Research Article Identification of Stem Leydig Cells Derived from Pig Testicular Interstitium Shuai Yu, Pengfei Zhang, Wuzi Dong, Wenxian Zeng, and Chuanying Pan College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi 712100, China Correspondence should be addressed to Chuanying Pan; [email protected] Received 26 August 2016; Accepted 19 December 2016; Published 24 January 2017 Academic Editor: James Adjaye Copyright © 2017 Shuai Yu et al. is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Stem Leydig cells (SLCs), located in the testicular interstitial compartment in the mammalian testes, are capable of differentiating to testosterone-synthesizing Leydig cells (LCs), thus providing a new strategy for treating testosterone deficiency. However, no previous reports have identified and cultured SLCs derived from the pig. e aim of the current study was to isolate, identify, and culture SLCs from pigs. Haematoxylin and eosin staining and immunochemical analysis showed that SLCs were present and that PDGFR was mainly expressed in the pig testicular interstitium, indicating that PDGFR was a marker for SLCs in the neonatal pig. In addition, reverse transcription-PCR results showed that SLC markers were expressed in primary isolated LCs, indicating that they were putative SLCs. e putative SLCs were subsequently cultured with a testicular fluid of piglets (pTF) medium. Clones formed aſter 7 days and the cells expressed PDGFR. However, no clones grew in the absence of pTF, but the cells expressed CYP17A1, indicating that pTF could sustain the features of porcine SLCs. To summarize, we isolated porcine SLCs and identified their basic characteristics. Taken together, these results may help lay the foundation for research in the clinical application of porcine SLCs. 1. Introduction Testosterone not only maintains the spermatogenesis pro- cess, but also protects the function of androgen-dependent tissues [1, 2]. As the primary source of synthesizing and secreting testosterone in mammalian testes, adult Leydig cells (ALCs) play essential roles in maintaining vital movement [3]. Recently, it has been demonstrated that ALCs arise from stem Leydig cells (SLCs) [4]. SLCs, which are located in the interstitial compartment close to the seminiferous tubules in mammalian testes, are one of the most important somatic stem cells types [5, 6]. SLCs were firstly identified and enriched from neonatal rat testes by Ge et al. (2006), and further studies demonstrated that putative mouse and human SLCs had the capacity to differentiate into testosterone-producing cells [4, 7, 8]. According to these previous studies, some characteristics of SLCs were identified [4, 9, 10]. First, the number of mammalian SLCs was fairly small; for example, an average of only 8,500 putative SLCs were obtained from one postnatal 7- day-old rat testes [4]. Second, the SLCs residing on the outer surface of the seminiferous tubules in rat testes were spindle- shaped in situ [4, 10]. In addition, putative SLCs expressed LIF receptor (LIFR), platelet-derived growth factor receptor (PDGFR), Nestin, y-1, and some stem cell markers; how- ever, they were 3-HSD- and luteinizing hormone receptor- (LHR-) negative [4, 8, 10, 11]. Unfortunately, no SLCs studies had been carried out in other mammalian animals except in rats, mice, and humans. With increasing age, the number of functional LCs decreased, and the ability for testosterone production, cAMP production, and the activities of steroidogenic enzymes is reduced [12, 13]. us, male infertility diseases may occur in older males as a result of LCs dysfunction or testos- terone disorder [14, 15]. Currently, androgen-replacement was the most efficient therapy for rescuing testosterone deficiency; however, it required successive treatments and carries inherent risks [16]. SLCs had the ability to self-renew and differentiate into LCs, therefore, providing a new strategy for treating these diseases by SLCs transplantation [17]. e pig had played a crucial role as a mammalian model in human disease studies [18, 19]. e pig testis had Hindawi Stem Cells International Volume 2017, Article ID 2740272, 9 pages https://doi.org/10.1155/2017/2740272
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Research ArticleIdentification of Stem Leydig Cells Derived fromPig Testicular Interstitium
Shuai Yu Pengfei Zhang Wuzi Dong Wenxian Zeng and Chuanying Pan
College of Animal Science and Technology Northwest AampF University Yangling Shaanxi 712100 China
Correspondence should be addressed to Chuanying Pan chuanyingpan126com
Received 26 August 2016 Accepted 19 December 2016 Published 24 January 2017
Academic Editor James Adjaye
Copyright copy 2017 Shuai Yu et alThis is an open access article distributed under the Creative Commons Attribution License whichpermits unrestricted use distribution and reproduction in any medium provided the original work is properly cited
Stem Leydig cells (SLCs) located in the testicular interstitial compartment in the mammalian testes are capable of differentiatingto testosterone-synthesizing Leydig cells (LCs) thus providing a new strategy for treating testosterone deficiency However noprevious reports have identified and cultured SLCs derived from the pig The aim of the current study was to isolate identify andculture SLCs from pigs Haematoxylin and eosin staining and immunochemical analysis showed that SLCs were present and thatPDGFR120572wasmainly expressed in the pig testicular interstitium indicating that PDGFR120572was amarker for SLCs in the neonatal pigIn addition reverse transcription-PCR results showed that SLCmarkerswere expressed in primary isolated LCs indicating that theywere putative SLCs The putative SLCs were subsequently cultured with a testicular fluid of piglets (pTF) medium Clones formedafter 7 days and the cells expressed PDGFR120572 However no clones grew in the absence of pTF but the cells expressed CYP17A1indicating that pTF could sustain the features of porcine SLCs To summarize we isolated porcine SLCs and identified their basiccharacteristics Taken together these results may help lay the foundation for research in the clinical application of porcine SLCs
1 Introduction
Testosterone not only maintains the spermatogenesis pro-cess but also protects the function of androgen-dependenttissues [1 2] As the primary source of synthesizing andsecreting testosterone inmammalian testes adult Leydig cells(ALCs) play essential roles in maintaining vital movement[3] Recently it has been demonstrated that ALCs arise fromstem Leydig cells (SLCs) [4] SLCs which are located in theinterstitial compartment close to the seminiferous tubules inmammalian testes are one of the most important somaticstem cells types [5 6]
SLCs were firstly identified and enriched from neonatalrat testes byGe et al (2006) and further studies demonstratedthat putative mouse and human SLCs had the capacityto differentiate into testosterone-producing cells [4 7 8]According to these previous studies some characteristicsof SLCs were identified [4 9 10] First the number ofmammalian SLCs was fairly small for example an average ofonly 8500 putative SLCs were obtained from one postnatal 7-day-old rat testes [4] Second the SLCs residing on the outer
surface of the seminiferous tubules in rat testes were spindle-shaped in situ [4 10] In addition putative SLCs expressedLIF receptor (LIFR) platelet-derived growth factor receptor120572(PDGFR120572) Nestin Thy-1 and some stem cell markers how-ever they were 3120573-HSD- and luteinizing hormone receptor-(LHR-) negative [4 8 10 11] Unfortunately no SLCs studieshad been carried out in other mammalian animals except inrats mice and humans
With increasing age the number of functional LCsdecreased and the ability for testosterone production cAMPproduction and the activities of steroidogenic enzymes isreduced [12 13] Thus male infertility diseases may occurin older males as a result of LCs dysfunction or testos-terone disorder [14 15] Currently androgen-replacementwas the most efficient therapy for rescuing testosteronedeficiency however it required successive treatments andcarries inherent risks [16] SLCs had the ability to self-renewand differentiate into LCs therefore providing a new strategyfor treating these diseases by SLCs transplantation [17]
The pig had played a crucial role as a mammalianmodel in human disease studies [18 19] The pig testis had
HindawiStem Cells InternationalVolume 2017 Article ID 2740272 9 pageshttpsdoiorg10115520172740272
2 Stem Cells International
been suggested as ldquothe most versatile steroid producingorgan knownrdquo and provided important material to researchthe physiology and genetics of human steroidogenesis [20]However porcine SLCs had yet to be isolated and enrichedAdditionally species distinctions complicated the studies ofporcine SLCs since completely mapping of the markers andculture systems of rat and mouse SLCs to porcine SLCs hadnot been achieved Owing to the importance of porcine SLCsin clinical applications the objective of this study was toisolate identify and culture SLCs from neonatal pig testes
2 Materials and Methods
21 Collection of Porcine Testes The study was approved bythe Animal Care and Use Committee of Northwest AampFUniversity in accordance with the Guide for the Care andUse of Laboratory Animals of the National Institutes ofHealth China Fresh testes samples of 7-day-old male pigsfrom Besun agricultural industry group Co Ltd (Yan-gling Shaanxi China) were transported to the laboratory inDulbeccorsquos phosphate-buffered saline (DPBS) supplementedwith 2 Penicillin-Streptomycin (PS) solution (InvitrogenCarlsbad CA USA) within 1 h Testes samples of 2-month-old male pigs were collected from a pig breeding farm inYangling Shaanxi Province China
22 Isolation of Porcine SLCs An enzymatic digestionmethodwas used for obtaining porcine SLCs Testes were firstwashed andminced after the epididymis and tunica albugineawere removedThen the testicular fragments were suspendedin 075mgmL collagenase type IV (Invitrogen) containing5 (vv) fetal bovine serum (FBS Gibco UK) plus DNaseI (100 120583gmL Bio Basic Markham Canada) and incubatedwith constant shaking at 34∘C for 90min [21] The 160 and59 120583mmonofilament nylonmeshes (Solarbio Beijing China)were then used to filter the cell suspension [21] The isolatedcells were treated with 1mgmL hyaluronidase (Invitrogen)and centrifugation at 500119892 for 5min at 20∘C After 5minstilling the upper side of the suspensions was cultured inmedia for another 15min stilling The cells on the upper sideof the suspensions were then collected Finally the isolatedLCs were cultured in Dulbeccorsquos modified eagle mediumnutrient mixture F-12 (DMEMF12 Invitrogen) medium
23 Preparation of Testicular Fluid of Piglets (pTF) The pTFand primary LCs were derived from the same source Thetestes of 7-day-old pigs were cut into fragments as small aspossible and pTF was extracted by tissue homogenization at20∘C [22] Finally the pTF was filtered through a 022120583mstrainer to degerm
24 Culture of Porcine Isolated LCs The isolated LCs precipi-tates were resuspended in two media one basic medium andthe other pTF medium (basic medium plus 30 (vv) pTF)[22] The basic medium consisted of DMEMF12 10 (vv)FBS 1 (vv) PS and 1 (vv) vitamins The LCs were thenincubated in an atmosphere of 95 air-5 CO
2at 34∘C and
cultured for at least 2 weeksThe culture media were changeddaily
25 Ethane Dimethanesulphonate (EDS) Treatment TheEDSwas provided by Professor Yuanqiang Zhang (Departmentof Human Anatomy Histology and Embryology The FourthMilitary Medical University China) According to the pre-vious methods EDS was dissolved in dimethyl sulfoxide(DMSO)sterile water (1 3 vv) [23ndash25] Afterwards the pri-mary isolated SLCs were seeded into a 6-well plate and 0 05075 and 10mgmL EDS (final concentration) were added tothe culture solution respectively [24 25] Quantitative realtime-PCR (qRT-PCR) and immunofluorescent analyses werecarried out 24 h after EDS treatment
26 Haematoxylin and Eosin (HampE) Staining and Immunohis-tochemistry Analysis Testis samples of 7 daysrsquo and 2 monthsrsquoold male pigs were fixed dehydrated and embedded inparaffin The paraffin-embedded tissues were then sectionedat 5 120583m using standard procedures and adhered to pre-coated glass slides Afterwards HampE staining of the paraffin-embedded sections was conducted to observe the histology[26]
For immunohistochemistry PDGFR120572 expression in theinterstitial cells of 7-day-old porcine testes and the type ofthese protein-positive cells was determined In detail theparaffin sections were deparaffinized rehydrated and rinsedin PBSThen antigen retrieval involved boiling of the samplesin a solution of 001M Tris-ethylenediamine tetraacetic acid(Tris-EDTA pH = 90) for 10min The sections were incu-bated with 10 donkey serum for 2 h at 37∘C followed byincubation with primary antibodies (anti-PDGFR120572 1 200Abcam Cambridge UK) overnight at 4∘C and subsequentincubation with secondary biotinylated antibodies (ZSGB-BIO China) for 1 h at 37∘C [27 28] Afterwards 331015840-diaminobenzidine (DAB ComWin Biotech China) was usedas a chromogen to detect protein expression
The characteristics of the isolated cells were detectedby immunofluorescence staining First cells were fixed with4 paraformaldehyde and permeabilized with 005 Tri-ton X-100 for 15min The cells were then incubated withprimary antibodies at 4∘C overnight and then for 2 h withappropriate Alexa Fluor 594-conjugated secondary antibod-ies (1 400 Invitrogen USA) at 37∘C Finally the cells werelabeled with 46-diamidino-2-phenylindole (DAPI 1 1000Beyotime China) The primary antibodies used were rabbitanti-PDGFR120572 (1 200 Abcam) and mouse anti-CYP17A1(1 100 Santa Cruz USA)
All images of all the staining were captured using a NikonEclipse 80i fluorescence microscope camera (Tokyo Japan)
27 qRT-PCR Analysis Total RNA were extracted fromcells and porcine testes tissues using RNAiso Plus reagent(TaKaRaDalian China) according to the recommended pro-tocol The cDNA was then synthesized for reverse transcrip-tion PCR (RT-PCR) using the PrimeSript RT reagent Kit(TaKaRa) Specific primers (Table 1) were used to characterizethe isolated cells The qRT-PCR reaction system was 20120583L in
Stem Cells International 3
Table 1 Primer sequences for genes designed and used in this study
Primers Primer sequences (51015840-31015840) Length of productionbp Notes
LIFR F TAGCACGTGAATTGCGGACT 117 RT-PCR amp qRT-PCRR CAGTGCAACAACGAATGCGA
Nestin F GGAGAAACAGGGCCTACAGAG 112 RT-PCRR TAGGAGGGTCCTGTATGTGGC
GATA-4 F AATCGAAGACGTCAGCAGGT 123 RT-PCRR GCTCTGTCTTGATGGGACGC
Oct4 F GTGTTCAGCCAAACGACCATC 143 RT-PCRR GTCTCTGCCTTGCATATCTCC
PDGFR120572 F GTGGAGAATCTGCTGCCTGG 133 RT-PCR amp qRT-PCRR TGTAGGTGACGCCGATGTAG
PLZF F GCGGAAGACCTGGATGACCT 105 RT-PCRR GTCGTCTGAGGCTTGGATGGT
SOX9 F GCAAACTCTGGAGACTGCTGAATG 137 RT-PCRR GCCGTTCTTCACCGACTTTCTC
CYP17A1 F ATTGACTCCAGCATTGGCGA 179 RT-PCR amp qRT-PCRR CCGAAGGGCAAGTAGCTCAA
120573-actin F CTCCATCATGAAGTGCGACGT 114 RT-PCR amp qRT-PCRR GTGATCTCCTTCTGCATCCTGTC
volume 10 120583L SYBR Premix Ex Taq II (2x) (TaKaRa) 08 120583LcDNA 05 120583L PCR Forward Primer (10 120583molL) 05120583L PCRReverse Primer (10 120583molL) and added sterile water to totalvolume of 20 120583L PCR reaction conditions were as followsdenaturation at 95∘C for 3min followed by 40 cycles of (95∘Cfor 15 s 60∘C for 30 s and 72∘C for 30 s)
28 Oil Red O Staining For the visualization of the lipiddroplets LC was fixed in 4 formaldehyde (freshly preparedfrom paraformaldehyde) for 15min stained in Oil red Ostaining solution (03 Oil Red O solution) for 10min andthenwashedwith PBS 2sim3 timesThe cells were then capturedusing a Nikon Eclipse 80i fluorescence microscope camera
29 Statistical Analyses The mRNA expressions detectedby qRT-PCR were calculated using the 2minusΔΔCT method andnormalized by the expression of 120573-actin [29] The mRNAexpression variation between different samples was calcu-lated using SPSS (version 180) (SPSS Inc Chicago ILUSA) Statistical differences of genes in different groups weredetermined by ANOVA and the data were presented asmeanplusmn standard deviation of duplicates
3 Results
31 SLCs Were Present in the Neonatal Porcine Testes Anumber of spindle-shaped cells were found in the testicularinterstitium in the postnatal 7 daysrsquo and 2 monthsrsquo oldporcine testes by HampE staining (Figure 1(a)) Furthermoreimmunochemical analyses showed that PDGFR120572wasmainlyexpressed in the testicular interstitium in postnatal 7-day-old pigs while the expression of PDGFR120572 was low in the2-month-old porcine testicular interstitium (Figure 1(b))
Moreover the expression of Nestin in the 7-day-old porcinetestes was significantly higher than that in the 2-month-oldtestes (119875 lt 05) (Figure 1(c)) Based on these results we choseto collect SLCs from 7-day-old pigs rather than 2-month-oldpigs
32 The Isolated LCs from Porcine Testicular InterstitiumExpressed Markers of SLCs The primary LCs were obtainedby digestion method (Figure 2(a)) RT-PCR and immunoflu-orescent analysis were then used to characterize these cellsAs shown in Figure 2(b) RT-PCR results showed that the iso-lated LCs expressed SLCs or pluripotency stem cell markers(Nestin PDGFR120572 GATA-4 Oct4 and LIFR) (Figure 2(b))Moreover markers of Sertoli cells (SOX9) and spermato-gonial stem cells (PLZF) were not detected (Figure 2(b))indicating no contaminationwith these cells in these LCsTheresults demonstrated that this digestion method was usefulin removing the seminiferous tubules Moreover qRT-PCRresults showed that the expressions of LIFR and PDGFR120572 inthe LCs were significantly higher than that in the porcinetestes (119875 lt 05) (Figures 2(c) and 2(d)) indicating thatthis method was able to enrich SLCs from porcine testes Insummary the primary isolated LCs expressing SLCsmarkers(Nestin PDGFR120572 GATA-4 Oct4 and LIFR) were putativeSLCs
EDS was used to specifically eliminate differentiated LCsin rat and mouse testes [4 8] According to results of theEDS treatment the percentage of porcine differentiated LCswas approximately 23 in the primary isolated LCs andthe purity of primary isolated porcine SLCs was over 77(Figures S1 S2 in SupplementaryMaterial available online athttpsdoiorg10115520172740272) In addition qRT-PCRresults of Nestin PDGFR120572 CYP17A1 expressions and the
4 Stem Cells International
2m
7 d
(a)
PDGFR120572 Control
ControlPDGFR120572
2m
7 d
(b)
B
A
Relat
ive m
RNA
expr
essio
n of
Nes
tin
Different period of pig testis2m7 d
00
05
10
15
20
25
30
(c)
Figure 1 Identification of pig stem Leydig cells (SLCs) in situ (a) HampE staining of 7 daysrsquo and 2 monthsrsquo old porcine testes (bar = 50 120583m)(b) Immunohistochemical analysis of PDGFR120572 of 7 daysrsquo and 2 monthsrsquo old porcine testes (bar = 50 120583m) the black arrowheads indicated thePDGFR120572-positive cells in testicular interstitium (c) mRNA expression of Nestin in 7 daysrsquo and 2 monthsrsquo old pig testes Different letters (AB) indicate significant difference (119875 lt 005)
immunofluorescent analysis of CYP17A1 further confirmedthat EDS could specifically eliminate differentiated LCs in thepig (Figures S3 S4) which was consistent with the results ofcell survival rates after EDS treatment (Figure S2)
