliki A.

Boussiotis, Angelo A. Cardoso and João T. Barata

*these authors contributed equally to this work

Adapted from Leukemia, 2009; 23 (1): 206-8

Interleukin-4 stimulates proliferation and growth of T-ALL cells

85

Abstract

IL-4 is produced within the bone marrow microenvironment and stimulates the

proliferation of T-cell acute lymphoblastic leukemia (T-ALL) cells by as yet unknown

mechanisms. In this study, we showed that IL-4 induced cell cycle progression of

primary T-ALL cells from G0/G1 into S and G2/M phases of the cell cycle, by up-

regulating cyclins D2, E and A, and down-regulating the cyclin-dependent kinase

inhibitor p27kip1

. These events were paralleled by sequential activation of CDK4 and

CDK2 and hyperphosphorylation of Rb. By transfecting T-ALL cells with the chimeric

protein VP22/p27kip1

, which is able to translocate into the cytoplasm and nucleus of

target cells, we showed that down-regulation of p27kip1

is mandatory for IL-4-mediated

proliferation. Furthermore, IL-4 stimulated mTOR activation, as determined by

increased phosphorylation of S6K, S6 and 4E-BP1. To evaluate the functional

contribution of mTOR activation to IL-4 mediated signaling in T-ALL cells, we

specifically inhibited mTOR using rapamycin. Flow cytometry analysis of FSCxSSC

distribution and BrdU+PI staining demonstrated that rapamycin completely prevented

IL-4-dependent T-ALL cell growth and cell cycle progression. Consequently,

proliferation was also abrogated, as assessed by 3H-Thymidine incorporation. In

summary, our data identify mTOR as a critical regulator of IL-4 mediated effects in T-

ALL cells and support the rationale for using mTOR pharmacological inhibitors in T-

ALL therapy.

Introduction

Interleukin-4 (IL-4) is produced within the BM microenvironment either by

nonresident circulating cells, namely T lymphocytes, mast cells, and basophils or by

BM stromal cells. Importantly, IL-4 is able to induce proliferation of T-cell acute

lymphoblastic leukemia (T-ALL) cells (1). Therefore, IL-4 produced in the BM milieu

might influence the progression of T-ALL by stimulating proliferation of tumor cells.

However, the exact mechanisms by which IL-4 induces leukemia expansion remain

unknown. The effects of IL-4 on normal lymphocytes involve at least two signaling

pathways, JAK/STAT and PI3K/PKB (2). In addition, IL-4 activates the PI3K

downstream target mTOR, which regulates cell cycle completion in activated mature T-

cells (3). Constitutive activation of mTOR has been reported in some T-ALL cases (4)

Interleukin-4 stimulates proliferation and growth of T-ALL cells

86

and suggested to regulate viability, cell size and proliferation of tumor cells. However,

leukemia cells depend not only on constitutive, cell-autonomous mechanisms but also

on cues from the microenvironment to fully activate key signaling molecules that are

essential for tumor expansion and decreased sensitivity to chemotherapy (5, 6).

Therefore, we investigated whether mTOR is involved in IL-4-mediated proliferation

and growth of T-ALL cells.

Materials and Methods

T-ALL cells. Primary T-ALL cells were obtained from the peripheral blood and/or the

bone marrow of patients with high leukemia involvement (85–100%). Informed consent

and Institutional Review Board approval was obtained for all sample collections.

Samples were enriched by density centrifugation over Ficoll-Hypaque (GE Healthcare

Life Sciences), washed twice in RPMI 1640 (Invitrogen) supplemented with 10%

(vol/vol) FBS and 2 mM L-glutamine (hereafter referred to as RPMI 10 medium),

subjected to immunophenotypic analysis by flow cytometry and classified according to

their maturation stage using the criteria defined by the European Group for

Immunological Characterization of Leukemias. The TAIL7 cell line was maintained as

described previously (7).

Cell culture. Primary T-ALL cells and TAIL7 cell line were cultured in RPMI-10

medium as 2 x 106 cells/mL at 37ºC with 5% CO2 in the following conditions: Medium

alone (with the appropriate vehicle), or medium with 10ng/mL IL-4 (Endogen) or with

IL-4 plus 100nM Rapamycin (Calbiochem) for the indicated time points. For short-term

stimulation TAIL7 cells were starved overnight in RPMI with 1 % FBS, and in the next

day stimulated in the indicated conditions and time points in PBS 1x. Cells were then

harvested and processed as indicated below for assessment of cell viability, cell cycle,

and proliferation, and protein extraction for Immunobloting.

Assessment of viability and cell size. Cell viability was examined using an apoptosis

detection kit, following the manufacturer‟s protocol (R&D Systems). Briefly, cells were

stained with fluorescein isothiocyanate- conjugated Annexin V and propidium iodide at

room temperature for 15 min in the appropriate binding buffer, and subsequently

Interleukin-4 stimulates proliferation and growth of T-ALL cells

87

analyzed by flow cytometry (FACSCalibur; Becton- Dickinson). Cell size increase was

measured by flow cytometry. Percentage of „„activated‟‟ cells (with increased cell size)

was calculated by defining a threshold gate that excluded most of the bulk, small-sized

fraction of cultured cells.

Proliferation. Cells were cultured (2 x 106 cells/mL) in triplicates in RPMI-10, in flat-

bottom 96-well plates at 37°C with 5% CO2. Cultures were carried out for 72 h in the

following conditions: medium without IL-4 (control condition); with IL-4; with IL-4

plus Rapamycin; with IL-4 plus VP22/VP22 fused with p27Kip1

(8). Cells were

incubated with 3H -thymidine (1µCi/well) for 16 h prior to harvest. Proliferation was

determined by analysis of DNA synthesis, which was assessed by 3H-thymidine

incorporation using a β-scintillation counter.

Cell cycle analysis. Determination of the percentage of cells at each stage of the cell

cycle was performed by assessment of DNA content after staining with propidium

iodide. Briefly, 3-5 x 105 cells per sample were resuspended in 0.5 mL PBS and then

fixed with ice-cold 80% ethanol. Samples were then incubated for 30 min at 37°C in the

dark after addition of propidium iodide (2.5 mg/mL) and ribonuclease A (50 mg/mL).

Flow cytometry acquisition was performed in a FACScanto (Becton Dickinson

Biosciences) and analysis of cell cycle histograms was carried out using ModFit LT

(Verity) or WinCycle DNA Analysis software (Phoenix Flow Systems). In some

experiments, cell cycle profile was determined using BrdU incorporation. The cells

were incubated with 1mM BrdU for 24 h, harvested and ressuspended in PBS, and then

fixed and permeabilized with 1% paraformaldehyde and 0.01% Tween-20. After

permeabilization, the cells were treated with DNase to expose BrdU epitopes and

incubated with anti-BrdU-FITC antibody. Cells were then treated with RNase A

(500µg/mL) and propidium iodide was added to a final concentration of 200µg/mL.

Immunobloting, immunoprecipitation and in vitro kinase reaction. After the

indicated conditions and time intervals of culture, cell lysates were prepared as

described (8) and equal amounts of protein were analyzed by 10% SDS-PAGE,

transferred onto nitrocellulose membranes, and immunoblotted with the following

antibodies: CDK2, CDK4, CDK6, cyclin A, cyclin D2, cyclin E, ZAP70 (Santa-Cruz

Biotechnology), Phospho-4EBP1, Phospho-S6, Phospho-p70S6K

(Cell Signaling

Interleukin-4 stimulates proliferation and growth of T-ALL cells

88

Technology) and p27Kip1

(Becton Dickinson Transduction Laboratories). To examine

the phosphorylation status of Rb, proteins were analyzed by 6% SDS-PAGE, transferred

onto nitrocellulose membrane, and blotted with Rb-specific mAb (Becton Dickinson

Pharmingen). After immunobloting with primary antibodies, immunodetection was

performed using HRP-conjugated anti-mouse IgG (Promega), anti-rabbit IgG (Promega)

or anti-goat IgG (Santa-Cruz Biotecnology) as indicated by the host origin of the

primary antibody and developed by chemiluminescence (Thermo Scientific). In vitro

kinase reactions were performed as described previously (8).

Results and Discussion

IL-4 signaling promotes proliferation of T-ALL cells by inducing cell cycle

progression

We previously showed that IL-4 promotes in vitro proliferation of a significant

proportion of primary T-ALL samples (1). Here, we selected 12 diagnostic patient

samples that proliferated to IL-4 as assessed by 3H-thymidine incorporation, to

investigate the mechanisms of IL-4-driven T-ALL cell expansion. We first evaluated the

effect of IL-4 on cell cycle progression by analyzing the DNA content of primary T-

ALL cells by flow cytometry. IL-4 promoted the transition from G0/G1 to S-phase and

G2/M in all five samples analyzed (Figure 2.1A). IL-4 also induced cell size increase

(cell growth) that paralleled the effect on cell cycle (Figure 2.1B and Table 2.1).

As proliferation may result not only from an effect on cell cycle progression but

also from increased survival, we evaluated the effect of IL-4 on T-ALL cell viability. In

accordance with previous studies (9), we found that IL-4 had heterogeneous effects on

T-ALL cell survival. IL-4 prevented T-ALL in vitro apoptosis in 6 of 12 cases (50%),

promoted cell death in four (33%) and had no significant effects in two cases (17%;

Table 2.1). Nonetheless, IL-4-mediated proliferation occurred irrespectively of the

effect on cell survival, and cell cycle progression was observed both in patients where

IL-4 promoted viability and apoptosis (Table 2.1). These data suggest that IL-4

promotes proliferation of primary T-ALL cells mainly through regulation of the cell

cycle machinery.

Interleukin-4 stimulates proliferation and growth of T-ALL cells

89

Table 2.1. Immunophenotype, classification, and response to IL-4 of primary T-ALL specimens

T-cell maturation stages were defined as described by the European Group for the Immunological Characterization of Leukemias - EGIL.

Effects of IL-4 on viability: death, IL-4 promoted apoptosis; survival, IL-4 prevented spontaneous apoptosis; no effect, IL-4 did not

prevent or increase apoptosis. nd, not determined.

Interleukin-4 stimulates proliferation and growth of T-ALL cells

90

Interleukin-4 stimulates proliferation and growth of T-ALL cells

91

IL4 down-regulates p27kip1

and up-regulates cyclin expression, CDK

activity and Rb hyperphosphorylation

Next we evaluated the mechanisms by which IL-4 mediated cell cycle

progression in T-ALL cells. IL-4 did not affect the expression of cyclin-dependent

kinases CDK6, CDK4 and CDK2 (Figure 2.1C). In contrast, cyclins were up-regulated

by IL-4 in a sequential manner (Figure 2.1D). The early G1 molecule cyclin D2 peaked

around 12–24 h of culture with IL-4, whereas expression of cyclins E and A, which are

associated with late G1 and S-phase, reached a plateau at later time points (48 and 72 h).

These effects were paralleled by hyperphosphorylation of Rb, a critical substrate of

cyclin/CDK activity in the cell (Figure 2.1E), indicating that IL-4 induced cyclin/cdk

activity. To confirm these results, we performed in vitro kinase assays with CDK4 and

CDK2 immunoprecipitated from IL-4-stimulated primary T-ALL cells. IL-4 clearly

augmented CDK activity (Figure 2.1F). In addition, IL-4 induced the down-regulation

of the CDK inhibitor p27kip1

(Figure 2.1G). This event was mandatory for IL-4-

mediated cell cycle progression, because forced expression of p27kip1

completely

abrogated IL-4-mediated proliferation (Figure 2.1H).

Figure 2.1. IL-4 stimulates cell cycle progression of primary T-ALL cells. (A) Primary

T-ALL cells were cultured with or without 10 ng/mL IL-4 for the indicated time points. The

percentage of cells at each phase of the cell cycle was examined within the viable population

by propidium iodide staining. Left: results from one representative patient; right: results from

all patients analyzed (n=5), 0 vs 72 h of culture with IL-4, P=0.0159 (2-tailed Mann–

Whitney). Cells in medium alone did not show significant cell cycle progression (not

shown). (B) Cell size of T-ALL cells cultured with or without 10 ng/mL IL-4 for 48 h was

evaluated by flow cytometry analysis. Representative results from two of twelve patients

analyzed are shown. (C-E) T-ALL cells cultured with IL-4 during the indicated periods were

lysed and analyzed by immunoblot for the expression of CDK6, CDK4 and CDK22 (C),

cyclin D2, cyclin E and cyclin A (D), and phosphorylation of Rb (E). (F) T-ALL cells were

cultured with IL-4 for the indicated time points and in vitro kinase activity of

immunoprecipitated CDK4 and CDK2 was performed using Rb-GST and Histone H1 as

exogenous substrates, respectively. (G) Expression of p27kip1

was evaluated by immunoblot

at the indicated time points. (H) T-ALL cells were cultured with IL-4 alone or with

rapamycin, VP22 control protein or VP22/p27kip1

fusion protein. Proliferation was

determined at 72 h by 3H-thymidine incorporation.

Interleukin-4 stimulates proliferation and growth of T-ALL cells

92

Activation of mTOR pathway is mandatory for IL4-induced proliferation

As mTOR-dependent signaling has been associated with regulation of cell cycle

and size, we next evaluated whether IL-4 activated mTOR in the T-ALL cell line

TAIL7, whose biological features are similar to those from primary leukemia cells (7).

IL-4 induced phosphorylation of mTOR downstream targets p70S6K

, S6 and 4E-BP1 in

TAIL7 cells (Figure 2.2A). As expected, IL-4 mediated phosphorylation of these

molecules was inhibited by treatment with the mTOR-specific antagonist rapamycin

(Figure 2.2B). These data strongly indicate that IL-4 activates mTOR signaling in T-

ALL cells. To evaluate the functional consequences of IL-4-mediated mTOR activation,

we cultured T-ALL cells with IL-4 in the presence of rapamycin. At the molecular level,

inhibition of mTOR prevented IL-4-dependent p27kip1

down-regulation (Figure 2.2C).

Accordingly, rapamycin completely blocked IL-4-mediated proliferation (Figure 2.1H),

cell cycle progression (Figures 2.2D and E) and growth (Figures 2.2F and G) of both

TAIL7 and primary T-ALL cells.

In summary, we demonstrated that IL-4 mediates proliferation of T-ALL cells

through mTOR-dependent regulation of cell cycle progression. In showing that mTOR

is activated by a BM microenvironmental factor that positively stimulates leukemia T-

cells, our observations strengthen the emphasis on mTOR as a key molecular target in

T-ALL, and suggest that the inhibition of IL-4 signaling may also have therapeutic

potential in T-cell leukemia.

Interleukin-4 stimulates proliferation and growth of T-ALL cells

93

Figure 2.2. IL-4-mediated activation of mTOR pathway is critical for cell cycle

progression of T-ALL cells. (A) TAIL7 T-ALL cells were stimulated with 10 ng/mL IL-4

for the indicated time points, lysed and analyzed by immunoblot for phosphorylation of the

indicated mTOR downstream targets. (B and C) TAIL7 cells were cultured with 10 ng/mL

IL-4 in the presence or absence of rapamycin (rapa) and phosphorylation of the indicated

mTOR downstream target proteins (B) or expression of p27kip1

(c) was evaluated at 72 h.

TAIL7 (D and F) or primary (E and G) T-ALL cells were cultured in the presence of IL-4

with or without rapamycin and analyzed for cell cycle distribution (D and E) and cell

growth (F and G) at the indicated time points. (D and E) Percentage of cells in G0/G1

(lower left region), S-phase (upper region) and G2/M (lower right region) were identified

using propidium iodide and BrdU + anti-BrdU-FITC. (F and G) Cell growth was determined

by FSC vs SSC flow cytometry analysis. Percentage of large-sized (FSC high) cells was

estimated relative to the control, small-size bulk population. Results in this figure are

representative of at least two independent experiments.

Interleukin-4 stimulates proliferation and growth of T-ALL cells

94

References

1. Barata, J.T., T.D. Keenan, A. Silva, L.M. Nadler, V.A. Boussiotis, and A.A.

Cardoso. 2004. Common gamma chain-signaling cytokines promote

proliferation of T-cell acute lymphoblastic leukemia. Haematologica 89:1459-

1467.

2. Acacia de Sa Pinheiro, A., A. Morrot, S. Chakravarty, M. Overstreet, J.H.

Bream, P.M. Irusta, and F. Zavala. 2007. IL-4 induces a wide-spectrum

intracellular signaling cascade in CD8+ T cells. J Leukoc Biol 81:1102-1110.

3. Stephenson, L.M., D.S. Park, A.L. Mora, S. Goenka, and M. Boothby. 2005.

Sequence motifs in IL-4R alpha mediating cell-cycle progression of primary

lymphocytes. J Immunol 175:5178-5185.

4. Avellino, R., S. Romano, R. Parasole, R. Bisogni, A. Lamberti, V. Poggi, S.

Venuta, and M.F. Romano. 2005. Rapamycin stimulates apoptosis of childhood

acute lymphoblastic leukemia cells. Blood 106:1400-1406.

5. Brown, V.I., J. Fang, K. Alcorn, R. Barr, J.M. Kim, R. Wasserman, and S.A.

Grupp. 2003. Rapamycin is active against B-precursor leukemia in vitro and in

vivo, an effect that is modulated by IL-7-mediated signaling. Proc Natl Acad Sci

U S A 100:15113-15118.

6. Qiuping, Z., X. Jei, J. Youxin, J. Wei, L. Chun, W. Jin, W. Qun, L. Yan, H.

Chunsong, Y. Mingzhen, G. Qingping, Z. Kejian, S. Zhimin, L. Qun, L. Junyan,

and T. Jinquan. 2004. CC chemokine ligand 25 enhances resistance to apoptosis

in CD4+ T cells from patients with T-cell lineage acute and chronic lymphocytic

leukemia by means of livin activation. Cancer Res 64:7579-7587.

7. Barata, J.T., V.A. Boussiotis, J.A. Yunes, A.A. Ferrando, L.A. Moreau, J.P.

Veiga, S.E. Sallan, A.T. Look, L.M. Nadler, and A.A. Cardoso. 2004. IL-7-

dependent human leukemia T-cell line as a valuable tool for drug discovery in

T-ALL. Blood 103:1891-1900.

8. Barata, J.T., A.A. Cardoso, L.M. Nadler, and V.A. Boussiotis. 2001. Interleukin-

7 promotes survival and cell cycle progression of T-cell acute lymphoblastic

leukemia cells by down-regulating the cyclin-dependent kinase inhibitor

p27(kip1). Blood 98:1524-1531.

Interleukin-4 stimulates proliferation and growth of T-ALL cells

95

9. Karawajew, L., V. Ruppert, C. Wuchter, A. Kosser, M. Schrappe, B. Dorken,

and W.D. Ludwig. 2000. Inhibition of in vitro spontaneous apoptosis by IL-7

correlates with bcl-2 up-regulation, cortical/mature immunophenotype, and

better early cytoreduction of childhood T-cell acute lymphoblastic leukemia.

Blood.96:297-306.

TAL1 and LMO2 expression impair human T-cell development

96

Chapter 3

TAL1 and LMO2 ectopic expression in human T-cell

progenitors impacts T-cell development in vitro

Bruno A. Cardoso, Nádia Correia, Ana Gírio, Patricia Fuentes, María J. García, Miguel

Abecasis, Nuno Clode, Helena Ferreira, João Gonçalves, Maria L. Toribio and João T.

Barata

TAL1 and LMO2 expression impair human T-cell development

97

Abstract

The transcription factor TAL1 is critical in early hematopoiesis and is aberrantly

expressed in T-cell acute lymphoblastic leukemia (T-ALL). TAL1 was shown to have

leukemogenic potential, since transgenic mice develop aggressive leukemias of T-cell

phenotype. However, there are clear discrepancies between mice and humans regarding

the stage of maturation block in T-cell differentiation and the expression of putative

TAL1 downstream targets. Most importantly, it is still unknown whether this gene can

trigger leukemogenesis in humans. Here, we show that transduction of human

hematopoietic progenitors with TAL1 or its partner LMO2 affected human T-cell

differentiation in co-culture with stromal cells. Interestingly, the concomitant expression

of TAL1 and LMO2 led to the accumulation of a minor, discrete subpopulation of

CD3+CD4

+CD8

+ thymocytes with increased cell size that was absent from other

conditions. Furthermore, efficient transduction of human T-cell progenitors with TAL1

and LMO2 strongly abrogated T-cell differentiation, decreasing the expression of all T-

cell markers tested. These preliminary results show that the TAL1 and LMO2 can

disrupt normal human T-cell development. This may predispose thymocytes to

malignant transformation.

Introduction

Several oncogenic transcription factors have been shown to be over-expressed in

T-ALL due to chromosomal lesions and other as yet unknown mechanisms (1-3). One

of these transcription factors, TAL1, is crucial for early hematopoiesis, although it is

rapidly down-regulated upon T-cell lineage commitment. TAL1 ectopic expression

occurs in up to 65% of T-ALL patients, whereas overexpression of LMO genes (LMO1

or LMO2) occurs with lower frequency, commonly in association with TAL1 (4).

TAL1 was initially identified in a translocation that juxtaposes TCRA/D regulatory

sequences to the TAL1 coding region, t(1;14)(p32;q11), driving TAL1 abnormal

expression in developing T-cells (5, 6). However, the main reason for TAL1 ectopic

expression in T-ALL is the interstitial deletion of 90 Kb (TAL1d) which places TAL1

coding region under the control of SIL regulatory elements (7). The TAL1 gene encodes

a class II bHLH transcription factor that heterodimerizes (through the bHLH domain)

with class I proteins to bind the major groove of the DNA to a specific E- box

consensus sequence, CANNTG (8). The usual TAL1 interacting partners are the E

TAL1 and LMO2 expression impair human T-cell development

98

proteins E2A and HEB (9, 10). These proteins regulate T-cell development and act as

tumor suppressors in T-cells (11, 12). Importantly, TAL1 transgenic mice develop fatal

T-cell leukemia, although with a long latency period (13-15), and inhibition of E2A

function by TAL1 was shown to be responsible for the development of T-cell leukemia

in one of the TAL1 transgenic mouse models (15).

LMO2 is also a transcription factor, although there is no evidence of its binding to

DNA. Instead, LMO2 acts as a bridging molecule, establishing important protein-

protein interactions with TAL1, E2A, GATA and LDB1 through its cystein-rich LIM

domains that are zinc binding motifs (16-18). Similar to TAL1, LMO2 is expressed in

T-ALL patients due to abnormal chromosomal rearrangements t(11;14)(p13;q11)] (19)

and del(11)(p12p13) (20), and other unknown reasons (21). LMO2 transgenic mice were

shown to develop T-cell leukemia with shorter latency periods than TAL1 transgenic

mice (22-24). Interestingly, TAL1 and LMO2 expression appears to be synergistic, since

double transgenic mice develop leukemia with shorter latency periods (22). Transgenic

mice for the LMO2 closely related gene LMO1 also develop leukemia and synergize

with the TAL1 gene (22, 25-27). The development of leukemia in these mouse models

appears to be preceded by an impairment in T-cell development, with a decrease in the

double positive population CD4+CD8

+ (13, 22, 26) and an increase in the double

negative (DN) population (CD4-CD8

-). Additionally, TAL1 and LMO1 expression was

reported not only to inhibit T-cell differentiation but to promote the expansion of a

population of DN thymocytes (27).

The evidence for the T-cell oncogenic potential of LMO2 stems not only from

mouse studies but also from unfortunate events in gene therapy trials for human SCID,

in which several patients developed T-cell leukemia-like disease. It was subsequently

observed that, during the retroviral delivery of the γ common chain (IL2RG) gene into

hematopoietic stem cells, the vector integrated near the LMO2 locus, and the strong

promoter in Long Terminal Repeat (LTR) drove LMO2 aberrant expression in the T-

cell precursor population in some of the patients (28-32). In contrast, the tumorigenic

potential of TAL1 has never been formally demonstrated in human cells. Moreover, one

TAL1 transgenic mouse model indicated that TAL1 may be incapable of triggering

leukemia per se (33). In addition, there are significant differences between mice and

humans regarding TAL1 involvement in T-ALL. For instance, T-ALL patients with

TAL1 ectopic expression typically display a phenotype of late cortical thymocytes

(CD4+CD8

+) (4), whereas in TAL1 transgenic mice T-cell development is inhibited at

TAL1 and LMO2 expression impair human T-cell development

99

early stages, when thymocytes lack the expression of CD4 and CD8 (14, 15). Moreover,

TAL1-positive patients show up-regulation of genes that are important for T-cell

development (LCK, TCRA, TCRB, CD2, CD6) (4), whereas in TAL1 transgenic mice the

T-cell differentiation gene expression program appears to be inhibited (15). These

discrepancies raise the possibility that the involmente of TAL1 in human T-ALL may

not be accurately reflected in mouse studies. Further, they raise the question of whether

TAL1 is actually a leukemogenic trigger in human T-ALL or merely a late contributor

to the process in already transformed cells.

To try and answer this question, we forced the expression of TAL1 and/or LMO2

in human hematopoietic stem cells and early thymic progenitors and analyzed their

impact on T-cell development in vitro. Our preliminary data suggest that, in the least,

both TAL1 and LMO2 can significantly deregulate human T-cell differenciation.

Materials and Methods

Cloning procedures. The MAT vectors described in this study were derived from the

#318.pRRE.sin.cPPT.pA.cte.Luci.mCMV.hPGK.GFP.Wpre (#318) vector (34), kindly

provided by Prof. Luigi Naldini. The TAL1 and LMO2 genes were amplified by PCR

from the pcDNA3.1(+) zeo TAL1 and pcDNA3.1 (+) LMO2-HA plasmids respectively,

using primers that span the CMV promoter and the poly-A site in pcDNA3.1 (+) zeo

plasmid (Table 3.1).

These two fragments replaced the luciferase gene in the #318 vector (using the EcoRV

and XbaI restriction enzymes). The IRES sequence from the pMigR1 vector was

amplified by PCR with a forward primer containing AgeI, MluI and NdeI restriction

Designation 5' to 3'

TATA+12 ATCAAGCTTCTCGAGGGTAGGCGTGTACGGTGG

XbaI GATGGCTGGCAACTAGAAGG

AgeI-MluI-NdeI-IRES ATACCGGTACGCGTCATATGAATTCCGCCCCTCTC

IRES-AgeI CGATACCGGTGGTTGTGGCCATATTATC

MluI-5‟ TAL1 ATACGCGTCCCAGGATGACCGAGCGG

NdeI-3‟ TAL1 TCATATGCATTCACCGAGGGCCGGCTCCATC

MluI-5‟ LMO2 ATACGCGTAGGATGTCCTCGGCCATCGAAAGG

NdeI-3‟ LMO2 ATCATATGCGGTCAAGAAGCGTAGTCCGGAACGTCGTACGGGTA

Table 3.1. List of primers used in the cloning of the MAT plasmids

TAL1 and LMO2 expression impair human T-cell development

100

sites upstream of the IRES sequence and a reverse primer containing the AgeI site. This

fragment was cloned upstream to the Green Fluorescent Protein (GFP) AgeI restriction

site. Finally, TAL1 and LMO2 were amplified by PCR from the respective plasmids

with primers containing the MluI and NdeI restriction sites and cloned upstream of the

IRES sequence. The pHR-SIN vectors were described previously (35) and were kindly

provided by Prof. Maria Toribio. We cloned TAL1 and LMO2 in the pSIN-BX-IR/EMW

vector (also provided by Prof. Maria Toribio) in the BamHI and XhoI restriction sites

upstream of the IRES-Emerald sequence. Next we removed the TAL1-IRES-Emerald

and LMO2-IRES-Emerald fragments from the pSIN-BX-IR/EMW vector and replaced

the GFP on the pHR-SIN-CSGW vector.

