Identification of TLR inducing Th1-responsive Leishmania donovani amastigote-specific antigens

Identification of TLR inducing Th1-responsive Leishmaniadonovani amastigote-specific antigens

Ankita Srivastava • Nisha Singh • Manish Mishra •

Vinod Kumar • Jalaj K. Gour • Surabhi Bajpai •

Sangram Singh • Haushila P. Pandey • Rakesh K. Singh

Received: 23 June 2011 / Accepted: 5 August 2011

� Springer Science+Business Media, LLC. 2011

Abstract Leishmania is known to elicit Th2 response that

causes leishmaniasis progression; on the other hand, Th1

cytokines restricts amastigote growth and disease pro-

gression. In this study, we report the potential of two

leishmanial antigens (65 and 98 kDa, in combination)

which enhance strong macrophage effector functions, viz.,

production of respiratory burst enzymes, nitric oxide, and

Th1 cytokines. The identification of antigens were done by

resolving the crude soluble antigens on SDS-PAGE and

eluted by reverse staining method. Further, RAW264.7

macrophages were challenged with eluted antigens, and the

innate immune response was observed by detecting respi-

ratory burst enzymes, nitric oxide (NOx), TNF-a, IFN-c,

IL-12, toll-like receptors (TLRs) gene expression, and

TLR-signaling proteins. These antigens increased the pro-

duction of nicotinamide adenine dinucleotide phosphate

(NADPH) oxidase, superoxide dismutase, NOx, TNF-a,

IFN-c, IL-12, TLR2, and p38 mitogen-activated protein

kinase. These antigens also induced human peripheral

blood mononuclear cells proliferation and Th1 cytokine

production. This study concludes that these antigens induce

innate immune response as well as have prophylactic

efficacy.

Keywords Leishmaniasis � Antigens � Toll-like

receptors � Th1 cytokines

Introduction

Leishmaniasis is a wide spectrum of vector born disease

with great epidemiological and clinical diversity. It is

caused by more than 20 species of protozoan parasite that

belongs to the family Kinetoplastida and genus Leishmania

[1]. The annual global prevalence of all forms i.e., cuta-

neous, mucocutaneous and visceral leishmaniasis is nearly

10 million and approximately 350 million people are at risk

[2]. However, there is a gross under reporting of the cases

from endemic regions and these figures may go up [3]. The

treatment of leishmaniasis relies primarily on chemother-

apy and till date no vaccine either preventive or prophy-

lactic is available [4].

The entry of Leishmania parasite into host macrophages

results in the onset of respiratory burst, characterized by

the increased production of reactive oxygen species (ROS),

like superoxide (O2-) and hydrogen peroxide (H2O2),

which is required for the killing of the parasites [5, 6].

These O2- are generated by activities of a multi component

enzyme complex i.e., nicotinamide adenine dinucleotide

phosphate (NADPH)/NADH oxidase. Moreover, in later

stages of infection, reactive nitrogen intermediates (RNI)

viz. nitric oxide groups (NOx) are also produced by the

activity of inducible nitric oxide (iNOS), which further

contribute to innate immunity and parasitic elimination.

However, in leishmanial infections, the microbicidal

activities of macrophage are severely hampered, leading to

the survival and proliferation of parasites inside the mac-

rophages [7]. In addition, owing to hampered macrophage

activity, the establishment of acquired immune response is

very poor in leishmanial infection. In general, leishmani-

asis is distinguished by mixed Th1 and Th2 response with a

positive balance towards Th2 response, which is charac-

terized by increased production of IL-10 as well as IL-4

A. Srivastava � N. Singh � M. Mishra � V. Kumar �J. K. Gour � S. Bajpai � H. P. Pandey � R. K. Singh (&)

Department of Biochemistry, Faculty of Science,

Banaras Hindu University, Varanasi 221005, India

e-mail: [email protected]; [email protected]

S. Singh

Department of Biochemistry, Dr. R.M.L. Avadh University,

Faizabad 224001, India

123

Mol Cell Biochem

DOI 10.1007/s11010-011-1029-5

[8]. It is now well established that in leishmaniasis pro-

tective immunity is achieved only when Th1 response,

characterized by increased levels of IFN-c and IL-12,

dominates over Th2 response [9]. Unfortunately, the anti-

gens that induce Th1 response in host immune cells have

not yet been fully identified.

Toll-like receptors (TLRs) are the crucial regulators of

innate immune response against the pathogens, and till

date, 11 TLRs are identified in mammals [10]. After

attachment with specific ligands, TLRs are involved in

variety of phenomenon like maturation, phagocytosis, and

microbicidal activity of phagosomes as well as production

of inflammatory cytokines such as TNF-a, IFN-c, IL-10,

IL-12, etc. [10]. TLR signaling occurs via MyD88-depen-

dent or -independent pathways that lead to the activation of

either mitogen-activated protein kinases (MAPK), viz.,

p38MAPK or extra-cellular signal related kinase (ERK-1/

2), and subsequent production of Th1 and Th2 inflamma-

tory cytokines [11, 12]. Several studies confirm the

importance of TLR signaling in the onset of leishmanial

pathogenesis, susceptibility, and resistance [13, 14].