33 These Isolated SLCs Exhibited High Clonogenic PotentialEven though the primary SLCs were isolated their culturesystem was yet to be determined In the current study pTFwas used as the main component in the medium Seven dayslater a number of clones were formed which grew largerfollowing 2 weeks of culture (Figure 3(a)) Immunofluores-cent analysis showed that the clones were PDGFR120572 positive(Figure 3(b)) The expressions of both Nestin and LIFR werehigher in porcine SLCs cultured with pTFmedium comparedto in SLCs without culture (119875 lt 05) (Figure 5) indicatingthat pTF was able to sustain the stem cell potential of SLCs
34 Isolated SLCs Showed the Capacity of Spontaneous Differ-entiation into LCs When Cultured In Vitro The isolated cellscultured with a basic medium did not form clones after 2weeks (Figure 4(a)) and expressed CYP17A1 a marker of pig
differentiated LCs (Figure 4(b)) Moreover the expressions ofbothNestin andLIFRwere significantly lower in porcine SLCscultured with the basic medium for 2 weeks compared to inSLCs without culture (119875 lt 05) (Figure 5) The expression ofCYP17A1 was significantly higher in porcine SLCs culturedwith the basic medium for 2 weeks than that of SLCs withoutculture (119875 lt 05) (Figure 5) Oil Red O staining showedthat the cultured cells secreted lipid droplets which wasalso a marker of differentiated LCs (Figure 6) These resultsdemonstrated that the primary isolated SLCs were able todifferentiate into LC lineages when cultured with the basicmedium indicating that the putative SLCs had capacity tospontaneously differentiate into LCs
4 Discussion
Several cell types were essential for spermatogenesis in thetestis germ cells Sertoli cells peritubular myoid cells andALCs [30] ALCs were the major source of testosteronesecretion in mammals however they were incapable ofproliferation Testosterone could diffuse into Sertoli cellsso that it indirectly regulated spermatogenesis When the
Stem Cells International 5
(a)
SLCsNestin
Oct4
LIFR
PLZF
SOX9
120573-Actin
PDGFR120572
+ minus
(b)
CC
A
LIFR
mRN
A le
vel (
relat
ive t
o be
ta-a
ctin
)
B
0
2
4
6
8
10
Sert
oli c
ells
Sper
mat
ogon
ia
SLCs
Testi
s
Different types of testicular cells
(c)
DC
B
mRN
A le
vel (
relat
ive t
o be
ta-a
ctin
)
A
Sper
mat
ogon
ia
SLCs
Sert
oli c
ells
Testi
s
PDGFR120572
0
20
40
(d)
Figure 2 Identification of porcine SLCs (a) The primary SLCs isolated from 7-day-old porcine testes with the help of collagenase type IV(bar = 50 120583m) (b) RT-PCR results of genes involved in stem cells potential and spermatogenesis SLCs the pig primary isolated SLCs +positive control (7-day-old pig testes) minus negative control (sterile water) (c and d) Expressions of LIFR and PDGFR120572 in pig testes pig Sertolicells pig Spermatogonia stem cells and pig primary isolated SLCs as fold change relative to beta-actin Spermatogonia Spermatogonia stemcells Different letters (A B) indicate significant difference (119875 lt 005)
processes of synthesizing testosterone were disturbed post-meiotic spermatids were significantly reduced or absent [30]SLCs were therefore ideal for rescuing infertility caused byLCs dysfunction In addition it had been demonstratedthat SLCs were able to differentiate into ALCs in vivo bytransplanting the alginate-encapsulated interstitial tissue intorat extra-testis tissue [31] Therefore mammalian SLCs heldgreat promise for research and clinical use in male infertility
Recently SLCs had been successfully isolated from ratsmice and humans but not from pigs Previous studieshad shown that several proteins were detected in putativeSLCs in the rat testicular interstitium such as Nestin LIFRPDGFR120572 CD90 and CD51 [11 32] However a majorityof these were also expressed in other testicular cells andthey made useful markers of SLCs as they were expressedin a time andor stage-specific manner For example Ge
and his colleagues demonstrated that the PDGFR120572-positiveand 3120573-HSD-negative cells in postnatal 7-day-old rats wereputative SLCs [4] They then concluded that PDGFR120572 wasa marker of rat SLCs in the neonatal stage In this studySLCswere identified andPDGFR120572was shown to be expressedin the SLCs using HampE staining and immunochemistryMoreover results from immunochemistry and qRT-PCRanalysis showed that the expressions of both PDGFR120572 andNestin were significantly higher in postnatal 7 daysrsquo than2 monthsrsquo old pig (119875 lt 05) These results predicted thatPDGFR120572 could also be used as a marker of neonatal porcineSLCs and the 7-day-old sampling point was more suitable forisolating SLCs than the 2 months old in pigs
However no studies had reported the isolation of porcineSLCs In the rat Percoll purification and immunoselectiontechnologies were used to obtain SLCs by Ge et al (2006) [4]
6 Stem Cells International
1w 2w0 d
(a)
PDGFR120572 DAPI Merge
(b)
Figure 3 Morphology development and PDGFR120572 immunofluorescence analysis of porcine SLCs cultured in pTF medium (bar = 50120583m)(a) Morphology development of porcine SLCs cultured 0 d 1 w and 2w in pTF medium (b) PDGFR120572 immunofluorescence of porcine SLCscultured in pTF medium for 2w
1w 2w0 d
(a)
CYP17A1 DAPI Merge
(b)
Figure 4 Morphology development and CYP17A1 immunofluorescence of porcine SLCs cultured in basic medium (a) Morphologydevelopment of porcine SLCs cultured 0 d 1 w and 2w in basic medium (b) CYP17A1 immunofluorescence of porcine SLCs cultured inbasic medium for 2w
and several studies had used transgenic mice to obtainmouse SLCs [8 9] In the current study collagenase andhyaluronidase digestion was used to isolate pig testicularinterstitial cells from pig testes Moreover hyaluronidasecould isolate individual cells from the outer surface of
seminiferous tubules Thus the method used in the currentstudy was simpler and faster than the methods used in miceand rats
Like other stem cells the proliferation and differentiationof SLCs were also regulated by the microenvironment which
Stem Cells International 7
C
B
A
mRN
A le
vel o
f Nes
tin (r
elat
ive t
o be
ta-a
ctin
)
Prim
ary
cells
Basic
med
ium
pTF
med
ium
00
05
10
15
20
25
30Nestin
(a)
CB
A
mRN
A le
vel o
f LIF
R (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
1
2
3
4
5
6
7
8
9
10LIFR
(b)
B B
A
mRN
A le
vel o
f CYP
17A
1 (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
5
10
15
20
25
30
35CYP17A1
(c)
Figure 5 Expressions of Nestin LIFR and CYP17A1 of porcine SLCs cultured in different media for 2w Note primary cells the primaryisolated porcine SLCs Different letters (A B C) indicate significant difference (119875 lt 005)
provided vital cell factors and proteins In the testes sometypes of cells such as Sertoli cells and peritubular myoidcells secreted factors into the testicular fluid to regulate theactivities of SLCs [33ndash35] Since the culture system of porcineSLCs had not been developed all factors from whole testeswere extracted as pTF At first we conjectured that the pTFcould maintain the stem cell potential of porcine SLCs whenadded to the culturemediumThe results of this work showedthat the pTF could indeed support the stem cell potentialof SLCs for 2 weeks in vitro The pTF was able to maintainthe self-renewal properties of SLCs as the origin of pTFwas consistent with the putative SLCs Moreover the pTFcontained abundant hormones growth factors cytokinesand a large amount of proteins which could provide the
necessary material basis for SLCs proliferation [22 36] Theimmunofluorescent analysis of PDGFR120572 also demonstratedthat the cells that had been cultured for 2 weeks were putativeSLCs Taken together the results indicated that the pTFmightbe contributing to maintaining self-renewal properties of theputative SLCs Therefore our future research will be directedtowards revealing the vital components for maintaining SLCsself-renewal in pTF
There were two areas of innovation of the present studyFirst it provided a simpler and faster method for obtainingthe porcine SLCs which might provide a reservoir for LCs-lineage differentiation Second it developed a new short-term culture system for porcine SLCs In addition as an idealhuman model some human drugs toxicity investigations of
8 Stem Cells International
Figure 6Oil RedO staining of pig LCs after cultured 7 d in the basicmedium (bar = 50 120583m)
sterile diseases could be assessed in the pig firstly beforehuman trials which could reduce the expense of investiga-tions into new drugs
5 Conclusions
To summarize we isolated porcine SLCs and identifiedsome of their basic characteristics Moreover pTF couldmaintain the features of porcine SLCs when added to culturesystemThis workmight help us to understand the regulatorymechanisms of proliferation and differentiation of SLCs andholds promise for further studies pertaining to porcine SLCs
Disclosure
The current address of Chuanying Pan is College of AnimalScience and Technology Northwest AampF University No 22Xinong Road Yangling Shaanxi 712100 China
Competing Interests
The authors declare that there are no competing interestsregarding the publication of this paper
Acknowledgments
This work was supported by China Postdoctoral ScienceFoundation funded project (no 2014M560809) the Fun-damental Research Funds for the Central Universities(NWSUAF no 2452015145) and the National Basic ResearchProgram of China (973 program no 2014CB943100) Specialthanks are due to Professor Yuan-Qiang Zhang (The FourthMilitary Medical University China) for his generous dona-tion of EDS
References
[1] A S Midzak H Chen V Papadopoulos and B R ZirkinldquoLeydig cell aging and the mechanisms of reduced testosteronesynthesisrdquoMolecular and Cellular Endocrinology vol 299 no 1pp 23ndash31 2009
[2] Y Yang Z Su W Xu et al ldquoDirected mouse embryonic stemcells into leydig-like cells rescue testosterone-deficientmale ratsin vivordquo StemCells andDevelopment vol 24 no 4 pp 459ndash4702015
[3] H Chen R-S Ge and B R Zirkin ldquoLeydig cells from stemcells to agingrdquo Molecular and Cellular Endocrinology vol 306no 1-2 pp 9ndash16 2009
[4] R-S Ge Q Dong C M Sottas V Papadopoulos B R Zirkinand M P Hardy ldquoIn search of rat stem Leydig cells identifica-tion isolation and lineage-specific developmentrdquo Proceedingsof the National Academy of Sciences of the United States ofAmerica vol 103 no 8 pp 2719ndash2724 2006
[5] M S Davidoff R Middendorff G Enikolopov D Rieth-macher A F Holstein and D Muller ldquoProgenitor cells of thetestosterone-producing Leydig cells revealedrdquo Journal of CellBiology vol 167 no 5 pp 935ndash944 2004
[6] M S Davidoff R Middendorff D Muller and A F HolsteinldquoThe neuroendocrine Leydig cells and their stem cell progeni-tors the pericytesrdquo Advances in Anatomy Embryology and CellBiology vol 205 pp 1ndash107 2009
[7] L Landreh K Spinnler K Schubert et al ldquoHuman tes-ticular peritubular cells host putative stem leydig cells withsteroidogenic capacityrdquo The Journal of Clinical Endocrinologyand Metabolism vol 99 no 7 pp E1227ndashE1235 2014
[8] M H Jiang B Cai Y Tuo et al ldquoCharacterization of Nestin-positive stem Leydig cells as a potential source for the treatmentof testicular Leydig cell dysfunctionrdquo Cell Research vol 24 no12 pp 1466ndash1485 2014
[9] K C Lo Z Lei C Venkateswara Rao J Beck and D J LambldquoDe novo testosterone production in luteinizing hormonereceptor knockout mice after transplantation of Leydig stemcellsrdquo Endocrinology vol 145 no 9 pp 4011ndash4015 2004
[10] E Stanley C-Y Lin S Jin et al ldquoIdentification proliferationand differentiation of adult leydig stem cellsrdquo Endocrinologyvol 153 no 10 pp 5002ndash5010 2012
[11] X Li Z Wang Z Jiang et al ldquoRegulation of seminiferoustubule-associated stem Leydig cells in adult rat testesrdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 113 no 10 pp 2666ndash2671 2016
[12] L Luo H Chen and B R Zirkin ldquoTemporal relationshipsamong testosterone production steroidogenic acute regulatoryprotein (StAR) and P450 side-chain cleavage enzyme (P450scc)during Leydig cell agingrdquo Journal of Andrology vol 26 no 1 pp25ndash31 2005
[13] A V Pechersky V F Semiglazov G B Loran A I Karpis-chenko V I Pechersky and V I Mazurov ldquoThe influence ofpartial androgen deficiency of aging men (PADAM) on theimpulse regime of incretion of several hormones and mitoticactivityrdquo Tsitologiya vol 48 no 10 pp 862ndash866 2006
[14] M Amore F Scarlatti A L Quarta and P Tagariello ldquoPartialandrogen deficiency depression and testosterone treatment inaging menrdquo Aging Clinical and Experimental Research vol 21no 1 pp 1ndash8 2009
[15] A Pechersky ldquoFeatures of diagnostics and treatment of partialandrogen deficiency of aging menrdquo Central European Journal ofUrology vol 67 no 4 pp 397ndash404 2014
[16] Y Nian M Ding S Hu et al ldquoTestosterone replacementtherapy improves health-related quality of life for patientswith late-onset hypogonadism a meta-analysis of randomizedcontrolled trialsrdquo Andrologia 2016
Stem Cells International 9
[17] Y Zhang R Ge and M P Hardy ldquoAndrogen-forming stemLeydig cells identification function and therapeutic potentialrdquoDisease Markers vol 24 no 4-5 pp 277ndash286 2008
[18] S Bergfelder-Druing C Grosse-Brinkhaus B Lind et al ldquoAgenome-wide association study in large white and landrace pigpopulations for number piglets born aliverdquo PLoS ONE vol 10no 3 Article ID e0117468 2015
[19] Z Jiang and M F Rothschild ldquoSwine genome science comes ofagerdquo International Journal of Biological Sciences vol 3 no 3 pp129ndash131 2007
[20] J I Raeside H L Christie R L Renaud and P A Sinclair ldquoTheboar testis the most versatile steroid producing organ knownrdquoSociety of Reproduction and Fertility Supplement vol 62 pp 85ndash97 2006
[21] Y Nakajima G Sato S Ohno and S Nakajin ldquoOrganotincompounds suppress testosterone production in Leydig cellsfrom neonatal pig testesrdquo Journal of Health Science vol 49 no6 pp 514ndash519 2003
[22] P Wang Y Zheng Y Li et al ldquoEffects of testicular interstitialfluid on the proliferation of the mouse spermatogonial stemcells in vitrordquo Zygote vol 22 no 3 pp 395ndash403 2014
[23] E-H Lee J-H Oh Y-S Lee et al ldquoGene expression analysisof toxicological pathways in TM3 leydig cell lines treatedwith Ethane dimethanesulfonaterdquo Journal of Biochemical andMolecular Toxicology vol 26 no 6 pp 213ndash223 2012
[24] T Li J Hu G-H He et al ldquoUp-regulation of NDRG2 throughnuclear factor-kappa B is required for Leydig cell apoptosisin both human and murine infertile testesrdquo Biochimica etBiophysica ActamdashMolecular Basis of Disease vol 1822 no 2 pp301ndash313 2012
[25] A JMorrisM F Taylor and I DMorris ldquoLeydig cell apoptosisin response to ethane dimethanesulphonate after both in vivoand in vitro treatmentrdquo Journal of Andrology vol 18 no 3 pp274ndash280 1997
[26] B Heidari M Rahmati-Ahmadabadi M M Akhondi et alldquoIsolation identification and culture of goat spermatogonialstem cells using c-kit and PGP95 markersrdquo Journal of AssistedReproduction and Genetics vol 29 no 10 pp 1029ndash1038 2012
[27] J-P Qi Y-L Yang H Zhu et al ldquoExpression of the androgenreceptor and its correlationwithmolecular subtypes in 980Chi-nese breast cancer patientsrdquo Breast Cancer Basic and ClinicalResearch vol 6 pp 1ndash8 2012
[28] Y Zheng YHe J An et al ldquoTHY1 is a surfacemarker of porcinegonocytesrdquoReproduction Fertility andDevelopment vol 26 no4 pp 533ndash539 2014
[29] K J Livak and T D Schmittgen ldquoAnalysis of relative geneexpression data using real-time quantitative PCR and the2(T)(minusDelta Delta C) methodrdquoMethods vol 25 no 4 pp 402ndash408 2001
[30] L B Smith andW H Walker ldquoThe regulation of spermatogen-esis by androgensrdquo Seminars in Cell and Developmental Biologyvol 30 pp 2ndash13 2014
[31] H Chen S Jin S Huang et al ldquoTransplantation of alginate-encapsulated seminiferous tubules and interstitial tissue intoadult rats leydig stem cell differentiation in vivordquo Molecularand Cellular Endocrinology vol 436 pp 250ndash258 2016
[32] H Chen Y Wang R Ge and B R Zirkin ldquoLeydig cell stemcells identification proliferation and differentiationrdquoMolecularand Cellular Endocrinology 2016
[33] R M Sharpe ldquoMonitoring of spermatogenesis in man-measurement of Sertoli cell- or germ cell-secreted proteins in
semen or bloodrdquo International Journal of Andrology vol 15 no3 pp 201ndash210 1992
[34] K J Turner C McKinnell T T McLaren et al ldquoDetectionof germ cell-derived proteins in testicular interstitial fluidpotential for monitoring spermatogenesis in vivordquo Journal ofAndrology vol 17 no 2 pp 127ndash136 1996
[35] L R Franca R A Hess J M Dufour M C Hofmann and MD Griswold ldquoThe Sertoli cell one hundred fifty years of beautyand plasticityrdquo Andrology vol 4 no 2 pp 189ndash212 2016
[36] P G Stanton C F Foo A Rainczuk et al ldquoMapping the testicu-lar interstitial fluid proteome fromnormal ratsrdquoPROTEOMICSvol 16 no 17 pp 2391ndash2402 2016
Submit your manuscripts athttpswwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
2 Stem Cells International
been suggested as ldquothe most versatile steroid producingorgan knownrdquo and provided important material to researchthe physiology and genetics of human steroidogenesis [20]However porcine SLCs had yet to be isolated and enrichedAdditionally species distinctions complicated the studies ofporcine SLCs since completely mapping of the markers andculture systems of rat and mouse SLCs to porcine SLCs hadnot been achieved Owing to the importance of porcine SLCsin clinical applications the objective of this study was toisolate identify and culture SLCs from neonatal pig testes
2 Materials and Methods
21 Collection of Porcine Testes The study was approved bythe Animal Care and Use Committee of Northwest AampFUniversity in accordance with the Guide for the Care andUse of Laboratory Animals of the National Institutes ofHealth China Fresh testes samples of 7-day-old male pigsfrom Besun agricultural industry group Co Ltd (Yan-gling Shaanxi China) were transported to the laboratory inDulbeccorsquos phosphate-buffered saline (DPBS) supplementedwith 2 Penicillin-Streptomycin (PS) solution (InvitrogenCarlsbad CA USA) within 1 h Testes samples of 2-month-old male pigs were collected from a pig breeding farm inYangling Shaanxi Province China
22 Isolation of Porcine SLCs An enzymatic digestionmethodwas used for obtaining porcine SLCs Testes were firstwashed andminced after the epididymis and tunica albugineawere removedThen the testicular fragments were suspendedin 075mgmL collagenase type IV (Invitrogen) containing5 (vv) fetal bovine serum (FBS Gibco UK) plus DNaseI (100 120583gmL Bio Basic Markham Canada) and incubatedwith constant shaking at 34∘C for 90min [21] The 160 and59 120583mmonofilament nylonmeshes (Solarbio Beijing China)were then used to filter the cell suspension [21] The isolatedcells were treated with 1mgmL hyaluronidase (Invitrogen)and centrifugation at 500119892 for 5min at 20∘C After 5minstilling the upper side of the suspensions was cultured inmedia for another 15min stilling The cells on the upper sideof the suspensions were then collected Finally the isolatedLCs were cultured in Dulbeccorsquos modified eagle mediumnutrient mixture F-12 (DMEMF12 Invitrogen) medium