Production of VSVG-pseudotyped lentiviruses. Vesicular-Stomatitis-Virus-

pseudotyped third-generation lentiviruses were produced by transient four-plasmid

cotransfection into 293T cells. Briefly, a total of 2 x 106 293T cells were seeded in 10

cm-diameter dishes 24 h prior to transfection in 10 mL DMEM (Gibco) with 10% fetal

bovine serum, penicillin (100 IU/mL), and streptomycin (100mg/mL) in a 5% CO2

incubator. 25µM Chloroquine (Sigma) was added to the culture medium 1 h prior to

transfection. A total of 11.6 µg of plasmid DNA was used for the transfection of one

dish: 2 µg of the envelope plasmid pMD2.VSVG, 1.4µg of helper plasmid pRSV-REV

plasmid, 3,1 µg of packaging plasmid pMDLg and 5.1 µg of transfer vector plasmid

where TAL1 and LMO2 were cloned. The precipitate was formed by adding the

plasmids to a final volume of 450 µl of sterile water and 50 µl of 2.5 M CaCl2, mixing

well, then adding dropwise to 500 µl of 2x HBSP buffer (280 mM NaCl, 10mM KCl,

50 mM HEPES, 1.6 mM Na2HPO4, 10mM D(+) Glucose [pH 7.05]) while vortexing

and immediately adding the precipitate to the cultures. The medium (10 mL) was

replaced after 14 to 16 h with medium containing 20mM HEPES (pH=7.9) and 10mM

Sodium Butyrate (6 mL), which was then replaced again after 8 h to 10 h by fresh

medium (6 mL). The conditioned medium (Lentiviral Supernatants) was collected after

another 24 h, filtered through 0.45 mm pore-size cellulose acetate filters, concentrated

using Amicon Columns (Millipore) and then stored at -80°C until use.

Cell lines. The OP9-Dll1 cells were kindly provided by Prof. Zuñiga-Pflücker (36),

maintained in MEM medium supplemented with 20% fetal bovine serum (MEM-20).

TAL1 and LMO2 expression impair human T-cell development

101

293T cells were maintained in DMEM medium supplemented with 10% fetal bovine

serum (DMEM-10).

Transduction of 293T cells. 100 x 103 293T cells were seeded with 2 mL of DMEM-

10 per well in 6-well plates. In the following day, the medium was removed and a 1:1

dilution of lentiviral supernatant in DMEM-10 was added. 72 h post-transduction, the

cells were washed and sorted for high expression of GFP. Sorted 293T cells were

expanded and lysed for protein extracts when indicated.

Isolation and transduction of hematopoietic and thymic progenitors. Institutional

review board approval was obtained for umbilical cord-blood and thymic sample

collections from Comissão de Ética, Faculdade de Medicina da Universidade de Lisboa

(Lisbon, Portugal) and Comissão de Ética of Centro Hospitalar de Lisboa Ocidental

(Carnaxide, Portugal), respectively. Umbilical cord blood (UCB) was collected in sterile

heparinized bags and mononuclear cells were isolated by density gradient centrifugation

(Lympholyte, Cedarlane). CD34+ cells were isolated using the CD34 Microbead kit

(Miltenyi Biotec) and separated in MidiMACS separation columns (Miltenyi Biotec)

according to the manufacturer‟s instructions. The CD34+ cells were further sorted for

CD34+CD38

- cells. Normal thymocytes were isolated from thymic tissue obtained from

children undergoing cardiac surgery. The tissue was gently minced in medium, the

resulting cell suspension was filtered through a cell strainer, and thymocytes were

enriched by density centrifugation to greater than 95% purity. The thymocytes were

enriched in CD34high

using the Human Cord Blood CD34 pre-enrichment cocktail (Stem

Cell Technologies) and depleted of CD1a cells with MidiMACS (Miltenyi biotec).

Purified precursors were transduced in retronectin (Takara) coated plates. Briefly, 105

cells were incubated in 500µl IMDM with 1% BSA plus 10ng/mL of SCF and FLT3L

in a retronectin-coated well (5µg/well) of a 24-well plate with 500µl of the respective

concentrated lentiviral supernatant. The cells were incubated overnight at 37ºC, and in

the next day, more lentiviral supernatant was added.

OP9-Dll1 co-cultures. Co-cultures of OP9-Dll1 stromal cells with hematopoietic cells

were performed as described (37). Briefly, 105 transduced thymic-derived CD34

+CD1a

-

or umbilical-cord blood derived CD34+CD38

- cells were added to a sub-confluent layer

of OP9-Dll1 cells. The co-cultures were maintained in MEM-20 medium supplemented

TAL1 and LMO2 expression impair human T-cell development

102

with 10ng/mL of IL-7 and FLT3L and the medium replaced every two days. At the

indicated time points the cells were harvested, counted (when indicated) and analyzed

by flow cytometry.

Flow Cytometry. Standard procedures were used to stain the cells with fluorochrome-

conjugated antibodies. The antibodies used in this study were CD34-PerCP-Cy5.5 and

TCRαβ-PE (Becton-Dickinson), CD1a-PE, CD3-PerCP-Cy5.5, CD4-PE-Cy7, CD7-PE,

CD8-APC, CD19-PerCP-Cy5.5 and CD38-PE (ebioscience). Samples were acquired in

a FACScalibur (Becton-Dickinson) or FACScanto (Becton-Dickinson) and analyzed

using Flow Jo.

Immunobloting. Transduced or transfected 293T cell lysates were lised as described

(38) and equal amounts of protein were resolved by 12% SDS-PAGE, transferred onto

nitrocellulose membranes, and immunoblotted with the following antibodies or antisera:

HA (Santa-Cruz Biotechnology), Actin (Santa-Cruz Biotechnology), TAL1 (Millipore)

and GFP (Roche). After immunobloting with primary antibodies, immunodetection was

performed using HRP-conjugated anti-mouse IgG (Promega), anti-rabbit IgG (Promega)

or anti-goat IgG (Santa-Cruz Biotecnology), as indicated by the host origin of the

primary antibody, and developed by chemiluminescence (Thermo Scientific).

RNA extraction, RT-PCR and semi-quantitative-PCR. When indicated, RNA was

extracted using High Pure RNA Isolation Kit (Roche) according to the manufacturer‟s

instructions. For the RT-PCR, a total of 65ng of total RNA was reverse transcribed

using SuperScript II (Invitrogen) and random hexamers. Primers used in the semi-

quantitative PCR are described in Table 3.2. The PCR reactions were performed in

50µl, using 3 µl cDNA, 2U of Gotaq DNA polymerase (Promega) and 200nM of each

primer, according to manufacturer‟s instructions. All the amplifications were performed

in a 96-well MyCycler (Bio-Rad). After the initial denaturation of 5 min at 95ºC, PCR

products were amplified by 40 cycles of 30 seg at 95ºC, 1 min at 60ºC and 1 min at

72ºC. 15µl aliquots were removed at cycles 20, 30 and 40. The PCR products were

separated in a 2% agarose gel and visualized under UV light.

TAL1 and LMO2 expression impair human T-cell development

103

Gene Forward primer 5' to 3' Reverse primer 5' to 3'

TAL1 AACAATCGAGTGAAGAGGAG CTTTGGTGTGGGGACCAT

LMO2 TCAGAGGAACCAGTGGATGAG CCGGCCCAGTTTGTAGTAGA

IRES ATACCGGTACGCGTCATATGAATTCCGCCCCTCTC CGATACCGGTGGTTGTGGCCATATTATC

GAPDH GGAGTCAACGGATTTGGTCG GACAAGCTTCCCGTTCTCAG

Results

Establishment of a system to simultaneously transduce target cells with

three genes

In order to simultaneously and stably express the TAL1 gene together with LMO2

and a reporter gene into human Hematopoietic stem cells (HSCs) or early T-cell

progenitors (ETPs) we used a third generation lentiviral vector developed in Naldini‟s

Lab (34), which displays an internal bi-directional promoter that allows the cloning and

efficient expression of two genes in opposite directions. Engineering this vector to

become bi-cistronic in one of its directions, we were able to express both TAL1 and

LMO2 genes, as well as eGFP (enhanced Green Fluorescent Protein), in the same target

cell.

The schematic representation of the five different constructs we generated is

described in Figure 3.1A. The empty vector (MAT-IRES-eGFP) consists of an IRES-

eGFP cassette cloned downstream of the human Phosphoglycerate kinase promoter

(hPGK) and WPRE, which is a post-transcriptional regulatory element from the

woodchuck hepatitis virus. This expression cassette is flanked by the 5‟ and 3‟ LTR.

The TAL1 and LMO2 genes were cloned upstream of the IRES-eGFP cassette. To create

the plasmids minCMV-TAL1/LMO2-MAT-TAL1/LMO2-IRES-eGFP, TAL1 and

LMO2 were cloned downstream of the minimal (TATA box and +1 nucleotide)

Cytomegalovirus (CMV) promoter, and inserted in the opposite direction to the hPGK.

All the constructs were confirmed by sequencing.

These constructs (Figure 3.1A) were then used to produce VSVG-pseudotyped

lentiviruses to transduce 293T fibroblasts. After transduction, we sorted the GFP

positive 293T cells and expanded them in culture.

Table 3.2. List of primers used in semi-quantitative-PCR

TAL1 and LMO2 expression impair human T-cell development

104

Figure 3.1. Transduction of MAT vectors into 293T and CD34+ CD38

- cord blood

cells. (A) Schematic representation of the MAT transfer plasmids. MAT viruses were

produced in 293T cells using four different plasmids: the transfer vector (shown in the

figure), and the packaging vector, the REV expressing vector and the envelop protein

vector Vesicular Stomatitis Virus G Glycoprotein (not shown). (B) 293T cells (not used to

produce the viruses) were transduced with the indicated MAT vectors and 72 h post-

transduction the GFP-positive cells were sorted and expanded for 5 days. GFP expression

of sorted cells was analyzed by flow cytometry and confirmed to be higher than 50% in all

cases. Cells were then lysed and TAL1, LMO2 and GFP expression were analyzed by

immunoblot. Actin was used as loading control. (C) Umbilical cord blood-derived

CD34+CD38

- cells were transduced with the indicated MAT vectors and 48 h post-

transduction the expression of TAL1, LMO2 and IRES was analyzed. GAPDH was used as

loading control.

TAL1 and LMO2 expression impair human T-cell development

105

As shown in Figure 3.1B, we detected LMO2 protein (tagged with HA) in the

lanes 4, 5 and 6 that contain the conditions where 293T cells were transduced with

MAT-LMO2-IRES-eGFP, mTAL1-MAT-LMO2-IRES-eGFP and mLMO2-MAT-

TAL1-IRES-eGFP, respectively. The level of expression in lane 6 is lower than the

previous ones, due to the fact that the LMO2 gene was cloned downstream of the

minCMV promoter that is less efficient than hPGK (34). TAL1 was detected in lanes 3,

5 and 6 that contain the conditions where 293T cells were transduced with MAT-TAL1-

IRES-eGFP, mTAL1-MAT-LMO2-IRES-eGFP and mLMO2-MAT-TAL1-IRES-eGFP,

respectively. The expression was lower in lane 5 for the same reason as for LMO2. As

expected, we detected GFP in all lanes containing transduced cells. These results show

that we were able to successfully clone three genes in the same vector and to detect the

proteins encoded by these genes.

Detection of TAL1 and LMO2 in cord-blood CD34+CD38

- cells

Human hematopoietic stem cells are essentially quiescent, and lentiviral vectors

are considered the most efficient means to deliver genes into these cells (42). We

transduced isolated umbilical cord blood CD34+CD38

- cells, enriched in hematopoetic

stem (HSC) and progenitor cells, with the constructs described in Figure 3.1A. In order

to detect TAL1 and LMO2 gene expression in transduced cells, we extracted the RNA

and performed semi-quantitative PCR. As expected, TAL1 and LMO2 RNA expression

was detected in cells that were not transduced or transduced with the empty vector

(Figure 3.1C). This is in agreement with the know expression and essential function of

TAL1 and LMO2 in hematopoietic stem cells (39, 40). Nonetheless, the basal levels of

TAL1 and LMO2 were clearly upregulated upon transduction with the respective vectors

(Figure 3.1C). High TAL1 expression was detected in cells transduced with MAT-

TAL1-IRES-eGFP, mTAL1-MAT-LMO2-IRES-eGFP and mLMO2-MAT-TAL1.

Similar results were obtained in cells transduced with MAT-LMO2-IRES-eGFP,

mTAL1-MAT-LMO2-IRES-eGFP and mLMO2-MAT-TAL1-IRES-eGFP, which

increased the levels of LMO2 gene expression. To confirm that the cells have been in

fact transduced, and the levels of TAL1 and LMO2 expression were not due to

differential culture conditions, we also measured the expression levels of the IRES

cassette that the vector harbors internally (Figure 3.1C). These results show that we

TAL1 and LMO2 expression impair human T-cell development

106

were able to transduce umbilical cord-blood hematopoietic CD34+CD38

- cells using

bidirectional vectors cloned with both TAL1 and LMO2 genes.

Forced TAL1 and LMO2 expression in CD34+CD38

- cells affect human T-

cell differentiation in vitro

In transgenic mouse models, the role for TAL1 and LMO2 in T-cell leukemia is

well established and associates with an arrest in T-cell development (13-15, 22-25). In

order to investigate whether TAL1 could have an actual role in the development of

human T-cell leukemia, we started by analyzing the function of this gene in co-culture

systems that allow the differentiation of human T-cells. Since TAL1 is often co-express

with LMO2 in T-ALL (4), we also analyzed the possible synergistic effect between

these two genes.

Mouse hematopoietic progenitor cells can differentiate into mature and functional

T-cells after 17 days in culture with a stromal layer of OP9-Dll1 cells (36).

Furthermore, the same co-culture system was used to differentiate human hematopoietic

stem cells into functional T-cells (37). We transduced CD34+CD38

- isolated from

umbilical cord-blood with the vectors described in Figure 3.1A and co-cultured these

cells with OP9-Dll1 cells for 3 weeks. Forced TAL1 expression per se did not affect

cell size. However, when TAL1 was expressed under a strong promoter it clearly

synergized with LMO2 (Figure 3.2A).

T-cell development was also affected by the expression of TAL1 and LMO2. CD7

expression decreased in all conditions when compared to empty transduced cells (Figure

3.2B). Furthermore, there was a tendency for a minor percent increase in CD34+ CD7-

stem/progenitor cells (Figure 3.2B). The co-culture system allowed the development of

a small amount of CD4+CD8

+ T-cells in the control condition (Figure 3.2C) that express

CD3 (Figure 3.2D). The proportion of this population decreased when cells were

transduced with TAL1 or LMO2 (Figure 3.2C), and also in the condition where TAL1 is

less expressed than LMO2 (mTAL1-MAT-LMO2-IRES-eGFP), in agreement with an

earlier developmental block. However, when TAL1 expression is higher than LMO2

(mLMO2-MAT-TAL1-IRES-eGFP), cells differentiated into a distinct population of

CD4+CD8

+ (Figure 3.2C) with high levels of CD3 (Figure 3.2D). Notably, our results

are in agreement with reports indicating that TAL1-expressing T-ALL patients are

associated with a CD3+ CD4

+ CD8

+ phenotype (4).

TAL1 and LMO2 expression impair human T-cell development

107

These results indicate that this co-culture system is a valid model for further

dissection of the mechanisms behind TAL1/LMO2-induced human leukemogenesis.

Figure 3.2. Coordinated expression of TAL1 and LMO2 in human hematopoietic

progenitors promotes cell growth and leads to the differentiation of CD3+CD4

+CD8

+

cells. (A-D) Umbilical cord blood-derived CD34+CD38

- were transduced with the indicated

MAT vectors. At 48 h post-transduction, the cells were co-cultured with OP9-Dll1 cells.

After 3 weeks of co-culture (A) cell size (as determined by FSC/SSC distribution), and

expression of (B) CD34 and CD7, (C) CD4 and CD8, and (D) CD3 within the CD4+CD8

+

population were analyzed by flow cytometry.

TAL1 and LMO2 expression impair human T-cell development

108

Taken together, the preliminary results obtained with this co-culture system

indicate that TAL1 and LMO2 ectopic expression can disrupt normal human T-cell

development.

High TAL1 and LMO2 expression in human thymic progenitors increases

cell proliferation and has a striking effect on T-cell differentiation

The vectors described in Figure 3.1 offer a simple strategy to analyze the possible

synergistic impact of TAL1 and LMO2 gene expression in human hematopoietic

progenitors. In fact, transduction of hematopoietic progenitor cells with these genes

partially disrupted in vitro T-cell development. However, the efficiency of transduction

was very low (data not shown), which could result in an underestimation of the effects

of these two genes. To address this question, we cloned TAL1 and LMO2 into a new

lentiviral vector (pHR-SIN). We detected both TAL1 (middle lane) and LMO2 (right

lane) in transfected 293T cells (Figure 3.3A). However, using this cloning strategy, we

could not transduce the hematopoietic stem cells with a single vector carrying both

genes. Instead, we transduced the cells with both vectors (pHR-SIN-TAL1 and pHR-

SIN-LMO2).

To allow for a more direct assessment of the effect of TAL1 and LMO2 in human

T-cell development, we next isolated CD34+CD1a

- thymic progenitor cells (instead of

cord-blood HSCs), transduced them with the pHR-SIN lentiviral vectors and co-

cultured these cells with OP9-Dll1 cells. The efficiency of transduction of these cells

was high, allowing the distinction between GFP positive and negative cells (data not

shown). As shown in Figure 3.3B, cells proliferated in a time-dependent manner.

Forced expression of LMO2 induced strong proliferation of thymic progenitors after day

17 (Figure 3.3B), in contrast to cells transduced with the empty vector and with TAL1.

In fact, TAL1 expression in these thymic progenitors did not increase the cell number

relative to the empty vector transduced cells. TAL1 and LMO2 co-expression in these

progenitors had a slight increase relative to empty transduced cells but only at the later

days of co-culture (Figure 3.3B).

Ectopic expression of both TAL1 and LMO2 decreased the expression of the CD3

marker (Figure 3.3C) in both days analyzed, when compared to empty transduced cells.

LMO2 expression had higher impact on CD3 expression than TAL1, and the

transduction with both genes did not seem to have a synergistic effect.

TAL1 and LMO2 expression impair human T-cell development

109

Moreover, TAL1 and LMO2 expression also decreased the percentage of double-

positive cells (CD4+CD8

+) at day 17 and to a minor extent at day 26 (Figure 3.3D). This

Figure 3.3. High TAL1 and LMO2 expression in human T-cell progenitors disrupts

normal T-cell development. (A) 293T cells were transfected with the indicated pHR-SIN

vectors and 48 h post-transfection the cells were lysed. TAL1, LMO2 and GFP expression

were analyzed by immunoblot. (B-E) Thymic-derived CD34+CD1a

- progenitors were

transduced with the respective pHR-SIN vectors for 48 h and then co-cultured in a stromal

layer of OP9-Dll1 cells for 26 days. (B) At the indicated time points, viable cells were counted

by trypan-blue exclusion and GFP expression was analyzed by flow cytometry. The bars

indicate the number of cells, normalized to the expression of GFP in the respective time point.

(C-D) At day 17 and 26 of co-culture, expression levels of (C) CD3 and (D) CD4/CD8 were

analyzed by flow cytometry. (E) The emergence of TCRαβ/CD3-expressing cells was analyzed

by flow cytometry at day 26.

TAL1 and LMO2 expression impair human T-cell development

110

effect appears to be associated with an earlier block at the double negative stage and not

to increased differentiation into CD4 or CD8 single-positive cells, as shown by

concomitant analysis of CD3 and TCR expression. A small percentage of cells

differentiated into CD3+TCRαβ

+ T-cells. This differentiation was strongly inhibited by

the expression of either TAL1 or LMO2 genes (Figure 3.3E). Notably, when cells were

transduced with both genes the differentiation of CD3+TCRαβ

+ T-cells was inhibited in

a synergistic fashion.

The results presented here clearly show that TAL1 and LMO2 genes have a

profound impact in human T-cell differentiation, and this is in agreement with the data

collected from TAL1 and LMO2 transgenic mice.

Discussion

TAL1 and LMO2 are fundamental for normal hematopoietic development (41, 42),

and are down-regulated upon T-cell differentiation (39, 40). These genes have been

associated with T-ALL, since they are over-expressed in a high percentage of T-ALL

patients (4). Moreover, TAL1 and LMO2 transgenic mice develop fatal and aggressive

T-cell leukemias (13, 22, 43). In contrast to LMO2 (28, 39), and despite being

commonly associated with human T-ALL, a clear causal role in the origin of the disease

has not been established for the TAL1 gene.

T-ALL is characterized by an accumulation of T-cells arrested at different stages

of development (44), and one of the first steps in malignant transformation may be the

arrest in T-cell differentiation. In fact, in TAL1 and LMO2 transgenic mice pre-

leukemic thymocytes are arrested at the double negative stage (CD4-CD8

-) (13, 22, 43).

Here we show that, TAL1 and LMO2 ectopic expression in hematopoietic progenitors

and early T-cell progenitors has a clear impact in normal T-cell differentiation (Figure

3.2-3.3).

To test whether the ectopic expression of these genes could impact human T-cell

differentitiation we used the OP9-Dll1 co-culture system. As described previously (37),

this co-culture system allows the differentiation of mature and functional human T-cells

in 52 days. We transduced umbilical cord-blood CD34+CD38

- cells and cultured them

in an OP9-Dll1 stromal layer. The transduction of both genes had a moderate effect in

T-cell differentiation and cellular activation, but the coordinated expression of both

genes (mLMO2-MAT-TAL1-IRES-eGFP) allowed the differentiation of a population

TAL1 and LMO2 expression impair human T-cell development

111

with a clear CD3+CD4

+CD8

+ phenotype and with a striking increase in cell size (Figure

3.2). This effect on cell size may have resulted from differences in differentiation

(different T-cell precursor subpopulations can have different sizes), increased

proliferation (dividing cells augment their size before division) and/or a process of

transformation (T-ALL blasts are bigger than normal thymocytes). Apart the

considerations on cell growth, these results are in agreement with previous reports

indicating that T-ALL patients with aberrant TAL1 expression are associated with a late

cortical phenotype (CD3+CD4

+CD8

+) (4). It is interesting to observe that TAL1 and

LMO2 expression per se in hematopoietic progenitors only slightly impaired normal T-

cell development (Figure 3.2). However, when both genes were co-expressed (where

TAL1 is expressed at higher levels in the mLMO2-MAT-TAL1-IRES-eGFP construct),

the blockade in T-cell development was higher (Figure 3.2). These results suggest that

TAL1 ectopic expression is able to reduce T-cell differentiation, but it likely requires

further events leading to malignant transformation, namely LMO2 expression. The

requirement for a second event was also observed in TAL1 transgenic mouse models

(13, 15). TAL1 transgenic mice develop leukemia with long latency periods, but when

combined with another pro-leukemogenic event, such as CK2 (13), LMO1 or LMO2

(22, 26) expression and heterozigoty of E2A/HEB genes (15), the latency period is

reduced. Surprisingly, LMO2 expression per se did not have a great impact in T-cell

development (Figure 3.2), not even when combined with low TAL1 expression

(mTAL1-MAT-LMO2-IRES-eGFP). This is in contrast with reports in transgenic mice

where LMO2 expression completely abrogates normal T-cell differentiation that

precedes the development of leukemia (22, 24, 43).

The initial lentiviral system that we used, allowed the coordinated expression of

both TAL1 and LMO2 genes in the same target cell, but with low efficiency of

transduction. This fact could explain why we observed moderate effects upon

transduction of hematopoietic progenitor cells with the TAL1 and LMO2 genes. To

circumvent this technical problem, we cloned both genes into pHR-SIN based lentiviral

vectors that are more efficient in the transduction of hematopoietic stem cells. The

transduction of thymic T-cell progenitors with the TAL1 and LMO2 genes cloned in

pHR-SIN based-vectors severely impaired T-cell differentiation, decresing the

expression of all the T-cell markers tested (Figure 3.3). Interestingly, in contrast with

the results generated using the other lentiviral system (Figure 3.2), ectopic expression of

LMO2 had a higher impact in T-cell differentiation than TAL1 (Figure 3.3), in

TAL1 and LMO2 expression impair human T-cell development

112

agreement with data collect from transgenic mouse models (22). Our results with this

lentiviral system did not show a synergistic impact of TAL1 and LMO2 expression in T-

cell differentiation. This could be due to a technical limitation of the system, since we

transduced the genes in separate vectors using the same reporter gene. Thus, we could

not assess whether the same cell is transduced simultaneous with TAL1 and LMO2. In

these conditions the GFP-positive population likely consists in a mixture of cells that

express either TAL1 or LMO2 and a fraction that expresses both genes.

Several reports (22, 25-27, 40) indicate that TAL1 cooperates with LMO proteins

(LMO1 and LMO2) to induce leukemia in transgenic mice. In these models, leukemia

development is preceded by an arrest in T-cell differentiation due to the accumulation of

immature CD4-CD8

- cells in the thymus. The reason for this accumulation could be due

to increased apoptosis of CD4+CD8

+ cells (26), but the inability of CD4

-CD8

- cells to

differentiate has also been suggested (40). Recently, it was observed that CD4-CD8

-

immature cells increase proliferation upon expression of TAL1 and LMO1 genes (27). In

our co-culture experiment, LMO2 expression increased cell counts by 15 fold relative to

empty transduced cells (Figure 3.3), which could also reflect increased proliferation of

immature T-cells.

Despite the heterogeneity between the two experimental settings reported here

(which could be due not only to the different vectors used and their specific limitations,

but also to the fact that we transduced different populations in each case), our results

provide the first indication that TAL1 ectopic expression can impair human T-cell

development. The deregulation of normal T-cell development seems to precede the

development of leukemogenesis in TAL1 and LMO2 transgenic mice. Our preliminary

data reported here, supports the notion that TAL1 and also LMO2 ectopic expression

can be leukemogenic triggers in human T-ALL. The analysis of how TAL1 and LMO2

deregulate normal T-cell development may be a critical step in understanding the

leukemogenic signatures of these genes in T-ALL.

References

1. Look, A.T. 1997. Oncogenic transcription factors in the human acute leukemias.

Science 278:1059-1064.

2. De Keersmaecker, K., P. Marynen, and J. Coolsi. 2005. Genetic insights in the

pathogenesis of T-cell acute lymphoblastic leukemia. Haematologica 90:1116-1127.

TAL1 and LMO2 expression impair human T-cell development

113

3. Graux, C., J. Cools, L. Michaux, P. Vandenberghe, and A. Hagemeijer. 2006.

Cytogenetics and molecular genetics of T-cell acute lymphoblastic leukemia: from

thymocyte to lymphoblast. Leukemia 20:1496-1510.

4. Ferrando, A.A., D.S. Neuberg, J. Staunton, M.L. Loh, C. Huard, S.C. Raimondi, F.G.

Behm, C.H. Pui, J.R. Downing, D.G. Gilliland, E.S. Lander, T.R. Golub, and A.T.

Look. 2002. Gene expression signatures define novel oncogenic pathways in T cell

acute lymphoblastic leukemia. Cancer Cell 1:75-87.

5. Chen, Q., J.T. Cheng, L.H. Tasi, N. Schneider, G. Buchanan, A. Carroll, W. Crist, B.

Ozanne, M.J. Siciliano, and R. Baer. 1990. The tal gene undergoes chromosome

translocation in T cell leukemia and potentially encodes a helix-loop-helix protein.