However, leishmanial ligands that induce production of

Th1 cytokines are not fully identified. As this is now evi-

denced that TLR may regulate the Th1/2 balance, this is

absolutely essential to identify those antigens/immunogens

that affects TLR-signaling pathways. In the present study,

we have identified two leishmanial antigens that induced

the production of inflammatory cytokines via TLR signal-

ing, which may further be employed to develop the pro-

phylactic or preventive vaccine candidates.

Materials and methods

Study design

Crude soluble antigens of Leishmania donovani were pre-

pared and, based on the molecular weights, different pro-

tein fractions were eluted from the gel. The effect of

different protein fractions (Fa, Fb, Fc, and Fd) were

observed in terms of respiratory burst activity of macro-

phage, nitric oxide assay, cytokines production, and TLR

expression. Based on the cytokines and TLR expression

results, we proceeded further only with fraction Fa and its

individual proteins to find out the most antigenic protein of

this fraction. Two proteins of Fa fraction (65 and 98 kDa)

were further assessed for their macrophage effector func-

tions and PBMC proliferation capabilities.

Axenic culture and antigen preparation

The L. donovani strain Dd8 (MHOM/IN/80) was main-

tained in vitro in Dulbecco minimum essential medium

(DMEM, Invitrogen, USA) supplemented with 10% FBS

(Invitrogen, USA) and antibiotics (gentamycin 20 lg/ml,

streptomycin 100 lg/ml, penicillin 100 U/ml, Sigma

Chemicals, USA) in a BOD incubator at 25�C. Axenic am-

astigotes were also maintained in the same medium but the

medium was acidified to pH 5.5 and incubated at 37�C in

humidified CO2 incubator containing 5% CO2. The axenic

amastigotes were characterized by their round or oval shape

without flagella and presence of amastigote-specific mega-

somes under phase contrast microscopy. Biochemical char-

acterization was done by lectin agglutination test [15]. For

preparation of leishmanial antigens, about 4 9 107 para-

sites/ml were taken in a 50-ml tube and centrifuged at

3,000 rpm for 15 min at 4�C. The resulting pellets were

washed thrice with cold 0.02 M PBS (pH 7.2). Finally, pel-

lets were dissolved in minimum amount of lysis buffer

containing 20 mM Tris–HCl (pH 7.4), 40 mM NaCl, 10 mM

EDTA, 2 mM PMSF (Sigma Chemicals, USA), 5 mM

iodoacetamide (Sigma Chemicals, USA), 10 lg/ml leupep-

tin (Sigma Chemicals, USA), and 0.4% SDS. Antigens were

prepared by sonication (12 amp/10 cycle/30 s) followed by

centrifugation at 10,000 rpm for 20 min. Supernatant was

collected, and protein estimation was done by Lowry’s

method [16]. Protein samples were stored at -80�C until use.

SDS-PAGE and elution of proteins

The leishmanial proteins (40 lg/well) were subjected to

12% SDS-PAGE to resolve individual leishmanial proteins

for 3 h in cold condition [17]. To visualize protein bands,

gel was silver stained according to the standard protocol. In

brief, gel was first incubated in fixative solution (40%

methanol, 10% glacial acetic acid, and 50% Milli Q water)

for 45 min at room temperature and then incubated in 0.2%

sodium thiosulphate with sodium acetate overnight at 4�C.

Following day, gel was incubated in 0.1% silver nitrate

solution for 1 h at room temperature. Bands were devel-

oped by 3% sodium carbonate, and reaction was stopped by

50 mM EDTA. Known molecular weight marker was run

in parallel, and gel was visualized under gel documentation

system.

For recovery, leishmanial proteins were resolved on 10%

SDS-PAGE and eluted by reverse staining approach as per

the standard protocol [18]. In brief, gel was rinsed with Milli

Q water and incubated in 0.2 M imidazole solution con-

taining 0.1% SDS for 10 min. Colorless bands were devel-

oped on white background by immersing the gel in 0.2 M

zinc sulphate for 5 min. Reaction was stopped by adding

water. Different proteins fractions were prepared by cutting

the gel pieces into fractions according to their molecular

weight. A definite range of molecular weight was selected

and, accordingly, fractions were divided into four groups,

i.e., Fa (175–65 kDa), Fb (54–43 kDa), Fc (35–23 kDa), and

Mol Cell Biochem

123

Fd (21–5 kDa). Before protein recovery, the gel strips were

rinsed with 0.02 M PBS (pH 7.2) for 10 min followed by

rinsing the gel with 100 mM EDTA to complex zinc ions for

protein mobilization. Gel was further rinsed with 0.1% Tri-

ton X-100 to remove excess SDS and to re-nature proteins to

the required amount by running several gels. Proteins were

eluted from each fraction by crushing and shaking rigorously

in minimum amount of PBS, and pure proteins were recov-

ered. Protein was estimated from each fraction and stored at

-80�C until use. The individual proteins of fraction Fa was

resolved on 8% SDS-PAGE and processed for elution and

quantification as described above.

Macrophage activation assay

The RAW264.7 macrophages were obtained from National

Centre for Cell Sciences (NCCS), Pune, India and main-

tained in DMEM containing 10% heat-inactivated FBS and

antibiotics at 37�C in humidified air containing 5% CO2.