23 Preparation of Testicular Fluid of Piglets (pTF) The pTFand primary LCs were derived from the same source Thetestes of 7-day-old pigs were cut into fragments as small aspossible and pTF was extracted by tissue homogenization at20∘C [22] Finally the pTF was filtered through a 022120583mstrainer to degerm
24 Culture of Porcine Isolated LCs The isolated LCs precipi-tates were resuspended in two media one basic medium andthe other pTF medium (basic medium plus 30 (vv) pTF)[22] The basic medium consisted of DMEMF12 10 (vv)FBS 1 (vv) PS and 1 (vv) vitamins The LCs were thenincubated in an atmosphere of 95 air-5 CO
2at 34∘C and
cultured for at least 2 weeksThe culture media were changeddaily
25 Ethane Dimethanesulphonate (EDS) Treatment TheEDSwas provided by Professor Yuanqiang Zhang (Departmentof Human Anatomy Histology and Embryology The FourthMilitary Medical University China) According to the pre-vious methods EDS was dissolved in dimethyl sulfoxide(DMSO)sterile water (1 3 vv) [23ndash25] Afterwards the pri-mary isolated SLCs were seeded into a 6-well plate and 0 05075 and 10mgmL EDS (final concentration) were added tothe culture solution respectively [24 25] Quantitative realtime-PCR (qRT-PCR) and immunofluorescent analyses werecarried out 24 h after EDS treatment
26 Haematoxylin and Eosin (HampE) Staining and Immunohis-tochemistry Analysis Testis samples of 7 daysrsquo and 2 monthsrsquoold male pigs were fixed dehydrated and embedded inparaffin The paraffin-embedded tissues were then sectionedat 5 120583m using standard procedures and adhered to pre-coated glass slides Afterwards HampE staining of the paraffin-embedded sections was conducted to observe the histology[26]
For immunohistochemistry PDGFR120572 expression in theinterstitial cells of 7-day-old porcine testes and the type ofthese protein-positive cells was determined In detail theparaffin sections were deparaffinized rehydrated and rinsedin PBSThen antigen retrieval involved boiling of the samplesin a solution of 001M Tris-ethylenediamine tetraacetic acid(Tris-EDTA pH = 90) for 10min The sections were incu-bated with 10 donkey serum for 2 h at 37∘C followed byincubation with primary antibodies (anti-PDGFR120572 1 200Abcam Cambridge UK) overnight at 4∘C and subsequentincubation with secondary biotinylated antibodies (ZSGB-BIO China) for 1 h at 37∘C [27 28] Afterwards 331015840-diaminobenzidine (DAB ComWin Biotech China) was usedas a chromogen to detect protein expression
The characteristics of the isolated cells were detectedby immunofluorescence staining First cells were fixed with4 paraformaldehyde and permeabilized with 005 Tri-ton X-100 for 15min The cells were then incubated withprimary antibodies at 4∘C overnight and then for 2 h withappropriate Alexa Fluor 594-conjugated secondary antibod-ies (1 400 Invitrogen USA) at 37∘C Finally the cells werelabeled with 46-diamidino-2-phenylindole (DAPI 1 1000Beyotime China) The primary antibodies used were rabbitanti-PDGFR120572 (1 200 Abcam) and mouse anti-CYP17A1(1 100 Santa Cruz USA)
All images of all the staining were captured using a NikonEclipse 80i fluorescence microscope camera (Tokyo Japan)
27 qRT-PCR Analysis Total RNA were extracted fromcells and porcine testes tissues using RNAiso Plus reagent(TaKaRaDalian China) according to the recommended pro-tocol The cDNA was then synthesized for reverse transcrip-tion PCR (RT-PCR) using the PrimeSript RT reagent Kit(TaKaRa) Specific primers (Table 1) were used to characterizethe isolated cells The qRT-PCR reaction system was 20120583L in
Stem Cells International 3
Table 1 Primer sequences for genes designed and used in this study
Primers Primer sequences (51015840-31015840) Length of productionbp Notes
LIFR F TAGCACGTGAATTGCGGACT 117 RT-PCR amp qRT-PCRR CAGTGCAACAACGAATGCGA
Nestin F GGAGAAACAGGGCCTACAGAG 112 RT-PCRR TAGGAGGGTCCTGTATGTGGC
GATA-4 F AATCGAAGACGTCAGCAGGT 123 RT-PCRR GCTCTGTCTTGATGGGACGC
Oct4 F GTGTTCAGCCAAACGACCATC 143 RT-PCRR GTCTCTGCCTTGCATATCTCC
PDGFR120572 F GTGGAGAATCTGCTGCCTGG 133 RT-PCR amp qRT-PCRR TGTAGGTGACGCCGATGTAG
PLZF F GCGGAAGACCTGGATGACCT 105 RT-PCRR GTCGTCTGAGGCTTGGATGGT
SOX9 F GCAAACTCTGGAGACTGCTGAATG 137 RT-PCRR GCCGTTCTTCACCGACTTTCTC
CYP17A1 F ATTGACTCCAGCATTGGCGA 179 RT-PCR amp qRT-PCRR CCGAAGGGCAAGTAGCTCAA
120573-actin F CTCCATCATGAAGTGCGACGT 114 RT-PCR amp qRT-PCRR GTGATCTCCTTCTGCATCCTGTC
volume 10 120583L SYBR Premix Ex Taq II (2x) (TaKaRa) 08 120583LcDNA 05 120583L PCR Forward Primer (10 120583molL) 05120583L PCRReverse Primer (10 120583molL) and added sterile water to totalvolume of 20 120583L PCR reaction conditions were as followsdenaturation at 95∘C for 3min followed by 40 cycles of (95∘Cfor 15 s 60∘C for 30 s and 72∘C for 30 s)
28 Oil Red O Staining For the visualization of the lipiddroplets LC was fixed in 4 formaldehyde (freshly preparedfrom paraformaldehyde) for 15min stained in Oil red Ostaining solution (03 Oil Red O solution) for 10min andthenwashedwith PBS 2sim3 timesThe cells were then capturedusing a Nikon Eclipse 80i fluorescence microscope camera
29 Statistical Analyses The mRNA expressions detectedby qRT-PCR were calculated using the 2minusΔΔCT method andnormalized by the expression of 120573-actin [29] The mRNAexpression variation between different samples was calcu-lated using SPSS (version 180) (SPSS Inc Chicago ILUSA) Statistical differences of genes in different groups weredetermined by ANOVA and the data were presented asmeanplusmn standard deviation of duplicates
3 Results
31 SLCs Were Present in the Neonatal Porcine Testes Anumber of spindle-shaped cells were found in the testicularinterstitium in the postnatal 7 daysrsquo and 2 monthsrsquo oldporcine testes by HampE staining (Figure 1(a)) Furthermoreimmunochemical analyses showed that PDGFR120572wasmainlyexpressed in the testicular interstitium in postnatal 7-day-old pigs while the expression of PDGFR120572 was low in the2-month-old porcine testicular interstitium (Figure 1(b))
Moreover the expression of Nestin in the 7-day-old porcinetestes was significantly higher than that in the 2-month-oldtestes (119875 lt 05) (Figure 1(c)) Based on these results we choseto collect SLCs from 7-day-old pigs rather than 2-month-oldpigs
32 The Isolated LCs from Porcine Testicular InterstitiumExpressed Markers of SLCs The primary LCs were obtainedby digestion method (Figure 2(a)) RT-PCR and immunoflu-orescent analysis were then used to characterize these cellsAs shown in Figure 2(b) RT-PCR results showed that the iso-lated LCs expressed SLCs or pluripotency stem cell markers(Nestin PDGFR120572 GATA-4 Oct4 and LIFR) (Figure 2(b))Moreover markers of Sertoli cells (SOX9) and spermato-gonial stem cells (PLZF) were not detected (Figure 2(b))indicating no contaminationwith these cells in these LCsTheresults demonstrated that this digestion method was usefulin removing the seminiferous tubules Moreover qRT-PCRresults showed that the expressions of LIFR and PDGFR120572 inthe LCs were significantly higher than that in the porcinetestes (119875 lt 05) (Figures 2(c) and 2(d)) indicating thatthis method was able to enrich SLCs from porcine testes Insummary the primary isolated LCs expressing SLCsmarkers(Nestin PDGFR120572 GATA-4 Oct4 and LIFR) were putativeSLCs
EDS was used to specifically eliminate differentiated LCsin rat and mouse testes [4 8] According to results of theEDS treatment the percentage of porcine differentiated LCswas approximately 23 in the primary isolated LCs andthe purity of primary isolated porcine SLCs was over 77(Figures S1 S2 in SupplementaryMaterial available online athttpsdoiorg10115520172740272) In addition qRT-PCRresults of Nestin PDGFR120572 CYP17A1 expressions and the
4 Stem Cells International
2m
7 d
(a)
PDGFR120572 Control
ControlPDGFR120572
2m
7 d
(b)
B
A
Relat
ive m
RNA
expr
essio
n of
Nes
tin
Different period of pig testis2m7 d
00
05
10
15
20
25
30
(c)
Figure 1 Identification of pig stem Leydig cells (SLCs) in situ (a) HampE staining of 7 daysrsquo and 2 monthsrsquo old porcine testes (bar = 50 120583m)(b) Immunohistochemical analysis of PDGFR120572 of 7 daysrsquo and 2 monthsrsquo old porcine testes (bar = 50 120583m) the black arrowheads indicated thePDGFR120572-positive cells in testicular interstitium (c) mRNA expression of Nestin in 7 daysrsquo and 2 monthsrsquo old pig testes Different letters (AB) indicate significant difference (119875 lt 005)
immunofluorescent analysis of CYP17A1 further confirmedthat EDS could specifically eliminate differentiated LCs in thepig (Figures S3 S4) which was consistent with the results ofcell survival rates after EDS treatment (Figure S2)
33 These Isolated SLCs Exhibited High Clonogenic PotentialEven though the primary SLCs were isolated their culturesystem was yet to be determined In the current study pTFwas used as the main component in the medium Seven dayslater a number of clones were formed which grew largerfollowing 2 weeks of culture (Figure 3(a)) Immunofluores-cent analysis showed that the clones were PDGFR120572 positive(Figure 3(b)) The expressions of both Nestin and LIFR werehigher in porcine SLCs cultured with pTFmedium comparedto in SLCs without culture (119875 lt 05) (Figure 5) indicatingthat pTF was able to sustain the stem cell potential of SLCs
34 Isolated SLCs Showed the Capacity of Spontaneous Differ-entiation into LCs When Cultured In Vitro The isolated cellscultured with a basic medium did not form clones after 2weeks (Figure 4(a)) and expressed CYP17A1 a marker of pig
differentiated LCs (Figure 4(b)) Moreover the expressions ofbothNestin andLIFRwere significantly lower in porcine SLCscultured with the basic medium for 2 weeks compared to inSLCs without culture (119875 lt 05) (Figure 5) The expression ofCYP17A1 was significantly higher in porcine SLCs culturedwith the basic medium for 2 weeks than that of SLCs withoutculture (119875 lt 05) (Figure 5) Oil Red O staining showedthat the cultured cells secreted lipid droplets which wasalso a marker of differentiated LCs (Figure 6) These resultsdemonstrated that the primary isolated SLCs were able todifferentiate into LC lineages when cultured with the basicmedium indicating that the putative SLCs had capacity tospontaneously differentiate into LCs
4 Discussion
Several cell types were essential for spermatogenesis in thetestis germ cells Sertoli cells peritubular myoid cells andALCs [30] ALCs were the major source of testosteronesecretion in mammals however they were incapable ofproliferation Testosterone could diffuse into Sertoli cellsso that it indirectly regulated spermatogenesis When the
Stem Cells International 5
(a)
SLCsNestin
Oct4
LIFR
PLZF
SOX9
120573-Actin
PDGFR120572
+ minus
(b)
CC
A
LIFR
mRN
A le
vel (
relat
ive t
o be
ta-a
ctin
)
B
0
2
4
6
8
10
Sert
oli c
ells
Sper
mat
ogon
ia
SLCs
Testi
s
Different types of testicular cells
(c)
DC
B
mRN
A le
vel (
relat
ive t
o be
ta-a
ctin
)
A
Sper
mat
ogon
ia
SLCs
Sert
oli c
ells
Testi
s
PDGFR120572
0
20
40
(d)
Figure 2 Identification of porcine SLCs (a) The primary SLCs isolated from 7-day-old porcine testes with the help of collagenase type IV(bar = 50 120583m) (b) RT-PCR results of genes involved in stem cells potential and spermatogenesis SLCs the pig primary isolated SLCs +positive control (7-day-old pig testes) minus negative control (sterile water) (c and d) Expressions of LIFR and PDGFR120572 in pig testes pig Sertolicells pig Spermatogonia stem cells and pig primary isolated SLCs as fold change relative to beta-actin Spermatogonia Spermatogonia stemcells Different letters (A B) indicate significant difference (119875 lt 005)
processes of synthesizing testosterone were disturbed post-meiotic spermatids were significantly reduced or absent [30]SLCs were therefore ideal for rescuing infertility caused byLCs dysfunction In addition it had been demonstratedthat SLCs were able to differentiate into ALCs in vivo bytransplanting the alginate-encapsulated interstitial tissue intorat extra-testis tissue [31] Therefore mammalian SLCs heldgreat promise for research and clinical use in male infertility
Recently SLCs had been successfully isolated from ratsmice and humans but not from pigs Previous studieshad shown that several proteins were detected in putativeSLCs in the rat testicular interstitium such as Nestin LIFRPDGFR120572 CD90 and CD51 [11 32] However a majorityof these were also expressed in other testicular cells andthey made useful markers of SLCs as they were expressedin a time andor stage-specific manner For example Ge
and his colleagues demonstrated that the PDGFR120572-positiveand 3120573-HSD-negative cells in postnatal 7-day-old rats wereputative SLCs [4] They then concluded that PDGFR120572 wasa marker of rat SLCs in the neonatal stage In this studySLCswere identified andPDGFR120572was shown to be expressedin the SLCs using HampE staining and immunochemistryMoreover results from immunochemistry and qRT-PCRanalysis showed that the expressions of both PDGFR120572 andNestin were significantly higher in postnatal 7 daysrsquo than2 monthsrsquo old pig (119875 lt 05) These results predicted thatPDGFR120572 could also be used as a marker of neonatal porcineSLCs and the 7-day-old sampling point was more suitable forisolating SLCs than the 2 months old in pigs
However no studies had reported the isolation of porcineSLCs In the rat Percoll purification and immunoselectiontechnologies were used to obtain SLCs by Ge et al (2006) [4]
6 Stem Cells International
1w 2w0 d
(a)
PDGFR120572 DAPI Merge
(b)
Figure 3 Morphology development and PDGFR120572 immunofluorescence analysis of porcine SLCs cultured in pTF medium (bar = 50120583m)(a) Morphology development of porcine SLCs cultured 0 d 1 w and 2w in pTF medium (b) PDGFR120572 immunofluorescence of porcine SLCscultured in pTF medium for 2w
1w 2w0 d
(a)
CYP17A1 DAPI Merge
(b)
Figure 4 Morphology development and CYP17A1 immunofluorescence of porcine SLCs cultured in basic medium (a) Morphologydevelopment of porcine SLCs cultured 0 d 1 w and 2w in basic medium (b) CYP17A1 immunofluorescence of porcine SLCs cultured inbasic medium for 2w
and several studies had used transgenic mice to obtainmouse SLCs [8 9] In the current study collagenase andhyaluronidase digestion was used to isolate pig testicularinterstitial cells from pig testes Moreover hyaluronidasecould isolate individual cells from the outer surface of
seminiferous tubules Thus the method used in the currentstudy was simpler and faster than the methods used in miceand rats
Like other stem cells the proliferation and differentiationof SLCs were also regulated by the microenvironment which
Stem Cells International 7
C
B
A
mRN
A le
vel o
f Nes
tin (r
elat
ive t
o be
ta-a
ctin
)
Prim
ary
cells
Basic
med
ium
pTF
med
ium
00
05
10
15
20
25
30Nestin
(a)
CB
A
mRN
A le
vel o
f LIF
R (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
1
2
3
4
5
6
7
8
9
10LIFR
(b)
B B
A
mRN
A le
vel o
f CYP
17A
1 (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
5
10
15
20
25
30
35CYP17A1
(c)
Figure 5 Expressions of Nestin LIFR and CYP17A1 of porcine SLCs cultured in different media for 2w Note primary cells the primaryisolated porcine SLCs Different letters (A B C) indicate significant difference (119875 lt 005)
provided vital cell factors and proteins In the testes sometypes of cells such as Sertoli cells and peritubular myoidcells secreted factors into the testicular fluid to regulate theactivities of SLCs [33ndash35] Since the culture system of porcineSLCs had not been developed all factors from whole testeswere extracted as pTF At first we conjectured that the pTFcould maintain the stem cell potential of porcine SLCs whenadded to the culturemediumThe results of this work showedthat the pTF could indeed support the stem cell potentialof SLCs for 2 weeks in vitro The pTF was able to maintainthe self-renewal properties of SLCs as the origin of pTFwas consistent with the putative SLCs Moreover the pTFcontained abundant hormones growth factors cytokinesand a large amount of proteins which could provide the
necessary material basis for SLCs proliferation [22 36] Theimmunofluorescent analysis of PDGFR120572 also demonstratedthat the cells that had been cultured for 2 weeks were putativeSLCs Taken together the results indicated that the pTFmightbe contributing to maintaining self-renewal properties of theputative SLCs Therefore our future research will be directedtowards revealing the vital components for maintaining SLCsself-renewal in pTF
There were two areas of innovation of the present studyFirst it provided a simpler and faster method for obtainingthe porcine SLCs which might provide a reservoir for LCs-lineage differentiation Second it developed a new short-term culture system for porcine SLCs In addition as an idealhuman model some human drugs toxicity investigations of
8 Stem Cells International
Figure 6Oil RedO staining of pig LCs after cultured 7 d in the basicmedium (bar = 50 120583m)
sterile diseases could be assessed in the pig firstly beforehuman trials which could reduce the expense of investiga-tions into new drugs
5 Conclusions
To summarize we isolated porcine SLCs and identifiedsome of their basic characteristics Moreover pTF couldmaintain the features of porcine SLCs when added to culturesystemThis workmight help us to understand the regulatorymechanisms of proliferation and differentiation of SLCs andholds promise for further studies pertaining to porcine SLCs
Disclosure
The current address of Chuanying Pan is College of AnimalScience and Technology Northwest AampF University No 22Xinong Road Yangling Shaanxi 712100 China
Competing Interests
The authors declare that there are no competing interestsregarding the publication of this paper
Acknowledgments
This work was supported by China Postdoctoral ScienceFoundation funded project (no 2014M560809) the Fun-damental Research Funds for the Central Universities(NWSUAF no 2452015145) and the National Basic ResearchProgram of China (973 program no 2014CB943100) Specialthanks are due to Professor Yuan-Qiang Zhang (The FourthMilitary Medical University China) for his generous dona-tion of EDS
References
[1] A S Midzak H Chen V Papadopoulos and B R ZirkinldquoLeydig cell aging and the mechanisms of reduced testosteronesynthesisrdquoMolecular and Cellular Endocrinology vol 299 no 1pp 23ndash31 2009
[2] Y Yang Z Su W Xu et al ldquoDirected mouse embryonic stemcells into leydig-like cells rescue testosterone-deficientmale ratsin vivordquo StemCells andDevelopment vol 24 no 4 pp 459ndash4702015
[3] H Chen R-S Ge and B R Zirkin ldquoLeydig cells from stemcells to agingrdquo Molecular and Cellular Endocrinology vol 306no 1-2 pp 9ndash16 2009
[4] R-S Ge Q Dong C M Sottas V Papadopoulos B R Zirkinand M P Hardy ldquoIn search of rat stem Leydig cells identifica-tion isolation and lineage-specific developmentrdquo Proceedingsof the National Academy of Sciences of the United States ofAmerica vol 103 no 8 pp 2719ndash2724 2006
[5] M S Davidoff R Middendorff G Enikolopov D Rieth-macher A F Holstein and D Muller ldquoProgenitor cells of thetestosterone-producing Leydig cells revealedrdquo Journal of CellBiology vol 167 no 5 pp 935ndash944 2004
