Identity, abundance and ecophysiology of filamentous Chloroflexi species present in activated sludge treatment plants: Ecophysiology of filamentous Chloroflexi species

Identity, abundanceand ecophysiologyof¢lamentousChloro£exispecies present inactivated sludge treatment plantsCaroline Kragelund1, Caterina Levantesi2, Arjan Borger3, Karin Thelen4, Dick Eikelboom5,Valter Tandoi2, Yunhong Kong1, Jaap van der Waarde6, Janneke Krooneman7, Simona Rossetti2,Trine Rolighed Thomsen1 & Per Halkjær Nielsen1

1Section of Environmental Engineering, Department of Biotechnology, Chemistry and Environmental Engineering, Aalborg University, Aalborg,

Denmark; 2CNR, Water Res Institute, Rome, Italy; 3TNO MEP; Department of Environmental Engineering; Laan van Apeldoorn, The Netherlands;4VERMICON AG, Munich, Germany; 5ASIS vof, Zutphen, The Netherlands; 6SNV Kameroen, Koeriersdienst Ministerie van Buitenlandse Zaken,

Den Haag, The Netherlands; and 7BIOCLEAR Environmental Biotechnology, Groningen, The Netherlands

Correspondence: Per Halkjær Nielsen,

Section of Environmental Engineering,

Department of Biotechnology, Chemistry and

Environmental Engineering, Aalborg

University, Sohngaardsholmsvej 57, DK-9000

Aalborg, Denmark. Tel.:145 96358503;

fax145 96350558; e-mail: [email protected]

Received 6 March 2006; revised 6 October

2006; accepted 15 October 2006.

First published online 22 December 2006.

DOI:10.1111/j.1574-6941.2006.00251.x

Editor: Michael Wagner

Keywords

Chloroflexi ; filamentous bacteria; activated

sludge; ecophysiology.

Abstract

Filamentous Chloroflexi species are often present in activated sludge wastewater

treatment plants in relatively low numbers, although bulking incidences caused by

Chloroflexi filaments have been observed. A new species-specific gene probe for

FISH was designed and using phylum-, subdivision-, morphotype 1851- and

species-specific gene probes, the abundance of Chloroflexi filaments were mon-

itored in samples from 126 industrial wastewater treatment plants from five

European countries. Chloroflexi filaments were present in 50% of the samples,

although in low quantities. In most treatment plants the filaments could only be

identified with phylum or subdivision probes, indicating the presence of great

undescribed biodiversity. The ecophysiology of various Chloroflexi filaments was

investigated by a suite of in situ methods. The experiments revealed that Chloroflexi

constituted a specialized group of filamentous bacteria only active under aerobic

conditions consuming primarily carbohydrates. Many exo-enzymes were excreted,

e.g. chitinase, glucuronidase and galactosidase, suggesting growth on complex

polysaccharides. The surface of Chloroflexi filaments appeared to be hydrophilic

compared to other filaments present. These results are generally supported by

physiological studies of two new isolates. Based on the results obtained in this

study, the potential role of filamentous Chloroflexi species in activated sludge is

discussed.

Introduction

Members of the phylum Chloroflexi, formerly known as the

green nonsulphur bacteria, have primarily been associated

with extreme habitats, e.g. microbial mats in hot springs

(Boomer et al., 2002; Nubel et al., 2002) and hypersaline

environments (Nubel et al., 2001), where they are known as

(filamentous) anoxygenic photothophs (Hanada et al., 2002;

Hanada & Pierson, 2002; Nubel et al., 2002). Filamentous

members of the phylum Chloroflexi have also been found in

activated sludge wastewater treatment plants (WTP), and they

have occasionally been associated with bulking incidences

(Beer et al., 2002; Bjornsson et al., 2002; Schade et al., 2002).

A common filamentous microorganism, Eikelboom’s

morphotype 1851, has been micromanipulated, cultured,

and sequenced, which has revealed that this morphotype

belongs to the phylum Chloroflexi (Beer et al., 2002). A

species-specific gene probe for FISH demonstrated its pre-

sence in activated sludge systems. Bjornsson et al. (2002)

developed a phylum-specific as well as two subdivision-

specific gene probes for Chloroflexi based on five clones

originating from a sequencing batch reactor as well as

publicly available Chloroflexi sequences. Phylogenetic analy-

sis of the sequences revealed four subdivisions in total, but

target sites suitable for probes were only found for two

(div. 1 and 3). In subdivision 1, mainly clones from environ-

mental sources were located, e.g. from polluted habitats;

isolates obtained from activated sludge were also found here

(Juretschko et al., 2002; Yamada et al., 2005). In subdivision

3, most characterized isolates clustered, e.g. morphotype

1851 (Beer et al., 2002), Chloroflexi ssp., Oscillochloris ssp.,

Roseiflexus carstenholzii and Herpetosiphon ssp. The closest

FEMS Microbiol Ecol 59 (2007) 671–682 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

relative to morphotype 1851 was Roseiflexus carstenholzii

[however, it only shares 84% 16S rRNA gene sequence

similarity; Beer et al. (2002)]. Many Chloroflexi members,

at least those found in activated sludge, resemble morpho-

type 1851 as defined by Eikelboom & van Buijsen (1983) and

Jenkins et al. (1993). This morphotype is characterized as

having a cell diameter of 0.5–0.8 mm, length of filaments

4 200 mm, with rectangular cell shape and weak Gram-

positive and Neisser-negative stain. They possess an atypical

Gram-negative cell wall (Beer et al., 2002), and staining

results seem to some extent to depend on the dye used in

Gram solution A (carbol gentian violet vs. crystal violet)

(D.H. Eikelboom, personal communication). They are fre-

quently observed with epiphytic bacteria, especially in

municipal WTP, and are often found in bundles.

Little is known about the physiology of filamentous

Chloroflexi in activated sludge. Only a few pure culture

studies have been conducted; one on the morphotype 1851

identified as Chloroflexi (Kohno et al., 2002) and another on

filamentous Chloroflexi isolated from mesophilic and ther-

mophilic methanogenic sludge granules (Yamada et al.,

2005). In the first study, five filamentous orange-pigmented

strains were isolated, characterized as morphotype 1851,

and named Kouleothix aurantiaca. Minor discrepancies were

seen between pure culture observations and the character-

ization manuals based on in situ observations, relating to

Gram staining, gliding motility on solid media and filament

length. The isolates grew mainly on sugars (e.g. glucose,

mannose, trehalose, and xylose) and pyruvate. Two of the

five strains were able to reduce nitrate to nitrite, and all

strains were able to ferment glucose (Kohno et al., 2002).

Three strains were also isolated from thermophilic and

mesophilic methanogenic sludge granules, and pure culture

investigations showed that they were strict anaerobes and

were specialized on carbohydrates (glucose, fructose and

sucrose). However, no growth was observed if yeast extract

was not added (Yamada et al., 2005). Recently, filamentous

Chloroflexi were identified in a nitrifying biofilm by applying

the phylum-specific gene probes (CFX1223 and GNSB941)

(Kindaichi et al., 2004). Studies of the ecophysiology using

FISH-micro-autoradiography (MAR) showed that they took

up N-acetylglucosamine and a mixture of amino acids, but

they were never observed to take up acetate.