For execution of experiments, cells (1 9 106 in 1 ml of

complete medium) were seeded in 24-well tissue culture

plates (Nunc, Demark). After 2-h incubation, macrophages

monolayer was rinsed with complete media to wash non-

adherent cells, if any. Finally, cells were sensitized with

LPS (100 ng/ml), protein fractions (20 lg/ml each), and

individual proteins (10 lg/ml each). The cells were further

incubated at 37�C in humidified air containing 5% CO2 in

an incubator for 24 h for assaying enzymes and cytokines.

Estimation of respiratory burst activities

in macrophages

Estimation of NADPH oxidase and superoxide

dismutase (SOD) activity

Nicotinamide adenine dinucleotide phosphate (NADPH)

oxidase activity was estimated by the method of Mahapatra

et al. [19]. Stimulated cells were washed with fresh 0.02 M

PBS (pH 7.2) and lysed with 0.25% SDS. This suspension

was centrifuged at 2,000 rpm for 10 min, and supernatant

was taken. The enzyme activity was determined in this

supernatant by measuring cytochrome-c reduction spec-

trophotometrically. In brief, in 900 ll of the reaction

mixture (10 mM phosphate buffer saline (pH 7.2) con-

taining 1 mM MgCl2, 80 lM cytochrome c, 2 mM NaN3)

was prepared, and 100 ll of cell supernatant was added to

make the final volume to 1.0 ml. NADPH was added

finally to initiate the reaction and absorbance was measured

at 550 nm. The enzyme activity was calculated according

to the formula: Enzyme activity (U/ml) = (DA550 nm/

min) 9 final volume of assay 9 dilution factor/extinction

coefficient 9 sample volume. Millimolar extinction coef-

ficient (e = 0.021 mM-1 cm-1) was used for calculations.

SOD estimation was done by the method of Mishra and

Fridovich using NBT and riboflavin [20]. In brief, the

100 ll cell supernatant was mixed with reaction mixtures

(5 mM PBS, 100 mM methionine, 1 mM EDTA, 450 lM

NBT, 10 lM riboflavin), and purple color was developed.

Absorbance was measured at 560 nm being the maximum

for the blank. The SOD activity was directly proportional

to % inhibition of NBT reduction and expressed in %

inhibition of NBT reduction/ml (50% of NBT reduction

correspond to one unit of enzyme/ml).

Determination of total nitric oxide (NOx)

The total nitric oxide content in the culture supernatants was

estimated by the method of Ding et al. using Griess reagent

[21]. In brief, 100 ll of supernatant was mixed with freshly

prepared Griess reagent (1% sulfanilamide, and 0.1%

naphthylethylene diammine in 5% phosphoric acid). The

mixture was incubated for 15–20 min at room temperature,

and the absorbance was recorded at 540 nm on ELISA plate

reader (Bio-Rad, USA). The concentration of total nitric

oxide (NOx; lM) was determined by comparing with a

standard curve plotted using sodium nitrite as standard.

Estimation of cytokines release from macrophages

The extracellular cytokines levels for TNF-a, IL-12, and

IFN-c were detected by ELISA MAXTM standard set

enzyme-linked immunosorbent assay kit as per manufac-

turer’s instructions (BioLegend, USA) in culture superna-

tants. The results were represented in pg of cytokines/ml.

Quantification of TLR and cytokine mRNA by RT-PCR

RNA isolation and cDNA preparation

Total RNA was extracted from stimulated cells with trizol

reagent (Sigma Chemicals, USA) following manufacturer’s

instructions. In brief, cells were collected and centrifuged at

5,000 rpm at 4�C and pelleted. The supernatant was

removed, and the cells were washed with 19 PBS so that

complete media could be removed. The cells were then

lysed in 300 ll of trizol reagent and 120 ll chloroform. The

suspension was centrifuged at 10,000 rpm at 25�C for

10 min. The upper aqueous layer was recovered, and twice

amount of isopropanol was added. The mixture was cen-

trifuged again at 10,000 rpm at 4�C for 10 min, and RNA

pellets were collected. Finally, RNA pellets were washed

with 70% DEPC ethanol three times to remove the impu-

rities. Total RNA was first digested with RNase-free DNase

(Fermantas, Germany) to avoid DNA contamination before

use. For cDNA preparation, 1 lg total RNA (kept equal for

each amplification subjected for densitometric analysis)

Mol Cell Biochem

123

was subjected to reverse transcription using 20 U M-MuLV

reverse transcriptase (Fermantas, Germany), 19 RT buffer,

20 mM dNTPs (New England Biolabs, USA), 20 U RNasin

(Fermentas, Germany), 0.1 M DTT with DEPC treated

water using 200 ng of random hexamers (Fermentas,

Germany).

cDNA amplification and analysis

The cDNA was subsequently amplified by gene-specific

PCR. The 25 ll of reaction mixture consisted 2 ll cDNA

templates, 19 PCR buffer, 0.5 mM MgCl2, 200 lM

dNTPs, 1 U Taq DNA polymerase (New England Biolabs,

USA), and 3.2 lM mice mRNA-specific forward and

reverse primers for cytokines (TNF-a, IFN-c, IL-12), toll-

like receptors (TLRs 1–9), and human mRNA-specific

IFN-c, IL-12, and IL-10. All the primers used in this study

are listed in Tables 1 and 2. The b-actin gene was used as

house-keeping control gene. Amplification was performed

in a thermal cycler (Labnet, USA) programmed for 30

cycles of denaturation at 94�C for 30 s, annealing at

55–46�C depending on the Tm of the primer for 30 s, and

extension at 72�C for 30 s, which were preceded by initial

denaturation at 94�C for 2 min. Final extension was for

5 min at 72�C. For some amplification, conditions were

changed as per requirements. The amplified DNA fragments

were separated in a 2% agarose gel, with ethidium bromide

and photographed under UV illumination on a gel docu-

mentation system (Alpha Imager EP, Alpha Innotech Cor-

poration, USA). The relative mRNA expression levels were

analyzed by Image Analysis Software (Alpha ViewTm,

Version 2.0.0.9, Alpha Innotech Corporation, USA).