[6] M S Davidoff R Middendorff D Muller and A F HolsteinldquoThe neuroendocrine Leydig cells and their stem cell progeni-tors the pericytesrdquo Advances in Anatomy Embryology and CellBiology vol 205 pp 1ndash107 2009
[7] L Landreh K Spinnler K Schubert et al ldquoHuman tes-ticular peritubular cells host putative stem leydig cells withsteroidogenic capacityrdquo The Journal of Clinical Endocrinologyand Metabolism vol 99 no 7 pp E1227ndashE1235 2014
[8] M H Jiang B Cai Y Tuo et al ldquoCharacterization of Nestin-positive stem Leydig cells as a potential source for the treatmentof testicular Leydig cell dysfunctionrdquo Cell Research vol 24 no12 pp 1466ndash1485 2014
[9] K C Lo Z Lei C Venkateswara Rao J Beck and D J LambldquoDe novo testosterone production in luteinizing hormonereceptor knockout mice after transplantation of Leydig stemcellsrdquo Endocrinology vol 145 no 9 pp 4011ndash4015 2004
[10] E Stanley C-Y Lin S Jin et al ldquoIdentification proliferationand differentiation of adult leydig stem cellsrdquo Endocrinologyvol 153 no 10 pp 5002ndash5010 2012
[11] X Li Z Wang Z Jiang et al ldquoRegulation of seminiferoustubule-associated stem Leydig cells in adult rat testesrdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 113 no 10 pp 2666ndash2671 2016
[12] L Luo H Chen and B R Zirkin ldquoTemporal relationshipsamong testosterone production steroidogenic acute regulatoryprotein (StAR) and P450 side-chain cleavage enzyme (P450scc)during Leydig cell agingrdquo Journal of Andrology vol 26 no 1 pp25ndash31 2005
[13] A V Pechersky V F Semiglazov G B Loran A I Karpis-chenko V I Pechersky and V I Mazurov ldquoThe influence ofpartial androgen deficiency of aging men (PADAM) on theimpulse regime of incretion of several hormones and mitoticactivityrdquo Tsitologiya vol 48 no 10 pp 862ndash866 2006
[14] M Amore F Scarlatti A L Quarta and P Tagariello ldquoPartialandrogen deficiency depression and testosterone treatment inaging menrdquo Aging Clinical and Experimental Research vol 21no 1 pp 1ndash8 2009
[15] A Pechersky ldquoFeatures of diagnostics and treatment of partialandrogen deficiency of aging menrdquo Central European Journal ofUrology vol 67 no 4 pp 397ndash404 2014
[16] Y Nian M Ding S Hu et al ldquoTestosterone replacementtherapy improves health-related quality of life for patientswith late-onset hypogonadism a meta-analysis of randomizedcontrolled trialsrdquo Andrologia 2016
Stem Cells International 9
[17] Y Zhang R Ge and M P Hardy ldquoAndrogen-forming stemLeydig cells identification function and therapeutic potentialrdquoDisease Markers vol 24 no 4-5 pp 277ndash286 2008
[18] S Bergfelder-Druing C Grosse-Brinkhaus B Lind et al ldquoAgenome-wide association study in large white and landrace pigpopulations for number piglets born aliverdquo PLoS ONE vol 10no 3 Article ID e0117468 2015
[19] Z Jiang and M F Rothschild ldquoSwine genome science comes ofagerdquo International Journal of Biological Sciences vol 3 no 3 pp129ndash131 2007
[20] J I Raeside H L Christie R L Renaud and P A Sinclair ldquoTheboar testis the most versatile steroid producing organ knownrdquoSociety of Reproduction and Fertility Supplement vol 62 pp 85ndash97 2006
[21] Y Nakajima G Sato S Ohno and S Nakajin ldquoOrganotincompounds suppress testosterone production in Leydig cellsfrom neonatal pig testesrdquo Journal of Health Science vol 49 no6 pp 514ndash519 2003
[22] P Wang Y Zheng Y Li et al ldquoEffects of testicular interstitialfluid on the proliferation of the mouse spermatogonial stemcells in vitrordquo Zygote vol 22 no 3 pp 395ndash403 2014
[23] E-H Lee J-H Oh Y-S Lee et al ldquoGene expression analysisof toxicological pathways in TM3 leydig cell lines treatedwith Ethane dimethanesulfonaterdquo Journal of Biochemical andMolecular Toxicology vol 26 no 6 pp 213ndash223 2012
[24] T Li J Hu G-H He et al ldquoUp-regulation of NDRG2 throughnuclear factor-kappa B is required for Leydig cell apoptosisin both human and murine infertile testesrdquo Biochimica etBiophysica ActamdashMolecular Basis of Disease vol 1822 no 2 pp301ndash313 2012
[25] A JMorrisM F Taylor and I DMorris ldquoLeydig cell apoptosisin response to ethane dimethanesulphonate after both in vivoand in vitro treatmentrdquo Journal of Andrology vol 18 no 3 pp274ndash280 1997
[26] B Heidari M Rahmati-Ahmadabadi M M Akhondi et alldquoIsolation identification and culture of goat spermatogonialstem cells using c-kit and PGP95 markersrdquo Journal of AssistedReproduction and Genetics vol 29 no 10 pp 1029ndash1038 2012
[27] J-P Qi Y-L Yang H Zhu et al ldquoExpression of the androgenreceptor and its correlationwithmolecular subtypes in 980Chi-nese breast cancer patientsrdquo Breast Cancer Basic and ClinicalResearch vol 6 pp 1ndash8 2012
[28] Y Zheng YHe J An et al ldquoTHY1 is a surfacemarker of porcinegonocytesrdquoReproduction Fertility andDevelopment vol 26 no4 pp 533ndash539 2014
[29] K J Livak and T D Schmittgen ldquoAnalysis of relative geneexpression data using real-time quantitative PCR and the2(T)(minusDelta Delta C) methodrdquoMethods vol 25 no 4 pp 402ndash408 2001
[30] L B Smith andW H Walker ldquoThe regulation of spermatogen-esis by androgensrdquo Seminars in Cell and Developmental Biologyvol 30 pp 2ndash13 2014
[31] H Chen S Jin S Huang et al ldquoTransplantation of alginate-encapsulated seminiferous tubules and interstitial tissue intoadult rats leydig stem cell differentiation in vivordquo Molecularand Cellular Endocrinology vol 436 pp 250ndash258 2016
[32] H Chen Y Wang R Ge and B R Zirkin ldquoLeydig cell stemcells identification proliferation and differentiationrdquoMolecularand Cellular Endocrinology 2016
[33] R M Sharpe ldquoMonitoring of spermatogenesis in man-measurement of Sertoli cell- or germ cell-secreted proteins in
semen or bloodrdquo International Journal of Andrology vol 15 no3 pp 201ndash210 1992
[34] K J Turner C McKinnell T T McLaren et al ldquoDetectionof germ cell-derived proteins in testicular interstitial fluidpotential for monitoring spermatogenesis in vivordquo Journal ofAndrology vol 17 no 2 pp 127ndash136 1996
[35] L R Franca R A Hess J M Dufour M C Hofmann and MD Griswold ldquoThe Sertoli cell one hundred fifty years of beautyand plasticityrdquo Andrology vol 4 no 2 pp 189ndash212 2016
[36] P G Stanton C F Foo A Rainczuk et al ldquoMapping the testicu-lar interstitial fluid proteome fromnormal ratsrdquoPROTEOMICSvol 16 no 17 pp 2391ndash2402 2016
Submit your manuscripts athttpswwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
Stem Cells International 3
Table 1 Primer sequences for genes designed and used in this study
Primers Primer sequences (51015840-31015840) Length of productionbp Notes
LIFR F TAGCACGTGAATTGCGGACT 117 RT-PCR amp qRT-PCRR CAGTGCAACAACGAATGCGA
Nestin F GGAGAAACAGGGCCTACAGAG 112 RT-PCRR TAGGAGGGTCCTGTATGTGGC
GATA-4 F AATCGAAGACGTCAGCAGGT 123 RT-PCRR GCTCTGTCTTGATGGGACGC
Oct4 F GTGTTCAGCCAAACGACCATC 143 RT-PCRR GTCTCTGCCTTGCATATCTCC
PDGFR120572 F GTGGAGAATCTGCTGCCTGG 133 RT-PCR amp qRT-PCRR TGTAGGTGACGCCGATGTAG
PLZF F GCGGAAGACCTGGATGACCT 105 RT-PCRR GTCGTCTGAGGCTTGGATGGT
SOX9 F GCAAACTCTGGAGACTGCTGAATG 137 RT-PCRR GCCGTTCTTCACCGACTTTCTC
CYP17A1 F ATTGACTCCAGCATTGGCGA 179 RT-PCR amp qRT-PCRR CCGAAGGGCAAGTAGCTCAA
120573-actin F CTCCATCATGAAGTGCGACGT 114 RT-PCR amp qRT-PCRR GTGATCTCCTTCTGCATCCTGTC
volume 10 120583L SYBR Premix Ex Taq II (2x) (TaKaRa) 08 120583LcDNA 05 120583L PCR Forward Primer (10 120583molL) 05120583L PCRReverse Primer (10 120583molL) and added sterile water to totalvolume of 20 120583L PCR reaction conditions were as followsdenaturation at 95∘C for 3min followed by 40 cycles of (95∘Cfor 15 s 60∘C for 30 s and 72∘C for 30 s)
28 Oil Red O Staining For the visualization of the lipiddroplets LC was fixed in 4 formaldehyde (freshly preparedfrom paraformaldehyde) for 15min stained in Oil red Ostaining solution (03 Oil Red O solution) for 10min andthenwashedwith PBS 2sim3 timesThe cells were then capturedusing a Nikon Eclipse 80i fluorescence microscope camera
29 Statistical Analyses The mRNA expressions detectedby qRT-PCR were calculated using the 2minusΔΔCT method andnormalized by the expression of 120573-actin [29] The mRNAexpression variation between different samples was calcu-lated using SPSS (version 180) (SPSS Inc Chicago ILUSA) Statistical differences of genes in different groups weredetermined by ANOVA and the data were presented asmeanplusmn standard deviation of duplicates
3 Results
31 SLCs Were Present in the Neonatal Porcine Testes Anumber of spindle-shaped cells were found in the testicularinterstitium in the postnatal 7 daysrsquo and 2 monthsrsquo oldporcine testes by HampE staining (Figure 1(a)) Furthermoreimmunochemical analyses showed that PDGFR120572wasmainlyexpressed in the testicular interstitium in postnatal 7-day-old pigs while the expression of PDGFR120572 was low in the2-month-old porcine testicular interstitium (Figure 1(b))
Moreover the expression of Nestin in the 7-day-old porcinetestes was significantly higher than that in the 2-month-oldtestes (119875 lt 05) (Figure 1(c)) Based on these results we choseto collect SLCs from 7-day-old pigs rather than 2-month-oldpigs
32 The Isolated LCs from Porcine Testicular InterstitiumExpressed Markers of SLCs The primary LCs were obtainedby digestion method (Figure 2(a)) RT-PCR and immunoflu-orescent analysis were then used to characterize these cellsAs shown in Figure 2(b) RT-PCR results showed that the iso-lated LCs expressed SLCs or pluripotency stem cell markers(Nestin PDGFR120572 GATA-4 Oct4 and LIFR) (Figure 2(b))Moreover markers of Sertoli cells (SOX9) and spermato-gonial stem cells (PLZF) were not detected (Figure 2(b))indicating no contaminationwith these cells in these LCsTheresults demonstrated that this digestion method was usefulin removing the seminiferous tubules Moreover qRT-PCRresults showed that the expressions of LIFR and PDGFR120572 inthe LCs were significantly higher than that in the porcinetestes (119875 lt 05) (Figures 2(c) and 2(d)) indicating thatthis method was able to enrich SLCs from porcine testes Insummary the primary isolated LCs expressing SLCsmarkers(Nestin PDGFR120572 GATA-4 Oct4 and LIFR) were putativeSLCs
EDS was used to specifically eliminate differentiated LCsin rat and mouse testes [4 8] According to results of theEDS treatment the percentage of porcine differentiated LCswas approximately 23 in the primary isolated LCs andthe purity of primary isolated porcine SLCs was over 77(Figures S1 S2 in SupplementaryMaterial available online athttpsdoiorg10115520172740272) In addition qRT-PCRresults of Nestin PDGFR120572 CYP17A1 expressions and the
4 Stem Cells International
2m
7 d
(a)
PDGFR120572 Control
ControlPDGFR120572
2m
7 d
(b)
B
A
Relat
ive m
RNA
expr
essio
n of
Nes
tin
Different period of pig testis2m7 d
00
05
10
15
20
25
30
(c)
Figure 1 Identification of pig stem Leydig cells (SLCs) in situ (a) HampE staining of 7 daysrsquo and 2 monthsrsquo old porcine testes (bar = 50 120583m)(b) Immunohistochemical analysis of PDGFR120572 of 7 daysrsquo and 2 monthsrsquo old porcine testes (bar = 50 120583m) the black arrowheads indicated thePDGFR120572-positive cells in testicular interstitium (c) mRNA expression of Nestin in 7 daysrsquo and 2 monthsrsquo old pig testes Different letters (AB) indicate significant difference (119875 lt 005)
immunofluorescent analysis of CYP17A1 further confirmedthat EDS could specifically eliminate differentiated LCs in thepig (Figures S3 S4) which was consistent with the results ofcell survival rates after EDS treatment (Figure S2)
33 These Isolated SLCs Exhibited High Clonogenic PotentialEven though the primary SLCs were isolated their culturesystem was yet to be determined In the current study pTFwas used as the main component in the medium Seven dayslater a number of clones were formed which grew largerfollowing 2 weeks of culture (Figure 3(a)) Immunofluores-cent analysis showed that the clones were PDGFR120572 positive(Figure 3(b)) The expressions of both Nestin and LIFR werehigher in porcine SLCs cultured with pTFmedium comparedto in SLCs without culture (119875 lt 05) (Figure 5) indicatingthat pTF was able to sustain the stem cell potential of SLCs
34 Isolated SLCs Showed the Capacity of Spontaneous Differ-entiation into LCs When Cultured In Vitro The isolated cellscultured with a basic medium did not form clones after 2weeks (Figure 4(a)) and expressed CYP17A1 a marker of pig
differentiated LCs (Figure 4(b)) Moreover the expressions ofbothNestin andLIFRwere significantly lower in porcine SLCscultured with the basic medium for 2 weeks compared to inSLCs without culture (119875 lt 05) (Figure 5) The expression ofCYP17A1 was significantly higher in porcine SLCs culturedwith the basic medium for 2 weeks than that of SLCs withoutculture (119875 lt 05) (Figure 5) Oil Red O staining showedthat the cultured cells secreted lipid droplets which wasalso a marker of differentiated LCs (Figure 6) These resultsdemonstrated that the primary isolated SLCs were able todifferentiate into LC lineages when cultured with the basicmedium indicating that the putative SLCs had capacity tospontaneously differentiate into LCs
4 Discussion
Several cell types were essential for spermatogenesis in thetestis germ cells Sertoli cells peritubular myoid cells andALCs [30] ALCs were the major source of testosteronesecretion in mammals however they were incapable ofproliferation Testosterone could diffuse into Sertoli cellsso that it indirectly regulated spermatogenesis When the
Stem Cells International 5
(a)
SLCsNestin
Oct4
LIFR
PLZF
SOX9
120573-Actin
PDGFR120572
+ minus
(b)
CC
A
LIFR
mRN
A le
vel (
relat
ive t
o be
ta-a
ctin
)
B
0
2
4
6
8
10
Sert
oli c
ells
Sper
mat
ogon
ia
SLCs
Testi
s
Different types of testicular cells
(c)
DC
B
mRN
A le
vel (
relat
ive t
o be
ta-a
ctin
)
A
Sper
mat
ogon
ia
SLCs
Sert
oli c
ells
Testi
s
PDGFR120572
0
20
40
(d)
Figure 2 Identification of porcine SLCs (a) The primary SLCs isolated from 7-day-old porcine testes with the help of collagenase type IV(bar = 50 120583m) (b) RT-PCR results of genes involved in stem cells potential and spermatogenesis SLCs the pig primary isolated SLCs +positive control (7-day-old pig testes) minus negative control (sterile water) (c and d) Expressions of LIFR and PDGFR120572 in pig testes pig Sertolicells pig Spermatogonia stem cells and pig primary isolated SLCs as fold change relative to beta-actin Spermatogonia Spermatogonia stemcells Different letters (A B) indicate significant difference (119875 lt 005)
processes of synthesizing testosterone were disturbed post-meiotic spermatids were significantly reduced or absent [30]SLCs were therefore ideal for rescuing infertility caused byLCs dysfunction In addition it had been demonstratedthat SLCs were able to differentiate into ALCs in vivo bytransplanting the alginate-encapsulated interstitial tissue intorat extra-testis tissue [31] Therefore mammalian SLCs heldgreat promise for research and clinical use in male infertility
Recently SLCs had been successfully isolated from ratsmice and humans but not from pigs Previous studieshad shown that several proteins were detected in putativeSLCs in the rat testicular interstitium such as Nestin LIFRPDGFR120572 CD90 and CD51 [11 32] However a majorityof these were also expressed in other testicular cells andthey made useful markers of SLCs as they were expressedin a time andor stage-specific manner For example Ge
and his colleagues demonstrated that the PDGFR120572-positiveand 3120573-HSD-negative cells in postnatal 7-day-old rats wereputative SLCs [4] They then concluded that PDGFR120572 wasa marker of rat SLCs in the neonatal stage In this studySLCswere identified andPDGFR120572was shown to be expressedin the SLCs using HampE staining and immunochemistryMoreover results from immunochemistry and qRT-PCRanalysis showed that the expressions of both PDGFR120572 andNestin were significantly higher in postnatal 7 daysrsquo than2 monthsrsquo old pig (119875 lt 05) These results predicted thatPDGFR120572 could also be used as a marker of neonatal porcineSLCs and the 7-day-old sampling point was more suitable forisolating SLCs than the 2 months old in pigs
However no studies had reported the isolation of porcineSLCs In the rat Percoll purification and immunoselectiontechnologies were used to obtain SLCs by Ge et al (2006) [4]
6 Stem Cells International
1w 2w0 d
(a)
PDGFR120572 DAPI Merge
(b)
Figure 3 Morphology development and PDGFR120572 immunofluorescence analysis of porcine SLCs cultured in pTF medium (bar = 50120583m)(a) Morphology development of porcine SLCs cultured 0 d 1 w and 2w in pTF medium (b) PDGFR120572 immunofluorescence of porcine SLCscultured in pTF medium for 2w
1w 2w0 d
(a)
CYP17A1 DAPI Merge
(b)
Figure 4 Morphology development and CYP17A1 immunofluorescence of porcine SLCs cultured in basic medium (a) Morphologydevelopment of porcine SLCs cultured 0 d 1 w and 2w in basic medium (b) CYP17A1 immunofluorescence of porcine SLCs cultured inbasic medium for 2w
and several studies had used transgenic mice to obtainmouse SLCs [8 9] In the current study collagenase andhyaluronidase digestion was used to isolate pig testicularinterstitial cells from pig testes Moreover hyaluronidasecould isolate individual cells from the outer surface of
seminiferous tubules Thus the method used in the currentstudy was simpler and faster than the methods used in miceand rats
Like other stem cells the proliferation and differentiationof SLCs were also regulated by the microenvironment which
Stem Cells International 7
C
B
A
mRN
A le
vel o
f Nes
tin (r
elat
ive t
o be
ta-a
ctin
)
Prim
ary
cells
Basic
med
ium
pTF
med
ium
00
05
10
15
20
25
30Nestin
(a)
CB
A
mRN
A le
vel o
f LIF
R (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
1
2
3
4
5
6
7
8
9
10LIFR
(b)
B B
A
mRN
A le
vel o
f CYP
17A
1 (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
5
10
15
20
25
30
35CYP17A1
(c)
Figure 5 Expressions of Nestin LIFR and CYP17A1 of porcine SLCs cultured in different media for 2w Note primary cells the primaryisolated porcine SLCs Different letters (A B C) indicate significant difference (119875 lt 005)
provided vital cell factors and proteins In the testes sometypes of cells such as Sertoli cells and peritubular myoidcells secreted factors into the testicular fluid to regulate theactivities of SLCs [33ndash35] Since the culture system of porcineSLCs had not been developed all factors from whole testeswere extracted as pTF At first we conjectured that the pTFcould maintain the stem cell potential of porcine SLCs whenadded to the culturemediumThe results of this work showedthat the pTF could indeed support the stem cell potentialof SLCs for 2 weeks in vitro The pTF was able to maintainthe self-renewal properties of SLCs as the origin of pTFwas consistent with the putative SLCs Moreover the pTFcontained abundant hormones growth factors cytokinesand a large amount of proteins which could provide the
necessary material basis for SLCs proliferation [22 36] Theimmunofluorescent analysis of PDGFR120572 also demonstratedthat the cells that had been cultured for 2 weeks were putativeSLCs Taken together the results indicated that the pTFmightbe contributing to maintaining self-renewal properties of theputative SLCs Therefore our future research will be directedtowards revealing the vital components for maintaining SLCsself-renewal in pTF