Recent studies on the ecophysiology of filamentous

microorganisms in activated sludge wastewater treatment

plants (WWTP) suggest that it is impossible to make general

statements regarding their physiology (Wagner et al., 2002).

Properties such as substrate uptake capability and rates,

substrate affinity, storage abilities, surface properties, and

exo-enzyme activity depend on the species examined. Stu-

dies on Microthrix (Nielsen et al., 2002), Thiothrix (Nielsen

et al., 2000), filamentous Alphaproteobacteria (Kragelund

et al., 2006), Aquaspirillum-related filaments (Thomsen

et al., 2006), Skermania (Eales et al., 2005) and TM7-related

filaments (Thomsen et al., 2002) revealed that, generally,

two types of physiological strategies are exhibited by these

filamentous bacteria. Some filamentous bacteria are versatile

in substrate utilization, appearing as general consumers of

organic matter and exemplified by the filamentous Alpha-

proteobacteria (Kragelund et al., 2006). Others are very

restricted and thus consumers of only few specific organic

compounds such as lipids by Microthix (Andreasen &

Nielsen, 2000; Nielsen et al., 2002). Some filamentous

species are also able to take up substrates with electron

acceptors other than oxygen and have a large storage

capacity. Based on this, it appears that many filamentous

bacteria possess an unusual physiology and ecology. If

detailed knowledge about the ecophysiology of specific

filamentous bacteria were combined with the characteriza-

tion of WWTP process conditions, better and more efficient

WWTP control strategies could be developed to prevent

sludge bulking.

In this study, the identity, abundance, and ecophysiology

of Chloroflexi species in industrial and municipal WWTP

were investigated. For this purpose, a new species-specific

gene probe was designed and the ecophysiology of filamen-

tous Chloroflexi in industrial and municipal WWTPs was

investigated by applying several in situ methods in combina-

tion with FISH. Also included are physiological character-

istics of two new Chloroflexi isolates, which appear to be

closely related to K. aurantiaca.

Materials and methods

Activated sludge

Activated sludge samples used for the survey were fixed

directly at the WWTP in 50% ethanol or 3.6% formaldehyde

to preserve both Gram-positive and Gram-negative bacteria.

In total, 126 samples from different industrial WWTPs and

five samples from municipal WWTPs were used to monitor

the presence and abundance of filamentous Chloroflexi as

well as other filamentous species. Samples from many

different industrial plants were included [agro industry (6),

brewery (2), chemical (27), dairy (10), fish (3), food (11),

potato (12), pulp and paper (22), textile (5), tannery (4),

other (13), domestic (4), and unknown (6)]. Samples were

collected in Denmark, Italy, Poland, Germany and the

Netherlands. Of the 126 different industrial plants, 68 had

nitrification and 58 also had denitrification.

Ecophysiology experiments were carried out with acti-

vated sludge from industrial and municipal plants from the

Netherlands (TNO17 and TNO25), Italy (CNR1) and Den-

mark (Ega and Skagen). Plant descriptions are presented in

Table 1 for all plants except TNO25, for which data were not

available. All five WWTPs had nitrification, three had

FEMS Microbiol Ecol 59 (2007) 671–682c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

672 C. Kragelund et al.

denitrification and two had enhanced biological phosphorus

removal. The temperature of the process tank varied, and

industrial WTP were operated at a higher temperature than

most municipal WTP. A selector [a small compartmenta-

lized tank where raw influent is mixed with return sludge to

control filaments, see e.g. Martins et al. (2004)] was present

in TNO17.

The activated sludge was collected and sent to Aalborg

(Denmark) by express mail overnight. In situ experiments

were conducted immediately after arrival of the sample.

Undiluted sludge was used for exo-enzyme and surface

property experiments. In all other experiments the sludge

was diluted to 1 gSS L�1 with nitrate or nitrite-free super-

natant from the activated sludge.

Isolation, phylogenetic analysis and probedesign

Thee isolates of filamentous bacteria morphologically iden-

tified as morphotype 1851 (Strain EU25, Ver9Iso1 and

Ver9Iso2) were obtained by micromanipulation from acti-

vated sludge samples originating from industrial WWTP

treating pulp and paper waste and brewery waste. EU 25 was

isolated on a simple medium (MSV1acetate, MSV1A)

composed of MSV mineral base (Williams & Unz, 1989)

acetate (0.5 g CH3COO�L�1) as sole carbon source and

Eikelboom vitamin solution (1% v/v Eikelboom, 1975).

The rich R2A medium (Reasoner & Geldreich, 1985) was

used to isolate Ver9Iso1 and Ver9Iso2.

PCR, purification of products and sequencing were

performed as described in detail elsewhere (Levantesi et al.,

2004). The sequences were edited using Sequencer DNA

sequencing software (Gene Codes Inc., Ann Arbor, MI).

Checks for chimeric sequences were conducted using the

CHECK_CHIMERA program from Ribosomal Database Project

(http://rdp.cme.msu.edu) and the program BELLEROPHON

(Hugenholtz & Huber, 2003). 16S rRNA gene sequences

were compiled and aligned using the automatic nucleic acid

aligner in the ARB software package (Ludwig et al., 2004), and

alignments were refined manually. Aligned sequences were

used for calculation of trees by neighbour-joining, distance

matrix, parsimony, and maximum likelihood approaches

using default settings in the ARB software. Oligonucleotide

probes were designed using the probe design/match tools in

the ARB software package. To evaluate the formamide con-

centration for optimum stringency, the designed probe was

analyzed on ethanol-fixed EU25 culture applying hybridiza-

tion buffer containing 0–60% formamide (5% increments).

Identification and abundance

The filamentous bacteria present in industrial WWTPs were

morphologically identified using the Eikelboom classifica-

tion system and the filament index (FI) (Eikelboom, 2002).

FI determines the population size of filamentous bacteria

and ranges from 0 (no filaments) to 5 (very many).

Furthermore, FISH was applied with 16S rRNA gene-

targeted oligonucleotide probes targeting all Bacteria, the

Chloroflexi phylum, subdivisions and specific species within

Chloroflexi (Table 2). Further details on oligonucleotide

probes are available at probeBase (Loy et al., 2003). Oligo-

nucleotides were labelled with 5(6)-carboxyfluorescein-N-

hydroxysuccinimide ester (FLUOS) or with the sulphoindo-

cyanine dyes (Cy3 and Cy5) (Thermohybaid Interactive,

Ulm, Germany). A confocal laser scanning microscope,

CLSM (LSM 510, Carl Zeiss, Oberkochen, Germany)

equipped with a UV laser (351 and 364 nm), an Ar ion laser

(458 and 488 nm), and two HeNe lasers (543 and 633 nm)

were used to record fluorescent signals from the gene

probes.

The abundance of Chloroflexi species was determined in

126 industrial and five municipal WTP with different

process designs. The above-mentioned gene probes were

applied to estimate the filament abundance of the Chloro-

flexi phylum (probe CFX1223), subdivision 1 (probe

CFX784) and 3 (probe CFX109) of Chloroflexi, morphotype

1851 (probe Chl1851) as well as the K. aurantiaca-related

bacteria targeted by probe EU25-1238. Hybridizations

with any of the above-mentioned Chloroflexi probes for

the screening were done in combination with CFXMIX

(CFX12231GNSB941).