Western blot analysis of MyD88, TRAF6, p38,

phospho-p38, ERK1/2, and phospho-ERK1/2

The expression of MAPK-signaling proteins in response to

65 and 98 kDa antigens were analyzed by western blotting

experiments using specific antibodies (Cell Signaling

Technology, USA) as per manufacturer’s instructions. In

brief, after 30-min stimulation with 65 and 98 kDa antigens

and LPS, macrophages were washed with tris buffer saline

50 mM TBS (pH 7.5) containing 1 mM sodium ortho-

vanadate. The cells were then lysed in 50 ll of lysis

buffer (10 mM Tris–HCl, 50 mM NaCl, 50 mM NaF,

2 mM EDTA, 1 mM EGTA, 1% SDS, 1 mM sodium

Table 1 List of mouse-specific

primersS. no. Target Mouse sequences (50–30) Product size (bp)

1. TLR1 F50TCTTGTGCCACCCAACAGTCAG30 207

R50CCCATAAGCATCTCCTAACACCAG30

2. TLR2 F 50CAGTGAGCAGGATTCCCATT30 326

R50TTATCTTGCGCAGTTTGCAG30

3. TLR3 F 50ATATGCGCTTCAATCCGTTC30 310

R50AAACCAAGAATCCGATGCAC30

4. TLR4 F50AGAATGAGGACTGGGTGAG30 267

R50CAAGGACAATGAAGATGATGC30

5. TLR5 F 50TTTCCCTTTTCATCCTGTGC30 266

R50GCATAGCCTGAGCCTGTTTC30

6. TLR6 F50CTTCACAACAACAGGATAATG30 287

R50ACCACTTCTCTTGCTACC30

7. TLR7 F 50CAGAAGTCTAAGTTTCTTCAGC30 373

R50GGGAAATATTTAACTGAGCATGG30

8. TLR8 F50GTGCTTTTGTCTGCTGTCCTCTG30 276

R50TTTGGGTGCTGTTGTTTGGC30

9. TLR9 F5’TGGAGTACCTCCTGGTGTCC3’ 367

R50GAAGGACAGGTTGAGCTTGC30

10. TNF-a F50CCGATGGGTTGTACCTTGTC30 285

R50CGGACTCCGCAAAGTCTAAG30

11. IL-12 F50 TGGAGGACCCATAAGACTGC30 319

R50TTTCCCCTTCTTGGAGGTTT30

12. IFNc F50GTGATTGCGGGGTTGTATCT30 219

R50GGGACAGCCTGTTACTACCTGA30

13. bactin F50AACCGCGAGAAGATGACCCAGATCATGTTT30 350

R50AGCAGCCGTGGCCATCTCTTGCTCGAAGTC30

Mol Cell Biochem

123

orthovanadate, 1 mM PMSF, and 50 lg/ml leupeptin) for

20 min at 4�C. The lysates were centrifuged at 15,000 rpm

for 10 min, and supernatants proteins were resolved on

12% SDS-PAGE and then transferred on nitrocellulose

membrane. The membranes were blocked with non-fat dry

milk in TBS. After blocking, membranes were incubated

with primary antibodies at appropriate dilution for MyD88

(1:500), TRAF6 (1:500), phospho-p38 (1:1,000), p38

(1:1,000), phospho-ERK1/2, and ERK1/2 for 2 h at room

temperature. Blots were washed with TBST [50 mM Tris–

HCl (pH 7.5), 150 mM NaCl, and 0.05% Tween20] thrice.

Finally, membranes were incubated with HRP-linked sec-

ondary antibody (1:1,000) for 1 h at room temperature.

Blots were developed by incubating membranes in 0.03%

DAB/0.01% H2O2 solution. Color development was stop-

ped by removing the above solution and adding water.

PBMCs proliferation and cytokine analysis

Peripheral blood mononuclear cells (PBMCs) were isolated

from the heparinised blood collected from ten healthy

(authors and lab members of this study), non endemic

individuals by density gradient centrifugation using ficoll–

paque plus (GE Healthcare, USA). In brief, blood samples

were diluted 1:1 ratio with complete DMEM and layered

on an equal volume of ficoll followed by centrifugation at

5,000 rpm for 30 min. PBMCs were carefully aspirated

and washed twice with 0.02 M PBS (pH 7.2) by centrifu-

gation at 5,000 rpm at 4�C for 15–20 min. The cellular

viability was checked by trypan blue dye exclusion

method. PBMCs were cultured in DMEM along with

antibiotics in 24-well tissue culture plates (Nunc, Den-

mark) at seeding density 1 9 106 cells/well. After 2 h cells

were washed with complete DMEM to remove non-

adherent cell, if any. Cells were then sensitized with 10 lg/

ml antigens (65 and 98 kDa) and PHA (10 lg/ml) and kept

for 72 h at 37�C in humidified air containing 5% CO2 in

CO2 incubator. The cellular proliferation was checked by

MTT assay [22]. Culture supernatants were assessed for

IFN-c, IL-12, and IL-10 by cytokine ELISA, and cells were

used for RT-PCR as described above.