Embo J 9:415-424.

6. Begley, C.G., P.D. Aplan, M.P. Davey, K. Nakahara, K. Tchorz, J. Kurtzberg, M.S.

Hershfield, B.F. Haynes, D.I. Cohen, T.A. Waldmann, and et al. 1989. Chromosomal

translocation in a human leukemic stem-cell line disrupts the T-cell antigen receptor

delta-chain diversity region and results in a previously unreported fusion transcript.

Proc Natl Acad Sci U S A 86:2031-2035.

7. Aplan, P.D., D.P. Lombardi, A.M. Ginsberg, J. Cossman, V.L. Bertness, and I.R.

Kirsch. 1990. Disruption of the human SCL locus by "illegitimate" V-(D)-J

recombinase activity. Science 250:1426-1429.

8. Hsu, H.L., L. Huang, J.T. Tsan, W. Funk, W.E. Wright, J.S. Hu, R.E. Kingston, and R.

Baer. 1994. Preferred sequences for DNA recognition by the TAL1 helix-loop-helix

proteins. Mol Cell Biol 14:1256-1265.

9. Bernard, M., E. Delabesse, L. Smit, C. Millien, I.R. Kirsch, J.L. Strominger, and E.A.

Macintyre. 1998. Helix-loop-helix (E2-5, HEB, TAL1 and Id1) protein interaction with

the TCRalphadelta enhancers. Int Immunol 10:1539-1549.

10. Hsu, H.L., I. Wadman, and R. Baer. 1994. Formation of in vivo complexes between the

TAL1 and E2A polypeptides of leukemic T cells. Proc Natl Acad Sci U S A 91:3181-

3185.

11. Bain, G., I. Engel, E.C. Robanus Maandag, H.P. te Riele, J.R. Voland, L.L. Sharp, J.

Chun, B. Huey, D. Pinkel, and C. Murre. 1997. E2A deficiency leads to abnormalities

in alphabeta T-cell development and to rapid development of T-cell lymphomas. Mol

Cell Biol 17:4782-4791.

12. Yan, W., A.Z. Young, V.C. Soares, R. Kelley, R. Benezra, and Y. Zhuang. 1997. High

incidence of T-cell tumors in E2A-null mice and E2A/Id1 double-knockout mice. Mol

Cell Biol 17:7317-7327.

13. Kelliher, M.A., D.C. Seldin, and P. Leder. 1996. Tal-1 induces T cell acute

lymphoblastic leukemia accelerated by casein kinase IIalpha. Embo J 15:5160-5166.

TAL1 and LMO2 expression impair human T-cell development

114

14. O'Neil, J., M. Billa, S. Oikemus, and M. Kelliher. 2001. The DNA binding activity of

TAL-1 is not required to induce leukemia/lymphoma in mice. Oncogene 20:3897-3905.

15. O'Neil, J., J. Shank, N. Cusson, C. Murre, and M. Kelliher. 2004. TAL1/SCL induces

leukemia by inhibiting the transcriptional activity of E47/HEB. Cancer Cell 5:587-596.

16. Wadman, I.A., H. Osada, G.G. Grutz, A.D. Agulnick, H. Westphal, A. Forster, and T.H.

Rabbitts. 1997. The LIM-only protein Lmo2 is a bridging molecule assembling an

erythroid, DNA-binding complex which includes the TAL1, E47, GATA-1 and

Ldb1/NLI proteins. Embo J 16:3145-3157.

17. Ono, Y., N. Fukuhara, and O. Yoshie. 1997. Transcriptional activity of TAL1 in T cell

acute lymphoblastic leukemia (T-ALL) requires RBTN1 or -2 and induces TALLA1, a

highly specific tumor marker of T-ALL. J Biol Chem 272:4576-4581.

18. Ono, Y., N. Fukuhara, and O. Yoshie. 1998. TAL1 and LIM-only proteins

synergistically induce retinaldehyde dehydrogenase 2 expression in T-cell acute

lymphoblastic leukemia by acting as cofactors for GATA3. Mol Cell Biol 18:6939-

6950.

19. Boehm, T., L. Foroni, Y. Kaneko, M.F. Perutz, and T.H. Rabbitts. 1991. The rhombotin

family of cysteine-rich LIM-domain oncogenes: distinct members are involved in T-cell

translocations to human chromosomes 11p15 and 11p13. Proc Natl Acad Sci U S A

88:4367-4371.

20. Van Vlierberghe, P., M. van Grotel, H.B. Beverloo, C. Lee, T. Helgason, J. Buijs-

Gladdines, M. Passier, E.R. van Wering, A.J. Veerman, W.A. Kamps, J.P. Meijerink,

and R. Pieters. 2006. The cryptic chromosomal deletion del(11)(p12p13) as a new

activation mechanism of LMO2 in pediatric T-cell acute lymphoblastic leukemia. Blood

108:3520-3529.

21. Ferrando, A.A., S. Herblot, T. Palomero, M. Hansen, T. Hoang, E.A. Fox, and A.T.

Look. 2004. Biallelic transcriptional activation of oncogenic transcription factors in T-

cell acute lymphoblastic leukemia. Blood 103:1909-1911.

22. Larson, R.C., I. Lavenir, T.A. Larson, R. Baer, A.J. Warren, I. Wadman, K. Nottage,

and T.H. Rabbitts. 1996. Protein dimerization between Lmo2 (Rbtn2) and Tal1 alters

thymocyte development and potentiates T cell tumorigenesis in transgenic mice. Embo

J 15:1021-1027.

23. Larson, R.C., P. Fisch, T.A. Larson, I. Lavenir, T. Langford, G. King, and T.H.

Rabbitts. 1994. T cell tumours of disparate phenotype in mice transgenic for Rbtn-2.

Oncogene 9:3675-3681.

24. Larson, R.C., H. Osada, T.A. Larson, I. Lavenir, and T.H. Rabbitts. 1995. The

oncogenic LIM protein Rbtn2 causes thymic developmental aberrations that precede

malignancy in transgenic mice. Oncogene 11:853-862.

TAL1 and LMO2 expression impair human T-cell development

115

25. Aplan, P.D., C.A. Jones, D.S. Chervinsky, X. Zhao, M. Ellsworth, C. Wu, E.A.

McGuire, and K.W. Gross. 1997. An scl gene product lacking the transactivation

domain induces bony abnormalities and cooperates with LMO1 to generate T-cell

malignancies in transgenic mice. Embo J 16:2408-2419.

26. Chervinsky, D.S., X.F. Zhao, D.H. Lam, M. Ellsworth, K.W. Gross, and P.D. Aplan.

1999. Disordered T-cell development and T-cell malignancies in SCL LMO1 double-

transgenic mice: parallels with E2A-deficient mice. Mol Cell Biol 19:5025-5035.

27. Tremblay, M., C.S. Tremblay, S. Herblot, P.D. Aplan, J. Hebert, C. Perreault, and T.

Hoang. Modeling T-cell acute lymphoblastic leukemia induced by the SCL and LMO1

oncogenes. Genes Dev 24:1093-1105.

28. Hacein-Bey-Abina, S., C. Von Kalle, M. Schmidt, M.P. McCormack, N. Wulffraat, P.

Leboulch, A. Lim, C.S. Osborne, R. Pawliuk, E. Morillon, R. Sorensen, A. Forster, P.

Fraser, J.I. Cohen, G. de Saint Basile, I. Alexander, U. Wintergerst, T. Frebourg, A.

Aurias, D. Stoppa-Lyonnet, S. Romana, I. Radford-Weiss, F. Gross, F. Valensi, E.

Delabesse, E. Macintyre, F. Sigaux, J. Soulier, L.E. Leiva, M. Wissler, C. Prinz, T.H.

Rabbitts, F. Le Deist, A. Fischer, and M. Cavazzana-Calvo. 2003. LMO2-associated

clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science

302:415-419.

29. Schmidt, M., S. Hacein-Bey-Abina, M. Wissler, F. Carlier, A. Lim, C. Prinz, H. Glimm,

I. Andre-Schmutz, C. Hue, A. Garrigue, F. Le Deist, C. Lagresle, A. Fischer, M.

Cavazzana-Calvo, and C. von Kalle. 2005. Clonal evidence for the transduction of

CD34+ cells with lymphomyeloid differentiation potential and self-renewal capacity in

the SCID-X1 gene therapy trial. Blood 105:2699-2706.

30. Hacein-Bey-Abina, S., A. Garrigue, G.P. Wang, J. Soulier, A. Lim, E. Morillon, E.

Clappier, L. Caccavelli, E. Delabesse, K. Beldjord, V. Asnafi, E. MacIntyre, L. Dal

Cortivo, I. Radford, N. Brousse, F. Sigaux, D. Moshous, J. Hauer, A. Borkhardt, B.H.

Belohradsky, U. Wintergerst, M.C. Velez, L. Leiva, R. Sorensen, N. Wulffraat, S.

Blanche, F.D. Bushman, A. Fischer, and M. Cavazzana-Calvo. 2008. Insertional

oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1. J Clin

Invest 118:3132-3142.

31. Deichmann, A., S. Hacein-Bey-Abina, M. Schmidt, A. Garrigue, M.H. Brugman, J. Hu,

H. Glimm, G. Gyapay, B. Prum, C.C. Fraser, N. Fischer, K. Schwarzwaelder, M.L.

Siegler, D. de Ridder, K. Pike-Overzet, S.J. Howe, A.J. Thrasher, G. Wagemaker, U.

Abel, F.J. Staal, E. Delabesse, J.L. Villeval, B. Aronow, C. Hue, C. Prinz, M. Wissler,

C. Klanke, J. Weissenbach, I. Alexander, A. Fischer, C. von Kalle, and M. Cavazzana-

Calvo. 2007. Vector integration is nonrandom and clustered and influences the fate of

lymphopoiesis in SCID-X1 gene therapy. J Clin Invest 117:2225-2232.

TAL1 and LMO2 expression impair human T-cell development

116

32. Howe, S.J., M.R. Mansour, K. Schwarzwaelder, C. Bartholomae, M. Hubank, H.

Kempski, M.H. Brugman, K. Pike-Overzet, S.J. Chatters, D. de Ridder, K.C. Gilmour,

S. Adams, S.I. Thornhill, K.L. Parsley, F.J. Staal, R.E. Gale, D.C. Linch, J. Bayford, L.

Brown, M. Quaye, C. Kinnon, P. Ancliff, D.K. Webb, M. Schmidt, C. von Kalle, H.B.

Gaspar, and A.J. Thrasher. 2008. Insertional mutagenesis combined with acquired

somatic mutations causes leukemogenesis following gene therapy of SCID-X1 patients.

J Clin Invest 118:3143-3150.

33. Robb, L., J.E. Rasko, M.L. Bath, A. Strasser, and C.G. Begley. 1995. scl, a gene

frequently activated in human T cell leukaemia, does not induce lymphomas in

transgenic mice. Oncogene 10:205-209.

34. Amendola, M., M.A. Venneri, A. Biffi, E. Vigna, and L. Naldini. 2005. Coordinate

dual-gene transgenesis by lentiviral vectors carrying synthetic bidirectional promoters.

Nat Biotechnol 23:108-116.

35. Caton, D., A. Calabrese, C. Mas, V. Serre-Beinier, A. Charollais, D. Caille, R. Zufferey,

D. Trono, and P. Meda. 2003. Lentivirus-mediated transduction of connexin cDNAs

shows level- and isoform-specific alterations in insulin secretion of primary pancreatic

beta-cells. J Cell Sci 116:2285-2294.

36. Schmitt, T.M., and J.C. Zuniga-Pflucker. 2002. Induction of T cell development from

hematopoietic progenitor cells by delta-like-1 in vitro. Immunity 17:749-756.

37. La Motte-Mohs, R.N., E. Herer, and J.C. Zuniga-Pflucker. 2005. Induction of T-cell

development from human cord blood hematopoietic stem cells by Delta-like 1 in vitro.

Blood 105:1431-1439.

38. Barata, J.T., A.A. Cardoso, L.M. Nadler, and V.A. Boussiotis. 2001. Interleukin-7

promotes survival and cell cycle progression of T-cell acute lymphoblastic leukemia

cells by down-regulating the cyclin-dependent kinase inhibitor p27(kip1). Blood

98:1524-1531.

39. Pike-Overzet, K., D. de Ridder, F. Weerkamp, M.R. Baert, M.M. Verstegen, M.H.

Brugman, S.J. Howe, M.J. Reinders, A.J. Thrasher, G. Wagemaker, J.J. van Dongen,

and F.J. Staal. 2007. Ectopic retroviral expression of LMO2, but not IL2Rgamma,

blocks human T-cell development from CD34+ cells: implications for leukemogenesis

in gene therapy. Leukemia 21:754-763.

40. Herblot, S., A.M. Steff, P. Hugo, P.D. Aplan, and T. Hoang. 2000. SCL and LMO1

alter thymocyte differentiation: inhibition of E2A-HEB function and pre-T alpha chain

expression. Nat Immunol 1:138-144.

41. Robb, L., I. Lyons, R. Li, L. Hartley, F. Kontgen, R.P. Harvey, D. Metcalf, and C.G.

Begley. 1995. Absence of yolk sac hematopoiesis from mice with a targeted disruption

of the scl gene. Proc Natl Acad Sci U S A 92:7075-7079.

TAL1 and LMO2 expression impair human T-cell development

117

42. Yamada, Y., A.J. Warren, C. Dobson, A. Forster, R. Pannell, and T.H. Rabbitts. 1998.

The T cell leukemia LIM protein Lmo2 is necessary for adult mouse hematopoiesis.

Proc Natl Acad Sci U S A 95:3890-3895.

43. Neale, G.A., J.E. Rehg, and R.M. Goorha. 1995. Ectopic expression of rhombotin-2

causes selective expansion of CD4-CD8- lymphocytes in the thymus and T-cell tumors

in transgenic mice. Blood 86:3060-3071.

44. Uckun, F.M., M.G. Sensel, L. Sun, P.G. Steinherz, M.E. Trigg, N.A. Heerema, H.N.

Sather, G.H. Reaman, and P.S. Gaynon. 1998. Biology and treatment of childhood T-

lineage acute lymphoblastic leukemia. Blood 91:735-746.

Identification of novel TAL1 targets in T-ALL

118

Chapter 4

Identification of novel TAL1 target genes with

potential impact on T-cell acute lymphoblastic

leukemia

Ana Gírio, Bruno A. Cardoso, Nádia Correia, Ana R. Grosso and João T. Barata

Identification of novel TAL1 targets in T-ALL

119

Abstract

TAL1, a transcription factor involved in early hematopoiesis, is overexpressed in

a high percentage of T-cell acute lymphoblastic leukemia (T-ALL) cases, and TAL1

transgenic mice develop T-cell malignancies. However, the mechanisms by which

TAL1 possibly contributes to leukemogenesis are very ill defined, particularly in

humans. To identify novel TAL1 effectors we generated an inducible system, in which

TAL1, fused to the hormone binding domain of the estrogen receptor (ER), translocates

to the nucleus on addition of 4-hydroxy-tamoxifen (4-OHT). Microarray analysis of the

gene expression profile in HPB-ALL, a TAL1-negative T-ALL cell line, stably

transduced with ER-TAL1, revealed a total of 26 genes up- or down-regulated upon 4-

OHT treatment, in at least two independent experiments. We selected seven of those

genes on the basis of their function/potential interest in cancer and confirmed the

differential expression of three (CASZ1, DMGDH and OR5M3) by qRT-PCR.

Accordingly, transfection of another TAL1-negative T-ALL cell line, P12, with TAL1,

also led to increased expression of the validated TAL1 target genes. Conversely, knock-

down of TAL1 with siRNA in the TAL1-positive T-ALL cell line Jurkat decreased the

expression of CASZ1, correlating with loss of cell viability. Furthermore, similar to

TAL1, CASZ1 knock-down negatively affected cellular viability and proliferation of T-

ALL cells. The genes identified in this study can provide new clues on how TAL1 may

be involved in T-ALL.

Introduction

T-cell acute lymphoblastic leukemia (T-ALL) is a heterogeneous disease,

characterized by the clonal expansion of malignant hematopoietic progenitors arrested

at different stages of development. Ectopic expression of oncogenic transcription factors

is associated with T-ALL (1-3). TAL1 is over-expressed in up to 65% of T-ALL

patients, and TAL1 expression was reported to associate with poor prognosis (4).

Several chromosomal translocations are responsible for TAL1 ectopic expression in T-

ALL patients (5-9). However, the interstitial deletion [del(1)p32p32 or TAL1d], which

renders TAL1 gene expression under the control of the SIL promoter (10), is the most

common mechanism TAL1 deregulation in T-ALL. Still, a significant number of T-

Identification of novel TAL1 targets in T-ALL

120

ALL cases present TAL1 ectopic expression without evidence of genomic alterations

involving its locus (4, 11).

TAL1 expression in T-ALL is associated with resistance to apoptosis. TAL1

ectopic expression in cell lines protects from apoptosis (12) and loss of TAL1

expression and activity results in increased apoptosis (13, 14). However, the

mechanisms by which TAL1 likely exerts its leukemogenic effect are still far from

being understood. The TAL1 gene codes for a class II bHLH transcription factor (5) that

heterodimerizes with the class I bHLH transcription factors E2A and HEB (15, 16) to

bind the DNA in specific sequences termed E-boxes (17). Several studies demonstrated

that TAL1 inhibits E2A mediated gene transcription (18-20). More importantly, this

inhibition was shown to be the trigger for the development of leukemia in a TAL1

transgenic mouse model (21). In addition to this negative role, TAL1 has also been

shown to promote the transcription of several genes, although validated direct targets

are relatively few. In the context of leukemia, RALDH2 (22); NFKB1 (23) and NKX3.1

(24) were shown to be regulated by TAL1. TAL1 target genes have also been reported

in other cellular contexts, including normal hematopoiesis (25, 26), embryogenesis (27)

and erythropoiesis (28, 29).

Recently, in a genome-wide study, TAL1 was shown to bind the promoter of a

high number of genes in association with E2A and HEB. Importantly, TAL1 modulated

the expression of several genes (TRAF3; RAB40B; EPBH1; PTPRU; TTC3 and RPS3A),

which are involved in important cellular functions (30).Genome-wide studies are

important to understand which genes could be regulated by TAL1. However, they do

not allow to pinpoint which genes contribute to the malignant process elicited by TAL1.

To identify new TAL1 target genes in the context of T-ALL, we analyzed TAL1-

induced gene expression profile. We identified and validated three genes (CASZ1,

DMGDH and OR5M3) whose expression is positively regulated by TAL1. Importantly,

knock-down of CASZ1 expression decreases T-ALL cell viability and proliferation. Full

characterization of the genes identified in this study, particularly CASZ1, might

contribute to the understanding of how TAL1 can participate in T-ALL.

Materials and Methods

Cloning procedures. The #-ER-empty and #-ER-TAL1 vectors were derived from the

#304.pCCL.sin.cPPT.pA.CTE.eGFP.minCMV.hPGK.deltaNGFR.WPRE (31). TAL1

Identification of novel TAL1 targets in T-ALL

121

was amplified by PCR from the pcDNA3.1 (+) zeo TAL1 and cloned into the pcDNA3-

ER plasmid (kindly provided by Prof. P. J. Coffer) that contains the hormone-binding

domain of the estrogen receptor (32). TAL1 was fused in frame in the C-terminus of the

Estrogen-Receptor and the results were confirmed by sequentiation. Both ER and ER-

TAL1 were then amplified by PCR and cloned into the

#304.pCCL.sin.cPPT.pA.CTE.eGFP.minCMV.hPGK.deltaNGFR.WPRE with the

appropriate restriction enzymes (SphI-SalI). TAL1 was amplified by PCR from the

pcDNA3.1 (+) zeo TAL1 and cloned in frame with a HA-tag to create the pMT2-HA-

TAL1 vector. The results were confirmed by sequentiation. The primers used in the

cloning procedures are listed in Table 4.1.

Designation 5' to 3'

ERNTAL1F TAGATATCGGAGGAATGACCGAGCG

ERNTAL1R TAGATATCTCACCGAGGGCCGGCTCCATC

ER F CATGCATGCTGGATGCGAAATGAAATGGGTGC

ER R GCGTCGACTAATCCTCCGATATCGTTGGGGAAG

ER-TAL1 R GCGTCGACTAATCACCGAGGGCCGGCTCCATC

SmaI-TAL1 AGCCCGGGATGACCGAGCGGCCGCCGAGC

TAL1-XhoI ATCTCGAGTCACCGAGGGCCGGCTCCATC

Production of VSVG-pseudotyped lentiviruses. Vesicular-Stomatitis-Virus-

pseudotyped third-generation lentiviruses were produced as described in Material and

Methods section in Chapter 3 (page 99).

Cell lines. 293T cells were maintained in DMEM medium (Invitrogen) supplemented

with 10% fetal bovine serum (DMEM-10) and were splitted every 2 days. The human

T-ALL cell lines HPB-ALL, P12 and Jurkat have already been described and

extensively studied. These three cell lines were maintained in RPMI medium

(Invitrogen) supplemented with 10% FBS (RPMI-10) and splitted every 2-3 days. The

human CML cell line K562 was maintained in RPMI-10 and splitted every 2 days.

HPB-ALL and transfected 293T cells were cultured in the presence of 4-Hidroxy-

Tamoxifen (Sigma) at a concentration of 2.0µM. At the indicated time points, the cells

were harvested and processed as indicated below for RNA extraction and protein lysates

for Immunobloting.

Table 4.1. List of primers used in the cloning procedures

Identification of novel TAL1 targets in T-ALL

122

Establishment of HPB-ALL-ER-empty and HPB-ALL-ER-TAL1 cell lines. HPB-

ALL cells were transduced in retronectin (Takara) coated plates. Briefly, 0.5 x 106 cells

were incubated in 500µl RPMI-10 in a retronectin-coated well (5µg/well) of a 24-well-

plate with 500µl #-ER-empty and #-ER-TAL1 lentiviral supernatant. Cells were

incubated over-night at 37ºC, and in the following day, were washed and fresh media

added. Cells were expanded and sorted for high GFP expression.

Immunofluorescence. 293T cells were grown in coverslips and transfected with 1.0µg

of each plasmid (pcDNA3.1 (+) zeo TAL1 and pcDNA3-ER-TAL1) using Fugene 6

reagent (Roche) according to the manufacturer‟s instructions. After transfection, cells

were washed with PBS, fixed with 1% PFA and permeabilized with PGS (PBS + 0.2%

Gelatin + 0.05% Saponin). TAL1 was detected using a mouse α-TAL1 primary

antibody (Millipore), followed by incubation with Alexa Fluor 488–conjugated goat

anti-mouse antibody (Invitrogen). The images were acquired by confocal microscopy

using a Zeiss LSM 510 Meta microscope, using identical acquisition parameters in one

imaging session.

RNA isolation and Affymetrix GeneChip analysis. RNA labeling, hybridization to

the Affymetrix HuGene 1.0 ST arrays and scanning was performed by the Affymetrix

Core Facility, Instituto Gulbenkian de Ciência, Portugal, as described below. Total

RNA was extracted using the High Pure RNA extraction Kit (Roche). Concentration

and purity were determined by spectrophotometry and integrity was confirmed using an

Agilent 2100 Bioanalyzer with a RNA 6000 Nano Assay (Agilent Technologies). RNA

was processed for use on Affymetrix HuGene 1.0 ST arrays, according to the

manufacturer‟s One-Cycle Target Labeling Assay. Arrays were scanned on an

Affymetrix GeneChip scanner 3000 7G. All the microarray data analysis was performed

using R and several packages available from CRAN (R Development Core Team, 2008)

and Bioconductor. The raw data (CEL files) was normalized and summarized with the

Robust MultiArray Average method from the affy package. The differentially expressed

genes were selected using linear models and empirical Bayes methods as implemented

in limma package, verifying the p-values corresponding to moderated “F statistics”, and

selecting as differentially expressed genes those that had adjusted p-values lower than

0.005.

Identification of novel TAL1 targets in T-ALL

123

RNA extraction, RT-PCR and (semi)-quantitative-PCR. When indicated, RNA was

extracted using the High Pure RNA Isolation Kit (Roche) according to the

manufacturer‟s instructions. For the RT-PCR, up to 1µg of total RNA was reverse

transcribed using SuperScript II (Invitrogen) and random hexamers. Expression of each

gene was normalized to the expression levels of GAPDH. Primers used in the semi and

quantitative -PCR are described in Table 4.2. Semi-quantitative PCR was performed in

20ul reactions, using 2ul of cDNA, 200nM each primer and 2U of Gotaq polymerase

(Promega) according to manufacturer‟s instructions. PCR reactions were performed in

an 96-Well MyCycler (Bio-Rad), after the initial denaturation of 5 min at 95ºC, PCR

products were amplified by 30 cycles of 30 seg at 95ºC, 1 min at 60ºC and 45 seg at

72ºC with a final extension step of 5 min at 72ºC. The PCR products were separated in a

2% agarose gel and visualized under UV light. For quantitative PCR, the transcripts

were amplified in 25µl reactions, using 10 µl cDNA, 12.5 µl Power SYBR Green

(Applied Biosystems) and 200nM of each primer, according to manufacturer‟s

instructions. All the amplifications were performed in an ABI PRISM 7500

thermocycler (Applied Biosystems) for 2 min at 50ºC, 10 min at 95ºC, followed by 45

cycles of 15 seg at 95ºC, and 1 min at 60ºC.

Gene Forward primer 5' to 3' Reverse primer 5' to 3'

TAL1 AACAATCGAGTGAAGAGGAG CTTTGGTGTGGGGACCAT

RALDH2 AGGAGATCTTTGGCCCTGTT TCTGGGCATTTAAGGCATTGTAAC

CASZ1-TV1 CAGGCTAGGTTGCAAGTACA CTCATCTGTCTCAGCATCCA

CASZ1-TV2 AGAAGTGAGTCCCTCGATGA AGCATCTTTGGCTAGAAGGA

DRAM ATTTCCATAACCAAGCTGGA GGGTGACACTCTGGAAATCT

DMGDH GGCCAGGACACTCAGTACA TAAAACCCACCTTTGGAATG

KLRK1 GATGGCAAAAGCAAAGATGT CAGTAACTTTCGGTCAAGGG

OR5M3 GCAATTGGGAATCCTCTGCTTTATGGC GCTGCCAGACTCGTCAGAAAACCA

S100A1 AGACCCTCATCAACGTGTTC CACATCCTTCTGGGCATC

TM4SF1 CAAAGTATGCCTCCGAAAAC TACAGAAGAAAGCATCGCAC

GAPDH GGAGTCAACGGATTTGGTCG GACAAGCTTCCCGTTCTCAG

Electroporation of P12 cells. Electroporation of P12 cells was performed using the

Gene Pulser II (Bio-Rad). P12 cells were washed in RPMI-10 medium and

ressuspended at a concentration of 40 x 106/mL in RPMI-10 medium (without

antibiotics) with 40 μg of pMT2-HA or pMT2-HA-TAL1 plasmid DNA. 300µl samples

Table 4.2. List of primers for quantitative and semi-quantitative-PCR.

Identification of novel TAL1 targets in T-ALL

124

were placed in 4 cm–gap cuvettes (Bio-Rad) and electroporation was performed using

350V and 750µF parameters. After electroporation, cells were washed and cultured for

24 h in RPMI-10 medium.