Table 1. Overview of wastewater treatment plants used for ecophysiological studies

Type of industry

AAE CNR1 Skagen Ega TNO17

Municipal Tannery Fish industry Municipal Paper

Nitrification 1 1 1 1 1

Denitrification 1 1 1 1 �Phosphorus removal (Biological/Chemical) B1Ch Ch B1Ch B1Ch Ch

Temperature of process tank ( 1C) 8–18 18–25 8–18 8–18 20

Sludge age (days) 25 15 25 25 30

Selector present� � � � � 1

�A small compartmentalized tank with a short residence time where raw influent is mixed with return sludge.

FEMS Microbiol Ecol 59 (2007) 671–682 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

673Ecophysiology of filamentous Chloroflexi species

In most cases, combinations of MAR-FISH, ELF-FISH,

and MAC-FISH (see below) were used for the studies of

ecophysiology, and hybridization was always done with

species-specific gene probes combined with the EUBMIX

(EUB3381EUB338-II1EUB338-III) targeting all Bacteria.

All the above-mentioned methods were examined by CLSM

before hybridization with gene probes, except MAR-FISH.

For MAR-FISH, hybridization with gene probes was per-

formed before applying the photographic emulsion. Posi-

tions of interest were recorded by an automatic stage

controller, and digital images of filaments were recorded.

Fresh samples used for ELF and MAC were fixed in 4%

paraformaldehyde for 1 h before FISH was conducted as

described by Amann (1995) and the stage control enabled

relocation of the microscopic field. Slight modification of

MAC-FISH and ELF-FISH were necessary, for details see

Kragelund et al. (2005).

Physiological characterization of isolates EU25and Ver9Iso2

The aerobic growth of EU25 and Ver9Iso2 was analyzed on a

range of carbon and nitrogen sources at 20 1C. Ver9Iso1 was

not further characterized. Tests were performed in triplicate,

and positive growth was determined against a negative

control without any carbon or nitrogen source. The inocu-

lum for these experiments was grown in liquid MSV1A

medium, and cultures were inoculated at 1% (v/v). MSV

mineral base with Eikelboom vitamin solution 0.1% (v/v)

was used for substrate utilization tests; carbon source

concentration was 0.5 g L�1 except alcohols and Tween 80

added at 1% (v/v). Acetate consumption during EU25

growth was ascertained by gas chromatography (Perkin

Elmer 8500, stationary phase Carbopack B-DA 80-120 4%

CW 20 M) measuring substrate concentration before inocu-

lum and after 10 days when growth was clearly visible.

Growth of isolates on different nitrogen sources (ammo-

nium, nitrate, nitrite, urea) was assessed by adding these

compounds (at 0.011% w/v of nitrogen) to basal medium

devoid of other nitrogen-containing compounds. For these

tests, acetate was used as substrate (0.5 g L�1), and Eikel-

boom vitamin solution 0.1% (v/v) was added to the media.

Autotrophic growth was tested in liquid MSV mineral

base with Eikelboom vitamin solution 0.1% (v/v) without

any added organic carbon source and with the addition

of NaHCO3 solution (0.42 g L�1) and NaS2O3 � 5H2O

(0.4 g L�1). Denitrification tests were carried out in tubes

containing liquid medium. R2A liquid medium was used for

Ver9Iso2 and MSV1A medium for EU25 with the addition

of 0.1% KNO3. The vials contained a Durham tube that

allowed visualization of any gas produced during incuba-

tion. Nitrite production was determined colorimetrically.

The ability to grow under anaerobic conditions was analyzed

using several different experimental strategies to obtain

anaerobiosis; anaerobiosis in a serum bottle with N2,

anaerobiosis in oxoid anaerobic bags (with oxygen indica-

tor), and anaerobiosis in an anaerobic chamber. The tem-

perature growth range of strains EU25 and Ver9Iso2 was

determined in liquid R2A medium incubated at 10, 15, 20,

25, 35 and 40 1C.

Nucleotide accession numbers

Partial length 16S rRNA gene sequences (1127 bp) of EU25,

Ver9Iso1 and Ver9Iso2 (1330 bp and 1252 bp, respectively)

were deposited in Genbank under the accession numbers

DQ232757, DQ812549 and DQ812550, respectively.

MAR and MAR-FISH

The micro-autoradiography experiments were performed

using 3H-labelled and 14C-labelled organic compounds and14C-labelled bicarbonate. Details of the procedure, which

includes incubation, fixation, and hybridization with gene

probes, addition of a radiosensitive emulsion, exposure,

processing, and microscopical investigations, are given else-

where (Andreasen & Nielsen, 1997; Lee et al., 1999; Nielsen

Table 2. Overview of specificity, sequences and hybridization conditions of oligonucleotide probes used

Probe name Specificity Probe sequence (50–30) % FA� Reference

EUB338 Most Bacteria GCTGCCTCCCGTAGGAGT 0–60 Amann et al. (1990)

EUB338-II Planctomycetales GCAGCCACCCGTAGGTGT 0–35 Daims et al. (1999)

EUB338-III Verrucomicrobiales GCTGCCACC CGTAGGTGT 0–60 Daims et al. (1999)

CFXMIX(CFX12231GNSB941) Phylum Chloroflexi CCATTGTAGCGTGTGTGTMG1

AAACCACACGCTCCGCT

35 Bjornsson et al. (2002),

Gich et al. (2001)

CFX109 Chloroflexi subdivision 3 CACGTGTTCCTCAGCCGT 30 Bjornsson et al. (2002)

CFX784 Chloroflexi subdivision 1a1b ACCGGGGTCTCTAATCCC 35 Bjornsson et al. (2002)

Chl1851 Filamentous bacterium

Eikelboom morphotype 1851

AATTCCACGAACCTCTGCCA 35 Beer et al. (2002)

EU25-1238 Kouleothix aurantiaca Isolate EU-25 CTGCGCATTGCCACCGACAT 35 This study

�Formamide concentration in hybridization buffer (v/v).

FEMS Microbiol Ecol 59 (2007) 671–682c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

674 C. Kragelund et al.

et al., 2000). In brief, two series of studies were conducted.

In the first series, various potential substrates were tested for

uptake under aerobic conditions to see whether gene probe-

defined representatives of Chloroflexi (probe-positive phy-

lum filaments (CFX1223), probe-positive subdivision 3

filaments (CFX109), probe-positive Type 1851 filaments

(Chl1851) or probe-positive K. aurantiaca-like filaments

(EU25-1238) were specialized or general consumers of

organic substrates. For this, a selection of substrates was

chosen representing short and long chain fatty acids, sugars,

alcohols, and amino acids. In the second series, potential use

of electron acceptors other than O2 was tested by studying

uptake of the same positively tested organic substrates with

nitrate or nitrite present as electron acceptor or under

anaerobic conditions (no oxygen, nitrate, or nitrite present).

In all experiments, 2 mL diluted activated sludge (1 gSS L�1)

was transferred to glass serum vials with a final substrate

concentration of 2 mM, and the labelled fraction was 10 mCi

per vial. Incubation time was 3 h (5 h for bicarbonate). In all

anaerobic incubations with nitrate or nitrite as e-acceptor

and strict anaerobic experiments, a preincubation step of 2 h

was included with unlabelled organic substrate (2 mM, oleic

acid 0.5 mM). In this way, only bacteria able to take up large

amounts of the substrate under these conditions (for storage

or growth) would be MAR-positive (Andreasen & Nielsen,

2000). After the preincubation period, labelled (10mCi per

vial) and unlabelled substrate was added to a final substrate

concentration of c. 2 mM (oleic acid 0.5 mM). The samples

were incubated for 3 h. All vials for anaerobic incubation

with either nitrate or nitrite as e-acceptor and strict anaero-

bic incubations were closed with a gas-tight rubber stopper

and flushed with ultrapure nitrogen gas before incubation.