Statistical analysis

The data were analyzed by one way analysis of variance

(ANOVA) using Students Newman Keuls (SNK) test with

Sigma Stat 3.5, wherever required. When comparing

between two groups student t-test was applied. The P-

values less than 0.05 were considered to be significant. All

the experiments were performed in quadruplicate, and data

are represented as mean ± standard deviation.

Results

The silver staining of SDS-PAGE revealed the presence of

proteins ranging from 5 to 175 kDa (Fig. 1a). Based on the

molecular weight, proteins were divided in four fractions

viz. Fa (175–65 kDa), Fb (54–43 kDa), Fc (35–23 kDa)

and Fd (21–5 kDa). The Fa fraction showed good response

in terms of macrophage effector functions and was further

resolved on 8% SDS-PAGE to recover six proteins of

relative molecular weights 175, 153, 119, 98, 76, and

65 kDa (Fig. 1b).

NADPH oxidase and superoxide dismutase (SOD)

activities

The activities of these enzymes in protein stimulated mac-

rophages are represented in Graphs 1 and 2. LPS-stimulated

cells were considered as positive antigenic control, and cells

without stimulants were considered as normal (negative)

controls. The activity of NADPH oxidase was higher in

Fa- and Fc-stimulated cells as compared with Fb and Fd

fractions; further, activity in Fa-stimulated cells were more

significant than that in Fc (P \ 0.001). The SOD activity was

also higher in Fa- and Fc-stimulated cells and was more

significant (P \ 0.01) in Fc as compared with Fa.

Nitric oxide production

Macrophages stimulated using protein fractions Fa and Fc

produced higher NOx levels relative to Fb and Fd

Table 2 List of human-specific

primersS. no. Target Primer sequence (50–30) Product size (bp)

1. IL-10 F50GAGGCAAGGCATTTGGATAA30 338

R50CACTGGCTGAGCAGGTCATA30

2. IL-12 F50AAGGAGGCGAGGTTCTAAGC30 283

R50TCCTTGTTGTCCCCTCTGAC30

3. IFN-c F50CCCCACTGCAAGTCTCTAGC30 320

R50CAAAGTCAACCCCAAAGGAA30

4. b-actin F50AGAAAATCTGGCACCACACC30 323

R50CTCCTTAATGTCACGCACGA30

Mol Cell Biochem

123

(Graph 3). On stimulation with Fa, cells caused an

increased production of NOx (P \ 0.01) relative to Fc

group. Further, out of six proteins of Fa fraction, only 65

and 98 kDa proteins were found to induce NOx production

(P \ 0.001) as compared to other proteins (Graph 4).

Production of cytokines by stimulated cells

The sensitization with Fa fraction resulted in significantly

(P \ 0.001) increased production of all cytokines as

compared with Fc fraction (Fig. 2). The other two fractions

did not show significant cytokine production. To find out

the most potent antigenic protein of Fa fraction, macro-

phages were stimulated with individual proteins of Fa

fraction. The production of all cytokines in 65- and

98-kDa-challenged macrophages was significantly

(P \ 0.001) higher as compared with other proteins of this

fraction (Graph 5). We further estimated antigenic

response of these antigens in combination. In comparison

to LPS, the production of IL-12 was significantly higher

(P \ 0.001) in 65- and 98-kDa-stimulated cells (Fig. 3).

Any other combination was not found antigenic. These

findings suggest antigenic nature of these two antigens, and

they were further evaluated for their TLR-association and

cellular-proliferation capabilities.

Fig. 1 a Silver-stained gel

(12% SDS-PAGE) of

leishmanial proteins showing

various fractions

(Fa = 175–65 kDa,

Fb = 54–43 kDa,

Fc = 35–23 kDa, and

Fd = 21–5 kDa) [Lane Amolecular weight marker, B–Fcrude leishmanial proteins

(40 lg/well)]; b: CBB-stained

8% SDS-PAGE of individual Fa

proteins of molecular weights

175–65 kDa [Lane A–F fraction

a protein (50 lg/well)]

Fig. 2 Production of various cytokines (TNF-a, IFN-c and IL-12)

and their relative expression by RAW264.7 macrophages stimulated

with various antigenic fractions. RAW264.7 cells were stimulated

with individual fraction (20 lg/ml each) or LPS (100 ng/ml).