Nucleofection of Jurkat cells. Nucleofection of Jurkat cells was performed using the

Amaxa Nucleofector II (Lonza) according to the manufacturer‟s instructions. Jurkat

cells were washed in RPMI-10 medium and 2 x 106 cells were ressuspended in 100µl of

solution V with 2µM of the respective small interfering RNA (siRNA) (Dharmacon).

Jurkat cells were nucleofected using the X-001 program and after the nucleofection the

cells were cultured for 24 h in RPMI-10 medium.

Viability assays. 48 h post-nucleofection cellular viability was examined using

Annexin-V and 7-Aminoactinomycin D. The cells were stained with Fluorescein

Isothiocyanate- conjugated Annexin V (eBiosciences) and 7-Aminoactinomycin D

(eBiosciences) at room temperature for 15 min in the appropriate binding buffer, and

subsequently analyzed by flow cytometry (FACSCalibur; Becton- Dickinson,).

Proliferation assays. 24 h post-nucleofection the cells were cultured (2 x 106 cells/mL)

in triplicate in RPMI-10 medium, in flat-bottomed 96-well plates at 37°C with 5% CO2

and incubated with 3H-thymidine (1µCi/well) for 16 h prior to harvest. DNA synthesis

was assessed by 3H-thymidine incorporation at 48 h post-nucleofection.

Immunobloting. At the indicated conditions, cell lysates were prepared and equal

amounts of protein were analyzed by 12% SDS-PAGE. The proteins were transferred

onto nitrocellulose membranes and immunoblotted with an antibody for ER (Santa-Cruz

Biotechnology). After immunobloting with the primary antibody, immunodetection was

performed using HRP-conjugated anti-mouse IgG (Promega) and developed by

chemiluminescence (Thermo Scientific).

Statistical analysis. Differences between populations were calculated using unpaired 2-

tailed Student‟s t test or One-way ANOVA, when appropriate (p<0.05 was considered

significant).

Identification of novel TAL1 targets in T-ALL

125

Results

TAL1 inducible system

To identify possible target genes that could be directly induced upon TAL1

expression, we used the 4OHT inducible system. The modified Hormone-binding

domain (HDB) of the Estrogen Receptor (ER) (32, 33) was fused to the N-terminus of

the TAL1 protein (ER-TAL1). As shown in Figure 4.1A, the ER-TAL1 protein is

sequestered in the cytoplasm due to the interaction of the ER domain with chaperones

(HSPs). When 4OHT is added to the cells, it binds to the ER-TAL1 fusion protein,

allowing its release from the chaperones and translocation into the nucleus. Once in the

nucleus, the ER-TAL1 fusion protein can activate the expression of TAL1 target genes

(Figure 4.1A). This type of induction system was developed to allow the refined

regulation of transcription factor activity (32, 33), although it has also been used to

study the function of signal transducer proteins (34).

TAL1 physiological localization is nuclear (Figure 4.1B, second panel) (35, 36).

We tested the efficacy of the ER-TAL1 fusion protein in 293T cells transfected with the

pcDNA3-ER-TAL1 plasmid. In the control condition, the ER-TAL1 fusion remained in

the cytoplasm of the 293T cells (Figure 4.1B, third panel). Upon upon induction with

2.0µM 4OHT, TAL1 localization shifted to the nucleus (Figure 4.1B, fourth panel).

These results indicate that the ER inducible system works properly.

Next, we subcloned ER and ER-TAL1 into lentiviral vectors that we transduced

into the TAL1-negative T-ALL cell line HPB-ALL (22), in order to identify genes that

are regulated by TAL1 activity in the context of T-ALL. As shown in Figure 4.1C,

HPB-ALL cells properly expressed both ER and ER-TAL1 proteins. To determine

whether the ER-TAL1 fusion effectively worked in HPB-ALL cells, we treated HPB-

ALL-ER and HPB-ALL-ER-TAL1 cells with 2.0µM 4OHT for 24 h and measured the

expression level of the RALDH2 gene, a known TAL1 target gene (22). Induction of the

ER-TAL1 fusion protein increased the expression of RALDH2 by roughly two-fold

when compared to ER alone (Figure 4.1D) in a time-dependent manner (Figure 4.1E).

These results indicate that the ER-TAL1 inducible system worked properly in HPB-

ALL cells.

Identification of novel TAL1 targets in T-ALL

126

Figure 4.1. Overview of the TAL1 inducible system. (A) In the non-induced condition,

Heat-Shock-Proteins (HSPs) bind to ER-TAL1 and arrest the fusion protein in the

cytoplasm. Upon addition of 4OHT, HSPs are released from ER-TAL1 allowing its

translocation to the nucleus and subsequent transcription of TAL1 target genes. (B) 293T

cells were transfected with the pcDNA3-ER-TAL1 plasmid, and 24 h post-transfection

2.0µM 4OHT was added. TAL1 localization was determined by confocal microscopy using

an α-TAL1 antibody. 293T cells transfected with pcDNA3.1(+) zeo TAL1 plasmid were

used as a positive control. (C) Wild type (WT) HPB-ALL cells, or stably expressing empty

ER or ER-TAL1 were lysed and ER and ER-TAL1 expression determined by immunoblot

using an α-ER antibody. Arrows indicate ER and ER-TAL1 expression respectively. (D-E)

HPB-ALL-ER-empty and HPB-ALL-ER-TAL1 cells were treated with 2.0µM 4OHT in the

indicated time points and RALDH2 expression analyzed. The graphs represent the

expression of RALDH2 mRNA measured by quantitative RT-PCR normalized to GAPDH.

The values were normalized relative to the untreated condition and represent mean ±

standard deviation of duplicates ( ** p<0.01).

Identification of novel TAL1 targets in T-ALL

127

TAL1 activity up-regulates genes associated with cancer

In order to identify potential TAL1 target genes that might have relevance in

leukemogenesis and leukemia progression, we analyzed the gene expression profile of

HPB-ALL-ER-TAL1 cells induced with 4OHT. We treated HPB-ALL-ER-TAL1 cells

with 2.0µM 4OHT for 24 h in three independent experiments, and analyzed the gene

expression profile using an Affymetrix microarray platform (Human Gene 1.0 ST). We

selected the genes whose expression changed by at least 1.5 fold upon TAL1 induction.

The Venn-diagram (Figure 4.2) shows the genes whose expression was altered in the

three experiments and the overlap between them. We considered as potential TAL1

targets exclusively those genes whose regulation showed the same trend in at least two

experiments (Table 4.3) and discarded all the rest.

Figure 4.2. Venn diagram of the number of genes differentially expressed in each

of three independent experiments upon TAL1 activity induction. mRNA extracted

from HPB-ALL-ER-TAL1 cells treated with 4OHT or vehicle for 24 h was used for

gene expression analysis by microarrays. A gene was considered positive when its

expression in the presence, relative to the absence, of 4OHT was changed more than 1.5

fold.

Identification of novel TAL1 targets in T-ALL

128

Gene

Up/Down-regulation

References This study

Described in

Cancer

CASZ1 (SRG) Up Up 38, 39

CYP2B6 Up no reports

DMGDH Up Up 37

DRAM Down Down 42

EYS Up no reports

FGF16 Up no reports

FLJ43390 Up no reports

FLJ43763 Up no reports

HIST1H2AJ Down no reports

KCNC1 (NGK2) Up no reports

KLRK1 (NGK2D) Down Down 43

KRT18P49 Up no reports

LOC283588 Down no reports

LOC391742 Up no reports

LOC644714 Up no reports

OR5M3 Up no reports

OR6C76 Up no reports

REG3G Up no reports

RNU13P1 Up no reports

RNU5F Down no reports

S100A1 Up Up 44-45

SNORD56B Down no reports

SNRPN Down no reports

SUMO1P3 Down no reports

TISP43 Up no reports

TM4SF1 Up Up 46

Next, we further narrowed the list of 26 genes to those already associated with

cancer (Table 4.3). Therefore, among the genes whose expression changed similarly in

at least two independent experiments, we selected six to proceed with our study

(CASZ1, DMGDH, DRAM, KLRK1, S100A1 and TM4SF1)(37-46). We also included

OR5M3 (47), which was up-regulated in all the three microarray experiments. Although

OR5M3 has not been described, as far as we know, as being involved in any form of

cancer, it belongs to the family of genes coding for G-coupled receptor proteins that

Table 4.3. List of genes identified in the microarray experiments (similarly regulated in at least

2 of 3 experiments).

Identification of novel TAL1 targets in T-ALL

129

have been associated with cancer progression (48). Notably, none of the genes identified

have been described in T-ALL.

CASZ1, DMGDH and OR5M3 are potential TAL1 target genes

To validate the microarray data, we next performed quantitative RT-PCR

analyses. The transcript levels of DRAM and KLRK1 decreased upon addition of 4OHT,

but the effect was minor (Figure 4.3A) and we could not detect the expression of

S100A1 and TM4SF1 in HPB-ALL cells (data not shown). In contrast, we confirmed

that induction of TAL1 activity in HPB-ALL cells increased the expression levels of

CASZ1 [both transcriptional variant 1 (TV1) and 2 (TV2)] ,DMGDH and OR5M3

(Figure 4.3A).

Identification of novel TAL1 targets in T-ALL

130

To further confirm whether the expression of these three genes is regulated by

TAL1, we electroporated another the TAL1-negative cell line P12 with a plasmid

expressing TAL1 and measured the expression levels of CASZ1 (TV1 and TV2),

DMGDH and OR5M3 at 24 and 48 h post-electroporation. In both time points

measured, the expression of TAL1 increased dramatically, indicating that the

electroporation was successful (Figure 4.3C). TAL1 ectopic expression in P12 cells

significantly up-regulated CASZ1 and OR5M3 and slightly induced DMGDH (Figure

4.3C). Taken together, these results support the hypothesis that TAL1 regulates the

expression of CASZ1, DMGDH and OR5M3.

CASZ1 knock-down decreases T-ALL cell viability and proliferation

The CASZ1 gene is associated with neuronal development (39) and reported to

protect from apoptosis (38). Interestingly, TAL1 expression and activity has also been

associated with protection from apoptosis (12-14). To analyze the impact of CASZ1

expression in T-ALL cells, we knocked down CASZ1 in Jurkat cells using siRNA. As

shown in Figure 4.4A, CASZ1 siRNA decreased the expression of both transcription

variants. We also analyzed TAL1 knockdown in the same cell line, which decreased

resulted in diminished CASZ1 expression, further supporting a role for TAL1 in the

regulation of this gene.

Figure 4.3. CASZ1, DMGDH and OR5M3 are potential TAL1 target genes. (A) HPB-

ALL-ER-TAL1 cells were treated for 24 h with 2.0µM 4OHT and the expression of the

indicated genes was measured. The graphs represent the transcript levels of the indicated

genes measured by quantitative RT-PCR normalized to GAPDH. The values were further

normalized relative to the untreated control condition and represent mean ± standard

deviation of duplicates. (B) HPB-ALL-ER-empty and HPB-ALL-ER-TAL1 cells were

incubated with 2.0µM 4OHT for 24 h and the expression of OR5M3 was analyzed by semi-

quantitative-RT-PCR. GAPDH amplification was used as a loading control. RNA extracted

from regularly cultured K562 cells was used as a positive control. (C) P12 cells were

electroporated with pMT2-HA and pMT2-HA-TAL1 plasmids and the transcript levels of the

indicated genes were measured in the indicated time points. The graphs represent the

transcript levels of the indicated genes measured by quantitative RT-PCR and normalized to

GAPDH. The values were further normalized relative to the pMT2-HA control condition and

represent mean ± standard deviation of duplicates.

Identification of novel TAL1 targets in T-ALL

131

The decrease in TAL1 gene expression had a small, but significant, negative

effect on T-ALL cell proliferation, whereas CASZ1 knockdown had a higher impact on

the reduction of cellular proliferation (Figure 4.4B). Furthermore, TAL1 knockdown

increased apoptosis (Figure 4.4C). This result is agreement with previous reports

indicating that TAL1 expression impacts on apoptosis (12, 13). Importantly, CASZ1

knockdown increased apoptosis similarly to the TAL1 knockdown (Figure 4.4C). Taken

together, our results suggest that CASZ1 might be involved in the biology of T-ALL

Figure 4.4. CASZ1 knockdown decreases T-ALL cell viability and proliferation. Jurkat

cells were nucleofected with siRNA for TAL1 and CASZ1 genes and the functional effects

were analyzed. (A) TAL1 and CASZ1 mRNA levels were analyzed by quantitative-RT-PCR

24 h post-nucleofection. The graphs represent the transcript levels of the indicated genes

and transcription variants measured by quantitative RT-PCR and normalized to 18S. The

values were further normalized relative to the non-targeting siRNA control condition and

represent mean ± standard deviation of duplicates. 48 h post-nucleofection proliferation (B)

and viability (C) were analyzed by 3H-thymidine incorporation and by flow cytometry

analysis of Annexin-V-FITC/7-AAD dot-plots, respectively. (A and C) Values represent

mean ± standard deviation of duplicates (** p<0.01; *** p<0.001).

Identification of novel TAL1 targets in T-ALL

132

and indicate that CASZ1 is positively regulated by TAL1. Analysis of OR5M3 and

DMGDH is warranted.

Discussion

Although TAL1 has been associated with human T-ALL (4, 49), little is known

about the transcriptional program promoted by this transcription factor in the context of

the disease. In our preliminary study, we identified novel putative TAL1 target genes by

showing that TAL1 forced expression up-regulates genes reported to be involved in

other cancers (CASZ1 and DMGDH) (37-41) and a member of the olfactory receptor

family (OR5M3) (47).

To identify these genes, we made use of the 4OHT inducible system (33), fusing

TAL1 with the hormone-binding-domain (HDB) of the estrogen receptor (ER), which

allowed the translocation of TAL1 to the nucleus upon 4OHT induction (Figure

4.1).Surprisingly, the translocation of TAL1 into the nucleus only clearly occurred after

24 h of induction with 4OHT. This result was in contrast with other reported ER-

fusions, which are induced much faster upon 4OHT induction (32). Since the TAL1

nuclear-localization-sequence (NLS) is N-terminal (36) it could be affected by the

fusion with the ER. Importantly, the ER-TAL1 fusion protein was able to induce the

expression of RALDH2 (a described TAL1-target gene) (Figure 4.1) even in the absence

of LMO proteins (22).

Our gene expression analyses showed that most of the genes were up-regulated

upon TAL1 induction by 4OHT (Table 4.3), suggesting that the main action of TAL1 is

to activate the expression of its target genes. From the list of genes described in Table

4.3, we chose to validate only those already reported as being involved in cancer

(CASZ1; DMGDH; DRAM; KLRK1; S100A1 and TM4SF1) and the only gene up-

regulated in all the three independent experiments (OR5M3). Of course, this strategy of

simplification implicates that other potentially relevant genes may have been

overlooked. We validated CASZ1, DMGDH and OR5M3 as new potential TAL1 targets

(Figure 4.3). Ectopic expression of TAL1 in another T-ALL cell line increased the

expression of these genes (Figure 4.3). Moreover, knockdown of TAL1 expression in T-

ALL cells decreased the expression of the CASZ1 gene. Despite the fact that our results

suggest these genes might be TAL1 targets in T-ALL, more experiments are required to

establish a direct link between TAL1 and their expression. Interestingly, the promoter

Identification of novel TAL1 targets in T-ALL

133

region of all the three genes contains consensus sequences (E-boxes) for TAL1 binding

(data not shown), supporting the possibility that these are TAL1 direct target genes.

The CASZ1 gene encodes for a transcription factor up-regulated in neuronal cell

differentiation and transcribes two different mRNAs (39). Interestingly, TAL1 was

shown to also play a role in neuronal differentiation (50, 51) and CASZ1 could be one of

its targets. Moreover, CASZ1 was also shown to be expressed in a variety of human

tumors and implicated in resistance to apoptosis (38). Importantly, TAL1 expression is

also directly associated with resistance to apoptosis in T-ALL cell lines (12-14). Here,

we demonstrated that CASZ1 expression regulates T-ALL cell viability and

proliferation (Figure 4.4). These results suggest that CASZ1 may act downstream of the

TAL1 leukemogenic pathway in the maintenance of T-ALL viability and proliferation.

DMGDH, which encodes for dimethylglycine dehydrogenase, was also up-

regulated upon induction of TAL1. The protein is a mitochondrial matrix enzyme that

generates sarcosine from dimethylglycine (40, 41). Its association with cancer comes

from the fact that high levels of sarcosine are associated with the aggressiveness of

prostate cancer cells (37).

OR5M3 was the only gene systematically up-regulated by TAL1 in all the three

independent experiments (Figure 4.2). OR5M3 is a member of the large family of G-

protein-coupled olfactory receptors (47). These receptors are expressed in sensory

neurons of mammals and other tissues (52) and can be activated by a variety of

chemical compounds (47). Recently, it was described that steroid hormones can bind to

OR51E2, an olfactory receptor expressed in prostate cancer, and inhibit cellular

proliferation by activation of p38 MAPK pathway (53). The ligands and activity of

OR5M3 are unknown. Nonetheless, it is conceivable that up-regulation of OR5M3

might contribute to TAL1-mediated leukemia.

Overall, our study identified three novel downstream targets of TAL1 with the

aim to characterize the possible mechanisms by which TAL1 might exert its

leukemogenic function. The fact that T-ALL patients with TAL1 ectopic expression

apparently have a less favorable prognosis (4), prompts for a better understanding of the

actual participation of TAL1 in T-ALL progression, including the identification of

functionally relevant effectors. Determining the exact participation of CASZ1, DMGDH

and OR5M3, in the network regulated by TAL1 in the context of leukemia and whether

they may represent novel therapeutic targets in the treatment of TAL1+ T-ALL requires

considerable investigation.

Identification of novel TAL1 targets in T-ALL

134

References

1. Look, A.T. 1997. Oncogenic transcription factors in the human acute leukemias.

Science 278:1059-1064.

2. Graux, C., J. Cools, L. Michaux, P. Vandenberghe, and A. Hagemeijer. 2006.

Cytogenetics and molecular genetics of T-cell acute lymphoblastic leukemia: from

thymocyte to lymphoblast. Leukemia 20:1496-1510.

3. De Keersmaecker, K., P. Marynen, and J. Coolsi. 2005. Genetic insights in the

pathogenesis of T-cell acute lymphoblastic leukemia. Haematologica 90:1116-1127.

4. Ferrando, A.A., D.S. Neuberg, J. Staunton, M.L. Loh, C. Huard, S.C. Raimondi, F.G.

Behm, C.H. Pui, J.R. Downing, D.G. Gilliland, E.S. Lander, T.R. Golub, and A.T.

Look. 2002. Gene expression signatures define novel oncogenic pathways in T cell

acute lymphoblastic leukemia. Cancer Cell 1:75-87.

5. Chen, Q., J.T. Cheng, L.H. Tasi, N. Schneider, G. Buchanan, A. Carroll, W. Crist, B.

Ozanne, M.J. Siciliano, and R. Baer. 1990. The tal gene undergoes chromosome

translocation in T cell leukemia and potentially encodes a helix-loop-helix protein.

Embo J 9:415-424.

6. Begley, C.G., P.D. Aplan, M.P. Davey, K. Nakahara, K. Tchorz, J. Kurtzberg, M.S.

Hershfield, B.F. Haynes, D.I. Cohen, T.A. Waldmann, and et al. 1989. Chromosomal

translocation in a human leukemic stem-cell line disrupts the T-cell antigen receptor

delta-chain diversity region and results in a previously unreported fusion transcript.

Proc Natl Acad Sci U S A 86:2031-2035.

7. Fitzgerald, T.J., G.A. Neale, S.C. Raimondi, and R.M. Goorha. 1991. c-tal, a helix-

loop-helix protein, is juxtaposed to the T-cell receptor-beta chain gene by a reciprocal

chromosomal translocation: t(1;7)(p32;q35). Blood 78:2686-2695.

8. Aplan, P.D., S.C. Raimondi, and I.R. Kirsch. 1992. Disruption of the SCL gene by a

t(1;3) translocation in a patient with T cell acute lymphoblastic leukemia. J Exp Med

176:1303-1310.

9. Francois, S., E. Delabesse, L. Baranger, M. Dautel, C. Foussard, M. Boasson, O.

Blanchet, O. Bernard, E.A. Macintyre, and N. Ifrah. 1998. Deregulated expression of

the TAL1 gene by t(1;5)(p32;31) in patient with T-cell acute lymphoblastic leukemia.

Genes Chromosomes Cancer 23:36-43.

10. Aplan, P.D., D.P. Lombardi, G.H. Reaman, H.N. Sather, G.D. Hammond, and I.R.

Kirsch. 1992. Involvement of the putative hematopoietic transcription factor SCL in T-

cell acute lymphoblastic leukemia. Blood 79:1327-1333.

Identification of novel TAL1 targets in T-ALL

135

11. Ferrando, A.A., S. Herblot, T. Palomero, M. Hansen, T. Hoang, E.A. Fox, and A.T.

Look. 2004. Biallelic transcriptional activation of oncogenic transcription factors in T-

cell acute lymphoblastic leukemia. Blood 103:1909-1911.

12. Bernard, M., E. Delabesse, S. Novault, O. Hermine, and E.A. Macintyre. 1998.

Antiapoptotic effect of ectopic TAL1/SCL expression in a human leukemic T-cell line.

Cancer Res 58:2680-2687.

13. Leroy-Viard, K., M.A. Vinit, N. Lecointe, H. Jouault, U. Hibner, P.H. Romeo, and D.

Mathieu-Mahul. 1995. Loss of TAL-1 protein activity induces premature apoptosis of

Jurkat leukemic T cells upon medium depletion. Embo J 14:2341-2349.

14. Park, S.T., G.P. Nolan, and X.H. Sun. 1999. Growth inhibition and apoptosis due to

restoration of E2A activity in T cell acute lymphoblastic leukemia cells. J Exp Med

189:501-508.

15. Hsu, H.L., I. Wadman, and R. Baer. 1994. Formation of in vivo complexes between the

TAL1 and E2A polypeptides of leukemic T cells. Proc Natl Acad Sci U S A 91:3181-

3185.

16. Bernard, M., E. Delabesse, L. Smit, C. Millien, I.R. Kirsch, J.L. Strominger, and E.A.

Macintyre. 1998. Helix-loop-helix (E2-5, HEB, TAL1 and Id1) protein interaction with

the TCRalphadelta enhancers. Int Immunol 10:1539-1549.

17. Hsu, H.L., L. Huang, J.T. Tsan, W. Funk, W.E. Wright, J.S. Hu, R.E. Kingston, and R.

Baer. 1994. Preferred sequences for DNA recognition by the TAL1 helix-loop-helix

proteins. Mol Cell Biol 14:1256-1265.

18. Hansson, A., C. Manetopoulos, J.I. Jonsson, and H. Axelson. 2003. The basic helix-

loop-helix transcription factor TAL1/SCL inhibits the expression of the p16INK4A and

pTalpha genes. Biochem Biophys Res Commun 312:1073-1081.

19. Tremblay, M., S. Herblot, E. Lecuyer, and T. Hoang. 2003. Regulation of pT alpha gene

expression by a dosage of E2A, HEB, and SCL. J Biol Chem 278:12680-12687.

20. Herblot, S., A.M. Steff, P. Hugo, P.D. Aplan, and T. Hoang. 2000. SCL and LMO1

alter thymocyte differentiation: inhibition of E2A-HEB function and pre-T alpha chain

expression. Nat Immunol 1:138-144.

21. O'Neil, J., J. Shank, N. Cusson, C. Murre, and M. Kelliher. 2004. TAL1/SCL induces

leukemia by inhibiting the transcriptional activity of E47/HEB. Cancer Cell 5:587-596.

22. Ono, Y., N. Fukuhara, and O. Yoshie. 1998. TAL1 and LIM-only proteins

synergistically induce retinaldehyde dehydrogenase 2 expression in T-cell acute

lymphoblastic leukemia by acting as cofactors for GATA3. Mol Cell Biol 18:6939-

6950.

23. Chang, P.Y., K. Draheim, M.A. Kelliher, and S. Miyamoto. 2006. NFKB1 is a direct

target of the TAL1 oncoprotein in human T leukemia cells. Cancer Res 66:6008-6013.

Identification of novel TAL1 targets in T-ALL

136

24. Kusy, S., B. Gerby, N. Goardon, N. Gault, F. Ferri, D. Gerard, F. Armstrong, P.

Ballerini, J.M. Cayuela, A. Baruchel, F. Pflumio, and P.H. Romeo. 2010. NKX3.1 is a

direct TAL1 target gene that mediates proliferation of TAL1-expressing human T cell

acute lymphoblastic leukemia. J Exp Med 207:2141-2156.

25. Lecuyer, E., S. Herblot, M. Saint-Denis, R. Martin, C.G. Begley, C. Porcher, S.H.

Orkin, and T. Hoang. 2002. The SCL complex regulates c-kit expression in

hematopoietic cells through functional interaction with Sp1. Blood 100:2430-2440.

26. Krosl, G., G. He, M. Lefrancois, F. Charron, P.H. Romeo, P. Jolicoeur, I.R. Kirsch, M.

Nemer, and T. Hoang. 1998. Transcription factor SCL is required for c-kit expression

and c-Kit function in hemopoietic cells. J Exp Med 188:439-450.

27. Landry, J.R., S. Kinston, K. Knezevic, M.F. de Bruijn, N. Wilson, W.T. Nottingham,

M. Peitz, F. Edenhofer, J.E. Pimanda, K. Ottersbach, and B. Gottgens. 2008. Runx

genes are direct targets of Scl/Tal1 in the yolk sac and fetal liver. Blood 111:3005-3014.

28. Lahlil, R., E. Lecuyer, S. Herblot, and T. Hoang. 2004. SCL assembles a multifactorial

complex that determines glycophorin A expression. Mol Cell Biol 24:1439-1452.

29. Xu, Z., S. Huang, L.S. Chang, A.D. Agulnick, and S.J. Brandt. 2003. Identification of a

TAL1 target gene reveals a positive role for the LIM domain-binding protein Ldb1 in

erythroid gene expression and differentiation. Mol Cell Biol 23:7585-7599.

30. Palomero, T., D.T. Odom, J. O'Neil, A.A. Ferrando, A. Margolin, D.S. Neuberg, S.S.

Winter, R.S. Larson, W. Li, X.S. Liu, R.A. Young, and A.T. Look. 2006.

Transcriptional regulatory networks downstream of TAL1/SCL in t-cell acute

lymphoblastic leukemia. Blood 986.

31. Amendola, M., M.A. Venneri, A. Biffi, E. Vigna, and L. Naldini. 2005. Coordinate

dual-gene transgenesis by lentiviral vectors carrying synthetic bidirectional promoters.

Nat Biotechnol 23:108-116.

32. Dijkers, P.F., R.H. Medema, C. Pals, L. Banerji, N.S. Thomas, E.W. Lam, B.M.

Burgering, J.A. Raaijmakers, J.W. Lammers, L. Koenderman, and P.J. Coffer. 2000.

Forkhead transcription factor FKHR-L1 modulates cytokine-dependent transcriptional

regulation of p27(KIP1). Mol Cell Biol 20:9138-9148.

33. Littlewood, T.D., D.C. Hancock, P.S. Danielian, M.G. Parker, and G.I. Evan. 1995. A

modified oestrogen receptor ligand-binding domain as an improved switch for the

regulation of heterologous proteins. Nucleic Acids Res 23:1686-1690.

34. van Gorp, A.G., K.M. Pomeranz, K.U. Birkenkamp, R.C. Hui, E.W. Lam, and P.J.