There were two areas of innovation of the present studyFirst it provided a simpler and faster method for obtainingthe porcine SLCs which might provide a reservoir for LCs-lineage differentiation Second it developed a new short-term culture system for porcine SLCs In addition as an idealhuman model some human drugs toxicity investigations of
8 Stem Cells International
Figure 6Oil RedO staining of pig LCs after cultured 7 d in the basicmedium (bar = 50 120583m)
sterile diseases could be assessed in the pig firstly beforehuman trials which could reduce the expense of investiga-tions into new drugs
5 Conclusions
To summarize we isolated porcine SLCs and identifiedsome of their basic characteristics Moreover pTF couldmaintain the features of porcine SLCs when added to culturesystemThis workmight help us to understand the regulatorymechanisms of proliferation and differentiation of SLCs andholds promise for further studies pertaining to porcine SLCs
Disclosure
The current address of Chuanying Pan is College of AnimalScience and Technology Northwest AampF University No 22Xinong Road Yangling Shaanxi 712100 China
Competing Interests
The authors declare that there are no competing interestsregarding the publication of this paper
Acknowledgments
This work was supported by China Postdoctoral ScienceFoundation funded project (no 2014M560809) the Fun-damental Research Funds for the Central Universities(NWSUAF no 2452015145) and the National Basic ResearchProgram of China (973 program no 2014CB943100) Specialthanks are due to Professor Yuan-Qiang Zhang (The FourthMilitary Medical University China) for his generous dona-tion of EDS
References
[1] A S Midzak H Chen V Papadopoulos and B R ZirkinldquoLeydig cell aging and the mechanisms of reduced testosteronesynthesisrdquoMolecular and Cellular Endocrinology vol 299 no 1pp 23ndash31 2009
[2] Y Yang Z Su W Xu et al ldquoDirected mouse embryonic stemcells into leydig-like cells rescue testosterone-deficientmale ratsin vivordquo StemCells andDevelopment vol 24 no 4 pp 459ndash4702015
[3] H Chen R-S Ge and B R Zirkin ldquoLeydig cells from stemcells to agingrdquo Molecular and Cellular Endocrinology vol 306no 1-2 pp 9ndash16 2009
[4] R-S Ge Q Dong C M Sottas V Papadopoulos B R Zirkinand M P Hardy ldquoIn search of rat stem Leydig cells identifica-tion isolation and lineage-specific developmentrdquo Proceedingsof the National Academy of Sciences of the United States ofAmerica vol 103 no 8 pp 2719ndash2724 2006
[5] M S Davidoff R Middendorff G Enikolopov D Rieth-macher A F Holstein and D Muller ldquoProgenitor cells of thetestosterone-producing Leydig cells revealedrdquo Journal of CellBiology vol 167 no 5 pp 935ndash944 2004
[6] M S Davidoff R Middendorff D Muller and A F HolsteinldquoThe neuroendocrine Leydig cells and their stem cell progeni-tors the pericytesrdquo Advances in Anatomy Embryology and CellBiology vol 205 pp 1ndash107 2009
[7] L Landreh K Spinnler K Schubert et al ldquoHuman tes-ticular peritubular cells host putative stem leydig cells withsteroidogenic capacityrdquo The Journal of Clinical Endocrinologyand Metabolism vol 99 no 7 pp E1227ndashE1235 2014
[8] M H Jiang B Cai Y Tuo et al ldquoCharacterization of Nestin-positive stem Leydig cells as a potential source for the treatmentof testicular Leydig cell dysfunctionrdquo Cell Research vol 24 no12 pp 1466ndash1485 2014
[9] K C Lo Z Lei C Venkateswara Rao J Beck and D J LambldquoDe novo testosterone production in luteinizing hormonereceptor knockout mice after transplantation of Leydig stemcellsrdquo Endocrinology vol 145 no 9 pp 4011ndash4015 2004
[10] E Stanley C-Y Lin S Jin et al ldquoIdentification proliferationand differentiation of adult leydig stem cellsrdquo Endocrinologyvol 153 no 10 pp 5002ndash5010 2012
[11] X Li Z Wang Z Jiang et al ldquoRegulation of seminiferoustubule-associated stem Leydig cells in adult rat testesrdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 113 no 10 pp 2666ndash2671 2016
[12] L Luo H Chen and B R Zirkin ldquoTemporal relationshipsamong testosterone production steroidogenic acute regulatoryprotein (StAR) and P450 side-chain cleavage enzyme (P450scc)during Leydig cell agingrdquo Journal of Andrology vol 26 no 1 pp25ndash31 2005
[13] A V Pechersky V F Semiglazov G B Loran A I Karpis-chenko V I Pechersky and V I Mazurov ldquoThe influence ofpartial androgen deficiency of aging men (PADAM) on theimpulse regime of incretion of several hormones and mitoticactivityrdquo Tsitologiya vol 48 no 10 pp 862ndash866 2006
[14] M Amore F Scarlatti A L Quarta and P Tagariello ldquoPartialandrogen deficiency depression and testosterone treatment inaging menrdquo Aging Clinical and Experimental Research vol 21no 1 pp 1ndash8 2009
[15] A Pechersky ldquoFeatures of diagnostics and treatment of partialandrogen deficiency of aging menrdquo Central European Journal ofUrology vol 67 no 4 pp 397ndash404 2014
[16] Y Nian M Ding S Hu et al ldquoTestosterone replacementtherapy improves health-related quality of life for patientswith late-onset hypogonadism a meta-analysis of randomizedcontrolled trialsrdquo Andrologia 2016
Stem Cells International 9
[17] Y Zhang R Ge and M P Hardy ldquoAndrogen-forming stemLeydig cells identification function and therapeutic potentialrdquoDisease Markers vol 24 no 4-5 pp 277ndash286 2008
[18] S Bergfelder-Druing C Grosse-Brinkhaus B Lind et al ldquoAgenome-wide association study in large white and landrace pigpopulations for number piglets born aliverdquo PLoS ONE vol 10no 3 Article ID e0117468 2015
[19] Z Jiang and M F Rothschild ldquoSwine genome science comes ofagerdquo International Journal of Biological Sciences vol 3 no 3 pp129ndash131 2007
[20] J I Raeside H L Christie R L Renaud and P A Sinclair ldquoTheboar testis the most versatile steroid producing organ knownrdquoSociety of Reproduction and Fertility Supplement vol 62 pp 85ndash97 2006
[21] Y Nakajima G Sato S Ohno and S Nakajin ldquoOrganotincompounds suppress testosterone production in Leydig cellsfrom neonatal pig testesrdquo Journal of Health Science vol 49 no6 pp 514ndash519 2003
[22] P Wang Y Zheng Y Li et al ldquoEffects of testicular interstitialfluid on the proliferation of the mouse spermatogonial stemcells in vitrordquo Zygote vol 22 no 3 pp 395ndash403 2014
[23] E-H Lee J-H Oh Y-S Lee et al ldquoGene expression analysisof toxicological pathways in TM3 leydig cell lines treatedwith Ethane dimethanesulfonaterdquo Journal of Biochemical andMolecular Toxicology vol 26 no 6 pp 213ndash223 2012
[24] T Li J Hu G-H He et al ldquoUp-regulation of NDRG2 throughnuclear factor-kappa B is required for Leydig cell apoptosisin both human and murine infertile testesrdquo Biochimica etBiophysica ActamdashMolecular Basis of Disease vol 1822 no 2 pp301ndash313 2012
[25] A JMorrisM F Taylor and I DMorris ldquoLeydig cell apoptosisin response to ethane dimethanesulphonate after both in vivoand in vitro treatmentrdquo Journal of Andrology vol 18 no 3 pp274ndash280 1997
[26] B Heidari M Rahmati-Ahmadabadi M M Akhondi et alldquoIsolation identification and culture of goat spermatogonialstem cells using c-kit and PGP95 markersrdquo Journal of AssistedReproduction and Genetics vol 29 no 10 pp 1029ndash1038 2012
[27] J-P Qi Y-L Yang H Zhu et al ldquoExpression of the androgenreceptor and its correlationwithmolecular subtypes in 980Chi-nese breast cancer patientsrdquo Breast Cancer Basic and ClinicalResearch vol 6 pp 1ndash8 2012
[28] Y Zheng YHe J An et al ldquoTHY1 is a surfacemarker of porcinegonocytesrdquoReproduction Fertility andDevelopment vol 26 no4 pp 533ndash539 2014
[29] K J Livak and T D Schmittgen ldquoAnalysis of relative geneexpression data using real-time quantitative PCR and the2(T)(minusDelta Delta C) methodrdquoMethods vol 25 no 4 pp 402ndash408 2001
[30] L B Smith andW H Walker ldquoThe regulation of spermatogen-esis by androgensrdquo Seminars in Cell and Developmental Biologyvol 30 pp 2ndash13 2014
[31] H Chen S Jin S Huang et al ldquoTransplantation of alginate-encapsulated seminiferous tubules and interstitial tissue intoadult rats leydig stem cell differentiation in vivordquo Molecularand Cellular Endocrinology vol 436 pp 250ndash258 2016
[32] H Chen Y Wang R Ge and B R Zirkin ldquoLeydig cell stemcells identification proliferation and differentiationrdquoMolecularand Cellular Endocrinology 2016
[33] R M Sharpe ldquoMonitoring of spermatogenesis in man-measurement of Sertoli cell- or germ cell-secreted proteins in
semen or bloodrdquo International Journal of Andrology vol 15 no3 pp 201ndash210 1992
[34] K J Turner C McKinnell T T McLaren et al ldquoDetectionof germ cell-derived proteins in testicular interstitial fluidpotential for monitoring spermatogenesis in vivordquo Journal ofAndrology vol 17 no 2 pp 127ndash136 1996
[35] L R Franca R A Hess J M Dufour M C Hofmann and MD Griswold ldquoThe Sertoli cell one hundred fifty years of beautyand plasticityrdquo Andrology vol 4 no 2 pp 189ndash212 2016
[36] P G Stanton C F Foo A Rainczuk et al ldquoMapping the testicu-lar interstitial fluid proteome fromnormal ratsrdquoPROTEOMICSvol 16 no 17 pp 2391ndash2402 2016
Submit your manuscripts athttpswwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
4 Stem Cells International
2m
7 d
(a)
PDGFR120572 Control
ControlPDGFR120572
2m
7 d
(b)
B
A
Relat
ive m
RNA
expr
essio
n of
Nes
tin
Different period of pig testis2m7 d
00
05
10
15
20
25
30
(c)
Figure 1 Identification of pig stem Leydig cells (SLCs) in situ (a) HampE staining of 7 daysrsquo and 2 monthsrsquo old porcine testes (bar = 50 120583m)(b) Immunohistochemical analysis of PDGFR120572 of 7 daysrsquo and 2 monthsrsquo old porcine testes (bar = 50 120583m) the black arrowheads indicated thePDGFR120572-positive cells in testicular interstitium (c) mRNA expression of Nestin in 7 daysrsquo and 2 monthsrsquo old pig testes Different letters (AB) indicate significant difference (119875 lt 005)
immunofluorescent analysis of CYP17A1 further confirmedthat EDS could specifically eliminate differentiated LCs in thepig (Figures S3 S4) which was consistent with the results ofcell survival rates after EDS treatment (Figure S2)
33 These Isolated SLCs Exhibited High Clonogenic PotentialEven though the primary SLCs were isolated their culturesystem was yet to be determined In the current study pTFwas used as the main component in the medium Seven dayslater a number of clones were formed which grew largerfollowing 2 weeks of culture (Figure 3(a)) Immunofluores-cent analysis showed that the clones were PDGFR120572 positive(Figure 3(b)) The expressions of both Nestin and LIFR werehigher in porcine SLCs cultured with pTFmedium comparedto in SLCs without culture (119875 lt 05) (Figure 5) indicatingthat pTF was able to sustain the stem cell potential of SLCs
34 Isolated SLCs Showed the Capacity of Spontaneous Differ-entiation into LCs When Cultured In Vitro The isolated cellscultured with a basic medium did not form clones after 2weeks (Figure 4(a)) and expressed CYP17A1 a marker of pig
differentiated LCs (Figure 4(b)) Moreover the expressions ofbothNestin andLIFRwere significantly lower in porcine SLCscultured with the basic medium for 2 weeks compared to inSLCs without culture (119875 lt 05) (Figure 5) The expression ofCYP17A1 was significantly higher in porcine SLCs culturedwith the basic medium for 2 weeks than that of SLCs withoutculture (119875 lt 05) (Figure 5) Oil Red O staining showedthat the cultured cells secreted lipid droplets which wasalso a marker of differentiated LCs (Figure 6) These resultsdemonstrated that the primary isolated SLCs were able todifferentiate into LC lineages when cultured with the basicmedium indicating that the putative SLCs had capacity tospontaneously differentiate into LCs
4 Discussion
Several cell types were essential for spermatogenesis in thetestis germ cells Sertoli cells peritubular myoid cells andALCs [30] ALCs were the major source of testosteronesecretion in mammals however they were incapable ofproliferation Testosterone could diffuse into Sertoli cellsso that it indirectly regulated spermatogenesis When the
Stem Cells International 5
(a)
SLCsNestin
Oct4
LIFR
PLZF
SOX9
120573-Actin
PDGFR120572
+ minus
(b)
CC
A
LIFR
mRN
A le
vel (
relat
ive t
o be
ta-a
ctin
)
B
0
2
4
6
8
10
Sert
oli c
ells
Sper
mat
ogon
ia
SLCs
Testi
s
Different types of testicular cells
(c)
DC
B
mRN
A le
vel (
relat
ive t
o be
ta-a
ctin
)
A
Sper
mat
ogon
ia
SLCs
Sert
oli c
ells
Testi
s
PDGFR120572
0
20
40
(d)
Figure 2 Identification of porcine SLCs (a) The primary SLCs isolated from 7-day-old porcine testes with the help of collagenase type IV(bar = 50 120583m) (b) RT-PCR results of genes involved in stem cells potential and spermatogenesis SLCs the pig primary isolated SLCs +positive control (7-day-old pig testes) minus negative control (sterile water) (c and d) Expressions of LIFR and PDGFR120572 in pig testes pig Sertolicells pig Spermatogonia stem cells and pig primary isolated SLCs as fold change relative to beta-actin Spermatogonia Spermatogonia stemcells Different letters (A B) indicate significant difference (119875 lt 005)
processes of synthesizing testosterone were disturbed post-meiotic spermatids were significantly reduced or absent [30]SLCs were therefore ideal for rescuing infertility caused byLCs dysfunction In addition it had been demonstratedthat SLCs were able to differentiate into ALCs in vivo bytransplanting the alginate-encapsulated interstitial tissue intorat extra-testis tissue [31] Therefore mammalian SLCs heldgreat promise for research and clinical use in male infertility
Recently SLCs had been successfully isolated from ratsmice and humans but not from pigs Previous studieshad shown that several proteins were detected in putativeSLCs in the rat testicular interstitium such as Nestin LIFRPDGFR120572 CD90 and CD51 [11 32] However a majorityof these were also expressed in other testicular cells andthey made useful markers of SLCs as they were expressedin a time andor stage-specific manner For example Ge
and his colleagues demonstrated that the PDGFR120572-positiveand 3120573-HSD-negative cells in postnatal 7-day-old rats wereputative SLCs [4] They then concluded that PDGFR120572 wasa marker of rat SLCs in the neonatal stage In this studySLCswere identified andPDGFR120572was shown to be expressedin the SLCs using HampE staining and immunochemistryMoreover results from immunochemistry and qRT-PCRanalysis showed that the expressions of both PDGFR120572 andNestin were significantly higher in postnatal 7 daysrsquo than2 monthsrsquo old pig (119875 lt 05) These results predicted thatPDGFR120572 could also be used as a marker of neonatal porcineSLCs and the 7-day-old sampling point was more suitable forisolating SLCs than the 2 months old in pigs
However no studies had reported the isolation of porcineSLCs In the rat Percoll purification and immunoselectiontechnologies were used to obtain SLCs by Ge et al (2006) [4]
6 Stem Cells International
1w 2w0 d
(a)
PDGFR120572 DAPI Merge
(b)
Figure 3 Morphology development and PDGFR120572 immunofluorescence analysis of porcine SLCs cultured in pTF medium (bar = 50120583m)(a) Morphology development of porcine SLCs cultured 0 d 1 w and 2w in pTF medium (b) PDGFR120572 immunofluorescence of porcine SLCscultured in pTF medium for 2w
1w 2w0 d
(a)
CYP17A1 DAPI Merge
(b)
Figure 4 Morphology development and CYP17A1 immunofluorescence of porcine SLCs cultured in basic medium (a) Morphologydevelopment of porcine SLCs cultured 0 d 1 w and 2w in basic medium (b) CYP17A1 immunofluorescence of porcine SLCs cultured inbasic medium for 2w
and several studies had used transgenic mice to obtainmouse SLCs [8 9] In the current study collagenase andhyaluronidase digestion was used to isolate pig testicularinterstitial cells from pig testes Moreover hyaluronidasecould isolate individual cells from the outer surface of
seminiferous tubules Thus the method used in the currentstudy was simpler and faster than the methods used in miceand rats
Like other stem cells the proliferation and differentiationof SLCs were also regulated by the microenvironment which
Stem Cells International 7
C
B
A
mRN
A le
vel o
f Nes
tin (r
elat
ive t
o be
ta-a
ctin
)
Prim
ary
cells
Basic
med
ium
pTF
med
ium
00
05
10
15
20
25
30Nestin
(a)
CB
A
mRN
A le
vel o
f LIF
R (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
1
2
3
4
5
6
7
8
9
10LIFR
(b)
B B
A
mRN
A le
vel o
f CYP
17A
1 (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
5
10
15
20
25
30
35CYP17A1
(c)
Figure 5 Expressions of Nestin LIFR and CYP17A1 of porcine SLCs cultured in different media for 2w Note primary cells the primaryisolated porcine SLCs Different letters (A B C) indicate significant difference (119875 lt 005)
provided vital cell factors and proteins In the testes sometypes of cells such as Sertoli cells and peritubular myoidcells secreted factors into the testicular fluid to regulate theactivities of SLCs [33ndash35] Since the culture system of porcineSLCs had not been developed all factors from whole testeswere extracted as pTF At first we conjectured that the pTFcould maintain the stem cell potential of porcine SLCs whenadded to the culturemediumThe results of this work showedthat the pTF could indeed support the stem cell potentialof SLCs for 2 weeks in vitro The pTF was able to maintainthe self-renewal properties of SLCs as the origin of pTFwas consistent with the putative SLCs Moreover the pTFcontained abundant hormones growth factors cytokinesand a large amount of proteins which could provide the
necessary material basis for SLCs proliferation [22 36] Theimmunofluorescent analysis of PDGFR120572 also demonstratedthat the cells that had been cultured for 2 weeks were putativeSLCs Taken together the results indicated that the pTFmightbe contributing to maintaining self-renewal properties of theputative SLCs Therefore our future research will be directedtowards revealing the vital components for maintaining SLCsself-renewal in pTF
There were two areas of innovation of the present studyFirst it provided a simpler and faster method for obtainingthe porcine SLCs which might provide a reservoir for LCs-lineage differentiation Second it developed a new short-term culture system for porcine SLCs In addition as an idealhuman model some human drugs toxicity investigations of
8 Stem Cells International
Figure 6Oil RedO staining of pig LCs after cultured 7 d in the basicmedium (bar = 50 120583m)
sterile diseases could be assessed in the pig firstly beforehuman trials which could reduce the expense of investiga-tions into new drugs
5 Conclusions
To summarize we isolated porcine SLCs and identifiedsome of their basic characteristics Moreover pTF couldmaintain the features of porcine SLCs when added to culturesystemThis workmight help us to understand the regulatorymechanisms of proliferation and differentiation of SLCs andholds promise for further studies pertaining to porcine SLCs
Disclosure
The current address of Chuanying Pan is College of AnimalScience and Technology Northwest AampF University No 22Xinong Road Yangling Shaanxi 712100 China
Competing Interests
The authors declare that there are no competing interestsregarding the publication of this paper