Supernatant were collected after 24-h stimulation and TNF-a, IL-

12, and IFN-c were measured by cytokine ELISA. RT-PCR was

performed using cytokine mRNA-specific primers. b-actin was used

as house-keeping control gene. (*** P \ 0.001, t-test between Fa

and Fc)

Fig. 3 Effect of 65- and 98-kDa antigens on the production of

various cytokines (TNF-a, IFN-c, and IL-12) and their relative

expression by RAW264.7 macrophages. The production of IL-12 was

found significantly (P \ 0.001) higher in antigens-stimulated cells as

compared to LPS

Mol Cell Biochem

123

Fig. 4 TLR mRNA expression levels in Fa and 65 ? 98 kDa

antigen-stimulated macrophages. RAW264.7 cells were stimulated

using Fa (20 lg/ml), 65 and 98 kDa (10 lg/ml each), and LPS

(100 ng/ml) for 24 h. Total RNA was isolated and amplified using

TLRs-specific primers. The relative mRNA expression is expressed in

the ratio of densitometric values of TLRs to b-actin. (*** P \ 0.001,

t-test between LPS and antigens for TLR2)

Fig. 5 LPS and antigen induced activation of various TLR-signalling

proteins. RAW264.7 cells were stimulated using 65 and 98 kDa

antigens (10 lg/ml), and LPS (100 ng/ml) for 30 min. Cell lysates

were subjected to SDS-PAGE followed by immune-blotting using

specific antibodies. The antigen-induced p38 were expressed more

strongly than ERK1/2

Fig. 6 Levels of various cytokines (IFN-c, IL-12, and IL-10) in

mitogen (PHA: 10 lg/ml) and antigen (65 and 98 kDa; 10 lg/ml)-

induced PBMCs. After 72 h of stimulation, cell supernatants were

collected, and level of cytokines were measured by cytokine ELISA.

The mRNA expression levels were determined by RT-PCR using

human mRNA-specific primers. b-actin was used as house-keeping

control. (*** P \ 0.001, ** P \ 0.01, ANOVA between various

groups)

0

0.02

0.04

0.06

0.08

0.1

0.12

control LPS Fa Fb Fc Fd

NA

DP

H o

xid

ase

act

ivit

y (U

/ml)

***

Graph 1 NADPH oxidase activity of RAW264.7 macrophages stim-

ulated with various fractions (Fa–Fd; 20 lg/ml). LPS (100 ng/ml)

was used as positive control. (*** P \ 0.001, t-test between Fa and

Fc)

01020304050607080

SO

D a

ctiv

ity

(% in

hib

itio

n

of

NB

T r

edu

ctio

n/m

l)

**

control LPS Fa Fb Fc Fd

Graph 2 SOD activity of macrophages stimulated with various

fractions. (** P \ 0.01, t-test between Fa and Fc)

Mol Cell Biochem

123

TLR expression by antigenic groups

In order to find out TLR ligands, the cDNA from different

fraction-stimulated cells were amplified with mRNA-spe-

cific primers of TLRs (TLR1-9). Results were expressed as

ratio of densitometric value of TLR to b-actin. The mRNA

transcripts for TLR2 and TLR4 were detected only in Fa-

stimulated cells (Fig. 4). Other antigenic groups did not

induce any of TLR mRNA expression. We further inves-

tigated the TLR expression in macrophages challenged

with individual proteins of Fa. None of single protein was

capable to induce any TLRs. However, 65 and 98 kDa

antigens together induced the expression of only TLR2

transcripts (Fig. 4). Any other combination was not TLRs

inductive.

TLR signaling

The western blots of various signaling proteins induced

after stimulation with 65 and 98 kDa antigens are depicted

in Fig. 5. Together, these antigens significantly induced

mitogen-activated protein kinase p38 and phospho p38

expressions relative to ERK1/2. In contrast, activation of

LPS leads to the significant activation of ERK1/2 and

pERK1/2. However, both LPS and antigens followed same

pathways of MyD88 and TRAF6 as their expression levels

were similar.

PBMC proliferation and cytokine response

The efficacy of 65 and 98 kDa antigens were further assessed

in terms of lymphocytes proliferation and cytokine prolif-

eration. Cultured PBMCs in presence of these antigens

showed significantly higher (P \ 0.001) proliferation rate as

compared with unstimulated control (Graph 6). The pro-

duction of IL-12 in cultured PBMC was significantly higher

(P \ 0.001) in antigen-stimulated cell as compared with

mitogen-induced cells (Fig. 6). However, the levels of IFN-cand IL-10 were higher in mitogen-induced PBMCs.

Discussion

The development of cellular immune response against

Leishmania is key factor in the control of L. donovani

infection. This can be achieved by the activation of mul-

tifaceted immune response by parasite molecules in which

components from innate and adaptive immune system are

involved. TLR, an innate immunity component, is involved

in recognition of pathogenic patterns and production of

cytokines via TLR-signaling pathways. TLRs are known to

participate in the control of Leishmania infection by

inducing Th1 response [23] but the role of leishmanial

antigens on the probable mechanism of TLR regulation and

cytokine production have never been addressed. It has been

suggested that particularly TLR2 and TLR4 could play an

0

5

10

15

20

25

30

35N

Ox

con

c. (

μM)

control LPS Fa Fb Fc Fd

Graph 3 Production of total nitric oxide (NOx) by protein fraction-

stimulated macrophages. (** P \ 0.01, t-test between Fa and Fc)

0

5

10

15

20

25

30

35

Control

LPS

65 kD

a

78kD

a

98kD

a

119 k

Da

153 kD

a

175 k

Da

NO

x co

nc.

(μM

) *** ***

Graph 4 Production of total nitric oxide (NOx) by macro-

phages stimulated with individual protein (10 lg/ml) of Fa fraction.