Coffer. 2006. Chronic protein kinase B (PKB/c-akt) activation leads to apoptosis

induced by oxidative stress-mediated Foxo3a transcriptional up-regulation. Cancer Res

66:10760-10769.

Identification of novel TAL1 targets in T-ALL

137

35. Goldfarb, A.N., S. Goueli, D. Mickelson, and J.M. Greenberg. 1992. T-cell acute

lymphoblastic leukemia--the associated gene SCL/tal codes for a 42-Kd nuclear

phosphoprotein. Blood 80:2858-2866.

36. Bernard, M., L. Smit, E. Macintyre, D. Matthieu-Mahul, and K. Pulford. 1995. Nuclear

localization of the SCL/TAL1 basic helix-loop-helix protein is not dependent on the

presence of the basic domain. Blood 85:3356-3357.

37. Sreekumar, A., L.M. Poisson, T.M. Rajendiran, A.P. Khan, Q. Cao, J. Yu, B. Laxman,

R. Mehra, R.J. Lonigro, Y. Li, M.K. Nyati, A. Ahsan, S. Kalyana-Sundaram, B. Han, X.

Cao, J. Byun, G.S. Omenn, D. Ghosh, S. Pennathur, D.C. Alexander, A. Berger, J.R.

Shuster, J.T. Wei, S. Varambally, C. Beecher, and A.M. Chinnaiyan. 2009.

Metabolomic profiles delineate potential role for sarcosine in prostate cancer

progression. Nature 457:910-914.

38. Yuan, Z.R., R. Wang, J. Solomon, X. Luo, H. Sun, L. Zhang, and Y. Shi. 2005.

Identification and characterization of survival-related gene, a novel cell survival gene

controlling apoptosis and tumorigenesis. Cancer Res 65:10716-10724.

39. Liu, Z., X. Yang, F. Tan, K. Cullion, and C.J. Thiele. 2006. Molecular cloning and

characterization of human Castor, a novel human gene upregulated during cell

differentiation. Biochem Biophys Res Commun 344:834-844.

40. Binzak, B.A., J.G. Vockley, R.B. Jenkins, and J. Vockley. 2000. Structure and analysis

of the human dimethylglycine dehydrogenase gene. Mol Genet Metab 69:181-187.

41. Binzak, B.A., R.A. Wevers, S.H. Moolenaar, Y.M. Lee, W.L. Hwu, J. Poggi-Bach, U.F.

Engelke, H.M. Hoard, J.G. Vockley, and J. Vockley. 2001. Cloning of dimethylglycine

dehydrogenase and a new human inborn error of metabolism, dimethylglycine

dehydrogenase deficiency. Am J Hum Genet 68:839-847.

42. Crighton, D., S. Wilkinson, J. O'Prey, N. Syed, P. Smith, P.R. Harrison, M. Gasco, O.

Garrone, T. Crook, and K.M. Ryan. 2006. DRAM, a p53-induced modulator of

autophagy, is critical for apoptosis. Cell 126:121-134.

43. Osaki, T., H. Saito, T. Yoshikawa, S. Matsumoto, S. Tatebe, S. Tsujitani, and M.

Ikeguchi. 2007. Decreased NKG2D expression on CD8+ T cell is involved in immune

evasion in patients with gastric cancer. Clin Cancer Res 13:382-387.

44. Teratani, T., T. Watanabe, F. Kuwahara, H. Kumagai, S. Kobayashi, U. Aoki, A.

Ishikawa, K. Arai, and R. Nozawa. 2002. Induced transcriptional expression of calcium-

binding protein S100A1 and S100A10 genes in human renal cell carcinoma. Cancer

Lett 175:71-77.

45. Kanamori, T., K. Takakura, M. Mandai, M. Kariya, K. Fukuhara, M. Sakaguchi, N.H.

Huh, K. Saito, T. Sakurai, J. Fujita, and S. Fujii. 2004. Increased expression of calcium-

Identification of novel TAL1 targets in T-ALL

138

binding protein S100 in human uterine smooth muscle tumours. Mol Hum Reprod

10:735-742.

46. Lekishvili, T., E. Fromm, M. Mujoomdar, and F. Berditchevski. 2008. The tumour-

associated antigen L6 (L6-Ag) is recruited to the tetraspanin-enriched microdomains:

implication for tumour cell motility. J Cell Sci 121:685-694.

47. Fleischer, J., H. Breer, and J. Strotmann. 2009. Mammalian olfactory receptors. Front

Cell Neurosci 3:9.

48. Dorsam, R.T., and J.S. Gutkind. 2007. G-protein-coupled receptors and cancer. Nat Rev

Cancer 7:79-94.

49. Bash, R.O., S. Hall, C.F. Timmons, W.M. Crist, M. Amylon, R.G. Smith, and R. Baer.

1995. Does activation of the TAL1 gene occur in a majority of patients with T-cell

acute lymphoblastic leukemia? A pediatric oncology group study. Blood 86:666-676.

50. Muroyama, Y., Y. Fujiwara, S.H. Orkin, and D.H. Rowitch. 2005. Specification of

astrocytes by bHLH protein SCL in a restricted region of the neural tube. Nature

438:360-363.

51. Bradley, C.K., E.A. Takano, M.A. Hall, J.R. Gothert, A.R. Harvey, C.G. Begley, and

J.A. van Eekelen. 2006. The essential haematopoietic transcription factor Scl is also

critical for neuronal development. Eur J Neurosci 23:1677-1689.

52. Feldmesser, E., T. Olender, M. Khen, I. Yanai, R. Ophir, and D. Lancet. 2006.

Widespread ectopic expression of olfactory receptor genes. BMC Genomics 7:121.

53. Neuhaus, E.M., W. Zhang, L. Gelis, Y. Deng, J. Noldus, and H. Hatt. 2009. Activation

of an olfactory receptor inhibits proliferation of prostate cancer cells. J Biol Chem

284:16218-16225

.

HDACis down-regulate TAL1 expression in T-ALL

139

Chapter 5

TAL1/SCL is down-regulated upon histone deacetylase

inhibition in T-cell acute lymphoblastic leukemia cells

Bruno A. Cardoso, Sérgio F. de Almeida, Angelo B. A. Laranjeira, Maria Carmo-

Fonseca, J. Andrés Yunes, Paul J. Coffer and João T. Barata

Adapted from Leukemia, 2011; 25(10): 1578-86.

HDACis down-regulate TAL1 expression in T-ALL

140

Abstract

The transcription factor TAL1 is a major T-cell oncogene associated with poor

prognosis in T-cell Acute Lymphoblastic Leukemia (T-ALL). TAL1 binds histone

deacetylase 1 (HDAC1) and incubation with histone deacetylase inhibitors (HDACis)

promotes apoptosis of leukemia cells derived from TAL1 transgenic mice. Here, we

show for the first time that TAL1 protein expression is strikingly down-regulated upon

HDAC inhibition in T-ALL cells. This is due to decreased TAL1 gene transcription in

cells with intact TAL1 locus, and to impaired TAL1 mRNA translation in cells that

harbor the TAL1d microdeletion and consequently express TAL1 under the control of the

SIL promoter. Notably, HDACi-triggered apoptosis of T-ALL cells is significantly

reversed by TAL1 forced overexpression. Our results indicate that the HDACi-mediated

apoptotic program in T-ALL cells is partially dependent on their capacity to down-

regulate TAL1, and provide support for the therapeutic use of HDACis in T-ALL.

Introduction

T-cell acute lymphoblastic leukemia (T-ALL) is characterized by the clonal

expansion of T-cell progenitors arrested at different stages of development. The T-cell

acute lymphocytic leukemia 1 (TAL1) transcription factor is essential for normal

hematopoeisis. However, TAL1 expression is rapidly down-regulated upon commitment

to the T-cell lineage (1, 2). Importantly, TAL1 is ectopically expressed in 65% of T-

ALL patients (3, 4). Aberrant expression of TAL1 in T-ALL results from relatively rare

non-random translocations that include t(1;14)(p32;q11), t(1;7)(p32;q34),

t(1;3)(p32;q21) and t(1;5)(p32;32) (5-9), and more frequently from a small interstitial

deletion [del(1)p32 or TAL1d] that renders the TAL1 gene expression dependent on the

upstream SIL promoter (10). Bi-allelic transcriptional activation, possibly resulting

from deregulation of the machinery normally involved in TAL1 gene repression during

normal T-cell development, can also account for TAL1 over-expression in some T-ALL

cases, although the precise mechanism is still unknown (11). The relevance of TAL1 in

T-ALL is supported by studies reporting the development of fatal T-cell leukemia in

TAL1 transgenic mice (12-15) and showing that TAL1 expression in T-ALL cell lines is

associated with protection from apoptosis (16-18). Furthermore, TAL1 expression has

been associated with poor prognosis in T-ALL (4).

HDACis down-regulate TAL1 expression in T-ALL

141

Histone acetylation, which plays a pivotal role in chromatin organization and gene

expression, is mainly regulated by two complexes of enzymes. Histone acetyl

transferases (HAT) add acetyl groups to the N-terminus of histones, and histone

deacetylases (HDAC) catalyze the opposite reaction (19). Increased histone acetylation

induces an open chromatin conformation that allows the transcriptional machinery to

access promoters and, in general, drives transcription. HDAC over-expression is

commonly observed in cancer (20), and HDAC inhibitors (HDACis) induce apoptosis

and growth arrest in cancer cell lines (19). Interestingly, gene expression profiling has

shown that cancer cells treated with HDACis not only up-regulate pro-apoptotic and

growth arrest genes but also commonly down-regulate oncogenic and proliferative

genes (21, 22).

TAL1 is a class II helix-loop-helix transcription factor that heterodimerizes with

the class I transcription factors E2A, E2-2 and HEB (23-25) and binds to specific DNA

sequences termed E-boxes (26). In addition, TAL1 was shown to interact with HDAC1

(27), as well as with chromatin remodeling complexes such as mSin3a (27) and HP1

(28), which influence TAL1 transcriptional activity. Moreover, TAL1 interaction with

mSin3a has been observed in pre-leukemic thymocytes from TAL1 transgenic mice, and

HDACi treatment was shown to selectively induce apoptosis of TAL1 transgenic

leukemia cells without affecting TAL1-negative cells (15).

Given that HDACis were previously shown to decrease the expression of different

oncogenes (29-31), we speculated that TAL1 could be regulated by HDACs. We treated

T-ALL cell lines and primary cells with Sodium Butyrate (SB) and Suberoylanilide

Hydroxamic Acid (SAHA) and found that TAL1 protein levels were strikingly reduced

upon treatment with these HDACis. This was due to inhibition of TAL1 gene

transcription in leukemia cells with an intact TAL1 locus, and to decreased protein

translation in cells bearing the TAL1d allele. Moreover, over-expression of TAL1

rescued HDACi-induced T-ALL cell apoptosis. Overall, these results indicate that

HDACis target TAL1 expression in T-ALL, and suggest that the apoptotic effect of

HDAC inhibition in T-ALL cells is partially dependent on TAL1 down-regulation.

Materials and Methods

T-ALL Primary cells and cell lines. T-ALL patient samples were obtained from

peripheral blood and/or bone marrow of patients with high leukemia involvement (85–

HDACis down-regulate TAL1 expression in T-ALL

142

100%). Informed consent and Institutional Review Board approval was obtained for all

sample collections in accordance with the Declaration of Helsinki. Samples were

enriched by density centrifugation over Lympholyte (Cedarlane Laboratories), washed

twice in RPMI 1640 (Invitrogen) supplemented with 10% (vol/vol) FBS and 2 mM l-

glutamine (hereafter referred to as RPMI10 medium), subjected to immunophenotypic

analysis by flow cytometry as described previously (32). The T-ALL cell lines CEM,

Jurkat, PF382 and SupT1 were maintained in RPMI10 medium and split every 2-3 days.

T-ALL primary cells and cell lines were cultured at 37ºC with 5% CO2 in RPMI10

alone (with the appropriate vehicle when necessary), or in RPMI10 plus: Sodium

Butyrate (SB) in the indicated concentrations (Sigma-Aldrich), 5mM Sodium Phenyl

Butyrate (SPB; Biomol International), Suberoylanilide Hydroxamic Acid (SAHA) in

the indicated concentrations (Cayman Chemicals), 150nM Trichostatin A (TSA; Sigma-

Aldrich), 2.5µg/mL Actinomycin D (Act.D; Sigma-Aldrich), 500µM Cyclohexamide

(CHX; Sigma-Aldrich) and 20µM QVD-OPH (Biovision). At the indicated time points,

the cells were harvested and processed as indicated below for assessment of cell

viability, and RNA and protein extraction.

Cloning procedures. The #-empty and #-TAL1 vectors were derived from the

pCCL.sin.cPPT.PGK.GFP.WPRE (33). In the empty vector, ΔLNGFR was removed

and the vector re-ligated. TAL1 gene was subcloned from the pcDNA 3.1 (+) zeo TAL1

vector using the appropriate restriction enzymes.

Production of VSVG-pseudotyped lentiviruses. Vesicular-Stomatitis-Virus-

pseudotyped third-generation lentiviruses were produced as described in Material and

Methods section in Chapter 3 (page 99).

Transduction of T-ALL cells. PF382 cells were transduced with VSVG-pseudotyped

TAL1-expressing lentiviruses. Briefly, 0.5 x 106 cells were incubated in 500µl RPMI10

plus 500µl of the corresponding lentiviral supernatant. The cells were then centrifuged

for 2 h at 2000 rpm at 33ºC, incubated overnight at 37ºC, washed and cultured in fresh

medium. After expansion, cells were sorted for high GFP expression. Viral supernatants

were produced by transient transfection of 293T cells, as described (33).

HDACis down-regulate TAL1 expression in T-ALL

143

Assessment of cell viability. Determination of cell viability was performed by flow

cytometry analysis of Forward Scatter versus Side Scatter (FSC/SSC) distribution using

a FACScalibur (Becton-Dickinson). We have previously confirmed that this strategy

measure lymphocyte viability as accurately as using Annexin V and propidium iodide

staining (32, 34). In experiments using primary T-ALL patient samples viable cells

were counted by trypan-blue exclusion.

Immunobloting. Cell lysates were prepared as described (35) and equal amounts of

protein were analyzed by 12% SDS-PAGE, transferred onto nitrocellulose membranes,

and immunoblotted with the following antibodies or antiserum: Actin (Santa-Cruz

Biotechnology); PARP (Novus Biologicals); phospho-S6 (S235/S236) (Cell signaling

technology); P-Akt/PKB (S473) (Cell signaling technology) and TAL1 (Millipore).

After immunobloting with primary antibodies, immunodetection was performed using

HRP-conjugated anti-mouse IgG (Promega), anti-rabbit IgG (Promega) or anti-goat IgG

(Santa-Cruz Biotecnology) as indicated by the host origin of the primary antibody and

developed by chemiluminescence (Thermo Scientific). Where indicated, densitometry

analysis was performed using Adobe Photoshop CS3 software (version 10.0). Each

band was analyzed with a constant frame and normalized to the respective loading

control.

RNA extraction, RT-PCR and quantitative-PCR. Where indicated, RNA was

extracted using High Pure Isolation Kit (Roche) according to the manufacturer‟s

instructions. For the RT-PCR, up to 1µg of total RNA was reverse transcribed using

SuperScript II (Invitrogen) and random hexamers. Expression of each gene was

normalized to the expression levels of GAPDH, 18S or ABL where indicated. Primers

used for the quantitative-PCR are indicated in Table 5.1. The transcripts were amplified

in 25µl reactions, using 10 µl cDNA, 12.5 µl Power SYBR Green (Applied Biosystems)

and 200nM of each primer, according to manufacturer‟s instructions. All the

amplifications were performed in an ABI PRISM 7500 thermocycler (Applied

Biosystems) for 2 min at 50ºC, 10 min at 95ºC, followed by 45 cycles of 15 seg at 95ºC,

and 1 min at 60ºC.

HDACis down-regulate TAL1 expression in T-ALL

144

Gene Forward primer 5' to 3' Reverse primer 5' to 3'

TAL1 AACAATCGAGTGAAGAGGAG CTTTGGTGTGGGGACCAT

TAL1 E5 TTGGGGAGCCGGATGCCTTC GTAATCTCCATCTCATAGGGGG

TAL1d AAGGGGAGCTAGTGGGAGAAA AGAGCCTGTCGCCAAGAA

p21 CAGCAGAGGAAGACCATGTG GGCGTTTGGAGTGGTAGAAA

GAPDH GGAGTCAACGGATTTGGTCG GACAAGCTTCCCGTTCTCAG

18S GGAGAGGGAGCCTGAGAAACG CGCGGCTGCTGGCACCAGACTT

ABL TGGAGATAACACTCTAAGCATAACTAAAGGT GATGTAGTTGCTTGGGACCCA

Chromatin Immunoprecipitation. For Chromatin Immunoprecipitation (ChIP), 2x108

Jurkat cells were used for each condition. Cells were washed twice in 1x Phosphate

Buffered Saline (PBS) and cross-linked with 1% formaldehyde at room temperature.

Cells were then lysed in SDS lysis buffer and sonicated. Chromatin was pre-cleared for

1 h at 4ºC using protein A-sepharose beads and then incubated overnight with 5µg

rabbit polyclonal antibody against RNA polymerase II (Santa Cruz Biotechnology) and

5µg rabbit polyclonal antibody against H3K9ac (Abcam). DNA-protein complexes were

pulled down with protein A-sepharose beads (Sigma-Aldrich) for 4 h at 4ºC, washed

and eluted in 1% SDS, 0.1 M NaHCO3 elution buffer. Cross-link was reversed

overnight at 65ºC in 0.2M NaCl (the input samples were also reverse cross-linked).

DNA was purified using phenol:chloroform extraction and ethanol precipitation, eluted

in DNase/RNase free water and used for quantitative-RT-PCR analysis. Primers were

designed to amplify specific regions of the TAL1 gene and are indicated in Table 5.2.

Region Forward primer 5'to 3' Reverse primer 5' to 3'

Promoter 1a GGATAGGGAGACTGCCCATTG CACCTCCCAGGGCTTCTTTC

Exon 4 TGAACGGCGTCGCCAAGGAG CGCGTCGCGGCCCTTTAAGT

Exon 6 TCGGCCTTTTGGGGGTGGGT GGGCCCGCCCACAGAAACAA

Statistical analysis. Differences between populations were calculated using unpaired 2-

tailed Student‟s t test or One-way ANOVA, when appropriate (p<0.05 was considered

significant).

Table 5.1. List of primers used in quantitative-PCR.

Table 5.2. List of primers used in Chromatin Immunoprecipitation experiments.

HDACis down-regulate TAL1 expression in T-ALL

145

Results

HDAC inhibition down-regulates TAL1 protein levels in T-ALL cells

HDACis are potent inducers of apoptosis in T-cell tumors derived from TAL1

transgenic mice (15). Since TAL1 has been implicated in prevention of T-ALL cell

apoptosis (16-18), we hypothesized that TAL1 expression and/or activity could be

altered by treatment with HDACi. To answer this question, we treated several T-ALL

cell lines with the HDACi SB. TAL1 protein expression significantly decreased in all

the cell lines tested (Figure 5.1A,B). Similar results were obtained with other HDACis,

including, SPB, TSA and SAHA (Figure 5.1B). Moreover, the negative effect of

HDACis on TAL1 protein expression was time- (Figure 5.1C,D) and dose-dependent

(Figure 5.1E,F).

HDACis down-regulate TAL1 expression in T-ALL

146

HDACi-mediated TAL1 protein down-regulation in T-ALL cells is not due

to increased apoptosis or protein degradation.

HDACis were shown to induce apoptosis of acute lymphoblastic leukemia cell

lines, including T-ALL (36). Analysis of PARP cleavage indicated that both SB (Figure

5.2A) and SAHA (Figure 5.2B) promoted apoptosis of Jurkat T-ALL cells. The

temporal down-regulation of TAL1 (Figure 5.1E,F) coincided with the induction of

apoptosis (Figure 5.2A,B). To exclude the possibility that TAL1 down-regulation

resulted from increased apoptosis, we treated Jurkat and PF382 cells with the pan-

caspase inhibitor QVD-OPH, and analyzed TAL1 protein expression upon incubation

with HDACis. Although QVD-OPH significantly rescued apoptosis in both cell lines, as

shown by analysis of PARP cleavage (Figure 5.2C) and percent cell viability (Figure

5.2D), it did not restore TAL1 protein levels (Figure 5.2C).

Several reports indicate that HDACis affect protein stability, inducing degradation

of oncogenes and cellular proteins (29, 37). To test whether protein degradation could

play a role in the TAL1 protein down-regulation induced by HDACis, we treated Jurkat

cells (Figure 5.2E) with the protein translation inhibitor Cycloheximide (CHX). The

half-life of TAL1 protein, which is roughly 6 h in Jurkat cells, is not significantly

altered by treatment with SB (Figure 5.2F), indicating that HDACis do not have a major

effect on TAL1 protein stability. Similar results were obtained in PF382 cells upon

treatment with CHX and SB, although TAL1 protein half-life was significantly longer

in these cells (around 12-16 h; data not shown).

Figure 5.1. HDACis down-regulate TAL1 protein in T-ALL cells. T-ALL cell lines

treated with HDACi, lysed and analyzed by immunoblot for the expression of TAL1. Actin

was used as loading control. (A) Jurkat, SupT1 and PF382 cells were treated for 24 h with the

indicated concentrations of SB. (B) Jurkat, SupT1, PF382 and CEM cells were treated for 24

h with 5mM SB, 5mM SPB, 150nM or 10µM SAHA. (C-F) Jurkat cells were treated with

5mM SB (C) or 2µM SAHA (D) for the indicated time points or treated for 24 h with

increasing concentrations of SB (E) or SAHA (F). Data are representative of at least three

independent experiments.

HDACis down-regulate TAL1 expression in T-ALL

147

Figure 5.2. HDACi-mediated TAL1 protein down-regulation is not due to increased

apoptosis or increased protein degradation. (A, B) Jurkat cells were treated for 24 h with

5mM SB (A) or 2µM SAHA (B). At the indicated time points the cells were lysed and PARP

cleavage was analyzed by immunoblot. Actin was used as loading control. (C, D) Jurkat and

PF382 were incubated for 24 h with the pan-caspase inhibitor QVD-OPH (20µM), SB (5mM)

or both. (C) The cells were lysed and TAL1 expression and PARP cleavage analyzed by

immunoblot. Actin was used as loading control. (D) Cell viability was determined by flow

cytometry analyzis of FSC/SSC distribution. Viability index was calculated as described in

“Materials and Methods”. Mean values ± standard deviation of duplicates of each condition are

represented ( ** p<0.01; *** p<0.001). (E, F) Jurkat cells were treated with 500µM CHX or

the combination of CHX and 5mM SB. At the indicated time points the cells were lysed and

TAL1 expression analyzed by immunoblot. Actin was used as a loading control (E). TAL1

protein levels were determined by densitometry analysis and are normalized to Actin (F). The

data are representative of two independent experiments.

HDACis down-regulate TAL1 expression in T-ALL

148

HDAC inhibition down-regulates TAL1 transcript levels without affecting

TAL1 splicing or mRNA stability

HDACis have been reported to diminish the transcript levels of specific genes by

inhibiting gene transcription (31) and by decreasing mRNA stability (30, 38). Hence,

we next evaluated whether HDACis decreased TAL1 protein expression in T-ALL cells

through down-regulation of TAL1 mRNA levels. Treatment of Jurkat and SupT1 cells

with SB and SAHA for 24 h induced a dramatic down-regulation of TAL1 mRNA levels

(Figure 5.3A). Similar results were obtained using three primary leukemia samples

collected from T-ALL patients at diagnosis (Figure 5.3B). Moreover, down-regulation

of TAL1 mRNA levels was rapid (Figure 5.3C,D) and dose-dependent (Figure 5.3E,F).

Notably, the decrease in TAL1 mRNA was not due to increased apoptosis

(Supplementary Figure 5.1) or to a generalized negative effect on gene expression, since

HDACi treatment clearly upregulated the transcript levels of CDKN1A, the gene coding

for the cell cycle inhibitor p21cip1

(Supplementary Figure 5.2), in accordance with

previous reports (39, 40).

Given the rapid down-regulation of TAL1 transcript levels and the fact that the

TAL1 gene is composed of several exons (Supplementary Figure 5.3A), we

hypothesized that TAL1 splicing was impaired upon HDAC inhibition, leading to an

accumulation of unspliced RNA that would result in decreased detection of the

processed TAL1 mRNA. To address this possibility, we treated Jurkat cells for up to 6 h

with 5mM SB. No difference between the levels of total and processed TAL1 transcripts

was observed in any of the time points analyzed (Figure 5.3G), suggesting that HDACi

treatment did not affect TAL1 mRNA splicing.

Several lines of evidence indicate that HDACis may decrease mRNA stability (30,

38). To test whether this could be the cause for decreased TAL1 mRNA expression, we

treated Jurkat cells with Actinomycin D (Act D), a known inhibitor of gene

transcription.

We treated Jurkat cells with 5mM SB, 2.5µg/mL Act D or the combination of

both inhibitors for 6 h and analyzed TAL1 mRNA levels. Treatment with Act D

decreased TAL1 mRNA similarly to SB, and the combination of both did not further

down-regulate TAL1 transcript levels (Figure 5.3H). These data suggest that HDACi

treatment did not affect TAL1 mRNA stability.

HDACis down-regulate TAL1 expression in T-ALL

149

HDACis down-regulate TAL1 expression in T-ALL

150

HDAC inhibition abrogates TAL1 transcription in TAL1-positive T-ALL

cells with an intact TAL1 locus

Since neither mRNA splicing nor stability were significantly affected by HDAC

inhibition, we next asked whether HDACis could directly affect TAL1 gene

transcription. We treated Jurkat cells with 5mM SB for 4 h and performed Chromatin

Immunoprecipition (ChIP) to analyze the binding of RNA polymerase II and the levels

of Histone H3 Lysine-9 acetylation (H3K9Ac), which is a marker of actively

transcribed euchromatin (41). SB incubation abrogated the binding of RNA polymerase

II to the TAL1 promoter 1a and to exon 4 (Figure 5.3I). It is interesting to note that

TAL1 exon 4 had a higher binding of RNA polymerase II than the promoter 1a in the

control condition (Figure 5.3I), suggesting that the TAL1 promoter IV (42) located

within this exon is active. Notably, SB incubation substantially decreased H3K9Ac,

both at TAL1 promoter 1a and at exon 4 (Figure 5.3J). Altogether, these results clearly

indicate that HDACis actively reduce binding of RNA polymerase II to TAL1 promoters

and inhibit TAL1 gene transcription.

Figure 5.3. HDACi down-regulate TAL1 through inhibition of TAL1 gene transcription

in TAL1wt

T-ALL cells lines. TAL1 mRNA levels from T-ALL cell lines and primary cells

were analyzed by quantitative-PCR, normalized to GAPDH (A, C-G), ABL (B) or 18S (H)

housekeeping genes and depicted as relative values to each control condition. (A) Jurkat and

SupT1 cells were treated with 5mM SB or 10µM SAHA for 24 h. (B) Primary T-ALL cells

collected from 3 different patients at diagnosis were treated with 5mM SB and 5µM SAHA

for 6 h. (C, D) Jurkat cells were treated with 5mM SB (C) and 2µM SAHA (D) for the

indicated time. (E, F) Jurkat cells were treated for 6 h with increasing concentrations of SB

(E) and SAHA (F). (G) Jurkat cells were incubated with 5mM SB, for the indicated time,

and TAL1 mRNA was amplified with primers that allow the detection of both processed and

total TAL1 transcripts (Supplementary figure 2B). (H) Jurkat cells were incubated with 5mM

SB, 2.5µg/mL Act.D or both, for the indicated time. (I, J) Jurkat cells were treated with

5mM SB for 4 h, cells were lysed and ChIP was performed to evaluate the binding of RNA

polymerase II (I) and H3K9Ac (J) to the indicated regions of the TAL1 locus. Fold

enrichment relative to the input is indicated. (A-J) Values represent mean ± standard

deviation of duplicates (* p<0.05; ** p<0.01; *** p<0.001).