Acknowledgments
This work was supported by China Postdoctoral ScienceFoundation funded project (no 2014M560809) the Fun-damental Research Funds for the Central Universities(NWSUAF no 2452015145) and the National Basic ResearchProgram of China (973 program no 2014CB943100) Specialthanks are due to Professor Yuan-Qiang Zhang (The FourthMilitary Medical University China) for his generous dona-tion of EDS
References
[1] A S Midzak H Chen V Papadopoulos and B R ZirkinldquoLeydig cell aging and the mechanisms of reduced testosteronesynthesisrdquoMolecular and Cellular Endocrinology vol 299 no 1pp 23ndash31 2009
[2] Y Yang Z Su W Xu et al ldquoDirected mouse embryonic stemcells into leydig-like cells rescue testosterone-deficientmale ratsin vivordquo StemCells andDevelopment vol 24 no 4 pp 459ndash4702015
[3] H Chen R-S Ge and B R Zirkin ldquoLeydig cells from stemcells to agingrdquo Molecular and Cellular Endocrinology vol 306no 1-2 pp 9ndash16 2009
[4] R-S Ge Q Dong C M Sottas V Papadopoulos B R Zirkinand M P Hardy ldquoIn search of rat stem Leydig cells identifica-tion isolation and lineage-specific developmentrdquo Proceedingsof the National Academy of Sciences of the United States ofAmerica vol 103 no 8 pp 2719ndash2724 2006
[5] M S Davidoff R Middendorff G Enikolopov D Rieth-macher A F Holstein and D Muller ldquoProgenitor cells of thetestosterone-producing Leydig cells revealedrdquo Journal of CellBiology vol 167 no 5 pp 935ndash944 2004
[6] M S Davidoff R Middendorff D Muller and A F HolsteinldquoThe neuroendocrine Leydig cells and their stem cell progeni-tors the pericytesrdquo Advances in Anatomy Embryology and CellBiology vol 205 pp 1ndash107 2009
[7] L Landreh K Spinnler K Schubert et al ldquoHuman tes-ticular peritubular cells host putative stem leydig cells withsteroidogenic capacityrdquo The Journal of Clinical Endocrinologyand Metabolism vol 99 no 7 pp E1227ndashE1235 2014
[8] M H Jiang B Cai Y Tuo et al ldquoCharacterization of Nestin-positive stem Leydig cells as a potential source for the treatmentof testicular Leydig cell dysfunctionrdquo Cell Research vol 24 no12 pp 1466ndash1485 2014
[9] K C Lo Z Lei C Venkateswara Rao J Beck and D J LambldquoDe novo testosterone production in luteinizing hormonereceptor knockout mice after transplantation of Leydig stemcellsrdquo Endocrinology vol 145 no 9 pp 4011ndash4015 2004
[10] E Stanley C-Y Lin S Jin et al ldquoIdentification proliferationand differentiation of adult leydig stem cellsrdquo Endocrinologyvol 153 no 10 pp 5002ndash5010 2012
[11] X Li Z Wang Z Jiang et al ldquoRegulation of seminiferoustubule-associated stem Leydig cells in adult rat testesrdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 113 no 10 pp 2666ndash2671 2016
[12] L Luo H Chen and B R Zirkin ldquoTemporal relationshipsamong testosterone production steroidogenic acute regulatoryprotein (StAR) and P450 side-chain cleavage enzyme (P450scc)during Leydig cell agingrdquo Journal of Andrology vol 26 no 1 pp25ndash31 2005
[13] A V Pechersky V F Semiglazov G B Loran A I Karpis-chenko V I Pechersky and V I Mazurov ldquoThe influence ofpartial androgen deficiency of aging men (PADAM) on theimpulse regime of incretion of several hormones and mitoticactivityrdquo Tsitologiya vol 48 no 10 pp 862ndash866 2006
[14] M Amore F Scarlatti A L Quarta and P Tagariello ldquoPartialandrogen deficiency depression and testosterone treatment inaging menrdquo Aging Clinical and Experimental Research vol 21no 1 pp 1ndash8 2009
[15] A Pechersky ldquoFeatures of diagnostics and treatment of partialandrogen deficiency of aging menrdquo Central European Journal ofUrology vol 67 no 4 pp 397ndash404 2014
[16] Y Nian M Ding S Hu et al ldquoTestosterone replacementtherapy improves health-related quality of life for patientswith late-onset hypogonadism a meta-analysis of randomizedcontrolled trialsrdquo Andrologia 2016
Stem Cells International 9
[17] Y Zhang R Ge and M P Hardy ldquoAndrogen-forming stemLeydig cells identification function and therapeutic potentialrdquoDisease Markers vol 24 no 4-5 pp 277ndash286 2008
[18] S Bergfelder-Druing C Grosse-Brinkhaus B Lind et al ldquoAgenome-wide association study in large white and landrace pigpopulations for number piglets born aliverdquo PLoS ONE vol 10no 3 Article ID e0117468 2015
[19] Z Jiang and M F Rothschild ldquoSwine genome science comes ofagerdquo International Journal of Biological Sciences vol 3 no 3 pp129ndash131 2007
[20] J I Raeside H L Christie R L Renaud and P A Sinclair ldquoTheboar testis the most versatile steroid producing organ knownrdquoSociety of Reproduction and Fertility Supplement vol 62 pp 85ndash97 2006
[21] Y Nakajima G Sato S Ohno and S Nakajin ldquoOrganotincompounds suppress testosterone production in Leydig cellsfrom neonatal pig testesrdquo Journal of Health Science vol 49 no6 pp 514ndash519 2003
[22] P Wang Y Zheng Y Li et al ldquoEffects of testicular interstitialfluid on the proliferation of the mouse spermatogonial stemcells in vitrordquo Zygote vol 22 no 3 pp 395ndash403 2014
[23] E-H Lee J-H Oh Y-S Lee et al ldquoGene expression analysisof toxicological pathways in TM3 leydig cell lines treatedwith Ethane dimethanesulfonaterdquo Journal of Biochemical andMolecular Toxicology vol 26 no 6 pp 213ndash223 2012
[24] T Li J Hu G-H He et al ldquoUp-regulation of NDRG2 throughnuclear factor-kappa B is required for Leydig cell apoptosisin both human and murine infertile testesrdquo Biochimica etBiophysica ActamdashMolecular Basis of Disease vol 1822 no 2 pp301ndash313 2012
[25] A JMorrisM F Taylor and I DMorris ldquoLeydig cell apoptosisin response to ethane dimethanesulphonate after both in vivoand in vitro treatmentrdquo Journal of Andrology vol 18 no 3 pp274ndash280 1997
[26] B Heidari M Rahmati-Ahmadabadi M M Akhondi et alldquoIsolation identification and culture of goat spermatogonialstem cells using c-kit and PGP95 markersrdquo Journal of AssistedReproduction and Genetics vol 29 no 10 pp 1029ndash1038 2012
[27] J-P Qi Y-L Yang H Zhu et al ldquoExpression of the androgenreceptor and its correlationwithmolecular subtypes in 980Chi-nese breast cancer patientsrdquo Breast Cancer Basic and ClinicalResearch vol 6 pp 1ndash8 2012
[28] Y Zheng YHe J An et al ldquoTHY1 is a surfacemarker of porcinegonocytesrdquoReproduction Fertility andDevelopment vol 26 no4 pp 533ndash539 2014
[29] K J Livak and T D Schmittgen ldquoAnalysis of relative geneexpression data using real-time quantitative PCR and the2(T)(minusDelta Delta C) methodrdquoMethods vol 25 no 4 pp 402ndash408 2001
[30] L B Smith andW H Walker ldquoThe regulation of spermatogen-esis by androgensrdquo Seminars in Cell and Developmental Biologyvol 30 pp 2ndash13 2014
[31] H Chen S Jin S Huang et al ldquoTransplantation of alginate-encapsulated seminiferous tubules and interstitial tissue intoadult rats leydig stem cell differentiation in vivordquo Molecularand Cellular Endocrinology vol 436 pp 250ndash258 2016
[32] H Chen Y Wang R Ge and B R Zirkin ldquoLeydig cell stemcells identification proliferation and differentiationrdquoMolecularand Cellular Endocrinology 2016
[33] R M Sharpe ldquoMonitoring of spermatogenesis in man-measurement of Sertoli cell- or germ cell-secreted proteins in
semen or bloodrdquo International Journal of Andrology vol 15 no3 pp 201ndash210 1992
[34] K J Turner C McKinnell T T McLaren et al ldquoDetectionof germ cell-derived proteins in testicular interstitial fluidpotential for monitoring spermatogenesis in vivordquo Journal ofAndrology vol 17 no 2 pp 127ndash136 1996
[35] L R Franca R A Hess J M Dufour M C Hofmann and MD Griswold ldquoThe Sertoli cell one hundred fifty years of beautyand plasticityrdquo Andrology vol 4 no 2 pp 189ndash212 2016
[36] P G Stanton C F Foo A Rainczuk et al ldquoMapping the testicu-lar interstitial fluid proteome fromnormal ratsrdquoPROTEOMICSvol 16 no 17 pp 2391ndash2402 2016
Submit your manuscripts athttpswwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
Stem Cells International 5
(a)
SLCsNestin
Oct4
LIFR
PLZF
SOX9
120573-Actin
PDGFR120572
+ minus
(b)
CC
A
LIFR
mRN
A le
vel (
relat
ive t
o be
ta-a
ctin
)
B
0
2
4
6
8
10
Sert
oli c
ells
Sper
mat
ogon
ia
SLCs
Testi
s
Different types of testicular cells
(c)
DC
B
mRN
A le
vel (
relat
ive t
o be
ta-a
ctin
)
A
Sper
mat
ogon
ia
SLCs
Sert
oli c
ells
Testi
s
PDGFR120572
0
20
40
(d)
Figure 2 Identification of porcine SLCs (a) The primary SLCs isolated from 7-day-old porcine testes with the help of collagenase type IV(bar = 50 120583m) (b) RT-PCR results of genes involved in stem cells potential and spermatogenesis SLCs the pig primary isolated SLCs +positive control (7-day-old pig testes) minus negative control (sterile water) (c and d) Expressions of LIFR and PDGFR120572 in pig testes pig Sertolicells pig Spermatogonia stem cells and pig primary isolated SLCs as fold change relative to beta-actin Spermatogonia Spermatogonia stemcells Different letters (A B) indicate significant difference (119875 lt 005)
processes of synthesizing testosterone were disturbed post-meiotic spermatids were significantly reduced or absent [30]SLCs were therefore ideal for rescuing infertility caused byLCs dysfunction In addition it had been demonstratedthat SLCs were able to differentiate into ALCs in vivo bytransplanting the alginate-encapsulated interstitial tissue intorat extra-testis tissue [31] Therefore mammalian SLCs heldgreat promise for research and clinical use in male infertility
Recently SLCs had been successfully isolated from ratsmice and humans but not from pigs Previous studieshad shown that several proteins were detected in putativeSLCs in the rat testicular interstitium such as Nestin LIFRPDGFR120572 CD90 and CD51 [11 32] However a majorityof these were also expressed in other testicular cells andthey made useful markers of SLCs as they were expressedin a time andor stage-specific manner For example Ge
and his colleagues demonstrated that the PDGFR120572-positiveand 3120573-HSD-negative cells in postnatal 7-day-old rats wereputative SLCs [4] They then concluded that PDGFR120572 wasa marker of rat SLCs in the neonatal stage In this studySLCswere identified andPDGFR120572was shown to be expressedin the SLCs using HampE staining and immunochemistryMoreover results from immunochemistry and qRT-PCRanalysis showed that the expressions of both PDGFR120572 andNestin were significantly higher in postnatal 7 daysrsquo than2 monthsrsquo old pig (119875 lt 05) These results predicted thatPDGFR120572 could also be used as a marker of neonatal porcineSLCs and the 7-day-old sampling point was more suitable forisolating SLCs than the 2 months old in pigs
However no studies had reported the isolation of porcineSLCs In the rat Percoll purification and immunoselectiontechnologies were used to obtain SLCs by Ge et al (2006) [4]
6 Stem Cells International
1w 2w0 d
(a)
PDGFR120572 DAPI Merge
(b)
Figure 3 Morphology development and PDGFR120572 immunofluorescence analysis of porcine SLCs cultured in pTF medium (bar = 50120583m)(a) Morphology development of porcine SLCs cultured 0 d 1 w and 2w in pTF medium (b) PDGFR120572 immunofluorescence of porcine SLCscultured in pTF medium for 2w
1w 2w0 d
(a)
CYP17A1 DAPI Merge
(b)
Figure 4 Morphology development and CYP17A1 immunofluorescence of porcine SLCs cultured in basic medium (a) Morphologydevelopment of porcine SLCs cultured 0 d 1 w and 2w in basic medium (b) CYP17A1 immunofluorescence of porcine SLCs cultured inbasic medium for 2w
and several studies had used transgenic mice to obtainmouse SLCs [8 9] In the current study collagenase andhyaluronidase digestion was used to isolate pig testicularinterstitial cells from pig testes Moreover hyaluronidasecould isolate individual cells from the outer surface of
seminiferous tubules Thus the method used in the currentstudy was simpler and faster than the methods used in miceand rats
Like other stem cells the proliferation and differentiationof SLCs were also regulated by the microenvironment which
Stem Cells International 7
C
B
A
mRN
A le
vel o
f Nes
tin (r
elat
ive t
o be
ta-a
ctin
)
Prim
ary
cells
Basic
med
ium
pTF
med
ium
00
05
10
15
20
25
30Nestin
(a)
CB
A
mRN
A le
vel o
f LIF
R (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
1
2
3
4
5
6
7
8
9
10LIFR
(b)
B B
A
mRN
A le
vel o
f CYP
17A
1 (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
5
10
15
20
25
30
35CYP17A1
(c)
Figure 5 Expressions of Nestin LIFR and CYP17A1 of porcine SLCs cultured in different media for 2w Note primary cells the primaryisolated porcine SLCs Different letters (A B C) indicate significant difference (119875 lt 005)
provided vital cell factors and proteins In the testes sometypes of cells such as Sertoli cells and peritubular myoidcells secreted factors into the testicular fluid to regulate theactivities of SLCs [33ndash35] Since the culture system of porcineSLCs had not been developed all factors from whole testeswere extracted as pTF At first we conjectured that the pTFcould maintain the stem cell potential of porcine SLCs whenadded to the culturemediumThe results of this work showedthat the pTF could indeed support the stem cell potentialof SLCs for 2 weeks in vitro The pTF was able to maintainthe self-renewal properties of SLCs as the origin of pTFwas consistent with the putative SLCs Moreover the pTFcontained abundant hormones growth factors cytokinesand a large amount of proteins which could provide the
necessary material basis for SLCs proliferation [22 36] Theimmunofluorescent analysis of PDGFR120572 also demonstratedthat the cells that had been cultured for 2 weeks were putativeSLCs Taken together the results indicated that the pTFmightbe contributing to maintaining self-renewal properties of theputative SLCs Therefore our future research will be directedtowards revealing the vital components for maintaining SLCsself-renewal in pTF
There were two areas of innovation of the present studyFirst it provided a simpler and faster method for obtainingthe porcine SLCs which might provide a reservoir for LCs-lineage differentiation Second it developed a new short-term culture system for porcine SLCs In addition as an idealhuman model some human drugs toxicity investigations of
8 Stem Cells International
Figure 6Oil RedO staining of pig LCs after cultured 7 d in the basicmedium (bar = 50 120583m)
sterile diseases could be assessed in the pig firstly beforehuman trials which could reduce the expense of investiga-tions into new drugs
5 Conclusions
To summarize we isolated porcine SLCs and identifiedsome of their basic characteristics Moreover pTF couldmaintain the features of porcine SLCs when added to culturesystemThis workmight help us to understand the regulatorymechanisms of proliferation and differentiation of SLCs andholds promise for further studies pertaining to porcine SLCs
Disclosure
The current address of Chuanying Pan is College of AnimalScience and Technology Northwest AampF University No 22Xinong Road Yangling Shaanxi 712100 China
Competing Interests
The authors declare that there are no competing interestsregarding the publication of this paper
Acknowledgments
This work was supported by China Postdoctoral ScienceFoundation funded project (no 2014M560809) the Fun-damental Research Funds for the Central Universities(NWSUAF no 2452015145) and the National Basic ResearchProgram of China (973 program no 2014CB943100) Specialthanks are due to Professor Yuan-Qiang Zhang (The FourthMilitary Medical University China) for his generous dona-tion of EDS
References
[1] A S Midzak H Chen V Papadopoulos and B R ZirkinldquoLeydig cell aging and the mechanisms of reduced testosteronesynthesisrdquoMolecular and Cellular Endocrinology vol 299 no 1pp 23ndash31 2009
[2] Y Yang Z Su W Xu et al ldquoDirected mouse embryonic stemcells into leydig-like cells rescue testosterone-deficientmale ratsin vivordquo StemCells andDevelopment vol 24 no 4 pp 459ndash4702015
[3] H Chen R-S Ge and B R Zirkin ldquoLeydig cells from stemcells to agingrdquo Molecular and Cellular Endocrinology vol 306no 1-2 pp 9ndash16 2009
[4] R-S Ge Q Dong C M Sottas V Papadopoulos B R Zirkinand M P Hardy ldquoIn search of rat stem Leydig cells identifica-tion isolation and lineage-specific developmentrdquo Proceedingsof the National Academy of Sciences of the United States ofAmerica vol 103 no 8 pp 2719ndash2724 2006
[5] M S Davidoff R Middendorff G Enikolopov D Rieth-macher A F Holstein and D Muller ldquoProgenitor cells of thetestosterone-producing Leydig cells revealedrdquo Journal of CellBiology vol 167 no 5 pp 935ndash944 2004
[6] M S Davidoff R Middendorff D Muller and A F HolsteinldquoThe neuroendocrine Leydig cells and their stem cell progeni-tors the pericytesrdquo Advances in Anatomy Embryology and CellBiology vol 205 pp 1ndash107 2009
[7] L Landreh K Spinnler K Schubert et al ldquoHuman tes-ticular peritubular cells host putative stem leydig cells withsteroidogenic capacityrdquo The Journal of Clinical Endocrinologyand Metabolism vol 99 no 7 pp E1227ndashE1235 2014
[8] M H Jiang B Cai Y Tuo et al ldquoCharacterization of Nestin-positive stem Leydig cells as a potential source for the treatmentof testicular Leydig cell dysfunctionrdquo Cell Research vol 24 no12 pp 1466ndash1485 2014
[9] K C Lo Z Lei C Venkateswara Rao J Beck and D J LambldquoDe novo testosterone production in luteinizing hormonereceptor knockout mice after transplantation of Leydig stemcellsrdquo Endocrinology vol 145 no 9 pp 4011ndash4015 2004
[10] E Stanley C-Y Lin S Jin et al ldquoIdentification proliferationand differentiation of adult leydig stem cellsrdquo Endocrinologyvol 153 no 10 pp 5002ndash5010 2012
[11] X Li Z Wang Z Jiang et al ldquoRegulation of seminiferoustubule-associated stem Leydig cells in adult rat testesrdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 113 no 10 pp 2666ndash2671 2016
[12] L Luo H Chen and B R Zirkin ldquoTemporal relationshipsamong testosterone production steroidogenic acute regulatoryprotein (StAR) and P450 side-chain cleavage enzyme (P450scc)during Leydig cell agingrdquo Journal of Andrology vol 26 no 1 pp25ndash31 2005
[13] A V Pechersky V F Semiglazov G B Loran A I Karpis-chenko V I Pechersky and V I Mazurov ldquoThe influence ofpartial androgen deficiency of aging men (PADAM) on theimpulse regime of incretion of several hormones and mitoticactivityrdquo Tsitologiya vol 48 no 10 pp 862ndash866 2006
[14] M Amore F Scarlatti A L Quarta and P Tagariello ldquoPartialandrogen deficiency depression and testosterone treatment inaging menrdquo Aging Clinical and Experimental Research vol 21no 1 pp 1ndash8 2009
[15] A Pechersky ldquoFeatures of diagnostics and treatment of partialandrogen deficiency of aging menrdquo Central European Journal ofUrology vol 67 no 4 pp 397ndash404 2014
[16] Y Nian M Ding S Hu et al ldquoTestosterone replacementtherapy improves health-related quality of life for patientswith late-onset hypogonadism a meta-analysis of randomizedcontrolled trialsrdquo Andrologia 2016
Stem Cells International 9
[17] Y Zhang R Ge and M P Hardy ldquoAndrogen-forming stemLeydig cells identification function and therapeutic potentialrdquoDisease Markers vol 24 no 4-5 pp 277ndash286 2008