When thiosulphate or nitrate was added, a final concentra-

tion of 2 mM was used (nitrite only 0.5 mM). A minimum of

30 filaments of each gene probe-defined organism were

investigated in each incubation to determine potential

uptake. In most experiments, MAR-positive and MAR-

negative filaments were assessed by comparing silver grains

on top of filaments to the background level. As a control for

chemography, sludge was pasteurized at 70 1C for 10 min

just before incubation under defined conditions. Light

microscopy was used to detect silver grains from MAR.

[3H]N-acetylglucosamine was purchased from American

Radiolabelled Chemicals Inc. (Bio Nuclear AB, Sweden).

Details of other radiochemicals used in this study can be

found elsewhere (Kragelund et al., 2005).

The isolate EU25 was grown in R2A medium. It was

washed thee times in liquid MSV media before MAR

incubation to remove residual carbon substrate. MAR

experiments were performed as described above. Additional

experiments were designed to test aerobic the photoauto-

trophic or photoheterotrophic ability of EU25. For this

purpose, labelled bicarbonate was used in combination with

unlabelled substrates (acetate and thiosulphate), and incu-

bations were carried out in both light and darkness. An

anaerobic experiment was carried out to determine the

potential uptake of labelled bicarbonate together with

acetate and thiosulphate in the presence of light.

Enzyme-labelled fluorescence (ELF), ELF-FISH

The presence of exo-enzyme activity was determined using

enzyme-labelled fluorescence (ELFs-97, Molecular Probes,

Eugene, OR), where substrates upon enzymatic cleavage

form a fluorescent precipitate (excitation 345 nm/emission

530 nm) on the surfaces of bacteria or microcolonies within

flocs (Van Ommen & Geesey, 1999; Nielsen et al., 2002). The

enzymatic activities of chitinase, esterase, galactosidase,

glucuronidase, lipase, and phosphatase activities were in-

vestigated. An optimized protocol can be found elsewhere

(Kragelund et al., 2005, 2006).

MAC, MAC-FISH

Surface properties were investigated using microsphere

adhesion to cells (MAC) where sulphate-modified micro-

spheres with hydrophobic characteristics and a diameter of

0.02 mm were applied (Molecular Probes). Details of micro-

spheres and protocol have previously been described (Niel-

sen et al., 2001; Kragelund et al., 2005).

Results

Phylogenetic analysis and gene probe design

Isolate EU25 and Ver9Iso2 shared 98% sequence similarity.

EU25 clustered together with the Eikelboom morphotype

1851 sequence obtained by Beer et al. (2002) in subdivision

3, along with most of the other isolates of Chloroflexi sp. The

isolate EU25 was closely related (99.1–99.9% 16S rRNA gene

sequence similarity) to the published sequences for K.

aurantiaca (GenBank AB079637-41). The sequence similar-

ity of isolate EU 25 and Eikelboom Type 1851 (Beer et al.,

2002) was 94.7%. Ver9Iso 1 and Ver9Iso2 shared 99%

sequence similarity. The K. aurantiaca sequences and Ver9-

Iso2 shared 98%. Ver9Iso2 and Eikelboom Type 1851 (Beer

et al., 2002) shared c. 93% sequence similarity.

The phylogenetic tree based on all publicly available 16S

rRNA gene sequences of primarily activated sludge clones

including isolate EU25 and Ver9Iso1 and 2 belonging to the

Chloroflexi phylum is shown in Fig. 1. Subdivisions 1–4

defined by Bjornsson et al. (2002) are marked with digits. All

sequences included are targeted by the phylum-specific

probes (CFXMIX), and the subdivision probes are also

denoted with a digit [subdivision 1 (CFX784) and subdivi-

sion 3 (CFX109), respectively]. All sequences within

FEMS Microbiol Ecol 59 (2007) 671–682 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

675Ecophysiology of filamentous Chloroflexi species

subdivision 3 were a perfect match to CFX109. Within this

subdivision, the probe Chl1851 designed for morphotype

1851 in 2002 by Beer et al. also targeted all K. aurantiaca

strains as well as isolates EU25, Ver9Iso1 and Ver9Iso2. One

16S rRNA gene-targeted oligonucleotide probe (EU25-

1238) in this project was designed in 2001 to target EU25

and was applied on all industrial samples collected in this

study. The probe sequence for EU25-1238 was 50-

CTGCGCATTGCCACCGACAT-30, and the optimal forma-

mide concentration was determined as 35%. Isolates EU25,

Ver9Iso1, Ver9iso2 and K. aurantiaca strains were a perfect

match to the probe EU25-1238.

Morphology of Chloroflexi filaments

Morphological characteristics such as filament length,

width, and cell shape were noted for filaments included in

the ecophysiological study, and measurements were carried

out on FISH-labelled filaments rather than on fresh samples.

This was done to locate the filaments otherwise hidden

inside floc material and, thus, cell diameter of the filaments

might be slightly biased due to the fixation procedure and

the FISH protocol. Only minor differences were observed

between the different gene probe-defined Chloroflexi sp.

Variable diameters were observed, ranging from 0.5 to

1.0 mm and variable Gram staining results. Moreover, epi-

phytic bacteria were absent from most of the Chloroflexi

filaments in industrial samples, whereas heavy growth of

epiphytic bacteria was noted in municipal WTP. All repre-

sentatives had a rectangular cell shape, were relatively short

and contained small PHA granules. Most Chloroflexi fila-

ments targeted by any of the above-mentioned probes in the

survey also hybridized with the probe for all Bacteria

(EUBMIX). However, only about half of the CFX109-positive

populations in the WWTP used for ecophysiological studies

showed a positive EUBMIX signal, indicating that the EU-

BMIX is unable to hybridize with all Chloroflexi species.

Abundance

The filament index of the 126 industrial samples screened

exceeded 1.5 for 104 samples and, of these, 92% had FI

greater than 2.5. Industrial WWTP often contained co-

occurring filamentous populations and this was found in

CFX784

0.10

EU25-1238

Chl1851

CFX109

CFX1223 +GNSB-941

33

2244

11

Fig. 1. 16S rRNA gene tree showing the phylogenetic affiliation of strain EU25, isolates Ver9Iso1 and Ver9Iso2 within the Chloroflexi phylum. The tree

was calculated by the neighbour-joining method using ARB default settings. The scale bar corresponds to 10% estimated sequence divergence. Perfect-

match organisms targeted by gene probes are illustrated with grey boxes. Acinetobacter was chosen as out-group (not shown). Numbers correspond to

subdivisions defined by Bjornsson et al. (2002).