HDACis down-regulate TAL1 expression in T-ALL

151

HDAC inhibition up-regulates TAL1 transcripts in T-ALL cells with TAL1d

As shown above, cell lines with an intact TAL1 locus (hereafter referred to as

TAL1wt

), such as Jurkat and SupT1, down-regulated TAL1 protein levels after HDACi

treatment, due to decreased TAL1 mRNA levels that resulted from diminished gene

transcription. However, we found that other T-ALL cell lines, such as PF382 and CEM,

paradoxically up-regulated TAL1 transcript levels upon incubation with HDACis

(Figure 5.4A), despite the fact that TAL1 protein expression was clearly decreased by

all the HDACis tested (Figure 5.1A,B).

We speculated that this could be due to the fact that TAL1 gene expression is not

driven by its native promoters in these cell lines, in such way that HDACi treatment

would not negatively affect TAL1 transcription. Similar to primary patient samples,

some TAL1+ T-ALL cell lines display a small interstitial deletion in the TAL1 promoter

(TAL1d) that renders TAL1 gene transcription dependent on regulatory elements of the

upstream gene SIL (10) (Supplementary Figure 5.4A).

HDACis down-regulate TAL1 expression in T-ALL

152

By using primers that specifically detect SIL-TAL1 fusion transcripts (43), we

confirmed that PF382 cells (Supplementary Figure 5.4B, right panel) and CEM (data

not shown) displayed the TAL1d microdelection and up-regulated TAL1 mRNA levels

in response to HDACi treatment (Supplementary Figure 5.4B, right panel, and data not

shown). In contrast, we did not detect SIL-TAL1 fusion transcripts in Jurkat cells

(Supplementary Figure 5.3B left panel) or SupT1 cells (data not shown).

HDAC inhibition down-regulates TAL1 protein levels by decreasing

translation in T-ALL cells with TAL1d

Next, we sought to determine the mechanism by which HDACis decreased TAL1

protein expression in TAL1d cell lines while augmenting TAL1 transcript levels. Our

results indicated that HDACi treatment did not affect TAL1 protein stability in PF382

cells (data not shown), excluding increased protein degradation as a compensatory

mechanism for increased TAL1 mRNA expression. Comparison of the kinetics of TAL1

protein down-regulation induced by HDACis in Jurkat (TAL1wt

) and PF382 (TAL1d)

cells showed that SB induced faster down-regulation of TAL1 protein in Jurkat cells

than in PF382 cells (Figure 5.4B). A recent report demonstrated that SAHA inhibits

Figure 5.4. HDACis down-regulate TAL1 by affecting TAL1 protein translation in

TAL1d T-ALL cell lines. (A) PF382 and CEM cells were treated with 5mM SB or 10µM

SAHA for 24 h. TAL1 mRNA levels were analyzed by quantitative-PCR, normalized to the

levels of GAPDH and depicted as relative values to the medium control condition. Values

indicate mean ± standard deviation of duplicates. (B) Jurkat and PF382 cells were treated

with 5mM SB. At the indicated time points, the cells were lysed and analyzed by

immunoblot for the expression of TAL1. Actin was used as loading control. TAL1 protein

levels were quantified by densitometry analysis, normalized to Actin and depicted as

relative values to the medium control condition at 6 h of treatment. (C) PF382 cells were

incubated for 6 h with 500µM CHX, washed, and then treated for further 24 h with 5mM

SB. Cells were lysed in the indicated time points that represent the time point where SB

was added to the cells. TAL1 expression was analyzed by immunoblot and Actin used as a

loading control. TAL1 protein levels were quantified by densitometry analysis, normalized

to Actin and depicted as relative values to the medium control condition at 6 h of

treatment. The data are representative of at least three independent experiments.

HDACis down-regulate TAL1 expression in T-ALL

153

cyclin D1 translation (44). Therefore, we speculated that HDACi impaired TAL1

protein translation in TAL1d cells and thereby negatively regulated TAL1 protein levels.

To test this hypothesis, we pretreated PF382 cells for 6 h with CHX, and then removed

the translation inhibitor to allow de novo protein synthesis. SB was incubated for

additional 24 h to analyze its effect on de novo translation of TAL1. Incubation with SB

inhibited TAL1 protein translation (Figure 5.4C), suggesting that HDAC inhibition

impaired TAL1 protein translation in TAL1d cell lines.

Forced TAL1 expression partially rescues T-ALL cell death induced by

HDAC inhibition

HDACis were demonstrated to induce apoptosis in human leukemia cell lines (36,

45) and primary cells (46). In accordance, we observed that primary T-ALL samples

(Supplementary Figure 5.5A) and cell lines (Supplementary Figure 5.5B) entered

apoptosis when treated with different HDACis. TAL1 expression was shown to prevent

apoptosis of T-ALL cells (16, 17), and HDACis were reported to promote cell death of

TAL1-expressing mouse leukemia cells (15). Thus, we next compared the efficacy of

HDAC inhibition upon forced expression of TAL1 in T-ALL cells. We transduced

PF382 (Figure 5.5A) and Jurkat (Supplementary Figure 5.6) cells with a lentiviral

vector driving the expression of TAL1. Forced expression of TAL1 significantly

reversed T-ALL cell death induced by treatment with as shown by the viability index

(Figure 5.5A and Supplementary Figure S6) and PARP cleavage (Figure 5.5B). These

results suggest that HDACis promote apoptosis of T-ALL cells in part via down-

regulation of TAL1.

Discussion

HDACis affect global gene expression. In cancer cells, HDACis have been shown

to induce the transcription of genes associated with apoptosis and cell cycle arrest, while

decreasing the expression of oncogenes and genes that promote proliferation (21, 22,

29-31). Here, we showed for the first time that TAL1, a major T-cell oncogene, was

strikingly down-regulated in T-ALL cells upon treatment with HDACi and that TAL1

forced expression partially reversed the pro-apoptotic effect of HDACis on the leukemic

cells.

HDACis down-regulate TAL1 expression in T-ALL

154

TAL1 ectopic expression in T-ALL cells can result from different non-random

chromosomal translocations (5-9) that, for example, juxtapose the promoter region of

TCR genes to the TAL1 locus. More frequently, TAL1 is expressed due to a small

interstitial deletion (TAL1d) that places TAL1 under the control of the regulatory

elements of the SIL locus (10). In both instances, TAL1 over-expression results from the

presence of a non-native „TAL1 promoter‟ that aberrantly drives TAL1 transcription. In

Figure 5.5. Enforced TAL1 expression partially rescues HDACi-mediated T-ALL cell

death. (A, B) PF382 cells were transduced with empty or TAL1 expressing lentiviruses and

incubated for 24 h with the indicated concentrations of SB. (A) Viability was determined by

flow cytometry analysis of FSC/SSC distribution. (B) Cells were lysed and TAL1 expression

and PARP cleavage analyzed by immunoblot. Actin was used as loading control. The data are

representative of at least two independent experiments.

HDACis down-regulate TAL1 expression in T-ALL

155

most cases, however, TAL1 ectopic expression results from other, as yet unknown,

mechanisms that apparently do not involve genomic alterations in the TAL1 locus

(TAL1wt

). In these cases TAL1 expression is aberrantly promoted by native regulatory

elements, perhaps due to epigenetic alterations affecting the chromatin structure. Our

present studies indicate that HDACis negatively affected TAL1 gene transcription in

TAL1wt

T-ALL cells by suppressing the binding of RNA polymerase II to the TAL1

promoter(s). In contrast, HDACis up-regulated TAL1 mRNA levels in TAL1d cells

(Supplementary Figure 5.7). This discrepancy likely reflects differences in the

respective promoters and their regulation. Normal T-cell precursors do not express

TAL1, which suggests that TAL1 ectopic expression in TAL1wt

cells results from an

aberrantly accessible TAL1 locus and/or from the inhibition of negative regulators of

TAL1 transcription. It is possible that HDACs have been selected by T-ALL cells to

partake in this process. In this regard, it is noteworthy that the transcripts of HDAC1 and

HDAC4 were recently shown to be highly expressed in primary T-ALL patient samples

(47). Whether HDAC1 and HDAC4 positively regulate TAL1 gene transcription in T-

ALL cells warrants investigation. HDACis can also induce the acetylation of proteins

other than histones (48). Thus, one can picture at least two mechanisms by which

HDACis can down-regulate TAL1 gene transcription: histone acetylation nearby the

promoter of a negative regulator of TAL1 gene expression (with consequent increase in

its transcription) and/or direct acetylation and functional activation of the TAL1

repressor. Whatever the mechanism, HDACis down-regulate TAL1 mRNA expression

in TAL1wt

similarly to what has been frequently reported for other oncogenes (30, 31,

49). In TAL1d T-ALL cells, TAL1 is under the control of the SIL promoter that is

normally active in hematopoietic cells (50). In this scenario, it is not surprising that

HDACis act by inducing an open-chromatin conformation that further activates TAL1

transcription.

TAL1 protein levels decreased upon treatment with HDACis in both TAL1wt

and

TAL1d cells, indicating the existence of an additional mechanism of regulation that

counterbalances increased TAL1 mRNA expression in the latter. Indeed, we found that

HDACis impair TAL1 translation, leading to a slow but significant decrease in TAL1

protein levels (Supplementary Figure 5.7). It is probable that HDACis have the potential

to inhibit TAL1 translation also in TAL1wt

T-ALL cells, although the rapid shutdown of

TAL1 gene transcription in these cells renders this mechanism irrelevant or vestigial. It

has been shown that treatment of mantle cell lymphoma cells with SAHA abrogates

HDACis down-regulate TAL1 expression in T-ALL

156

cyclin D1 translation, by direct inhibition of PI3K activity (44). However, inhibition of

PI3K or its downstream target mTOR does not mimic the effect of HDACis on TAL1

protein expression (Supplementary Figure 5.8), suggesting that a different pathway

controls TAL1 translation in T-ALL.

In summary, we showed that HDACis promote human T-ALL cell death at least

in part via a previously unrecognized mechanism involving down-regulation of TAL1

expression. Since TAL1 is one of the most commonly deregulated oncogenes in T-ALL,

defining a major cytogenetic subgroup with bad prognosis, our data provide further

rationale for the inclusion of HDACis into T-ALL therapeutic regimens.

References

1. Herblot, S., A.M. Steff, P. Hugo, P.D. Aplan, and T. Hoang. 2000. SCL and

LMO1 alter thymocyte differentiation: inhibition of E2A-HEB function and pre-

T alpha chain expression. Nat Immunol 1:138-144.

2. Pike-Overzet, K., D. de Ridder, F. Weerkamp, M.R. Baert, M.M. Verstegen,

M.H. Brugman, S.J. Howe, M.J. Reinders, A.J. Thrasher, G. Wagemaker, J.J.

van Dongen, and F.J. Staal. 2007. Ectopic retroviral expression of LMO2, but

not IL2Rgamma, blocks human T-cell development from CD34+ cells:

implications for leukemogenesis in gene therapy. Leukemia 21:754-763.

3. Bash, R.O., S. Hall, C.F. Timmons, W.M. Crist, M. Amylon, R.G. Smith, and R.

Baer. 1995. Does activation of the TAL1 gene occur in a majority of patients

with T-cell acute lymphoblastic leukemia? A pediatric oncology group study.

Blood 86:666-676.

4. Ferrando, A.A., D.S. Neuberg, J. Staunton, M.L. Loh, C. Huard, S.C. Raimondi,

F.G. Behm, C.H. Pui, J.R. Downing, D.G. Gilliland, E.S. Lander, T.R. Golub,

and A.T. Look. 2002. Gene expression signatures define novel oncogenic

pathways in T cell acute lymphoblastic leukemia. Cancer Cell 1:75-87.

5. Chen, Q., J.T. Cheng, L.H. Tasi, N. Schneider, G. Buchanan, A. Carroll, W.

Crist, B. Ozanne, M.J. Siciliano, and R. Baer. 1990. The tal gene undergoes

chromosome translocation in T cell leukemia and potentially encodes a helix-

loop-helix protein. Embo J 9:415-424.

6. Begley, C.G., P.D. Aplan, M.P. Davey, K. Nakahara, K. Tchorz, J. Kurtzberg,

M.S. Hershfield, B.F. Haynes, D.I. Cohen, T.A. Waldmann, and et al. 1989.

HDACis down-regulate TAL1 expression in T-ALL

157

Chromosomal translocation in a human leukemic stem-cell line disrupts the T-

cell antigen receptor delta-chain diversity region and results in a previously

unreported fusion transcript. Proc Natl Acad Sci U S A 86:2031-2035.

7. Fitzgerald, T.J., G.A. Neale, S.C. Raimondi, and R.M. Goorha. 1991. c-tal, a

helix-loop-helix protein, is juxtaposed to the T-cell receptor-beta chain gene by a

reciprocal chromosomal translocation: t(1;7)(p32;q35). Blood 78:2686-2695.

8. Aplan, P.D., S.C. Raimondi, and I.R. Kirsch. 1992. Disruption of the SCL gene

by a t(1;3) translocation in a patient with T cell acute lymphoblastic leukemia. J

Exp Med 176:1303-1310.

9. Francois, S., E. Delabesse, L. Baranger, M. Dautel, C. Foussard, M. Boasson, O.

Blanchet, O. Bernard, E.A. Macintyre, and N. Ifrah. 1998. Deregulated

expression of the TAL1 gene by t(1;5)(p32;31) in patient with T-cell acute

lymphoblastic leukemia. Genes Chromosomes Cancer 23:36-43.

10. Aplan, P.D., D.P. Lombardi, G.H. Reaman, H.N. Sather, G.D. Hammond, and

I.R. Kirsch. 1992. Involvement of the putative hematopoietic transcription factor

SCL in T-cell acute lymphoblastic leukemia. Blood 79:1327-1333.

11. Ferrando, A.A., S. Herblot, T. Palomero, M. Hansen, T. Hoang, E.A. Fox, and

A.T. Look. 2004. Biallelic transcriptional activation of oncogenic transcription

factors in T-cell acute lymphoblastic leukemia. Blood 103:1909-1911.

12. Kelliher, M.A., D.C. Seldin, and P. Leder. 1996. Tal-1 induces T cell acute

lymphoblastic leukemia accelerated by casein kinase IIalpha. Embo J 15:5160-

5166.

13. Aplan, P.D., C.A. Jones, D.S. Chervinsky, X. Zhao, M. Ellsworth, C. Wu, E.A.

McGuire, and K.W. Gross. 1997. An scl gene product lacking the transactivation

domain induces bony abnormalities and cooperates with LMO1 to generate T-

cell malignancies in transgenic mice. Embo J 16:2408-2419.

14. O'Neil, J., M. Billa, S. Oikemus, and M. Kelliher. 2001. The DNA binding

activity of TAL-1 is not required to induce leukemia/lymphoma in mice.

Oncogene 20:3897-3905.

15. O'Neil, J., J. Shank, N. Cusson, C. Murre, and M. Kelliher. 2004. TAL1/SCL

induces leukemia by inhibiting the transcriptional activity of E47/HEB. Cancer

Cell 5:587-596.

16. Leroy-Viard, K., M.A. Vinit, N. Lecointe, H. Jouault, U. Hibner, P.H. Romeo,

and D. Mathieu-Mahul. 1995. Loss of TAL-1 protein activity induces premature

HDACis down-regulate TAL1 expression in T-ALL

158

apoptosis of Jurkat leukemic T cells upon medium depletion. Embo J 14:2341-

2349.

17. Bernard, M., E. Delabesse, S. Novault, O. Hermine, and E.A. Macintyre. 1998.

Antiapoptotic effect of ectopic TAL1/SCL expression in a human leukemic T-

cell line. Cancer Res 58:2680-2687.

18. Park, S.T., G.P. Nolan, and X.H. Sun. 1999. Growth inhibition and apoptosis

due to restoration of E2A activity in T cell acute lymphoblastic leukemia cells. J

Exp Med 189:501-508.

19. Schrump, D.S. 2009. Cytotoxicity mediated by histone deacetylase inhibitors in

cancer cells: mechanisms and potential clinical implications. Clin Cancer Res

15:3947-3957.

20. Nakagawa, M., Y. Oda, T. Eguchi, S. Aishima, T. Yao, F. Hosoi, Y. Basaki, M.

Ono, M. Kuwano, M. Tanaka, and M. Tsuneyoshi. 2007. Expression profile of

class I histone deacetylases in human cancer tissues. Oncol Rep 18:769-774.

21. Glaser, K.B., M.J. Staver, J.F. Waring, J. Stender, R.G. Ulrich, and S.K.

Davidsen. 2003. Gene expression profiling of multiple histone deacetylase

(HDAC) inhibitors: defining a common gene set produced by HDAC inhibition

in T24 and MDA carcinoma cell lines. Mol Cancer Ther 2:151-163.

22. Peart, M.J., G.K. Smyth, R.K. van Laar, D.D. Bowtell, V.M. Richon, P.A.

Marks, A.J. Holloway, and R.W. Johnstone. 2005. Identification and functional

significance of genes regulated by structurally different histone deacetylase

inhibitors. Proc Natl Acad Sci U S A 102:3697-3702.

23. Hsu, H.L., I. Wadman, and R. Baer. 1994. Formation of in vivo complexes

between the TAL1 and E2A polypeptides of leukemic T cells. Proc Natl Acad

Sci U S A 91:3181-3185.

24. Bernard, M., E. Delabesse, L. Smit, C. Millien, I.R. Kirsch, J.L. Strominger, and

E.A. Macintyre. 1998. Helix-loop-helix (E2-5, HEB, TAL1 and Id1) protein

interaction with the TCRalphadelta enhancers. Int Immunol 10:1539-1549.

25. Tanaka, A., F. Itoh, S. Itoh, and M. Kato. 2009. TAL1/SCL relieves the E2-2-

mediated repression of VEGFR2 promoter activity. J Biochem 145:129-135.

26. Hsu, H.L., L. Huang, J.T. Tsan, W. Funk, W.E. Wright, J.S. Hu, R.E. Kingston,

and R. Baer. 1994. Preferred sequences for DNA recognition by the TAL1 helix-

loop-helix proteins. Mol Cell Biol 14:1256-1265.

HDACis down-regulate TAL1 expression in T-ALL

159

27. Huang, S., and S.J. Brandt. 2000. mSin3A regulates murine erythroleukemia cell

differentiation through association with the TAL1 (or SCL) transcription factor.

Mol Cell Biol 20:2248-2259.

28. Wen, J., S. Huang, S.D. Pack, X. Yu, S.J. Brandt, and C.T. Noguchi. 2005.

Tal1/SCL binding to pericentromeric DNA represses transcription. J Biol Chem

280:12956-12966.

29. Nimmanapalli, R., L. Fuino, P. Bali, M. Gasparetto, M. Glozak, J. Tao, L.

Moscinski, C. Smith, J. Wu, R. Jove, P. Atadja, and K. Bhalla. 2003. Histone

deacetylase inhibitor LAQ824 both lowers expression and promotes proteasomal

degradation of Bcr-Abl and induces apoptosis of imatinib mesylate-sensitive or -

refractory chronic myelogenous leukemia-blast crisis cells. Cancer Res 63:5126-

5135.

30. Krishnan, M., A.B. Singh, J.J. Smith, A. Sharma, X. Chen, S. Eschrich, T.J.

Yeatman, R.D. Beauchamp, and P. Dhawan. 2010. HDAC inhibitors regulate

claudin-1 expression in colon cancer cells through modulation of mRNA

stability. Oncogene 29:305-312.

31. Yamaguchi, K., A. Lantowski, A.J. Dannenberg, and K. Subbaramaiah. 2005.

Histone deacetylase inhibitors suppress the induction of c-Jun and its target

genes including COX-2. J Biol Chem 280:32569-32577.

32. Silva, A., J.A. Yunes, B.A. Cardoso, L.R. Martins, P.Y. Jotta, M. Abecasis, A.E.

Nowill, N.R. Leslie, A.A. Cardoso, and J.T. Barata. 2008. PTEN

posttranslational inactivation and hyperactivation of the PI3K/Akt pathway

sustain primary T cell leukemia viability. J Clin Invest 118:3762-3774.

33. Amendola, M., M.A. Venneri, A. Biffi, E. Vigna, and L. Naldini. 2005.

Coordinate dual-gene transgenesis by lentiviral vectors carrying synthetic

bidirectional promoters. Nat Biotechnol 23:108-116.

34. Barata, J.T., A. Silva, J.G. Brandao, L.M. Nadler, A.A. Cardoso, and V.A.

Boussiotis. 2004. Activation of PI3K is indispensable for interleukin 7-mediated

viability, proliferation, glucose use, and growth of T cell acute lymphoblastic

leukemia cells. J Exp Med 200:659-669.

35. Silva, A., P.Y. Jotta, A.B. Silveira, D. Ribeiro, S.R. Brandalise, J.A. Yunes, and

J.T. Barata. 2010. Regulation of PTEN by CK2 and Notch1 in primary T-cell

acute lymphoblastic leukemia: rationale for combined use of CK2- and gamma-

secretase inhibitors. Haematologica 95:674-678.

HDACis down-regulate TAL1 expression in T-ALL

160

36. Tsapis, M., M. Lieb, F. Manzo, P. Shankaranarayanan, R. Herbrecht, P. Lutz,

and H. Gronemeyer. 2007. HDAC inhibitors induce apoptosis in glucocorticoid-

resistant acute lymphatic leukemia cells despite a switch from the extrinsic to

the intrinsic death pathway. Int J Biochem Cell Biol 39:1500-1509.

37. Cha, T.L., M.J. Chuang, S.T. Wu, G.H. Sun, S.Y. Chang, D.S. Yu, S.M. Huang,

S.K. Huan, T.C. Cheng, T.T. Chen, P.L. Fan, and P.W. Hsiao. 2009. Dual

degradation of aurora A and B kinases by the histone deacetylase inhibitor

LBH589 induces G2-M arrest and apoptosis of renal cancer cells. Clin Cancer

Res 15:840-850.

38. Januchowski, R., M. Dabrowski, H. Ofori, and P.P. Jagodzinski. 2007.

Trichostatin A down-regulate DNA methyltransferase 1 in Jurkat T cells.

Cancer Lett 246:313-317.

39. Fandy, T.E., S. Shankar, D.D. Ross, E. Sausville, and R.K. Srivastava. 2005.

Interactive effects of HDAC inhibitors and TRAIL on apoptosis are associated

with changes in mitochondrial functions and expressions of cell cycle regulatory

genes in multiple myeloma. Neoplasia 7:646-657.

40. Siavoshian, S., J.P. Segain, M. Kornprobst, C. Bonnet, C. Cherbut, J.P.

Galmiche, and H.M. Blottiere. 2000. Butyrate and trichostatin A effects on the

proliferation/differentiation of human intestinal epithelial cells: induction of

cyclin D3 and p21 expression. Gut 46:507-514.

41. Pokholok, D.K., C.T. Harbison, S. Levine, M. Cole, N.M. Hannett, T.I. Lee,

G.W. Bell, K. Walker, P.A. Rolfe, E. Herbolsheimer, J. Zeitlinger, F. Lewitter,

D.K. Gifford, and R.A. Young. 2005. Genome-wide map of nucleosome

acetylation and methylation in yeast. Cell 122:517-527.

42. Bernard, O., O. Azogui, N. Lecointe, F. Mugneret, R. Berger, C.J. Larsen, and

D. Mathieu-Mahul. 1992. A third tal-1 promoter is specifically used in human T

cell leukemias. J Exp Med 176:919-925.

43. Delabesse, E., M. Bernard, J. Landman-Parker, F. Davi, D. Leboeuf, B. Varet, F.

Valensi, and E.A. Macintyre. 1997. Simultaneous SIL-TAL1 RT-PCR detection

of all tal(d) deletions and identification of novel tal(d) variants. Br J Haematol

99:901-907.

44. Kawamata, N., J. Chen, and H.P. Koeffler. 2007. Suberoylanilide hydroxamic

acid (SAHA; vorinostat) suppresses translation of cyclin D1 in mantle cell

lymphoma cells. Blood 110:2667-2673.

HDACis down-regulate TAL1 expression in T-ALL

161

45. Bernhard, D., M.J. Ausserlechner, M. Tonko, M. Loffler, B.L. Hartmann, A.

Csordas, and R. Kofler. 1999. Apoptosis induced by the histone deacetylase

inhibitor sodium butyrate in human leukemic lymphoblasts. Faseb J 13:1991-

2001.

46. Batova, A., L.E. Shao, M.B. Diccianni, A.L. Yu, T. Tanaka, A. Rephaeli, A.

Nudelman, and J. Yu. 2002. The histone deacetylase inhibitor AN-9 has

selective toxicity to acute leukemia and drug-resistant primary leukemia and

cancer cell lines. Blood 100:3319-3324.

47. Moreno, D.A., C.A. Scrideli, M.A. Cortez, R. de Paula Queiroz, E.T. Valera, V.

da Silva Silveira, J.A. Yunes, S.R. Brandalise, and L.G. Tone. 2010. Differential

expression of HDAC3, HDAC7 and HDAC9 is associated with prognosis and

survival in childhood acute lymphoblastic leukaemia. Br J Haematol 150:665-

673.

48. Dokmanovic, M., C. Clarke, and P.A. Marks. 2007. Histone deacetylase

inhibitors: overview and perspectives. Mol Cancer Res 5:981-989.

49. You, J.S., J.K. Kang, E.K. Lee, J.C. Lee, S.H. Lee, Y.J. Jeon, D.H. Koh, S.H.

Ahn, D.W. Seo, H.Y. Lee, E.J. Cho, and J.W. Han. 2008. Histone deacetylase

inhibitor apicidin downregulates DNA methyltransferase 1 expression and

induces repressive histone modifications via recruitment of corepressor complex

to promoter region in human cervix cancer cells. Oncogene 27:1376-1386.

50. Aplan, P.D., D.P. Lombardi, and I.R. Kirsch. 1991. Structural characterization

of SIL, a gene frequently disrupted in T-cell acute lymphoblastic leukemia. Mol

Cell Biol 11:5462-5469.

HDACis down-regulate TAL1 expression in T-ALL

162

Supplementary figure 5.1. HDACi-mediated down-regulation of TAL1 mRNA is not

due to increased apoptosis in TAL1wt

T-ALL cell lines. Jurkat cells were treated for 24 h

with 5mM SB, 20µM QVD-OPH or both. RNA was extracted and TAL1 transcripts

analyzed by quantitative-PCR. TAL1 mRNA levels were normalized to the levels of the

GAPDH housekeeping gene and normalized again to medium control condition. Values

indicate mean ± standard deviation of duplicates. The data is representative of two

independent experiments.

Supplementary figure 5.2. HDACis up-regulates CDKN1A/p21 mRNA expression.

Jurkat cells were treated with 5mM SB for 24 h. The mRNA levels of CDKN1A/p21

were analyzed by quantitative -PCR, and normalized to GAPDH and to medium control

condition. Values indicate mean ± standard deviation of duplicates (* p<0.05). The data

is representative of two independent experiments.