(*** P \ 0.001, ANOVA between various antigenic groups)

0

100

200

300

400

500

600

700

cyto

kin

es le

vel (

pg

/ml)

TNF α IFNγ IL-12

*** ***

Control

LPS

65 kD

a

78kD

a

98kD

a

119 k

Da

153 kD

a

175 k

Da

Graph 5 Levels of various cytokines produced by individual protein

(Fa fraction)-activated macrophages. (*** P \ 0.001, ANOVA

between individual proteins)

0

0.5

1

1.5

2

2.5

control PHA 65+98kDa

Ab

sorb

ance

at

540n

m

******

Graph 6 Peripheral blood mononuclear cells proliferation (PBMCs)

in response to mitogen and antigens. (*** P \ 0.001, t-test compared

with control)

Mol Cell Biochem

123

important role by regulating the initial pro-inflammatory

response during the leishmanial infections [14, 24].

Further, in Leishmania infection, TLR-mediated mito-

gen-activated protein kinases (MAPK) signaling plays

significant role in control of infection as evidenced by

reciprocal regulation of p38 and ERK1/2, the downstream

signaling proteins. Leishmanial signals lead to either p38 or

ERK1/2 activation, or subsequent cytokines production

[25, 26]. The phosphorylation of p38 leads to the produc-

tion of IL-12, which eventually result in disease termina-

tion; and ERK1/2 signaling results in the production of IL-

10 and disease progression [27, 28]. However, these signals

are not yet identified. In this study, the western blotting

experiments revealed more expression of p38 and phospho

p38 as compared with ERK1/2 and pERK1/2. The potential

of identified antigens to elicit strong IL-12 production may

be linked to their TLR2 signaling as activation of p38

MAPK leads to production of IL-12 [27].

The innate immune response is characterized by the

phagocytosis of invading microorganism as well as huge

free radical generation, which is required to kill the path-

ogen. Further, the products of innate immune response also

facilitate the establishment of adaptive immune response to

boost immunity. In this study, the identified antigens (65

and 98 kDa) were capable of inducing macrophages in

terms of increased respiratory burst enzymes, such as

NADPH oxidase, superoxide dismutase, and elicited strong

Th1 cytokine production. The significant production of Th1

cytokine especially IL-12 by both macrophages and PBMC

confirms their antigenicity. Identification of these two

antigens is of great importance since decreased IL-12

levels in leishmanial infection play important role in dis-

ease susceptibility and resistance [27]. Leishmaniasis is

also characterized by decreased NO production [29]. These

antigens also induced production of nitric oxide by mac-

rophages though it was not very significant. However, since

IL-12 is a key player in induction of iNOS and subsequent

NO production, which is required for parasite removal, the

identified antigens having IL-12-inducing properties may

be quite useful to boost innate immunity against leish-

manial infections. These findings suggest that in spite of

less capability of NO production, these two antigens are

capable enough to elicit strong Th1 cytokines response

especially IL-12 production by macrophages via TLR2

signaling.

In addition to hampered innate immunity, leishmaniasis

is also characterized by poor proliferation of T cells

because of poor antigen recognition and presentation to T

cells [30, 31]. These antigens together showed significant

proliferative abilities for human PBMCs, which support

their potential as a strong adaptive immunity inducer. In

addition, the production of IFN-c and IL-12 was also sig-

nificant relative to IL-10, which further proves their

potential as future prophylactic or preventive candidate for

prevention of leishmanial infection. However, further

studies are required to characterize the epitopic groups of

these two antigens as well as their prophylactic

capabilities.

Acknowledgments Financial assistance received from the Depart-

ment of Science and Technology (SR/FT/LS/066/2007), and the

Department of Biotechnology—DBT (BT/PR11177/MED/29/99/

2008), New Delhi, India is gratefully acknowledged. AS and NS are

highly thankful to the DBT, New Delhi for senior research fellowship.

Conflict of interest None.

References

1. Mishra BB, Singh RK, Srivastava A, Tripathi VJ, Tiwari VK

(2009) Fighting against leishmaniasis: search of alkaloids as

future true potential anti-leishmanial agents. Mini Rev Med

Chem 9:107–123

2. Desjeux P (2004) Leishmaniasis: current situation and new per-

spectives. Comp Immunol Microbiol Infect Dis 27:305–318

3. Singh SP, Reddy DC, Rai M, Sundar S (2006) Serious underre-

porting of visceral leishmaniasis through passive case reporting in

Bihar, India. Trop Med Int Health 11:899–905

4. Singh RK, Pandey HP, Sundar S (2006) Visceral leishmaniasis

(kala-azar): challenges ahead. Indian J Med Res 123:331–344

5. Kumar P, Pai K, Pandey HP, Sundar S (2002) NADH-oxidase,

NADPH-oxidase and myeloperoxidase activity of visceral leish-

maniasis patients. J Med Microbiol 51:832–836

6. Singh VK, Balaraman S, Tewary P, Madhubala R (2004) Leish-mania donovani activates nuclear transcription factor-kappaB in

macrophages through reactive oxygen intermediates. Biochem

Biophys Res Commun 322:1086–1095

7. Olivier M, Gregory DJ, Forget G (2005) Subversion mechanisms

by which Leishmania parasites can escape the host immune

response: a signaling point of view. Clin Microbiol Rev

18:293–305

8. Bacellar O, D’Oliveira A Jr, Jeronimo S, Carvalho EM (2000) IL-

10 and IL-12 are the main regulatory cytokines in visceral

leishmaniasis. Cytokine 12:1228–1231

9. Ghalib HW, Whittle JA, Kubin M, Hashim FA, el-Hassan AM,

Grabstein KH, Trinchieri G, Reed SG (1995) IL-12 enhances

Th1-type responses in human Leishmania donovani infections.