[18] S Bergfelder-Druing C Grosse-Brinkhaus B Lind et al ldquoAgenome-wide association study in large white and landrace pigpopulations for number piglets born aliverdquo PLoS ONE vol 10no 3 Article ID e0117468 2015
[19] Z Jiang and M F Rothschild ldquoSwine genome science comes ofagerdquo International Journal of Biological Sciences vol 3 no 3 pp129ndash131 2007
[20] J I Raeside H L Christie R L Renaud and P A Sinclair ldquoTheboar testis the most versatile steroid producing organ knownrdquoSociety of Reproduction and Fertility Supplement vol 62 pp 85ndash97 2006
[21] Y Nakajima G Sato S Ohno and S Nakajin ldquoOrganotincompounds suppress testosterone production in Leydig cellsfrom neonatal pig testesrdquo Journal of Health Science vol 49 no6 pp 514ndash519 2003
[22] P Wang Y Zheng Y Li et al ldquoEffects of testicular interstitialfluid on the proliferation of the mouse spermatogonial stemcells in vitrordquo Zygote vol 22 no 3 pp 395ndash403 2014
[23] E-H Lee J-H Oh Y-S Lee et al ldquoGene expression analysisof toxicological pathways in TM3 leydig cell lines treatedwith Ethane dimethanesulfonaterdquo Journal of Biochemical andMolecular Toxicology vol 26 no 6 pp 213ndash223 2012
[24] T Li J Hu G-H He et al ldquoUp-regulation of NDRG2 throughnuclear factor-kappa B is required for Leydig cell apoptosisin both human and murine infertile testesrdquo Biochimica etBiophysica ActamdashMolecular Basis of Disease vol 1822 no 2 pp301ndash313 2012
[25] A JMorrisM F Taylor and I DMorris ldquoLeydig cell apoptosisin response to ethane dimethanesulphonate after both in vivoand in vitro treatmentrdquo Journal of Andrology vol 18 no 3 pp274ndash280 1997
[26] B Heidari M Rahmati-Ahmadabadi M M Akhondi et alldquoIsolation identification and culture of goat spermatogonialstem cells using c-kit and PGP95 markersrdquo Journal of AssistedReproduction and Genetics vol 29 no 10 pp 1029ndash1038 2012
[27] J-P Qi Y-L Yang H Zhu et al ldquoExpression of the androgenreceptor and its correlationwithmolecular subtypes in 980Chi-nese breast cancer patientsrdquo Breast Cancer Basic and ClinicalResearch vol 6 pp 1ndash8 2012
[28] Y Zheng YHe J An et al ldquoTHY1 is a surfacemarker of porcinegonocytesrdquoReproduction Fertility andDevelopment vol 26 no4 pp 533ndash539 2014
[29] K J Livak and T D Schmittgen ldquoAnalysis of relative geneexpression data using real-time quantitative PCR and the2(T)(minusDelta Delta C) methodrdquoMethods vol 25 no 4 pp 402ndash408 2001
[30] L B Smith andW H Walker ldquoThe regulation of spermatogen-esis by androgensrdquo Seminars in Cell and Developmental Biologyvol 30 pp 2ndash13 2014
[31] H Chen S Jin S Huang et al ldquoTransplantation of alginate-encapsulated seminiferous tubules and interstitial tissue intoadult rats leydig stem cell differentiation in vivordquo Molecularand Cellular Endocrinology vol 436 pp 250ndash258 2016
[32] H Chen Y Wang R Ge and B R Zirkin ldquoLeydig cell stemcells identification proliferation and differentiationrdquoMolecularand Cellular Endocrinology 2016
[33] R M Sharpe ldquoMonitoring of spermatogenesis in man-measurement of Sertoli cell- or germ cell-secreted proteins in
semen or bloodrdquo International Journal of Andrology vol 15 no3 pp 201ndash210 1992
[34] K J Turner C McKinnell T T McLaren et al ldquoDetectionof germ cell-derived proteins in testicular interstitial fluidpotential for monitoring spermatogenesis in vivordquo Journal ofAndrology vol 17 no 2 pp 127ndash136 1996
[35] L R Franca R A Hess J M Dufour M C Hofmann and MD Griswold ldquoThe Sertoli cell one hundred fifty years of beautyand plasticityrdquo Andrology vol 4 no 2 pp 189ndash212 2016
[36] P G Stanton C F Foo A Rainczuk et al ldquoMapping the testicu-lar interstitial fluid proteome fromnormal ratsrdquoPROTEOMICSvol 16 no 17 pp 2391ndash2402 2016
Submit your manuscripts athttpswwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
6 Stem Cells International
1w 2w0 d
(a)
PDGFR120572 DAPI Merge
(b)
Figure 3 Morphology development and PDGFR120572 immunofluorescence analysis of porcine SLCs cultured in pTF medium (bar = 50120583m)(a) Morphology development of porcine SLCs cultured 0 d 1 w and 2w in pTF medium (b) PDGFR120572 immunofluorescence of porcine SLCscultured in pTF medium for 2w
1w 2w0 d
(a)
CYP17A1 DAPI Merge
(b)
Figure 4 Morphology development and CYP17A1 immunofluorescence of porcine SLCs cultured in basic medium (a) Morphologydevelopment of porcine SLCs cultured 0 d 1 w and 2w in basic medium (b) CYP17A1 immunofluorescence of porcine SLCs cultured inbasic medium for 2w
and several studies had used transgenic mice to obtainmouse SLCs [8 9] In the current study collagenase andhyaluronidase digestion was used to isolate pig testicularinterstitial cells from pig testes Moreover hyaluronidasecould isolate individual cells from the outer surface of
seminiferous tubules Thus the method used in the currentstudy was simpler and faster than the methods used in miceand rats
Like other stem cells the proliferation and differentiationof SLCs were also regulated by the microenvironment which
Stem Cells International 7
C
B
A
mRN
A le
vel o
f Nes
tin (r
elat
ive t
o be
ta-a
ctin
)
Prim
ary
cells
Basic
med
ium
pTF
med
ium
00
05
10
15
20
25
30Nestin
(a)
CB
A
mRN
A le
vel o
f LIF
R (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
1
2
3
4
5
6
7
8
9
10LIFR
(b)
B B
A
mRN
A le
vel o
f CYP
17A
1 (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
5
10
15
20
25
30
35CYP17A1
(c)
Figure 5 Expressions of Nestin LIFR and CYP17A1 of porcine SLCs cultured in different media for 2w Note primary cells the primaryisolated porcine SLCs Different letters (A B C) indicate significant difference (119875 lt 005)
provided vital cell factors and proteins In the testes sometypes of cells such as Sertoli cells and peritubular myoidcells secreted factors into the testicular fluid to regulate theactivities of SLCs [33ndash35] Since the culture system of porcineSLCs had not been developed all factors from whole testeswere extracted as pTF At first we conjectured that the pTFcould maintain the stem cell potential of porcine SLCs whenadded to the culturemediumThe results of this work showedthat the pTF could indeed support the stem cell potentialof SLCs for 2 weeks in vitro The pTF was able to maintainthe self-renewal properties of SLCs as the origin of pTFwas consistent with the putative SLCs Moreover the pTFcontained abundant hormones growth factors cytokinesand a large amount of proteins which could provide the
necessary material basis for SLCs proliferation [22 36] Theimmunofluorescent analysis of PDGFR120572 also demonstratedthat the cells that had been cultured for 2 weeks were putativeSLCs Taken together the results indicated that the pTFmightbe contributing to maintaining self-renewal properties of theputative SLCs Therefore our future research will be directedtowards revealing the vital components for maintaining SLCsself-renewal in pTF
There were two areas of innovation of the present studyFirst it provided a simpler and faster method for obtainingthe porcine SLCs which might provide a reservoir for LCs-lineage differentiation Second it developed a new short-term culture system for porcine SLCs In addition as an idealhuman model some human drugs toxicity investigations of
8 Stem Cells International
Figure 6Oil RedO staining of pig LCs after cultured 7 d in the basicmedium (bar = 50 120583m)
sterile diseases could be assessed in the pig firstly beforehuman trials which could reduce the expense of investiga-tions into new drugs
5 Conclusions
To summarize we isolated porcine SLCs and identifiedsome of their basic characteristics Moreover pTF couldmaintain the features of porcine SLCs when added to culturesystemThis workmight help us to understand the regulatorymechanisms of proliferation and differentiation of SLCs andholds promise for further studies pertaining to porcine SLCs
Disclosure
The current address of Chuanying Pan is College of AnimalScience and Technology Northwest AampF University No 22Xinong Road Yangling Shaanxi 712100 China
Competing Interests
The authors declare that there are no competing interestsregarding the publication of this paper
Acknowledgments
This work was supported by China Postdoctoral ScienceFoundation funded project (no 2014M560809) the Fun-damental Research Funds for the Central Universities(NWSUAF no 2452015145) and the National Basic ResearchProgram of China (973 program no 2014CB943100) Specialthanks are due to Professor Yuan-Qiang Zhang (The FourthMilitary Medical University China) for his generous dona-tion of EDS
References
[1] A S Midzak H Chen V Papadopoulos and B R ZirkinldquoLeydig cell aging and the mechanisms of reduced testosteronesynthesisrdquoMolecular and Cellular Endocrinology vol 299 no 1pp 23ndash31 2009
[2] Y Yang Z Su W Xu et al ldquoDirected mouse embryonic stemcells into leydig-like cells rescue testosterone-deficientmale ratsin vivordquo StemCells andDevelopment vol 24 no 4 pp 459ndash4702015
[3] H Chen R-S Ge and B R Zirkin ldquoLeydig cells from stemcells to agingrdquo Molecular and Cellular Endocrinology vol 306no 1-2 pp 9ndash16 2009
[4] R-S Ge Q Dong C M Sottas V Papadopoulos B R Zirkinand M P Hardy ldquoIn search of rat stem Leydig cells identifica-tion isolation and lineage-specific developmentrdquo Proceedingsof the National Academy of Sciences of the United States ofAmerica vol 103 no 8 pp 2719ndash2724 2006
[5] M S Davidoff R Middendorff G Enikolopov D Rieth-macher A F Holstein and D Muller ldquoProgenitor cells of thetestosterone-producing Leydig cells revealedrdquo Journal of CellBiology vol 167 no 5 pp 935ndash944 2004
[6] M S Davidoff R Middendorff D Muller and A F HolsteinldquoThe neuroendocrine Leydig cells and their stem cell progeni-tors the pericytesrdquo Advances in Anatomy Embryology and CellBiology vol 205 pp 1ndash107 2009
[7] L Landreh K Spinnler K Schubert et al ldquoHuman tes-ticular peritubular cells host putative stem leydig cells withsteroidogenic capacityrdquo The Journal of Clinical Endocrinologyand Metabolism vol 99 no 7 pp E1227ndashE1235 2014
[8] M H Jiang B Cai Y Tuo et al ldquoCharacterization of Nestin-positive stem Leydig cells as a potential source for the treatmentof testicular Leydig cell dysfunctionrdquo Cell Research vol 24 no12 pp 1466ndash1485 2014
[9] K C Lo Z Lei C Venkateswara Rao J Beck and D J LambldquoDe novo testosterone production in luteinizing hormonereceptor knockout mice after transplantation of Leydig stemcellsrdquo Endocrinology vol 145 no 9 pp 4011ndash4015 2004
[10] E Stanley C-Y Lin S Jin et al ldquoIdentification proliferationand differentiation of adult leydig stem cellsrdquo Endocrinologyvol 153 no 10 pp 5002ndash5010 2012
[11] X Li Z Wang Z Jiang et al ldquoRegulation of seminiferoustubule-associated stem Leydig cells in adult rat testesrdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 113 no 10 pp 2666ndash2671 2016
[12] L Luo H Chen and B R Zirkin ldquoTemporal relationshipsamong testosterone production steroidogenic acute regulatoryprotein (StAR) and P450 side-chain cleavage enzyme (P450scc)during Leydig cell agingrdquo Journal of Andrology vol 26 no 1 pp25ndash31 2005
[13] A V Pechersky V F Semiglazov G B Loran A I Karpis-chenko V I Pechersky and V I Mazurov ldquoThe influence ofpartial androgen deficiency of aging men (PADAM) on theimpulse regime of incretion of several hormones and mitoticactivityrdquo Tsitologiya vol 48 no 10 pp 862ndash866 2006
[14] M Amore F Scarlatti A L Quarta and P Tagariello ldquoPartialandrogen deficiency depression and testosterone treatment inaging menrdquo Aging Clinical and Experimental Research vol 21no 1 pp 1ndash8 2009
[15] A Pechersky ldquoFeatures of diagnostics and treatment of partialandrogen deficiency of aging menrdquo Central European Journal ofUrology vol 67 no 4 pp 397ndash404 2014
[16] Y Nian M Ding S Hu et al ldquoTestosterone replacementtherapy improves health-related quality of life for patientswith late-onset hypogonadism a meta-analysis of randomizedcontrolled trialsrdquo Andrologia 2016
Stem Cells International 9
[17] Y Zhang R Ge and M P Hardy ldquoAndrogen-forming stemLeydig cells identification function and therapeutic potentialrdquoDisease Markers vol 24 no 4-5 pp 277ndash286 2008
[18] S Bergfelder-Druing C Grosse-Brinkhaus B Lind et al ldquoAgenome-wide association study in large white and landrace pigpopulations for number piglets born aliverdquo PLoS ONE vol 10no 3 Article ID e0117468 2015
[19] Z Jiang and M F Rothschild ldquoSwine genome science comes ofagerdquo International Journal of Biological Sciences vol 3 no 3 pp129ndash131 2007
[20] J I Raeside H L Christie R L Renaud and P A Sinclair ldquoTheboar testis the most versatile steroid producing organ knownrdquoSociety of Reproduction and Fertility Supplement vol 62 pp 85ndash97 2006
[21] Y Nakajima G Sato S Ohno and S Nakajin ldquoOrganotincompounds suppress testosterone production in Leydig cellsfrom neonatal pig testesrdquo Journal of Health Science vol 49 no6 pp 514ndash519 2003
[22] P Wang Y Zheng Y Li et al ldquoEffects of testicular interstitialfluid on the proliferation of the mouse spermatogonial stemcells in vitrordquo Zygote vol 22 no 3 pp 395ndash403 2014
[23] E-H Lee J-H Oh Y-S Lee et al ldquoGene expression analysisof toxicological pathways in TM3 leydig cell lines treatedwith Ethane dimethanesulfonaterdquo Journal of Biochemical andMolecular Toxicology vol 26 no 6 pp 213ndash223 2012
[24] T Li J Hu G-H He et al ldquoUp-regulation of NDRG2 throughnuclear factor-kappa B is required for Leydig cell apoptosisin both human and murine infertile testesrdquo Biochimica etBiophysica ActamdashMolecular Basis of Disease vol 1822 no 2 pp301ndash313 2012
[25] A JMorrisM F Taylor and I DMorris ldquoLeydig cell apoptosisin response to ethane dimethanesulphonate after both in vivoand in vitro treatmentrdquo Journal of Andrology vol 18 no 3 pp274ndash280 1997
[26] B Heidari M Rahmati-Ahmadabadi M M Akhondi et alldquoIsolation identification and culture of goat spermatogonialstem cells using c-kit and PGP95 markersrdquo Journal of AssistedReproduction and Genetics vol 29 no 10 pp 1029ndash1038 2012
[27] J-P Qi Y-L Yang H Zhu et al ldquoExpression of the androgenreceptor and its correlationwithmolecular subtypes in 980Chi-nese breast cancer patientsrdquo Breast Cancer Basic and ClinicalResearch vol 6 pp 1ndash8 2012
[28] Y Zheng YHe J An et al ldquoTHY1 is a surfacemarker of porcinegonocytesrdquoReproduction Fertility andDevelopment vol 26 no4 pp 533ndash539 2014
[29] K J Livak and T D Schmittgen ldquoAnalysis of relative geneexpression data using real-time quantitative PCR and the2(T)(minusDelta Delta C) methodrdquoMethods vol 25 no 4 pp 402ndash408 2001
[30] L B Smith andW H Walker ldquoThe regulation of spermatogen-esis by androgensrdquo Seminars in Cell and Developmental Biologyvol 30 pp 2ndash13 2014
[31] H Chen S Jin S Huang et al ldquoTransplantation of alginate-encapsulated seminiferous tubules and interstitial tissue intoadult rats leydig stem cell differentiation in vivordquo Molecularand Cellular Endocrinology vol 436 pp 250ndash258 2016
[32] H Chen Y Wang R Ge and B R Zirkin ldquoLeydig cell stemcells identification proliferation and differentiationrdquoMolecularand Cellular Endocrinology 2016
[33] R M Sharpe ldquoMonitoring of spermatogenesis in man-measurement of Sertoli cell- or germ cell-secreted proteins in
semen or bloodrdquo International Journal of Andrology vol 15 no3 pp 201ndash210 1992
[34] K J Turner C McKinnell T T McLaren et al ldquoDetectionof germ cell-derived proteins in testicular interstitial fluidpotential for monitoring spermatogenesis in vivordquo Journal ofAndrology vol 17 no 2 pp 127ndash136 1996
[35] L R Franca R A Hess J M Dufour M C Hofmann and MD Griswold ldquoThe Sertoli cell one hundred fifty years of beautyand plasticityrdquo Andrology vol 4 no 2 pp 189ndash212 2016
[36] P G Stanton C F Foo A Rainczuk et al ldquoMapping the testicu-lar interstitial fluid proteome fromnormal ratsrdquoPROTEOMICSvol 16 no 17 pp 2391ndash2402 2016
Submit your manuscripts athttpswwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
Stem Cells International 7
C
B
A
mRN
A le
vel o
f Nes
tin (r
elat
ive t
o be
ta-a
ctin
)
Prim
ary
cells
Basic
med
ium
pTF
med
ium
00
05
10
15
20
25
30Nestin
(a)
CB
A
mRN
A le
vel o
f LIF
R (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
1
2
3
4
5
6
7
8
9
10LIFR
(b)
B B
A
mRN
A le
vel o
f CYP
17A
1 (r
elat
ive t
o be
ta-a
ctin
)
pTF
med
ium
Basic
med
ium
Prim
ary
cells
0
5
10
15
20
25
30
35CYP17A1
(c)
Figure 5 Expressions of Nestin LIFR and CYP17A1 of porcine SLCs cultured in different media for 2w Note primary cells the primaryisolated porcine SLCs Different letters (A B C) indicate significant difference (119875 lt 005)
provided vital cell factors and proteins In the testes sometypes of cells such as Sertoli cells and peritubular myoidcells secreted factors into the testicular fluid to regulate theactivities of SLCs [33ndash35] Since the culture system of porcineSLCs had not been developed all factors from whole testeswere extracted as pTF At first we conjectured that the pTFcould maintain the stem cell potential of porcine SLCs whenadded to the culturemediumThe results of this work showedthat the pTF could indeed support the stem cell potentialof SLCs for 2 weeks in vitro The pTF was able to maintainthe self-renewal properties of SLCs as the origin of pTFwas consistent with the putative SLCs Moreover the pTFcontained abundant hormones growth factors cytokinesand a large amount of proteins which could provide the
necessary material basis for SLCs proliferation [22 36] Theimmunofluorescent analysis of PDGFR120572 also demonstratedthat the cells that had been cultured for 2 weeks were putativeSLCs Taken together the results indicated that the pTFmightbe contributing to maintaining self-renewal properties of theputative SLCs Therefore our future research will be directedtowards revealing the vital components for maintaining SLCsself-renewal in pTF
There were two areas of innovation of the present studyFirst it provided a simpler and faster method for obtainingthe porcine SLCs which might provide a reservoir for LCs-lineage differentiation Second it developed a new short-term culture system for porcine SLCs In addition as an idealhuman model some human drugs toxicity investigations of
8 Stem Cells International
Figure 6Oil RedO staining of pig LCs after cultured 7 d in the basicmedium (bar = 50 120583m)
sterile diseases could be assessed in the pig firstly beforehuman trials which could reduce the expense of investiga-tions into new drugs
5 Conclusions
To summarize we isolated porcine SLCs and identifiedsome of their basic characteristics Moreover pTF couldmaintain the features of porcine SLCs when added to culturesystemThis workmight help us to understand the regulatorymechanisms of proliferation and differentiation of SLCs andholds promise for further studies pertaining to porcine SLCs
Disclosure
The current address of Chuanying Pan is College of AnimalScience and Technology Northwest AampF University No 22Xinong Road Yangling Shaanxi 712100 China
Competing Interests
The authors declare that there are no competing interestsregarding the publication of this paper
Acknowledgments