HDACis down-regulate TAL1 expression in T-ALL

163

Supplementary figure 5.3. Schematic representation of TAL1 locus and the primers

used to detect total and processed TAL1 mRNA. (A) TAL1 locus is schematic summarized.

TAL1 exons are represented as boxes. White boxes depict untranslated exons or regions,

while the black boxes show the translated exons and regions [adapted from (10)]. The SIL

locus is located at the 5‟ and the MAP17 locus is located at the 3‟ end of the TAL1 locus. (B)

Primers that detect total TAL1 mRNA were designed to bind exclusively within exon 5 in

order to detect both the processed and unprocessed transcripts. Primers that detect processed

TAL1 mRNA bind within exon 5 and in the exon-exon boundary between exons 5 and 6,

allowing the detection of TAL1 mRNA only after splicing when exon 5 and 6 are juxtaposed.

HDACis down-regulate TAL1 expression in T-ALL

164

Supplementary figure 5.4. TAL1d-expressing T-ALL cells up-regulated TAL1 mRNA

upon HDACi treatment. (A) Structural comparison of TAL1wt

(left panel) and TAL1d

(right panel) locus [Adapted from (10)]. The SIL locus is located at the 5‟ and the MAP17

locus is located at the 3‟ end of the TAL1 locus. Exons are represented as boxes. The white

boxes represent exons or regions that are not translated, while the black boxes show exons

or regions that are translated. The grey box indicates the SIL exon that is placed in the

TAL1 locus upon the TAL1d deletion. The arrows represent the TAL1 promoters (Pr.) (B)

Jurkat and PF382 cells were treated with 5mM SB or 10µM SAHA, RNA was extracted

and TAL1 and SIL-TAL1 transcripts analyzed by quantitative-PCR. TAL1 and SIL-TAL1

mRNA levels were normalized to the levels of the GAPDH housekeeping gene and

depicted as relative values to the medium control condition. Values represent mean ±

standard deviation of duplicates (** p<0.01). The data is representative of two independent

experiments.

HDACis down-regulate TAL1 expression in T-ALL

165

Supplementary figure 5.5. HDACis induce T-ALL cell death. T-ALL cells were treated

with HDACi and cellular viability was determined as described in “Materials and Methods.

Viability index represents the viability values normalized to the viability in medium control

condition. (A) Primary T-ALL cells (n=3) were treated for 24 h in the indicated

concentrations of SB and SAHA. (B) Jurkat, PF382 and SupT1 cells were treated for 24 h

with the indicated concentrations of SB or TSA. Values indicate the mean ± standard

deviation of duplicates (* p<0.05; ** p<0.01; *** p<0.001). The data is representative of at

least two independent experiments.

HDACis down-regulate TAL1 expression in T-ALL

166

Supplementary figure 5.6. Enforced TAL1 expression partially rescues HDACi-

mediated apoptosis of Jurkat cells. Jurkat cells were transduced with empty or TAL1

expressing lentiviruses and incubated for 24 h with the indicated concentrations of SB.

Viability was determined by flow cytometry analysis of FSC/SSC distribution. Viability

index represents the viability values normalized to the viability in medium control

condition. Values indicate the mean ± standard deviation of triplicates (*** p<0.001).

HDACis down-regulate TAL1 expression in T-ALL

167

Supplementary figure 5.7. Model for HDACi-mediated TAL1 down-regulation in T-

ALL cells. In T-ALL cells that contain an intact TAL1 locus (TAL1wt

), treatment with

HDACi impairs TAL1 gene transcription by displacing RNA polymerase II from TAL1

native promoters. In T-ALL cells that contain the TAL1d allele and consequently express

TAL1 under the control of the SIL promoter, HDACi do not negatively affect TAL1 gene

transcription, (on the contrary, they appear to up-regulate it) but shut down TAL1 protein

translation. Both mechanisms lead to the same outcome: down-regulation of TAL1 protein

expression in HDACi-treated T-ALL cells.

HDACis down-regulate TAL1 expression in T-ALL

168

Supplementary figure 5.8. TAL1 expression is not affect by inhibition of PI3K and

mTOR. PF382 cells were cultured for 24 h with 5mM SB, 50µM LY294002 (LY), 200nM

Rapamycin (Rap.) or the indicated combinations. Cells were lysed and the phosphorylation

levels of S6 and Akt/PKB, as well as TAL1 protein expression were analyzed by

immunoblot. Actin was used as loading control.

Discussion

169

Chapter 6

DISCUSSION

Discussion

170

Cytokine signaling in T-ALL: the role of IL-4

Cytokines that bind γ-common-chain receptors have a clear impact on the

proliferation of T-ALL cells. We previously showed that incubation of primary T-ALL

cells with γ-common chain cytokines increases their proliferation. In fact, from the

panel of cytokines tested, IL-7 and IL-4 showed the highest proliferative responses.

While IL-7 induced proliferation in T-ALL cells in all the maturation stages, IL-4

induced-proliferation is largely restricted to cortical and mature T-ALL (1). Regarding

the role of IL-7 in T-ALL, it was demonstrated that the incubation of T-ALL cells with

this cytokine led to increased proliferation and viability through the activation of the

PI3K pathway (2).

IL-4 is a cytokine produced by several types of cells (stromal cells, lymphocytes)

(3, 4) and is involved in Th2-type immune responses (4). Importantly, IL-4 is also

produced within the bone marrow (5, 6), which is a major niche where T-ALL cells

proliferate. In chapter 2 we showed that IL-4 promotes T-ALL cell proliferation through

the activation of mTOR signaling pathway and inhibition of the cyclin-dependent kinase

inhibitor p27Kip1

(Figure 6.1). It is possible that IL-4 could also activate other signaling

pathways in T-ALL cells, since studies indicate that IL4 can activate other signaling

pathways in lymphoid cells (7, 8). This notwithsatnding, when we treat T-ALL cells

with the mTOR pathway inhibitor Rapamycin, IL-4-induced proliferation is completely

abrogated. These results clearly show that the mTOR signaling pathway is the main

driver of IL-4 induced proliferation (chapter 2). Increasing lines of evidence suggest

that IL-4 can have a role in cancer development. Recently, it has been described that IL-

4 can stimulate the proliferation of pancreatic cancer cell lines (9). Furthermore, human

colon cancer cells express the IL-4 receptor and its signaling promotes proliferation of

these cell lines (10). Despite the increasing evidence that IL-4 promotes tumor cell

growth, IL-4 is not classified as an oncogene. The IL-4 transgenic mouse was described

in 1991 and did not show any signs of tumorigenesis. However, it is interesting that IL-

4 transgenic mice display enlarged spleens and B cells with increased size and number

(11).

It was also demonstrated that IL-4 can modulate the immune response against

tumors. It has been postulated that IL-4 can impair tumor growth by inhibiting

angiogenesis and activating several innate immune effectors, such as granulocytes and

Discussion

171

eosinophils. In contrast, other studies suggest that IL-4 impairs tumor control by the

immune system by depleting the pool of primary and memory CD8+ cells (12).

Figure 6.1. IL-4 signaling promotes the proliferation of T-ALL cells through the

activation of the mTOR pathway. In T-ALL cells, binding of IL-4 to its cognate

receptor activates the mTOR pathway. The activation is measured by the increased

phosphorylation in mTOR and its downstream targets p70S6K

and 4EBP1, which in turn

activate protein synthesis and therefore contribute to increase the cell size. Activation of

mTOR also down-regulates the expression of the cyclin-dependent kinase inhibitor

p27Kip1

, promoting cell cycle entry. Importantly, blockade of the mTOR pathway with

Rapamycin completely abrogates IL-4-induced proliferation of T-ALL cells.

Discussion

172

Our results implicate the mTOR pathway as a main driver of IL-4-induced T-ALL

proliferation. Treatment of T-ALL cells with IL-4 increased the phosphorylation levels

of mTOR and its downstream targets S6, 4EBP1 and p70S6K

(Figure 2.1). The mTOR

kinase associates in two multimeric complexes, mTORC1 and mTORC2 (13, 14). The

mTORC1 complex is directly activated by PKB (13, 15) and it is involved in the

regulation of protein synthesis and cell cycle progression (16). The PI3K pathway has

been shown to be constitutively activated in several human cancers (17-19). Recently,

we described that T-ALL cells also display constitutive activation of PI3K-PKB

pathway (19). Importantly, blockade of PI3K and mTOR pathways with

pharmacological inhibitors (LY294002 and Rapamycin) severely impairs the viability

of these cells (19, 20). Due to its efficacy in promoting apoptosis in human tumors,

several mTOR pathway inhibitors, including CCI-779 and RAD001, were successfully

tested in clinical trials (21). Our results reinforce the idea that the PI3K-mTOR axis,

activated by both microenvironmental stimuli, such as IL-4, and by cell-autonomous

alterations, has a pivotal and non-redundant role in T-ALL.

Is TAL1 a human T-cell oncogene?

While the importance of microenvironmental cues as contributors to T-ALL

disease progression is increasingly recognized, it remains inquestionable that the

trigger(s) for leukemogenesis lie within the developing T-cell itself. A common feature

in T-ALL is the occurrence of non-random chromosomal translocations that lead to

increased expression of several oncogenes (22, 23). In fact, the TAL1 and LMO2 genes

were initially identified due to the occurrence of these non-random chromosomal

translocations (24-26). The TAL1 gene, essential for hematopoietic development (27,

28), is down-regulated upon commitment to the lymphoid lineage (29-31). TAL1

ectopic expression is arguably the most common oncogenic alteration in T-ALL, being

ectopically expressed in up to 65% of T-ALL patients (32, 33). Despite the fact that this

gene is commonly expressed in a high percentage of T-ALL patients, it is still unknown

whether it could be at the origin of human leukemia or it is merely a by-product of

already transformed and genetically unstable cells.

The LMO2 gene is also frequently over-expressed in T-ALL and is commonly

associated with TAL1 ectopic expression (33). In contrast to TAL1, ectopic expression

of LMO2 in human hematopoietic progenitors was already shown to have an impact in

Discussion

173

T-cell development (29). In a recent gene therapy trial for correction of human SCID,

two patients developed leukemia due to the integration of a retrovirus carrying the

IL2RG gene near the LMO2 locus leading to its expression in developing T-cells (34-

38). These observations indicate that LMO2 actually acts as a human T-cell oncogene,

by impairing normal T-cell differentiation (29) and promoting clonal T-cell expansion

that originated leukemia (34). However, it is possible that the synergism between the

LMO2 and the IL2RG gene, rather than LMO2 per se, was the driving force of this T-

cell proliferation.

In transgenic mouse models, the role for the TAL1 gene in the etiology of T-cell

leukemia is well documented and its expression results in the development of T-cell

tumors (39-41). Importantly, the combined expression of both TAL1 and LMO genes in

transgenic mouse models also led to the development of T-cell tumors with a decreased

latency period suggestive of a synergistic effect (30, 42, 43). The development of T-cell

leukemia in TAL1 transgenic mouse models is preceded by an arrest in normal T-cell

differentiation by the accumulation of immature T-cells arrested at the DN stage (40,

41). In these mouse models, the abrogation of normal T-cell differentiation seems to be

a requirement for the development of T-cell leukemia. Our results described in chapter 3

are in agreement with these findings and provide the first evidence that TAL1 ectopic

gene expression can negatively affect normal human T-cell development in vitro. The

data presented on LMO2 confirms previous observations from other groups (29).

Moreover, our results support, in part, the possibility that the effect of TAL1 and LMO2

is synergistic and recapitulate what happens in transgenic mouse models for the TAL1

and LMO2 genes, where the T-cell differentiation program is strongly inhibited (42, 43).

Since in these transgenic mice T-cell developmental arrest precedes leukemia, it is

tempting to speculate that thymic progenitor cells upon ectopic expression of these

genes would also became leukemic, provide they would have enough time. Further

studies are required to clarify this question.

Previous reports show that TAL1 gene expression and activity in T-ALL cells

protects from apoptosis (44-46), observations that we recapitulated in chapter 4.

Notably however, the results in chapter 3 demonstrate that ectopic expression of the

TAL1 gene in association with LMO2 in normal human hematopoietic progenitors can

increase the cell size, which is normally associated with increase in cellular metabolism

and proliferation. This may indicate that metabolism, rather than viability, is the

primary effect of TAL1/LMO2 aberrant expression in normal T cell precursors, and that

Discussion

174

possibly the impact on viability in T-ALL cells a late effect resulting from oncogene

addiction.

Taken together, as stated above, our results indicate that TAL1 ectopic gene

expression can inhibit normal human T-cell development in synergism with the LMO2

gene. However, further studies are still necessary to formally test whether the TAL1

gene is responsible for human T-ALL. The ectopic expression of TAL1 in hematopoietic

and thymic progenitors and further transplantation into immunocompromised mice will

confirm whether this gene is a human oncogene capable of triggering T-ALL or its

expression is merely a secondary event in already transformed T-ALL cells, in which

case its importance could be limited to advanced-stage disease.

Novel TAL1 target genes in T-ALL and beyond

Despite the multiple processes, from regulation of early hematopoiesis to neural

development, in which TAL1 is involved, the actual number of validated and well

characterized TAL1 target genes described so far is surprisingly short. TAL1 targets are

associated with different cellular mechanisms. NKX3.1 and NFKB1 (47, 48) regulate

cellular proliferation; pTα (30, 49), is involved in T-cell differentiation; RALDH2 (50),

in metabolism; c-Kit (51, 52), in hematopoietic development; Runx1 and Runx3 (53), in

embryogenesis; and GPA and P4.2 (54, 55), in red blood cell differentiation.

Even fewer TAL1 target genes were identified in the context of T-ALL. In chapter

4, we identified three novel putative TAL1 target genes. CASZ1, DMGDH and OR5M3

were identified by gene expression profiling of a T-ALL cell line upon ectopic

expression of TAL1. Among the genes identified in the microarray screen, we only

validated those that had been reported to associate with cancer in the literature.

Evidently, this option implicates that there may be genes that we have not yet explored

which may nonetheless play a role in TAL1-mediated leukemia.

The genes identified in our screen are associated with very different cellular

processes such as apoptosis (CASZ1) (56), cellular metabolism (DMGDH) (57-59) and

extracellular signaling (OR5M3) (60). These results indicate that TAL1 can activate a

broad transcriptional program, involved in the regulation of an array of different cellular

functions. In addition, we demonstrated that CASZ1 gene is involved in T-ALL cell

maintenance by promoting not only viability but also proliferation (Figure 4.4). The

mechanisms by which CASZ1 mediates these effects require further investigation.

Discussion

175

We identified these genes in a leukemia context, by ectopic expression of TAL1

in a T-ALL cell line (61). However, the genes that we identified may also be associated

with the physiological transcriptional program of TAL1. Given the known role of TAL1

in neuronal differentiation (62), it is noteworthy that the TAL1 target genes that we

have identified are normally expressed in neuronal tissues. CASZ1 encodes a

transcription factor up-regulated during neuronal differentiation (63). DMDGH encodes

for Dimethylglycine Dehydrogenase which is a mitochondrial enzyme that produces

sarcosine (57, 58), which in turn can also play a role as a neuronal transmitter (64, 65).

Finally, OR5M3 is a member of the olfactory family of receptors (60), which is

expressed in the sensory neurons of mammals (66). Determining whether any of these

genes plays a role in TAL1-mediated functions in other contexts besides T-ALL is an

interesting challenge ahead, which may arise from the studies described in this thesis.

The TAL1 protein heterodimerizes with E2A and HEB proteins to bind the DNA

(49, 67-69) and it has been suggested that TAL1 induces leukemia by inhibiting the

transcriptional activity of E2A and HEB (41). Under this light, it is conceivable to

consider at least three possible scenarios to explain how TAL1 may regulate the

expression of the genes we have now identified (Figure 6.2). In the simplest scenario

(Figure 6.2A), E2A/HEB transcription factors repress the transcription of CASZ1,

DMGDH and OR5M3 genes. Upon expression of TAL1, E2A/HEB homodimers are

inhibited and the transcription of CASZ1, DMGDH and OR5M3 genes occurs. Another

possibility is that upon expression, TAL1 heterodimerizes with E2A/HEB and these

transcription factors leave the promoters of their target genes and occupy the promoters

of CASZ1, DMGDH and OR5M3 genes activating their transcription (Figure 6.2B). It is

also conceivable that TAL1 activates the expression of a still unknown gene which in

turn would activate the transcription of these genes (Figure 6.2C). However, the

promoters of the three genes harbor consensus binding sites for TAL1, reinforcing the

idea that the role of TAL1 in the expression of CASZ1, DMGDH and OR5M3 genes

could be direct (Figure 6.2A and 6.2B).

Discussion

176

HDAC inhibitors: a novel therapeutic approach for T-ALL?

T-ALL is characterized by the clonal expansion of T-cell progenitors arrested at

different stages of development, and associates with poor prognosis even though

intensive and risk adjusted chemotherapy have led to significantly improved outcome

(70, 71). Despite the therapeutic successes, T-ALL patients remain in need of novel

approaches that diminish the aggressiveness of the current treatment protocols, in order

to minimize side-effects and augment efficacy.

Figure 6.2. Several hypothetical mechanisms could explain TAL1-mediated up-

regulation of CASZ1, DMGDH and OR5M3. (A) E2A/HEB homodimers repress the

transcription of the CASZ1, DMGDH and OR5M3 genes. Upon ectopic expression, TAL1

heterodimerizes with E2A/HEB and the transcription of CASZ1, DMGDH and OR5M3

genes is activated. (B) E2A/HEB homodimers are bound to the promoters of their target

genes (gene X) promoting their transcription. However, when TAL1 is expressed it

heterodimerizes with E2A/HEB promoting the transcription of its target-genes (CASZ1,

DMGDH and OR5M3). (C) Upon TAL1 expression, it binds to E2A/HEB and activates the

expression of a yet unknown gene (the Y gene) which in turns activates the expression of

CASZ1, DMGDH and OR5M3.

Discussion

177

In chapter 5, we demonstrate that TAL1 expression is rapidly and strikingly

down-regulated upon treatment with HDACis. Interestingly, we found that HDACis

inhibit not only TAL1 gene transcription but also TAL1 protein translation. T-ALL

patients with TAL1 expression are associated with a poorer prognosis when compared

with patients that express other T-cell oncogenes (33). This can be related with the fact

that TAL1 expression and activity in T-ALL protects from apoptosis (44-46). Why this

is the case remains to be determined, but it could be the result of the fact that TAL1 is

involved in a broad transcriptional program that may be required for proper cell

function. Interestingly, ectopic expression of TAL1 in a T-ALL cell line protected it

from apoptosis induced by standard chemotherapeutic drugs (45). We propose that the

combined use of HDACis and standard chemotherapeutic drugs could be useful in the

treatment of T-ALL cases with TAL1 ectopic expression and poorer prognosis. It is

tempting to speculate that the use of HDACis to decrease TAL1 expression followed by

the combined use of standard chemotherapeutic drugs (72) would be efficient in the

treatment of TAL1-expressing T-ALL cases.

Acetylation, a new clue on TAL1 regulation?

We showed in chapter 5 that TAL1 expression is down-regulated by HDACi

incubation via two independent mechanisms. In T-ALL cells that contain the TAL1

native promoter HDACi treatment displaces the RNA polymerase II from the promoter

impairing TAL1 gene transcription (Figure 5.3). In contrast, in T-ALL cells that harbor

the TAL1d deletion, HDACi treatment down-regulates TAL1 expression by inhibiting

TAL1 translation (Figure 5.4).

The fact that HDACi treatment impairs TAL1 gene transcription could help

uncover how this gene is transcriptionally regulated. The TAL1 gene is controlled by

several elements that include promoters (73, 74), enhancers (75, 76) and also a silencer

(77, 78). HDACi treatment not only displaces the RNA polymerase II from the

promoter Ia and IV, but also decreases the levels of H3K9Ac, a chromatin marker

highly associated with active transcription (79). The TAL1 promoters Ia and Ib are

regulated by several transcription factors that include SP1, SP3 and GATA1 (80-83).

Importantly, the transcriptional and DNA binding activity of these proteins was shown

to be regulated by acetylation (84-86). In fact, acetylation of these proteins can increase

or decrease their transcriptional activity depending on the cellular and genomic

Discussion

178

environment (87, 88). Thus, it is tempting to speculate that HDACis increase the

acetylation levels of the transcription factors that regulate the TAL1 Ia promoter,

particularly the GATA1 transcription factor. However, additional experiments are

required to test whether incubation with HDACis increase the level of GATA1

acetylation in T-ALL cells and whether this increased acetylation results in diminished

activity at the TAL1 Ia promoter. It is also possible that incubation with HDACis in T-

ALL also impairs TAL1 gene transcription at the Ib promoter that is regulated by SP1

and SP3 (82), but we only analyzed the genomic region of the TAL1 promoter Ia.

HDACis incubation in T-ALL cells that display a TAL1d allele also down-

regulates TAL1 expression (Figure 5.1 and 5.4). As described previously, the TAL1d

mutation juxtaposes the SIL regulatory sequences to the coding region of the TAL1

gene, rendering TAL1 gene expression under the control of the former (89). In chapter 5,

we describe that HDACis up-regulate TAL1 mRNA levels in TAL1d T-ALL cells but

impair the translation of these transcripts (Figure 5.4). This is not the first report of

impaired mRNA translation by HDACis. Previously, Kawamata and colleagues

described that HDACi treatment of Mantle Cell Lymphoma cells impaired cyclin D1

translation, through the inhibition of the PI3K pathway (90). Treatment of T-ALL cells

with HDACis also impairs the PI3K-mTOR axis. However the inhibition of these

pathways fails to decrease TAL1 expression in T-ALL cells (Supplementary Figure 5.7

and 5.8). It is possible that the incubation of HDACis in T-ALL cells can alter the

acetylation levels of proteins involved in translation regulation. In fact, Fenton and

colleagues described that p300 and P/CAF proteins interact and acetylate in vitro and in

vivo S6 kinases, and importantly, HDACis enhance the acetylation levels of the S6

kinases. However, the authors did not report any alterations in the activity or

localization of the S6 kinases upon increased acetylation (91). Still, is possible that

HDACi treatment in TAL1d T-ALL cells could alter the activity of proteins involved in

translation control by increasing their protein acetylation levels. However further

experiments are required to clarify whether this is the mechanism responsible for the

decrease in TAL1 mRNA translation levels.

Concluding remarks

Increasing evidence demonstrates that both cell-autonomous (24, 33, 39, 41, 92-

97) and extra-cellular cues regulate and contribute to leukemia progression (1, 98, 99).

Discussion

179

We previously demonstrated that primary T-ALL cells display constitutive activation of

the PI3K pathway (19), but also that IL-7 signaling can increase viability and

proliferation of T-ALL cells through the activation of this pathway (2, 99). In other

words, cell-intrinsic and external cues converge on the activation of PI3K pathway, to

promote leukemia expansion.

In this thesis, we describe in chapter 2, that IL-4, yet another cytokine produced in

the leukemic milieu, can contribute to T-ALL progression by increasing proliferation

through the activation of the mTOR pathway, which lies downstream of PI3K.

On the other hand, we also looked at the cell-autonomous mechanisms that may

promote leukemia progression. We showed that TAL1 and LMO2 (two frequently

ectopically expressed genes in T-ALL) could contribute to T-ALL through the

inhibition of normal T-cell development (chapter 3). Moreover, we identified new

TAL1 target genes up-regulated in the context of T-ALL (chapter 4). Finally, the

demonstration that incubation of HDACis down-regulated TAL1 expression in T-ALL

cells opens a novel therapeutic window in the treatment of the cohort of T-ALL patients

associated with poor prognosis (chapter 5).

The results that we describe in this PhD thesis are summarized in Figure 6.3.

Discussion

180

Figure 6.3. The role of extra-cellular cues and cell-autonomous mechanisms in the

progression of T-ALL. An environmental factor like IL-4 increases the proliferation of T-

ALL cells through the activation of key signaling components such as those belonging to the

the mTOR pathway (chapter 2). Extracellular cues complement the effect of cell-

autonomous aberrations, such as the ectopic expression of TAL1 and/or LMO2 in T-cell

progenitors. Abnormal TAL1/LMO2 levels impair normal thymocyte differentiation,

possibly predisposing cells to leukemogenesis (chapter 3). The activation of genes

potentially reported to be involved in cancer (chapter 4) may be a mechanism by which

TAL1 contributes to T-ALL. Importantly, HDACi incubation of T-ALL cells decreases

TAL1 expression (chapter 5). This result opens the possibility of using HDACis to treat T-

ALL patients, especially those that display TAL1 expression. Overall, the results described

in the present thesis support the notion that both microenvironmental cues and cell-

autonomous mechanisms contribute to T-ALL progression, through the complementary

activation of signaling pathways and up-regulation of genes involved in the maintenance of

viability and proliferation of T-ALL cells.

Discussion

181

References

1. Barata, J.T., T.D. Keenan, A. Silva, L.M. Nadler, V.A. Boussiotis, and A.A. Cardoso.

2004. Common gamma chain-signaling cytokines promote proliferation of T-cell acute

lymphoblastic leukemia. Haematologica 89:1459-1467.

2. Barata, J.T., A. Silva, J.G. Brandao, L.M. Nadler, A.A. Cardoso, and V.A. Boussiotis.

2004. Activation of PI3K is indispensable for interleukin 7-mediated viability,

proliferation, glucose use, and growth of T cell acute lymphoblastic leukemia cells. J

Exp Med 200:659-669.

3. Gessner, A., K. Mohrs, and M. Mohrs. 2005. Mast cells, basophils, and eosinophils

acquire constitutive IL-4 and IL-13 transcripts during lineage differentiation that are

sufficient for rapid cytokine production. J Immunol 174:1063-1072.

4. Min, B., M. Prout, J. Hu-Li, J. Zhu, D. Jankovic, E.S. Morgan, J.F. Urban, Jr., A.M.

Dvorak, F.D. Finkelman, G. LeGros, and W.E. Paul. 2004. Basophils produce IL-4 and

accumulate in tissues after infection with a Th2-inducing parasite. J Exp Med 200:507-

517.

5. Yoshimoto, T., H. Tsutsui, K. Tominaga, K. Hoshino, H. Okamura, S. Akira, W.E.

Paul, and K. Nakanishi. 1999. IL-18, although antiallergic when administered with IL-

12, stimulates IL-4 and histamine release by basophils. Proc Natl Acad Sci U S A

96:13962-13966.

6. Gutierrez-Ramos, J.C., C. Olsson, and R. Palacios. 1992. Interleukin (IL1 to IL7) gene

expression in fetal liver and bone marrow stromal clones: cytokine-mediated positive

and negative regulation. Exp Hematol 20:986-990.

7. Stephenson, L.M., D.S. Park, A.L. Mora, S. Goenka, and M. Boothby. 2005. Sequence

motifs in IL-4R alpha mediating cell-cycle progression of primary lymphocytes. J

Immunol 175:5178-5185.

8. Acacia de Sa Pinheiro, A., A. Morrot, S. Chakravarty, M. Overstreet, J.H. Bream, P.M.

Irusta, and F. Zavala. 2007. IL-4 induces a wide-spectrum intracellular signaling

cascade in CD8+ T cells. J Leukoc Biol 81:1102-1110.

9. Prokopchuk, O., Y. Liu, D. Henne-Bruns, and M. Kornmann. 2005. Interleukin-4

enhances proliferation of human pancreatic cancer cells: evidence for autocrine and

paracrine actions. Br J Cancer 92:921-928.