FEMS Microbiol Ecol 59 (2007) 671–682c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

676 C. Kragelund et al.

c. 75 of the WWTPs, 35% of which contained Chloroflexi

with a filament index 4 1.5. Chloroflexi were identified in

63 of the WWTPs; of these, 52% contained Chloroflexi

populations larger than FI4 1.5. Only in 16 WWTPs were

Chloroflexi present as FI4 2.5. In general, no industrial

waste particularly favoured the presence of filamentous

Chloroflexi; they were detected in all types of industries as

well as in all the municipal plants. Filamentous Chloroflexi

were found in WWTP with carbon removal, nitrification

and denitrification. In 32 of the Chloroflexi- containing

WWTP samples it was not possible to identify the filament

beyond phylum level (CFX 1223), indicating the presence of

many yet unidentified Chloroflexi species. In seven samples

probe CFX1223 positive filaments were higher than

FI4 1.5. Subdivision 3 affiliated Chloroflexi positive by

probe CFX109 were responsible for the high filament index

(FI4 1.5) in four WWTPs, probe positive EU25-1238

targeted filaments in two WWTPs, probe-defined CFX784

filaments and probe Chl1851 positive filaments each in one

plant. Approximately 50% of the probe EU25-1238 defined

filaments did not hybridize with the probe Chl1851,

although the sequence of EU25 should have a perfect match

to probe Chl1851. This could indicate an undescribed

phylogenetic diversity. The gene probe-defined filaments

were often located in bundles within the floc material,

rendering a morphological identification difficult. They

were rarely found outside flocs, except if filament index

exceeded 2, as was the case in most samples used for

ecophysiological studies.

Different morphologies were targeted by the Chloroflexi

probes in the FISH survey; CFX1223 targeted primarily

typical morphotype 1851 as well as some without epiphytic

bacteria. Also, some filaments were very thin (0.5 mm), and

others with a diameter of 2.0 mm were targeted. A few

showed similarities to a thick morphotype 0041, and others

looked like morphotype Type 021N. CFX 109 targeted

mainly thin filaments without attached growth. The probes

Chl1851 and EU25-1238 both primarily targeted morpho-

type Type 1851, although some differences were seen with

respect to epiphytic bacteria and Gram staining results.

Apart from filamentous bacteria, single cells were targeted

by the phylum-specific probes (CFX1223 and CFXMIX) as

well as the subdivision-specific probes (CFX784 and

CFX109).

Pure culture physiology

Isolates Ver9Iso2 and EU25 grew preferentially on carbohy-

drates (glucose, fructose), organic acid (acetate, pyruvate)

and yeast extracts; no alcohols were utilized (Table 3). Minor

differences were observed between the two isolates, in

particular in propionate usage. However, these differences

might account for the longer incubation time of strain

Ver9Iso2, where it was observed that a larger selection of

substrates could be utilized by increasing the incubation

time from 40 to 90 days. Uptake of acetate was validated for

isolate EU25 by gas chromatography. Here, acetate concen-

tration decreased to 24% of initial concentration after c. 10

days of incubation. None of the isolates was able to grow

chemo-autotrophically. Neither isolate EU25 nor Ver9Iso2

was able to denitrify. The capability to grow anaerobically

could not be verified due to replica failure. However, only

scarce growth was observed whenever positive anaerobic

growth replicas were obtained. The temperature growth

range was identical for both isolates, where 15 1C was the

minimum temperature sustaining growth, and 35 1C the

maximum temperature.

The pure culture EU25 was tested for uptake of several

substrates (Table 4) using MAR, and only glucose and

mannose were taken up; uptake of fatty acids, amino acids

or ethanol was not observed. Minute traces of glucose were

taken up under conditions where nitrate served as

e-acceptor. No aerobic photoautotrophic or photochemo-

trophic behaviour was observed for EU25. Anaerobic in-

cubation with labelled bicarbonate together with acetate and

thiosulphate did not result in a positive MAR signal (data

not shown).

Table 3. Physiology of isolates EU25 and Ver9Iso2 in pure culture and

Kouleothix aurantiaca data from Kohno et al. (2000)

Metabolism EU25 Ver9Iso2 Kouleothix aurantiaca

Chemoautotrophic � � ND

Denitrification � � �Reduction of NO3

�-NO2� � � 1 (two strains)

Anaerobic growth 1� � 1� � 1 (glucose and fructose)

Substrate utilized

for growth

1 1 1

Glucose 1 1 ND

Fructose 1 1 1

Lactose ND 1 ND

Galactose 1 1 ND

Acetate 1 1 1

Pyruvate � 1� ND

Propionate ND 1 ND

Lactate � ND ND

Oxalacetate � � ND

Citrate 1 1 ND

Yeast extract ND 1 ND

Casaminoacids � � ND

Ethanol � � ND

Propanol � ND ND

Butanol � ND ND

Tween 80

Temperature growth

range

15–35 1C 15–35 1C 25–30 1Cw

�Growth after 90 days of incubation.wOptimum growth temperature. ND, not determined; 1� , failure

between replica; 1, growth; � , no growth.

FEMS Microbiol Ecol 59 (2007) 671–682 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

677Ecophysiology of filamentous Chloroflexi species

Ecophysiology

Substrate assimilation profile

A number of WWTPs were selected for detailed studies of

the ecophysiology of various probe-defined Chloroflexi

species. Type 1851 (positive with Chl1851) was present in

one treatment plant. A closely related species positive with

the probe EU25-1238, but not probe Chl1851, was present

in another two plants. Some filaments, not positive with the

specific probes, but positive with the broader probe CFX109,

were also studied as well as some filaments only positive

with the phylum probe CFX1223. Uptake of various carbon

substrates by the probe-defined Chloroflexi under aerobic in

situ conditions is shown in Table 4. All substrates tested were

taken up by some floc-forming bacteria and single cells

during all incubations, serving as positive controls.

Type 1851 (positive with Chl1851 or EU25-1238) mainly

consumed glucose and N-acetylglucosamine among the

substrates tested. They did not consume a range of other

substrates such as acetate, ethanol and amino acids. How-

ever, some filaments also took up butyrate and pyruvate; this

was largely in agreement with the pure culture studies.

Other Chloroflexi species positive with the broader probes

(subdivision 3-targeted filaments and phylum-specific fila-

ments) also all consumed glucose and, to a varying degree,

the other substrates. Some filaments only positive with the

phylum probe (CFX1223) showed a slightly broader uptake

spectrum, which reflects the existence of one or more new

Chloroflexi species in the plant. Uptake of substrates under

denitrifying or anaerobic conditions was never observed for

any Chloroflexi (data not shown).

Surface properties and exo-enzymatic activity

The distribution of hydrophobic and hydrophilic surfaces

was investigated in the different sludges by MAC (Table 5).

Sludge flocs from all industrial WWTPs showed parts of

the flocs covered with microspheres and other parts with-

out microspheres, thus acting as control. All gene probe-

defined filaments tested hydrophilic, as no hydrophobic

microspheres attached to their surface. Although probe

EU25-1238-defined filaments from TNO25 appeared

slightly less hydrophilic with few microspheres attached,

other filamentous species present in the sludge were more

Table 4. Uptake of substrates by the different filamentous Chloroflexi species under aerobic conditions as investigated by MAR

Probe WTP

CFX1223 CFX109 Chl1851 EU25-1238

CNR1 AAE Ega Skagen TNO17 Skagen TNO25

Pure culture

EU25

Formate � � � � � � � �Acetate � 1 � � � � � ND

Propionate � ND � � ND � � �Butyrate � 11 � 11 ND � 1 �Pyruvate � (1) � � 11 � � �Oleic acid � � � � � � � �Glucose 11 (1) 1/11 1/11� 11 11 1 11

Mannose 11 ND � � 1 � � 1

Galactose 1 ND � � � � � �Leucine � ND � � � (1) � �Glycine � � � � ND � � �Thymidine ND 11 ND ND ND ND ND ND

Ethanol � ND � � ND � � �N-acetyl-glucosamine ND 11 � � ND 11 ND ND

Bicarbonate1thiosulphate � ND � � ND � � �

�Not all filaments are positive.