J Immunol 154:4623–4629

10. Akira S (2003) Toll like receptor signalling. J Biol Chem

278:38105–38108

11. Ghosh S, Bhattacharyya S, Sirkar M, Sa GS, Das T, Majumdar D,

Roy S, Majumdar S (2002) Leishmania donovani suppresses

activated protein 1 and NF-kappaB activation in host macro-

phages via ceramide generation: involvement of extracellular

signal-regulated kinase. Infect Immun 70:6828–6838

12. Kawai T, Akira S (2007) TLR signaling. Semin Immunol

19:24–32

13. de Veer MJ, Curtis JM, Baldwin TM, Di Donato JA, Sexton A,

McConville MJ, Handman E, Schofield L (2003) MyD88 is

essential for clearance of Leishmania major: possible role for

lipophosphoglycan and Toll-like receptor 2 signaling. Eur J

Immunol 33:2822–2831

14. Flandin JF, Chano F, Descoteaux A (2006) RNA interference

reveals a role for TLR2 and TLR3 in the recognition of Leish-mania donovani promastigotes by interferon-gamma-primed

macrophages. Eur J Immunol 36:411–420

Mol Cell Biochem

123

15. Balanco JMF, Pral EMF, Da Silva S, Bijovsky AT, Mortara RA,

Alfieri SC (1998) Axenic cultivation and partial characterization

of Leishmania brazilensis amastigote like stages. Parasitology

116:103–113

16. Lowry OH, Rosebrough NJ, Farr AL, Randal RJ (1951) Protein

measurement with folin-phenol reagent. J Biol Chem 193:265–

275

17. Laemmli UK (1970) Cleavage of structural proteins during the

assembly of the head of bacteriophage T4. Nature 227:680–685

18. Castellanos-Serra LR, Fernandez-Patron C, Hardy E, Santana H,

Huerta V (1997) High yield elution of proteins from sodium

dodecyl sulfate-polyacrylamide gels at the low-picomole level

application to N-terminal sequencing of a scarce protein and to

in-solution biological activity analysis of on-gel renatured pro-

teins. J Protein Chem 16:415–419

19. Mahapatra SK, Chakraborty SP, Roy S (2010) In Vitro time

dependent nicotine-induced free radical generation and status of

glutathione cycle in murine peritoneal macrophage. Al Ameen J

Med Sci 3:182–194

20. Misra HP, Fridovich I (1972) The role of superoxide anion in the

autoxidation of epinephrine and a simple assay for superoxide

dismutase. J Biol Chem 247:3170–3175

21. Ding AH, Nathan CF, Stuehr DJ (1988) Release of reactive

nitrogen intermediates and reactive oxygen intermediates from

mouse peritoneal macrophages. Comparison of activating cyto-

kines and evidence for independent production. J Immunol

141:2407–2412

22. Mosmann TR, Coffman RL (1989) Th1 and Th2 cells: different

patterns of lymphokine secretion lead to different functional

properties. Annu Rev Immunol 7:145–173

23. Abou Fakher FH, Rachinel N, Klimczak M, Louis J, Doyen N

(2009) TLR9-dependent activation of dendritic cells by DNA

from Leishmania major favors Th1 cell development and the

resolution of lesions. J Immunol 182:1386–1396

24. Kropf P, Freudenberg MA, Modolell M, Price HP, Herath S,

Antoniazi S, Galanos C, Smith DF, Muller I (2004) Toll-like

receptor 4 contributes to efficient control of infection with the

protozoan parasite Leishmania major. Infect Immun 72:1920–

1928

25. Ben-Othman R, Dellagi K, Guizani-Tabbane L (2009) Leish-mania major parasites induced macrophage tolerance: implica-

tion of MAPK and NF-kappaB pathways. Mol Immunol

46:3438–3444

26. Ben-Othman R, Guizani-Tabbane L, Dellagi K (2008) Leishmaniainitially activates but subsequently down-regulates intracellular

mitogen-activated protein kinases and nuclear factor-kappaB

signaling in macrophages. Mol Immunol 45:3222–3229

27. Mathur RK, Awasthi A, Wadhone P, Ramanamurthy B, Saha B

(2004) Reciprocal CD40 signals through p38MAPK and ERK-1/2

induce counteracting immune responses. Nat Med 10:540–544

28. Murphy ML, Wille U, Villegas EN, Hunter CA, Farrell JP (2001)

IL-10 mediates susceptibility to Leishmania donovani infection.

Eur J Immunol 31:2848–2856

29. Kumar R, Pai K, Sundar S (2001) Reactive oxygen intermediates,

nitrite and IFN-gamma in Indian visceral leishmaniasis. Clin Exp

Immunol 124:262–265

30. Ghalib HW, Piuvezam MR, Skeiky YA W, Siddig M, Hasim FA,

El-Hassan AM, Russo DM, Reed SG (1993) Interleukin 10 pro-

duction correlates with pathology in human Leishmania donovaniinfections. J Clin Invest 92:324–329

31. Sacks DL, Lal SL, Shrivastava SN, Blackwell J, Neva FA (1987)

An analysis of T cell responsiveness in Indian kala-azar.

J Immunol 138:908–913

Mol Cell Biochem

123