10. Koller, F.L., D.G. Hwang, E.A. Dozier, and B. Fingleton. Epithelial interleukin-4

receptor expression promotes colon tumor growth. Carcinogenesis 31:1010-1017.

11. Burstein, H.J., R.I. Tepper, P. Leder, and A.K. Abbas. 1991. Humoral immune

functions in IL-4 transgenic mice. J Immunol 147:2950-2956.

Discussion

182

12. Olver, S., S. Apte, A. Baz, and N. Kienzle. 2007. The duplicitous effects of interleukin

4 on tumour immunity: how can the same cytokine improve or impair control of tumour

growth? Tissue Antigens 69:293-298.

13. Steelman, L.S., S.L. Abrams, J. Whelan, F.E. Bertrand, D.E. Ludwig, J. Basecke, M.

Libra, F. Stivala, M. Milella, A. Tafuri, P. Lunghi, A. Bonati, A.M. Martelli, and J.A.

McCubrey. 2008. Contributions of the Raf/MEK/ERK, PI3K/PTEN/Akt/mTOR and

Jak/STAT pathways to leukemia. Leukemia 22:686-707.

14. Guertin, D.A., and D.M. Sabatini. 2007. Defining the role of mTOR in cancer. Cancer

Cell 12:9-22.

15. Inoki, K., Y. Li, T. Zhu, J. Wu, and K.L. Guan. 2002. TSC2 is phosphorylated and

inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 4:648-657.

16. Panwalkar, A., S. Verstovsek, and F.J. Giles. 2004. Mammalian target of rapamycin

inhibition as therapy for hematologic malignancies. Cancer 100:657-666.

17. Xu, Q., S.E. Simpson, T.J. Scialla, A. Bagg, and M. Carroll. 2003. Survival of acute

myeloid leukemia cells requires PI3 kinase activation. Blood 102:972-980.

18. Hsu, J., Y. Shi, S. Krajewski, S. Renner, M. Fisher, J.C. Reed, T.F. Franke, and A.

Lichtenstein. 2001. The AKT kinase is activated in multiple myeloma tumor cells.

Blood 98:2853-2855.

19. Silva, A., J.A. Yunes, B.A. Cardoso, L.R. Martins, P.Y. Jotta, M. Abecasis, A.E.

Nowill, N.R. Leslie, A.A. Cardoso, and J.T. Barata. 2008. PTEN posttranslational

inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell

leukemia viability. J Clin Invest 118:3762-3774.

20. Avellino, R., S. Romano, R. Parasole, R. Bisogni, A. Lamberti, V. Poggi, S. Venuta,

and M.F. Romano. 2005. Rapamycin stimulates apoptosis of childhood acute

lymphoblastic leukemia cells. Blood 106:1400-1406.

21. Faivre, S., G. Kroemer, and E. Raymond. 2006. Current development of mTOR

inhibitors as anticancer agents. Nat Rev Drug Discov 5:671-688.

22. Graux, C., J. Cools, L. Michaux, P. Vandenberghe, and A. Hagemeijer. 2006.

Cytogenetics and molecular genetics of T-cell acute lymphoblastic leukemia: from

thymocyte to lymphoblast. Leukemia 20:1496-1510.

23. De Keersmaecker, K., P. Marynen, and J. Coolsi. 2005. Genetic insights in the

pathogenesis of T-cell acute lymphoblastic leukemia. Haematologica 90:1116-1127.

24. Begley, C.G., P.D. Aplan, M.P. Davey, K. Nakahara, K. Tchorz, J. Kurtzberg, M.S.

Hershfield, B.F. Haynes, D.I. Cohen, T.A. Waldmann, and et al. 1989. Chromosomal

translocation in a human leukemic stem-cell line disrupts the T-cell antigen receptor

delta-chain diversity region and results in a previously unreported fusion transcript.

Proc Natl Acad Sci U S A 86:2031-2035.

Discussion

183

25. Chen, Q., J.T. Cheng, L.H. Tasi, N. Schneider, G. Buchanan, A. Carroll, W. Crist, B.

Ozanne, M.J. Siciliano, and R. Baer. 1990. The tal gene undergoes chromosome

translocation in T cell leukemia and potentially encodes a helix-loop-helix protein.

Embo J 9:415-424.

26. Boehm, T., L. Foroni, Y. Kaneko, M.F. Perutz, and T.H. Rabbitts. 1991. The rhombotin

family of cysteine-rich LIM-domain oncogenes: distinct members are involved in T-cell

translocations to human chromosomes 11p15 and 11p13. Proc Natl Acad Sci U S A

88:4367-4371.

27. Robb, L., I. Lyons, R. Li, L. Hartley, F. Kontgen, R.P. Harvey, D. Metcalf, and C.G.

Begley. 1995. Absence of yolk sac hematopoiesis from mice with a targeted disruption

of the scl gene. Proc Natl Acad Sci U S A 92:7075-7079.

28. Porcher, C., W. Swat, K. Rockwell, Y. Fujiwara, F.W. Alt, and S.H. Orkin. 1996. The T

cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic

lineages. Cell 86:47-57.

29. Pike-Overzet, K., D. de Ridder, F. Weerkamp, M.R. Baert, M.M. Verstegen, M.H.

Brugman, S.J. Howe, M.J. Reinders, A.J. Thrasher, G. Wagemaker, J.J. van Dongen,

and F.J. Staal. 2007. Ectopic retroviral expression of LMO2, but not IL2Rgamma,

blocks human T-cell development from CD34+ cells: implications for leukemogenesis

in gene therapy. Leukemia 21:754-763.

30. Herblot, S., A.M. Steff, P. Hugo, P.D. Aplan, and T. Hoang. 2000. SCL and LMO1

alter thymocyte differentiation: inhibition of E2A-HEB function and pre-T alpha chain

expression. Nat Immunol 1:138-144.

31. Ferrando, A.A., S. Herblot, T. Palomero, M. Hansen, T. Hoang, E.A. Fox, and A.T.

Look. 2004. Biallelic transcriptional activation of oncogenic transcription factors in T-

cell acute lymphoblastic leukemia. Blood 103:1909-1911.

32. Bash, R.O., S. Hall, C.F. Timmons, W.M. Crist, M. Amylon, R.G. Smith, and R. Baer.

1995. Does activation of the TAL1 gene occur in a majority of patients with T-cell

acute lymphoblastic leukemia? A pediatric oncology group study. Blood 86:666-676.

33. Ferrando, A.A., D.S. Neuberg, J. Staunton, M.L. Loh, C. Huard, S.C. Raimondi, F.G.

Behm, C.H. Pui, J.R. Downing, D.G. Gilliland, E.S. Lander, T.R. Golub, and A.T.

Look. 2002. Gene expression signatures define novel oncogenic pathways in T cell

acute lymphoblastic leukemia. Cancer Cell 1:75-87.

34. Hacein-Bey-Abina, S., C. Von Kalle, M. Schmidt, M.P. McCormack, N. Wulffraat, P.

Leboulch, A. Lim, C.S. Osborne, R. Pawliuk, E. Morillon, R. Sorensen, A. Forster, P.

Fraser, J.I. Cohen, G. de Saint Basile, I. Alexander, U. Wintergerst, T. Frebourg, A.

Aurias, D. Stoppa-Lyonnet, S. Romana, I. Radford-Weiss, F. Gross, F. Valensi, E.

Delabesse, E. Macintyre, F. Sigaux, J. Soulier, L.E. Leiva, M. Wissler, C. Prinz, T.H.

Discussion

184

Rabbitts, F. Le Deist, A. Fischer, and M. Cavazzana-Calvo. 2003. LMO2-associated

clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science

302:415-419.

35. Hacein-Bey-Abina, S., A. Garrigue, G.P. Wang, J. Soulier, A. Lim, E. Morillon, E.

Clappier, L. Caccavelli, E. Delabesse, K. Beldjord, V. Asnafi, E. MacIntyre, L. Dal

Cortivo, I. Radford, N. Brousse, F. Sigaux, D. Moshous, J. Hauer, A. Borkhardt, B.H.

Belohradsky, U. Wintergerst, M.C. Velez, L. Leiva, R. Sorensen, N. Wulffraat, S.

Blanche, F.D. Bushman, A. Fischer, and M. Cavazzana-Calvo. 2008. Insertional

oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1. J Clin

Invest 118:3132-3142.

36. Schmidt, M., S. Hacein-Bey-Abina, M. Wissler, F. Carlier, A. Lim, C. Prinz, H. Glimm,

I. Andre-Schmutz, C. Hue, A. Garrigue, F. Le Deist, C. Lagresle, A. Fischer, M.

Cavazzana-Calvo, and C. von Kalle. 2005. Clonal evidence for the transduction of

CD34+ cells with lymphomyeloid differentiation potential and self-renewal capacity in

the SCID-X1 gene therapy trial. Blood 105:2699-2706.

37. Deichmann, A., S. Hacein-Bey-Abina, M. Schmidt, A. Garrigue, M.H. Brugman, J. Hu,

H. Glimm, G. Gyapay, B. Prum, C.C. Fraser, N. Fischer, K. Schwarzwaelder, M.L.

Siegler, D. de Ridder, K. Pike-Overzet, S.J. Howe, A.J. Thrasher, G. Wagemaker, U.

Abel, F.J. Staal, E. Delabesse, J.L. Villeval, B. Aronow, C. Hue, C. Prinz, M. Wissler,

C. Klanke, J. Weissenbach, I. Alexander, A. Fischer, C. von Kalle, and M. Cavazzana-

Calvo. 2007. Vector integration is nonrandom and clustered and influences the fate of

lymphopoiesis in SCID-X1 gene therapy. J Clin Invest 117:2225-2232.

38. Howe, S.J., M.R. Mansour, K. Schwarzwaelder, C. Bartholomae, M. Hubank, H.

Kempski, M.H. Brugman, K. Pike-Overzet, S.J. Chatters, D. de Ridder, K.C. Gilmour,

S. Adams, S.I. Thornhill, K.L. Parsley, F.J. Staal, R.E. Gale, D.C. Linch, J. Bayford, L.

Brown, M. Quaye, C. Kinnon, P. Ancliff, D.K. Webb, M. Schmidt, C. von Kalle, H.B.

Gaspar, and A.J. Thrasher. 2008. Insertional mutagenesis combined with acquired

somatic mutations causes leukemogenesis following gene therapy of SCID-X1 patients.

J Clin Invest 118:3143-3150.

39. Kelliher, M.A., D.C. Seldin, and P. Leder. 1996. Tal-1 induces T cell acute

lymphoblastic leukemia accelerated by casein kinase IIalpha. Embo J 15:5160-5166.

40. O'Neil, J., M. Billa, S. Oikemus, and M. Kelliher. 2001. The DNA binding activity of

TAL-1 is not required to induce leukemia/lymphoma in mice. Oncogene 20:3897-3905.

41. O'Neil, J., J. Shank, N. Cusson, C. Murre, and M. Kelliher. 2004. TAL1/SCL induces

leukemia by inhibiting the transcriptional activity of E47/HEB. Cancer Cell 5:587-596.

42. Larson, R.C., I. Lavenir, T.A. Larson, R. Baer, A.J. Warren, I. Wadman, K. Nottage,

and T.H. Rabbitts. 1996. Protein dimerization between Lmo2 (Rbtn2) and Tal1 alters

Discussion

185

thymocyte development and potentiates T cell tumorigenesis in transgenic mice. Embo

J 15:1021-1027.

43. Chervinsky, D.S., X.F. Zhao, D.H. Lam, M. Ellsworth, K.W. Gross, and P.D. Aplan.

1999. Disordered T-cell development and T-cell malignancies in SCL LMO1 double-

transgenic mice: parallels with E2A-deficient mice. Mol Cell Biol 19:5025-5035.

44. Leroy-Viard, K., M.A. Vinit, N. Lecointe, H. Jouault, U. Hibner, P.H. Romeo, and D.

Mathieu-Mahul. 1995. Loss of TAL-1 protein activity induces premature apoptosis of

Jurkat leukemic T cells upon medium depletion. Embo J 14:2341-2349.

45. Bernard, M., E. Delabesse, S. Novault, O. Hermine, and E.A. Macintyre. 1998.

Antiapoptotic effect of ectopic TAL1/SCL expression in a human leukemic T-cell line.

Cancer Res 58:2680-2687.

46. Park, S.T., G.P. Nolan, and X.H. Sun. 1999. Growth inhibition and apoptosis due to

restoration of E2A activity in T cell acute lymphoblastic leukemia cells. J Exp Med

189:501-508.

47. Kusy, S., B. Gerby, N. Goardon, N. Gault, F. Ferri, D. Gerard, F. Armstrong, P.

Ballerini, J.M. Cayuela, A. Baruchel, F. Pflumio, and P.H. Romeo. NKX3.1 is a direct

TAL1 target gene that mediates proliferation of TAL1-expressing human T cell acute

lymphoblastic leukemia. J Exp Med 207:2141-2156.

48. Chang, P.Y., K. Draheim, M.A. Kelliher, and S. Miyamoto. 2006. NFKB1 is a direct

target of the TAL1 oncoprotein in human T leukemia cells. Cancer Res 66:6008-6013.

49. Tremblay, M., S. Herblot, E. Lecuyer, and T. Hoang. 2003. Regulation of pT alpha gene

expression by a dosage of E2A, HEB, and SCL. J Biol Chem 278:12680-12687.

50. Ono, Y., N. Fukuhara, and O. Yoshie. 1998. TAL1 and LIM-only proteins

synergistically induce retinaldehyde dehydrogenase 2 expression in T-cell acute

lymphoblastic leukemia by acting as cofactors for GATA3. Mol Cell Biol 18:6939-

6950.

51. Krosl, G., G. He, M. Lefrancois, F. Charron, P.H. Romeo, P. Jolicoeur, I.R. Kirsch, M.

Nemer, and T. Hoang. 1998. Transcription factor SCL is required for c-kit expression

and c-Kit function in hemopoietic cells. J Exp Med 188:439-450.

52. Lecuyer, E., S. Herblot, M. Saint-Denis, R. Martin, C.G. Begley, C. Porcher, S.H.

Orkin, and T. Hoang. 2002. The SCL complex regulates c-kit expression in

hematopoietic cells through functional interaction with Sp1. Blood 100:2430-2440.

53. Landry, J.R., S. Kinston, K. Knezevic, M.F. de Bruijn, N. Wilson, W.T. Nottingham,

M. Peitz, F. Edenhofer, J.E. Pimanda, K. Ottersbach, and B. Gottgens. 2008. Runx

genes are direct targets of Scl/Tal1 in the yolk sac and fetal liver. Blood 111:3005-3014.

54. Lahlil, R., E. Lecuyer, S. Herblot, and T. Hoang. 2004. SCL assembles a multifactorial

complex that determines glycophorin A expression. Mol Cell Biol 24:1439-1452.

Discussion

186

55. Xu, Z., S. Huang, L.S. Chang, A.D. Agulnick, and S.J. Brandt. 2003. Identification of a

TAL1 target gene reveals a positive role for the LIM domain-binding protein Ldb1 in

erythroid gene expression and differentiation. Mol Cell Biol 23:7585-7599.

56. Yuan, Z.R., R. Wang, J. Solomon, X. Luo, H. Sun, L. Zhang, and Y. Shi. 2005.

Identification and characterization of survival-related gene, a novel cell survival gene

controlling apoptosis and tumorigenesis. Cancer Res 65:10716-10724.

57. Binzak, B.A., J.G. Vockley, R.B. Jenkins, and J. Vockley. 2000. Structure and analysis

of the human dimethylglycine dehydrogenase gene. Mol Genet Metab 69:181-187.

58. Binzak, B.A., R.A. Wevers, S.H. Moolenaar, Y.M. Lee, W.L. Hwu, J. Poggi-Bach, U.F.

Engelke, H.M. Hoard, J.G. Vockley, and J. Vockley. 2001. Cloning of dimethylglycine

dehydrogenase and a new human inborn error of metabolism, dimethylglycine

dehydrogenase deficiency. Am J Hum Genet 68:839-847.

59. Sreekumar, A., L.M. Poisson, T.M. Rajendiran, A.P. Khan, Q. Cao, J. Yu, B. Laxman,

R. Mehra, R.J. Lonigro, Y. Li, M.K. Nyati, A. Ahsan, S. Kalyana-Sundaram, B. Han, X.

Cao, J. Byun, G.S. Omenn, D. Ghosh, S. Pennathur, D.C. Alexander, A. Berger, J.R.

Shuster, J.T. Wei, S. Varambally, C. Beecher, and A.M. Chinnaiyan. 2009.

Metabolomic profiles delineate potential role for sarcosine in prostate cancer

progression. Nature 457:910-914.

60. Fleischer, J., H. Breer, and J. Strotmann. 2009. Mammalian olfactory receptors. Front

Cell Neurosci 3:9.

61. Ono, Y., N. Fukuhara, and O. Yoshie. 1997. Transcriptional activity of TAL1 in T cell

acute lymphoblastic leukemia (T-ALL) requires RBTN1 or -2 and induces TALLA1, a

highly specific tumor marker of T-ALL. J Biol Chem 272:4576-4581.

62. Bradley, C.K., E.A. Takano, M.A. Hall, J.R. Gothert, A.R. Harvey, C.G. Begley, and

J.A. van Eekelen. 2006. The essential haematopoietic transcription factor Scl is also

critical for neuronal development. Eur J Neurosci 23:1677-1689.

63. Liu, Z., X. Yang, F. Tan, K. Cullion, and C.J. Thiele. 2006. Molecular cloning and

characterization of human Castor, a novel human gene upregulated during cell

differentiation. Biochem Biophys Res Commun 344:834-844.

64. Zhang, H.X., K. Hyrc, and L.L. Thio. 2009. The glycine transport inhibitor sarcosine is

an NMDA receptor co-agonist that differs from glycine. J Physiol 587:3207-3220.

65. Zhang, H.X., A. Lyons-Warren, and L.L. Thio. 2009. The glycine transport inhibitor

sarcosine is an inhibitory glycine receptor agonist. Neuropharmacology 57:551-555.

66. Feldmesser, E., T. Olender, M. Khen, I. Yanai, R. Ophir, and D. Lancet. 2006.

Widespread ectopic expression of olfactory receptor genes. BMC Genomics 7:121.

Discussion

187

67. Hsu, H.L., I. Wadman, and R. Baer. 1994. Formation of in vivo complexes between the

TAL1 and E2A polypeptides of leukemic T cells. Proc Natl Acad Sci U S A 91:3181-

3185.

68. Bernard, M., E. Delabesse, L. Smit, C. Millien, I.R. Kirsch, J.L. Strominger, and E.A.

Macintyre. 1998. Helix-loop-helix (E2-5, HEB, TAL1 and Id1) protein interaction with

the TCRalphadelta enhancers. Int Immunol 10:1539-1549.

69. Park, S.T., and X.H. Sun. 1998. The Tal1 oncoprotein inhibits E47-mediated

transcription. Mechanism of inhibition. J Biol Chem 273:7030-7037.

70. Schrappe, M., A. Reiter, W.D. Ludwig, J. Harbott, M. Zimmermann, W. Hiddemann, C.

Niemeyer, G. Henze, A. Feldges, F. Zintl, B. Kornhuber, J. Ritter, K. Welte, H. Gadner,

and H. Riehm. 2000. Improved outcome in childhood acute lymphoblastic leukemia

despite reduced use of anthracyclines and cranial radiotherapy: results of trial ALL-

BFM 90. German-Austrian-Swiss ALL-BFM Study Group. Blood 95:3310-3322.

71. Silverman, L.B., R.D. Gelber, V.K. Dalton, B.L. Asselin, R.D. Barr, L.A. Clavell, C.A.

Hurwitz, A. Moghrabi, Y. Samson, M.A. Schorin, S. Arkin, L. Declerck, H.J. Cohen,

and S.E. Sallan. 2001. Improved outcome for children with acute lymphoblastic

leukemia: results of Dana-Farber Consortium Protocol 91-01. Blood 97:1211-1218.

72. Pui, C.H., and W.E. Evans. 2006. Treatment of acute lymphoblastic leukemia. N Engl J

Med 354:166-178.

73. Begley, C.G., L. Robb, S. Rockman, J. Visvader, E.O. Bockamp, Y.S. Chan, and A.R.

Green. 1994. Structure of the gene encoding the murine SCL protein. Gene 138:93-99.

74. Bernard, O., O. Azogui, N. Lecointe, F. Mugneret, R. Berger, C.J. Larsen, and D.

Mathieu-Mahul. 1992. A third tal-1 promoter is specifically used in human T cell

leukemias. J Exp Med 176:919-925.

75. Sanchez, M., B. Gottgens, A.M. Sinclair, M. Stanley, C.G. Begley, S. Hunter, and A.R.

Green. 1999. An SCL 3' enhancer targets developing endothelium together with

embryonic and adult haematopoietic progenitors. Development 126:3891-3904.

76. Gottgens, B., C. Broccardo, M.J. Sanchez, S. Deveaux, G. Murphy, J.R. Gothert, E.

Kotsopoulou, S. Kinston, L. Delaney, S. Piltz, L.M. Barton, K. Knezevic, W.N. Erber,

C.G. Begley, J. Frampton, and A.R. Green. 2004. The scl +18/19 stem cell enhancer is

not required for hematopoiesis: identification of a 5' bifunctional hematopoietic-

endothelial enhancer bound by Fli-1 and Elf-1. Mol Cell Biol 24:1870-1883.

77. Courtes, C., N. Lecointe, L. Le Cam, F. Baudoin, C. Sardet, and D. Mathieu-Mahul.

2000. Erythroid-specific inhibition of the tal-1 intragenic promoter is due to binding of

a repressor to a novel silencer. J Biol Chem 275:949-958.

Discussion

188

78. Le Clech, M., E. Chalhoub, C. Dohet, V. Roure, S. Fichelson, F. Moreau-Gachelin, and

D. Mathieu. 2006. PU.1/Spi-1 binds to the human TAL-1 silencer to mediate its

activity. J Mol Biol 355:9-19.

79. Pokholok, D.K., C.T. Harbison, S. Levine, M. Cole, N.M. Hannett, T.I. Lee, G.W. Bell,

K. Walker, P.A. Rolfe, E. Herbolsheimer, J. Zeitlinger, F. Lewitter, D.K. Gifford, and

R.A. Young. 2005. Genome-wide map of nucleosome acetylation and methylation in

yeast. Cell 122:517-527.

80. Lecointe, N., O. Bernard, K. Naert, V. Joulin, C.J. Larsen, P.H. Romeo, and D.

Mathieu-Mahul. 1994. GATA-and SP1-binding sites are required for the full activity of

the tissue-specific promoter of the tal-1 gene. Oncogene 9:2623-2632.

81. Bockamp, E.O., F. McLaughlin, A.M. Murrell, B. Gottgens, L. Robb, C.G. Begley, and

A.R. Green. 1995. Lineage-restricted regulation of the murine SCL/TAL-1 promoter.

Blood 86:1502-1514.

82. Bockamp, E.O., J.L. Fordham, B. Gottgens, A.M. Murrell, M.J. Sanchez, and A.R.

Green. 1998. Transcriptional regulation of the stem cell leukemia gene by PU.1 and Elf-

1. J Biol Chem 273:29032-29042.

83. Bockamp, E.O., F. McLaughlin, B. Gottgens, A.M. Murrell, A.G. Elefanty, and A.R.

Green. 1997. Distinct mechanisms direct SCL/tal-1 expression in erythroid cells and

CD34 positive primitive myeloid cells. J Biol Chem 272:8781-8790.

84. Braun, H., R. Koop, A. Ertmer, S. Nacht, and G. Suske. 2001. Transcription factor Sp3

is regulated by acetylation. Nucleic Acids Res 29:4994-5000.

85. Boyes, J., P. Byfield, Y. Nakatani, and V. Ogryzko. 1998. Regulation of activity of the

transcription factor GATA-1 by acetylation. Nature 396:594-598.

86. Waby, J.S., H. Chirakkal, C. Yu, G.J. Griffiths, R.S. Benson, C.D. Bingle, and B.M.

Corfe. Sp1 acetylation is associated with loss of DNA binding at promoters associated

with cell cycle arrest and cell death in a colon cell line. Mol Cancer 9:275.

87. Ammanamanchi, S., J.W. Freeman, and M.G. Brattain. 2003. Acetylated sp3 is a

transcriptional activator. J Biol Chem 278:35775-35780.

88. White, N.R., P. Mulligan, P.J. King, and I.R. Sanderson. 2006. Sodium butyrate-

mediated Sp3 acetylation represses human insulin-like growth factor binding protein-3

expression in intestinal epithelial cells. J Pediatr Gastroenterol Nutr 42:134-141.

89. Aplan, P.D., D.P. Lombardi, A.M. Ginsberg, J. Cossman, V.L. Bertness, and I.R.

Kirsch. 1990. Disruption of the human SCL locus by "illegitimate" V-(D)-J

recombinase activity. Science 250:1426-1429.

90. Kawamata, N., J. Chen, and H.P. Koeffler. 2007. Suberoylanilide hydroxamic acid

(SAHA; vorinostat) suppresses translation of cyclin D1 in mantle cell lymphoma cells.

Blood 110:2667-2673.

Discussion

189

91. Fenton, T.R., J. Gwalter, J. Ericsson, and I.T. Gout. Histone acetyltransferases interact

with and acetylate p70 ribosomal S6 kinases in vitro and in vivo. Int J Biochem Cell

Biol 42:359-366.

92. Pear, W.S., J.C. Aster, M.L. Scott, R.P. Hasserjian, B. Soffer, J. Sklar, and D.

Baltimore. 1996. Exclusive development of T cell neoplasms in mice transplanted with

bone marrow expressing activated Notch alleles. J Exp Med 183:2283-2291.

93. Weng, A.P., A.A. Ferrando, W. Lee, J.P.t. Morris, L.B. Silverman, C. Sanchez-Irizarry,

S.C. Blacklow, A.T. Look, and J.C. Aster. 2004. Activating mutations of NOTCH1 in

human T cell acute lymphoblastic leukemia. Science 306:269-271.

94. Tycko, B., S.D. Smith, and J. Sklar. 1991. Chromosomal translocations joining LCK

and TCRB loci in human T cell leukemia. J Exp Med 174:867-873.

95. Abraham, K.M., S.D. Levin, J.D. Marth, K.A. Forbush, and R.M. Perlmutter. 1991.

Thymic tumorigenesis induced by overexpression of p56lck. Proc Natl Acad Sci U S A

88:3977-3981.

96. Lacronique, V., A. Boureux, V.D. Valle, H. Poirel, C.T. Quang, M. Mauchauffe, C.

Berthou, M. Lessard, R. Berger, J. Ghysdael, and O.A. Bernard. 1997. A TEL-JAK2

fusion protein with constitutive kinase activity in human leukemia. Science 278:1309-

1312.

97. Carron, C., F. Cormier, A. Janin, V. Lacronique, M. Giovannini, M.T. Daniel, O.

Bernard, and J. Ghysdael. 2000. TEL-JAK2 transgenic mice develop T-cell leukemia.

Blood 95:3891-3899.

98. Irish, J.M., R. Hovland, P.O. Krutzik, O.D. Perez, O. Bruserud, B.T. Gjertsen, and G.P.

Nolan. 2004. Single cell profiling of potentiated phospho-protein networks in cancer

cells. Cell 118:217-228.

99. Barata, J.T., A.A. Cardoso, L.M. Nadler, and V.A. Boussiotis. 2001. Interleukin-7

promotes survival and cell cycle progression of T-cell acute lymphoblastic leukemia

cells by down-regulating the cyclin-dependent kinase inhibitor p27(kip1). Blood

98:1524-1531.