ND, not determined; � , No silver grains (no substrate uptake); (1), some filaments slightly positive, some silver grains; 1, few silver grains, but clearly

positive; 11, positive, many silver grains.

Table 5. Surface properties and exo-enzymatic activity of the Chloro-

flexi species determined by MAC and ELF, respectively

WTP

Gene probe

defined

filament

Surface

properties

(MAC)

Exo-enzyme

activity (ELF)

CNR1 CFX1223 � CHIT/GLU

AAE CFX1223 ND CHIT/GLU

TNO17 Chl1851 � EST/GLU

TNO25 EU25-1238 (� ) EST/GAL

Pure culture EU25 EU25-1238 � EST/GAL

ND, not determined; � ,no hydrophobic beads attached; (� ), few

hydrophobic beads attached; CHIT, chitinase; EST, esterase; GAL, galac-

tosidase; GLU, glucuronidase.

FEMS Microbiol Ecol 59 (2007) 671–682c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

678 C. Kragelund et al.

hydrophobic. The pure culture EU25 was also characterized

as hydrophilic.

The presence of exo-enzyme activity in the sludge flocs

and on the filament surfaces was determined by enzyme-

labelled fluorescence assays (Table 5). Sludge flocs from all

plants exhibited exo-enzyme activity for all enzymes tested,

although some enzyme activity was low and some very high,

e.g. lipase and esterase, respectively. Esterase activity was

observed for all Type 1851 (Chl1851 or EU25-1238-positive

filaments) and for the pure culture. Glucuronidase and

galactosidase activity was also found for some Type 1851.

The filaments that were positive only with the phylum probe

CFX1223 exhibited chitinase and glucuronidase activity.

Discussion

This study presents a comprehensive investigation of fila-

mentous Chloroflexi species present in both municipal and

industrial WWTP. At present, very little is known about the

physiology of phylum representatives of Chloroflexi present

in wastewater systems, where only in situ data from an

autotrophic nitrifying biofilm (Kindaichi et al., 2004) and

two pure culture studies exist (Kohno et al., 2002; Yamada

et al., 2005). This paper reports the first investigation from

WWTP where information on identity, abundance and

ecophysiology is combined.

Identity and abundance

Phylogenetic analysis of activated sludge clones belonging to

the Chloroflexi phylum showed that these are found in

subdivisions 1 and 3, as defined by Bjornsson et al. (2002).

The isolate EU 25 and different K. aurantiaca strains sharing

between 99.1 and 99.9% 16S rRNA gene similarity are

located in subdivision 3. The isolated morphotype 1851

identified by Beer et al. (2002) and isolates EU 25 and

Ver9Iso2 from this study most likely belong to two different

species with 94.7% and 93% 16S rRNA gene similarity, but

this should be confirmed by DNA : DNA hybridization.

Filamentous Chloroflexi were present in half of the 126

industrial WTP investigated in this comprehensive study

and thus verify the observations by Beer et al. (2002) and

Bjornsson et al. (2002) that Chloroflexi is a normal member

of the activated sludge microbial community. In 33 WWTP

samples, Chloroflexi filaments were present as FI4 1.5,

indicating potential bulking. In c. 12% of the WWTP

samples, high amounts of Chloroflexi filaments were found

(FI4 2.5), identifying them as important filamentous bac-

teria involved in bulking incidences. We found that a large

fraction of the samples had unidentified Chloroflexi species

that only hybridized with the phylum probe, not with

subdivision- or species-specific probes. The new probe

designed in this study hybridized with almost the same

sequences as probe Chl1851 (Beer et al., 2002). It was

designed before Beer’s probe was published and was there-

fore used in the survey. However, when Chl1851 subse-

quently was used on the same sludge samples, it appeared

that there was not a complete overlap of the two probes on

Chloroflexi filaments, indicating that the diversity is still

poorly described in activated sludge. Probe Chl1851-posi-

tive filaments were identified in 22% of the Chloroflexi

positive population. The probe EU25-1238 targeted an

additional 16% and when the two probes were used in

combination, 38% of the Chloroflexi could be identified. For

this reason, the two probes are recommended to be applied

together for identification of filamentous Chloroflexi in

activated sludge communities. The Chloroflexi species tar-

geted by probe EU25-1238 or probe Chl1851 was, however,

abundant in only three plants (FI4 1.5).

In 34 other WWTPs, filaments with the same morpholo-

gical appearance, but only hybridizing with the subdivision

probe (10 samples) or the phylum probe (26 samples), were

responsible for a high filament index. This emphasizes that

unidentified species are more common than these isolates in

full-scale WWTPs. It also shows that phylum probes

(CFXMIX) should be applied for screening the presence of

filamentous Chloroflexi species in WWTP. Almost all probe-

defined Chloroflexi filaments also hybridized with EUBMIX;

however, only half of the CFX109-positive filaments de-

tected in the samples used for ecophysiological studies gave a

positive EUBMIX signal, suggesting that some Chloroflexi

species did not hybridize with the EUBMIX probes. This

needs to be resolved in future studies.

The morphology of most gene probe-defined Chloroflexi

from the ecophysiological studies fell within the broadly

defined morphotype 1851. Minor differences were seen, for

example, in cell diameter and Gram staining but these

characters also differ in the two identification manuals

(Eikelboom, 2002; Jenkins et al., 2004). Morphotype 1851

filaments without epiphytic bacteria have been observed

frequently in industrial WWTP, and in this study with gene

probe-defined Chloroflexi, no epiphytic bacteria were ob-

served in three of four industrial WTP subjected to ecophy-

siological characterization. Almost all Chloroflexi sp.

examined here showed variability in Gram staining, which

might reflect an unusual cell wall, as reported in Beer et al.

(2002). This has also been observed for a close relative,

Chloroflexi aurantiacus, which also stains Gram-negative,

although the peptidoglycan composition has Gram-positive

characteristics (Garrity & Holt, 2001).

In 26% of the WWTPs investigated, probe-defined Chlor-

oflexi constituted a filament index higher than 1.5, which

could have an impact on floc structure and WWTP opera-

tion. In only a few of the cases observed here (TNO17 and

TNO25) were representatives of the Chloroflexi directly

involved in bulking. Morphology-based surveys have also

been reported, and morphotype 1851 only dominated in a

FEMS Microbiol Ecol 59 (2007) 671–682 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

679Ecophysiology of filamentous Chloroflexi species

few incidences. However, these results are difficult to com-

pare as the FISH screening in our study showed that filaments

with different morphology than that of morphotype 1851

were in some cases targeted by some of the probes applied.

Ecophysiological behaviour

The Chloroflexi sp. in the WWTP samples examined were

only active in situ under aerobic conditions, which is

different from many other filamentous bacteria in activated

sludge (Nielsen et al., 2002, Thomsen et al., 2002, Kragelund

et al., 2006). The substrates taken up were mainly sugars.

Butyrate and a few short chained fatty acids were also used

by some filamentous Chloroflexi, but not all. Butyrate is not

often taken up by activated sludge bacteria (Kragelund and

Nielsen, unpublished results). Acetate was taken up only by

filaments in one WTP targeted by the Chloroflexi phylum

probe. Whether some unknown Chloroflexi species can

consume this compound, as was shown for the new isolates

in the pure culture growth tests, or whether the observation

is due to unspecific phylum probes is so far unknown. N-

acetylglucosamine uptake for Chloroflexi was observed in

half of the WWTPs tested. This monosaccharide is a

component in lipopolysaccharides and peptidoglycan, con-

stituting the cell wall of most bacteria (Barker & Stuckey,

1999). It is not a substrate commonly used by filamentous

bacteria in activated sludge (Kragelund and Nielsen, unpub-

lished results), but would be available continuously due to

cell decay and subsequent release of N-acetylglucosamine

units. Uptake of N-acetylglucosamine has also been observed

under aerobic conditions for filamentous Chloroflexi present

in a biofilm (Kindaichi et al., 2004). The expression of exo-

enzymes also supports the degradation of polysaccharides,

e.g. chitinase, galactosidase, and glucuronidase activity. All

examined Chloroflexi filaments appeared hydrophilic, and

they were often observed in large bundles inside sludge flocs

and were not always visible using phase contrast microscopy.

Comparing the isolates EU25 and Ver9Iso2 with the

strains of Kohno et al. (2002), many identical physiological

traits were observed. We tested more substrates supporting

the specialization on sugars and some short chain fatty

acids. However, reduction of nitrate to nitrite observed by

Kohno and coworkers (two of the five strains) was not seen

for isolate EU25 or Ver9Iso2. The strains isolated by Kohno

and coworkers were able to grow anaerobically on sugars

(glucose and fructose), whereas the ability to grow anaero-

bically for strain EU25 and Ver9Iso2 was not confirmed in

our study. A small uptake of glucose using MAR was

observed under conditions where nitrate served as e-accep-

tor for isolate EU25, but growth could not be observed.

Comparing the results from the pure cultures with in situ

studies it is clear that the pure culture shows greater

versatility in physiology than the gene probe-defined fila-

ments in corresponding activated sludge samples. For in-

stance, fewer substrates could be assimilated, and no uptake

under anaerobic conditions was recorded. This phenomen-

on is in agreement with other studies (Rossetti et al., 2005)

showing that isolates tend to show their greater physiologi-

cal potential in pure culture, whereas under in situ condi-

tions they are more restricted in their physiological activity.

Possible role in sludge

Filamentous members of the Chloroflexi phylum are fre-

quently observed in activated sludge and contribute to the

overall filament index number. Most likely, the population

sizes of Chloroflexi species in sludge have been underesti-

mated by conventional microscopical identification due to

their location inside sludge flocs. Furthermore, many as yet

unidentified members are present in activated sludge sam-

ples which no gene probes target beyond phylum level.

Interestingly, acetate was not used (except possibly in one

case) by Chloroflexi filaments under in situ conditions,

although it is one of the most common substrates present

in activated sludge (Hvitved-Jacobsen et al., 1995). Chloro-

flexi filaments appear to be specialized in polysaccharide

degradation as different monosaccharides were taken up,

combined with exo-enzyme activity used for polysaccharide

degradation. The location of the investigated filaments

inside sludge flocs and preferential use of sugars suggest that

they grow on colloids and particles from the incoming

wastewater trapped in the surrounding exopolymeric ma-

trix, on exopolymers produced by other microorganisms,

and on decaying cells. Other filamentous members in

activated sludge, e.g. members of Bacteroidetes (Kindaichi

et al., 2004), have also been shown to use the same type of

substrate, and competition between these species is therefore

likely. The influence of morphotype 1851 on floc structure

has been observed, causing bridging and even open struc-

tured sludge flocs if they become more abundant. However,

this requires a large population size and is not frequently

observed. All in all, filamentous members of Chloroflexi are

commonly observed in municipal and industrial WTP, but

are only occasionally involved in bulking or foaming in-

cidences.

Acknowledgements

This study was funded by the EU program ‘Dynamics and

composition of filamentous micro-organism communities

in industrial water systems’ (DYNAFILM).

References

Amann RI (1995) In situ identification of micro-organisms by

whole cell hybridization with rRNA- targeted nucleic acid

FEMS Microbiol Ecol 59 (2007) 671–682c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

680 C. Kragelund et al.

probes. Molecular Microbial Ecological Manual (Akkermans

ADL, van Elsas JD & de Bruijn FJ, eds), pp. 1–15. Kluwer

Academic Publications, London, UK.

Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereux R &

Stahl DA (1990) Combination of 16S rRNA-targeted

oligonucleotide probes with flow cytometry for analyzing

mixed microbial populations. Appl Environ Microbiol 56:

1919–1925.

Andreasen K & Nielsen PH (1997) Application of

microautoradiography to the study of substrate uptake by

filamentous microorganisms in activated sludge. Appl Environ

Microbiol 63: 3662–3668.

Andreasen K & Nielsen PH (2000) Growth of Microthix parvicella

in nutrient removal activated sludge plants: studies of in situ

physiology. Water Res 34: 1559–1569.

Barker DJ & Stuckey DC (1999) A review of soluble microbial

products (SMP) in wastewater treatment systems. Water Res

33: 3063–3082.

Beer M, Seviour EM, Kong Y, Cunningham M, Blackall LL &

Seviour RJ (2002) Phylogeny of the filamentous bacterium

Eikelboom Type 1851, and design and application of a 16S

rRNA targeted oligonucleotide probe for its fluorescence in

situ identification in activated sludge. FEMS Microbiol Lett

207: 179–183.

Bjornsson L, Hugenholtz P, Tyson GW & Blackall LL (2002)

Filamentous Chloroflexi (green non-sulfur bacteria) are

abundant in wastewater treatment processes with biological

nutrient removal. Microbiology 148: 2309–2318.

Boomer SM, Lodge DP, Dutton BE & Pierson B (2002) Molecular

characterization of novel red green nonsulfur bacteria from

five distinct hot spring communities in Yellowstone National

Park. Appl Environ Microbiol 68: 346–355.

Daims H, Bruhl A, Amann R, Schleifer KH & Wagner M (1999)

The domain-specific probe EUB338 is insufficient for the

detection of all Bacteria: development and evaluation of a

more comprehensive probe set. Syst Appl Microbiol 22:

434–444.

Eales Kl, Nielsen JL, Kragelund C, Seviour RJ & Nielsen PH

(2005) The in situ physiology of pine tree like organisms

(PTLO) in activated sludge foams. Acta hydrochim hydrobiol

33: 203–209.

Eikelboom DH (1975) Filamentous organisms observed in

activate sludge. Water Res 9: 365–388.

Eikelboom DH (2002) Process Control of Activated Sludge Plants

by Microscopic Investigation. IWA Publishing, UK.

Eikelboom DH & van Buijsen HJ (1983) Microscopic Sludge

Investigation Manual. TNO Research Institute for

Environmental Hygiene, Delft, the Netherlands.

Garrity GM & Holt JG (2001) The Chloroflexi. Bergey’s Manual of

Systematic Bacteriology (Boone DR & Castenholz RW, eds), pp.

426–446. Springer-Verlag, New York.

Gich F, Garcia-Gil J & Overmann J (2001) Previously unknown

and phylogenetically diverse members of the green nonsulfur

bacteria are indigenous to freshwater lakes. Archives of

Microbiology 117: 1–10.

Hanada S & Pierson B (2002) The family Chloroflexaceae. The

Prokaryotes (Balows A, Truper HG, Dworkin M, Harder W &

Schleifer KH, eds). Springer-Verlag, Berlin.

Hanada S, Takaichi S, Matsuura K & Nakamura K (2002)

Roseiflexus castenholzii gen. nov., sp nov., a thermophilic,

filamentous, photosynthetic bacterium that lacks

chlorosomes. Int J Syst Evol Microbiol 52: 187–193.

Hugenholtz P & Huber T (2003) Chimeric 16S rDNA sequences

of diverse origin are accumulating in the public databases. Int J

Syst Evol Microbiol 53: 289–293.

Hvitved-Jacobsen T, Raunkjaer K & Nielsen PH (1995) Volatile

fatty acids and sulfide in pressure mains. Water Sci Technol 31:

169–179.

Jenkins D, Richard M & Daigger G (1993) Manual on Cases and

Control of Activated Sludge Bulking and Foaming. Lewis

Publishers, Chelsea, Michigan.

Jenkins D, Richard MG & Daigger GT (2004) Manual on the

Causes and Control of Activated Sludge Bulking, Foaming, and

other Solids Separation Problems. IWA publishing, CRC Press,

London, UK.

Juretschko S, Loy A, Lehner A & Wagner M (2002) The microbial

community composition of a nitrifying-denitrifying activated

sludge from an industrial sewage treatment plant analyzed by

the full-cycle rRNA approach. Syst Appl Microbiol 25: 84–99.

Kindaichi T, Ito T & Okabe S (2004) Ecophysiological interaction

between nitrifying bacteria and heterotrophic bacteria in

autotrophic nitrifying biofilms as determined by

microautoradiography-fluorescence in situ hybridization.

Appl Environ Microbiol 70: 1641–1650.

Kohno T, Sei K & Mori K (2002) Characterization of Type 1851

organism isolated from activated sludge samples. Water Sci

Technol 46: 111–114.

Kragelund C, Nielsen JL, Thomsen TR & Nielsen PH (2005)

Ecophysiology of the filamentous Alphaproteobacterium

Meganema perideroedes in activated sludge. FEMS Microbiol

Ecol 54: 111–122.

Kragelund C, Kong Y, van der Waarde J, Thelen K, Eikelboom D,

Tandoi V, Thomsen TR & Nielsen PH (2006) Ecophysiology of

different filamentous Alphaproteobacteria species from

industrial waste water treatment plants. Microbiology 152:

3003–3012.

Lee N, Nielsen PH, Andreasen KH, Juretschko S, Nielsen JL,

Schleifer KH & Wagner M (1999) Combination of fluorescent

in situ hybridization and microautoradiography-a new tool for

structure-function analyses in microbial ecology. Appl Environ

Microbiol 65: 1289–1297.

Levantesi C, Beimfoh C, Geurkink B, Rossetti S, Thelen K,

Krooneman J, Snaidr J, van der Waarde J & Tandoi V (2004)

Filamentous Alphaproteobacteria associated with bulking in

industrial wastewater treatment plants. Syst Appl Microbiol 27:

728–736.

Loy A, Horn M & Wagner M (2003) probeBase: an online

resource for rRNA-targeted oligonucleotide probes. Nucleic

Acids Res 31: 514–516.

FEMS Microbiol Ecol 59 (2007) 671–682 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

681Ecophysiology of filamentous Chloroflexi species

Ludwig W, Strunk O, Westram et al. (2004) ARB: a software

environment for sequence data. Nucleic Acids Res 32:

1363–1371.

Martins AM, Pagilla K, Heijnen JJ & Van Loosdrecht MC (2004)

Filamentous bulking sludge-a critical review. Water Res 38:

793–817.

Nielsen PH, de Muro MA & Nielsen JL (2000) Studies on the in

situ physiology of Thiothix spp. present in activated sludge.

Environ Microbiol 2: 389–398.

Nielsen JL, Mikkelsen LH & Nielsen PH (2001) In situ detection

of cell surface hydrophobicity of probe-defined bacteria in

activated sludge. Water Sci Technol 43: 97–103.

Nielsen PH, Roslev P, Dueholm TE & Nielsen JL (2002) Microthix

parvicella, a specialized lipid consumer in anaerobic-aerobic

activated sludge plants. Water Sci Technol 46: 73–80.

Nubel U, Bateson MM, Madigan MT, Kuhl M & Ward DM (2001)

Diversity and distribution in hypersaline microbial mats of

bacteria related to Chloroflexus spp. Appl Environ Microbiol 67:

4365–4371.

Nubel U, Bateson MM, Vandieken V, Wieland A, Kuhl M & Ward

DM (2002) Microscopic examination of distribution and

phenotypic properties of phylogenetically diverse

Chloroflexaceae-related bacteria in hot spring microbial mats.

Appl Environ Microbiol 68: 4593–4603.

Reasoner DJ & Geldreich EE (1985) A new medium for the

enumeration and subculture of bacteria from potable water.

Appl Environ Microbiol 49: 1–7.

Rossetti S, Tomei MC, Nielsen PH & Tandoi V (2005) ‘‘Microthix

parvicella’’, a filamentous bacterium causing bulking and

foaming in activated sludge systems: a review of current

knowledge. FEMS Microbiol Rev 29: 49–64.

Schade M, Beimfoh C & Lemmer H (2002) Phylogenetic and

physiological characterization of a ‘‘Nostocoida limicola’’-like

organism isolated from activated sludge. Water Sci Technol 46:

91–97.

Thomsen TR, Kjellerup BV, Nielsen JL, Hugenholtz P & Nielsen

PH (2002) In situ studies of the phylogeny and physiology of

filamentous bacteria with attached growth. Environ Microbiol

4: 383–391.

Thomsen TR, Kragelund C & Nielsen PH (2006) Abundance and

physiology of Aquaspirillum-related filamentous bacteria in

activatedsludge. Water Sci Technol 54: 237–245.

Van Ommen KF & Geesey GG (1999) Localization and

Identification of Populations of Phosphatase-Active Bacterial

Cells Associated with Activated Sludge Flocs. Microb Ecol 38:

201–214.

Wagner M, Loy A, Nogueira R, Purkhold U, Lee N & Daims H

(2002) Microbial community composition and function in

wastewater treatment plants. Antonie Van Leeuwenhoek 81:

665–680.

Williams TM & Unz RF (1989) The nutrition of Thiothix,

Type-021N, Beggiatoa and Leucothix Strains. Water Res 23:

15–22.

Yamada T, Sekiguchi Y, Imachi H, Kamagata Y, Ohashi A &

Harada H (2005) Diversity, localization, and physiological

properties of filamentous microbes belonging to Chloroflexi

subphylum I in mesophilic and thermophilic methanogenic

sludge granules. Appl Environ Microbiol 71: 7493–7503.

FEMS Microbiol Ecol 59 (2007) 671–682c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

682 C. Kragelund et al.