This work was supported by China Postdoctoral ScienceFoundation funded project (no 2014M560809) the Fun-damental Research Funds for the Central Universities(NWSUAF no 2452015145) and the National Basic ResearchProgram of China (973 program no 2014CB943100) Specialthanks are due to Professor Yuan-Qiang Zhang (The FourthMilitary Medical University China) for his generous dona-tion of EDS
References
[1] A S Midzak H Chen V Papadopoulos and B R ZirkinldquoLeydig cell aging and the mechanisms of reduced testosteronesynthesisrdquoMolecular and Cellular Endocrinology vol 299 no 1pp 23ndash31 2009
[2] Y Yang Z Su W Xu et al ldquoDirected mouse embryonic stemcells into leydig-like cells rescue testosterone-deficientmale ratsin vivordquo StemCells andDevelopment vol 24 no 4 pp 459ndash4702015
[3] H Chen R-S Ge and B R Zirkin ldquoLeydig cells from stemcells to agingrdquo Molecular and Cellular Endocrinology vol 306no 1-2 pp 9ndash16 2009
[4] R-S Ge Q Dong C M Sottas V Papadopoulos B R Zirkinand M P Hardy ldquoIn search of rat stem Leydig cells identifica-tion isolation and lineage-specific developmentrdquo Proceedingsof the National Academy of Sciences of the United States ofAmerica vol 103 no 8 pp 2719ndash2724 2006
[5] M S Davidoff R Middendorff G Enikolopov D Rieth-macher A F Holstein and D Muller ldquoProgenitor cells of thetestosterone-producing Leydig cells revealedrdquo Journal of CellBiology vol 167 no 5 pp 935ndash944 2004
[6] M S Davidoff R Middendorff D Muller and A F HolsteinldquoThe neuroendocrine Leydig cells and their stem cell progeni-tors the pericytesrdquo Advances in Anatomy Embryology and CellBiology vol 205 pp 1ndash107 2009
[7] L Landreh K Spinnler K Schubert et al ldquoHuman tes-ticular peritubular cells host putative stem leydig cells withsteroidogenic capacityrdquo The Journal of Clinical Endocrinologyand Metabolism vol 99 no 7 pp E1227ndashE1235 2014
[8] M H Jiang B Cai Y Tuo et al ldquoCharacterization of Nestin-positive stem Leydig cells as a potential source for the treatmentof testicular Leydig cell dysfunctionrdquo Cell Research vol 24 no12 pp 1466ndash1485 2014
[9] K C Lo Z Lei C Venkateswara Rao J Beck and D J LambldquoDe novo testosterone production in luteinizing hormonereceptor knockout mice after transplantation of Leydig stemcellsrdquo Endocrinology vol 145 no 9 pp 4011ndash4015 2004
[10] E Stanley C-Y Lin S Jin et al ldquoIdentification proliferationand differentiation of adult leydig stem cellsrdquo Endocrinologyvol 153 no 10 pp 5002ndash5010 2012
[11] X Li Z Wang Z Jiang et al ldquoRegulation of seminiferoustubule-associated stem Leydig cells in adult rat testesrdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 113 no 10 pp 2666ndash2671 2016
[12] L Luo H Chen and B R Zirkin ldquoTemporal relationshipsamong testosterone production steroidogenic acute regulatoryprotein (StAR) and P450 side-chain cleavage enzyme (P450scc)during Leydig cell agingrdquo Journal of Andrology vol 26 no 1 pp25ndash31 2005
[13] A V Pechersky V F Semiglazov G B Loran A I Karpis-chenko V I Pechersky and V I Mazurov ldquoThe influence ofpartial androgen deficiency of aging men (PADAM) on theimpulse regime of incretion of several hormones and mitoticactivityrdquo Tsitologiya vol 48 no 10 pp 862ndash866 2006
[14] M Amore F Scarlatti A L Quarta and P Tagariello ldquoPartialandrogen deficiency depression and testosterone treatment inaging menrdquo Aging Clinical and Experimental Research vol 21no 1 pp 1ndash8 2009
[15] A Pechersky ldquoFeatures of diagnostics and treatment of partialandrogen deficiency of aging menrdquo Central European Journal ofUrology vol 67 no 4 pp 397ndash404 2014
[16] Y Nian M Ding S Hu et al ldquoTestosterone replacementtherapy improves health-related quality of life for patientswith late-onset hypogonadism a meta-analysis of randomizedcontrolled trialsrdquo Andrologia 2016
Stem Cells International 9
[17] Y Zhang R Ge and M P Hardy ldquoAndrogen-forming stemLeydig cells identification function and therapeutic potentialrdquoDisease Markers vol 24 no 4-5 pp 277ndash286 2008
[18] S Bergfelder-Druing C Grosse-Brinkhaus B Lind et al ldquoAgenome-wide association study in large white and landrace pigpopulations for number piglets born aliverdquo PLoS ONE vol 10no 3 Article ID e0117468 2015
[19] Z Jiang and M F Rothschild ldquoSwine genome science comes ofagerdquo International Journal of Biological Sciences vol 3 no 3 pp129ndash131 2007
[20] J I Raeside H L Christie R L Renaud and P A Sinclair ldquoTheboar testis the most versatile steroid producing organ knownrdquoSociety of Reproduction and Fertility Supplement vol 62 pp 85ndash97 2006
[21] Y Nakajima G Sato S Ohno and S Nakajin ldquoOrganotincompounds suppress testosterone production in Leydig cellsfrom neonatal pig testesrdquo Journal of Health Science vol 49 no6 pp 514ndash519 2003
[22] P Wang Y Zheng Y Li et al ldquoEffects of testicular interstitialfluid on the proliferation of the mouse spermatogonial stemcells in vitrordquo Zygote vol 22 no 3 pp 395ndash403 2014
[23] E-H Lee J-H Oh Y-S Lee et al ldquoGene expression analysisof toxicological pathways in TM3 leydig cell lines treatedwith Ethane dimethanesulfonaterdquo Journal of Biochemical andMolecular Toxicology vol 26 no 6 pp 213ndash223 2012
[24] T Li J Hu G-H He et al ldquoUp-regulation of NDRG2 throughnuclear factor-kappa B is required for Leydig cell apoptosisin both human and murine infertile testesrdquo Biochimica etBiophysica ActamdashMolecular Basis of Disease vol 1822 no 2 pp301ndash313 2012
[25] A JMorrisM F Taylor and I DMorris ldquoLeydig cell apoptosisin response to ethane dimethanesulphonate after both in vivoand in vitro treatmentrdquo Journal of Andrology vol 18 no 3 pp274ndash280 1997
[26] B Heidari M Rahmati-Ahmadabadi M M Akhondi et alldquoIsolation identification and culture of goat spermatogonialstem cells using c-kit and PGP95 markersrdquo Journal of AssistedReproduction and Genetics vol 29 no 10 pp 1029ndash1038 2012
[27] J-P Qi Y-L Yang H Zhu et al ldquoExpression of the androgenreceptor and its correlationwithmolecular subtypes in 980Chi-nese breast cancer patientsrdquo Breast Cancer Basic and ClinicalResearch vol 6 pp 1ndash8 2012
[28] Y Zheng YHe J An et al ldquoTHY1 is a surfacemarker of porcinegonocytesrdquoReproduction Fertility andDevelopment vol 26 no4 pp 533ndash539 2014
[29] K J Livak and T D Schmittgen ldquoAnalysis of relative geneexpression data using real-time quantitative PCR and the2(T)(minusDelta Delta C) methodrdquoMethods vol 25 no 4 pp 402ndash408 2001
[30] L B Smith andW H Walker ldquoThe regulation of spermatogen-esis by androgensrdquo Seminars in Cell and Developmental Biologyvol 30 pp 2ndash13 2014
[31] H Chen S Jin S Huang et al ldquoTransplantation of alginate-encapsulated seminiferous tubules and interstitial tissue intoadult rats leydig stem cell differentiation in vivordquo Molecularand Cellular Endocrinology vol 436 pp 250ndash258 2016
[32] H Chen Y Wang R Ge and B R Zirkin ldquoLeydig cell stemcells identification proliferation and differentiationrdquoMolecularand Cellular Endocrinology 2016
[33] R M Sharpe ldquoMonitoring of spermatogenesis in man-measurement of Sertoli cell- or germ cell-secreted proteins in
semen or bloodrdquo International Journal of Andrology vol 15 no3 pp 201ndash210 1992
[34] K J Turner C McKinnell T T McLaren et al ldquoDetectionof germ cell-derived proteins in testicular interstitial fluidpotential for monitoring spermatogenesis in vivordquo Journal ofAndrology vol 17 no 2 pp 127ndash136 1996
[35] L R Franca R A Hess J M Dufour M C Hofmann and MD Griswold ldquoThe Sertoli cell one hundred fifty years of beautyand plasticityrdquo Andrology vol 4 no 2 pp 189ndash212 2016
[36] P G Stanton C F Foo A Rainczuk et al ldquoMapping the testicu-lar interstitial fluid proteome fromnormal ratsrdquoPROTEOMICSvol 16 no 17 pp 2391ndash2402 2016
Submit your manuscripts athttpswwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
8 Stem Cells International
Figure 6Oil RedO staining of pig LCs after cultured 7 d in the basicmedium (bar = 50 120583m)
sterile diseases could be assessed in the pig firstly beforehuman trials which could reduce the expense of investiga-tions into new drugs
5 Conclusions
To summarize we isolated porcine SLCs and identifiedsome of their basic characteristics Moreover pTF couldmaintain the features of porcine SLCs when added to culturesystemThis workmight help us to understand the regulatorymechanisms of proliferation and differentiation of SLCs andholds promise for further studies pertaining to porcine SLCs
Disclosure
The current address of Chuanying Pan is College of AnimalScience and Technology Northwest AampF University No 22Xinong Road Yangling Shaanxi 712100 China
Competing Interests
The authors declare that there are no competing interestsregarding the publication of this paper
Acknowledgments
This work was supported by China Postdoctoral ScienceFoundation funded project (no 2014M560809) the Fun-damental Research Funds for the Central Universities(NWSUAF no 2452015145) and the National Basic ResearchProgram of China (973 program no 2014CB943100) Specialthanks are due to Professor Yuan-Qiang Zhang (The FourthMilitary Medical University China) for his generous dona-tion of EDS
References
[1] A S Midzak H Chen V Papadopoulos and B R ZirkinldquoLeydig cell aging and the mechanisms of reduced testosteronesynthesisrdquoMolecular and Cellular Endocrinology vol 299 no 1pp 23ndash31 2009
[2] Y Yang Z Su W Xu et al ldquoDirected mouse embryonic stemcells into leydig-like cells rescue testosterone-deficientmale ratsin vivordquo StemCells andDevelopment vol 24 no 4 pp 459ndash4702015
[3] H Chen R-S Ge and B R Zirkin ldquoLeydig cells from stemcells to agingrdquo Molecular and Cellular Endocrinology vol 306no 1-2 pp 9ndash16 2009
[4] R-S Ge Q Dong C M Sottas V Papadopoulos B R Zirkinand M P Hardy ldquoIn search of rat stem Leydig cells identifica-tion isolation and lineage-specific developmentrdquo Proceedingsof the National Academy of Sciences of the United States ofAmerica vol 103 no 8 pp 2719ndash2724 2006
[5] M S Davidoff R Middendorff G Enikolopov D Rieth-macher A F Holstein and D Muller ldquoProgenitor cells of thetestosterone-producing Leydig cells revealedrdquo Journal of CellBiology vol 167 no 5 pp 935ndash944 2004
[6] M S Davidoff R Middendorff D Muller and A F HolsteinldquoThe neuroendocrine Leydig cells and their stem cell progeni-tors the pericytesrdquo Advances in Anatomy Embryology and CellBiology vol 205 pp 1ndash107 2009
[7] L Landreh K Spinnler K Schubert et al ldquoHuman tes-ticular peritubular cells host putative stem leydig cells withsteroidogenic capacityrdquo The Journal of Clinical Endocrinologyand Metabolism vol 99 no 7 pp E1227ndashE1235 2014
[8] M H Jiang B Cai Y Tuo et al ldquoCharacterization of Nestin-positive stem Leydig cells as a potential source for the treatmentof testicular Leydig cell dysfunctionrdquo Cell Research vol 24 no12 pp 1466ndash1485 2014
[9] K C Lo Z Lei C Venkateswara Rao J Beck and D J LambldquoDe novo testosterone production in luteinizing hormonereceptor knockout mice after transplantation of Leydig stemcellsrdquo Endocrinology vol 145 no 9 pp 4011ndash4015 2004
[10] E Stanley C-Y Lin S Jin et al ldquoIdentification proliferationand differentiation of adult leydig stem cellsrdquo Endocrinologyvol 153 no 10 pp 5002ndash5010 2012
[11] X Li Z Wang Z Jiang et al ldquoRegulation of seminiferoustubule-associated stem Leydig cells in adult rat testesrdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 113 no 10 pp 2666ndash2671 2016
[12] L Luo H Chen and B R Zirkin ldquoTemporal relationshipsamong testosterone production steroidogenic acute regulatoryprotein (StAR) and P450 side-chain cleavage enzyme (P450scc)during Leydig cell agingrdquo Journal of Andrology vol 26 no 1 pp25ndash31 2005
[13] A V Pechersky V F Semiglazov G B Loran A I Karpis-chenko V I Pechersky and V I Mazurov ldquoThe influence ofpartial androgen deficiency of aging men (PADAM) on theimpulse regime of incretion of several hormones and mitoticactivityrdquo Tsitologiya vol 48 no 10 pp 862ndash866 2006
[14] M Amore F Scarlatti A L Quarta and P Tagariello ldquoPartialandrogen deficiency depression and testosterone treatment inaging menrdquo Aging Clinical and Experimental Research vol 21no 1 pp 1ndash8 2009
[15] A Pechersky ldquoFeatures of diagnostics and treatment of partialandrogen deficiency of aging menrdquo Central European Journal ofUrology vol 67 no 4 pp 397ndash404 2014
[16] Y Nian M Ding S Hu et al ldquoTestosterone replacementtherapy improves health-related quality of life for patientswith late-onset hypogonadism a meta-analysis of randomizedcontrolled trialsrdquo Andrologia 2016
Stem Cells International 9
[17] Y Zhang R Ge and M P Hardy ldquoAndrogen-forming stemLeydig cells identification function and therapeutic potentialrdquoDisease Markers vol 24 no 4-5 pp 277ndash286 2008
[18] S Bergfelder-Druing C Grosse-Brinkhaus B Lind et al ldquoAgenome-wide association study in large white and landrace pigpopulations for number piglets born aliverdquo PLoS ONE vol 10no 3 Article ID e0117468 2015
[19] Z Jiang and M F Rothschild ldquoSwine genome science comes ofagerdquo International Journal of Biological Sciences vol 3 no 3 pp129ndash131 2007
[20] J I Raeside H L Christie R L Renaud and P A Sinclair ldquoTheboar testis the most versatile steroid producing organ knownrdquoSociety of Reproduction and Fertility Supplement vol 62 pp 85ndash97 2006
[21] Y Nakajima G Sato S Ohno and S Nakajin ldquoOrganotincompounds suppress testosterone production in Leydig cellsfrom neonatal pig testesrdquo Journal of Health Science vol 49 no6 pp 514ndash519 2003
[22] P Wang Y Zheng Y Li et al ldquoEffects of testicular interstitialfluid on the proliferation of the mouse spermatogonial stemcells in vitrordquo Zygote vol 22 no 3 pp 395ndash403 2014
[23] E-H Lee J-H Oh Y-S Lee et al ldquoGene expression analysisof toxicological pathways in TM3 leydig cell lines treatedwith Ethane dimethanesulfonaterdquo Journal of Biochemical andMolecular Toxicology vol 26 no 6 pp 213ndash223 2012
[24] T Li J Hu G-H He et al ldquoUp-regulation of NDRG2 throughnuclear factor-kappa B is required for Leydig cell apoptosisin both human and murine infertile testesrdquo Biochimica etBiophysica ActamdashMolecular Basis of Disease vol 1822 no 2 pp301ndash313 2012
[25] A JMorrisM F Taylor and I DMorris ldquoLeydig cell apoptosisin response to ethane dimethanesulphonate after both in vivoand in vitro treatmentrdquo Journal of Andrology vol 18 no 3 pp274ndash280 1997
[26] B Heidari M Rahmati-Ahmadabadi M M Akhondi et alldquoIsolation identification and culture of goat spermatogonialstem cells using c-kit and PGP95 markersrdquo Journal of AssistedReproduction and Genetics vol 29 no 10 pp 1029ndash1038 2012
[27] J-P Qi Y-L Yang H Zhu et al ldquoExpression of the androgenreceptor and its correlationwithmolecular subtypes in 980Chi-nese breast cancer patientsrdquo Breast Cancer Basic and ClinicalResearch vol 6 pp 1ndash8 2012
[28] Y Zheng YHe J An et al ldquoTHY1 is a surfacemarker of porcinegonocytesrdquoReproduction Fertility andDevelopment vol 26 no4 pp 533ndash539 2014
[29] K J Livak and T D Schmittgen ldquoAnalysis of relative geneexpression data using real-time quantitative PCR and the2(T)(minusDelta Delta C) methodrdquoMethods vol 25 no 4 pp 402ndash408 2001
[30] L B Smith andW H Walker ldquoThe regulation of spermatogen-esis by androgensrdquo Seminars in Cell and Developmental Biologyvol 30 pp 2ndash13 2014
[31] H Chen S Jin S Huang et al ldquoTransplantation of alginate-encapsulated seminiferous tubules and interstitial tissue intoadult rats leydig stem cell differentiation in vivordquo Molecularand Cellular Endocrinology vol 436 pp 250ndash258 2016
[32] H Chen Y Wang R Ge and B R Zirkin ldquoLeydig cell stemcells identification proliferation and differentiationrdquoMolecularand Cellular Endocrinology 2016
[33] R M Sharpe ldquoMonitoring of spermatogenesis in man-measurement of Sertoli cell- or germ cell-secreted proteins in
semen or bloodrdquo International Journal of Andrology vol 15 no3 pp 201ndash210 1992
[34] K J Turner C McKinnell T T McLaren et al ldquoDetectionof germ cell-derived proteins in testicular interstitial fluidpotential for monitoring spermatogenesis in vivordquo Journal ofAndrology vol 17 no 2 pp 127ndash136 1996
[35] L R Franca R A Hess J M Dufour M C Hofmann and MD Griswold ldquoThe Sertoli cell one hundred fifty years of beautyand plasticityrdquo Andrology vol 4 no 2 pp 189ndash212 2016
[36] P G Stanton C F Foo A Rainczuk et al ldquoMapping the testicu-lar interstitial fluid proteome fromnormal ratsrdquoPROTEOMICSvol 16 no 17 pp 2391ndash2402 2016
Submit your manuscripts athttpswwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
Stem Cells International 9
[17] Y Zhang R Ge and M P Hardy ldquoAndrogen-forming stemLeydig cells identification function and therapeutic potentialrdquoDisease Markers vol 24 no 4-5 pp 277ndash286 2008
[18] S Bergfelder-Druing C Grosse-Brinkhaus B Lind et al ldquoAgenome-wide association study in large white and landrace pigpopulations for number piglets born aliverdquo PLoS ONE vol 10no 3 Article ID e0117468 2015
[19] Z Jiang and M F Rothschild ldquoSwine genome science comes ofagerdquo International Journal of Biological Sciences vol 3 no 3 pp129ndash131 2007
[20] J I Raeside H L Christie R L Renaud and P A Sinclair ldquoTheboar testis the most versatile steroid producing organ knownrdquoSociety of Reproduction and Fertility Supplement vol 62 pp 85ndash97 2006
[21] Y Nakajima G Sato S Ohno and S Nakajin ldquoOrganotincompounds suppress testosterone production in Leydig cellsfrom neonatal pig testesrdquo Journal of Health Science vol 49 no6 pp 514ndash519 2003
[22] P Wang Y Zheng Y Li et al ldquoEffects of testicular interstitialfluid on the proliferation of the mouse spermatogonial stemcells in vitrordquo Zygote vol 22 no 3 pp 395ndash403 2014
[23] E-H Lee J-H Oh Y-S Lee et al ldquoGene expression analysisof toxicological pathways in TM3 leydig cell lines treatedwith Ethane dimethanesulfonaterdquo Journal of Biochemical andMolecular Toxicology vol 26 no 6 pp 213ndash223 2012
[24] T Li J Hu G-H He et al ldquoUp-regulation of NDRG2 throughnuclear factor-kappa B is required for Leydig cell apoptosisin both human and murine infertile testesrdquo Biochimica etBiophysica ActamdashMolecular Basis of Disease vol 1822 no 2 pp301ndash313 2012
[25] A JMorrisM F Taylor and I DMorris ldquoLeydig cell apoptosisin response to ethane dimethanesulphonate after both in vivoand in vitro treatmentrdquo Journal of Andrology vol 18 no 3 pp274ndash280 1997
[26] B Heidari M Rahmati-Ahmadabadi M M Akhondi et alldquoIsolation identification and culture of goat spermatogonialstem cells using c-kit and PGP95 markersrdquo Journal of AssistedReproduction and Genetics vol 29 no 10 pp 1029ndash1038 2012
[27] J-P Qi Y-L Yang H Zhu et al ldquoExpression of the androgenreceptor and its correlationwithmolecular subtypes in 980Chi-nese breast cancer patientsrdquo Breast Cancer Basic and ClinicalResearch vol 6 pp 1ndash8 2012
[28] Y Zheng YHe J An et al ldquoTHY1 is a surfacemarker of porcinegonocytesrdquoReproduction Fertility andDevelopment vol 26 no4 pp 533ndash539 2014
[29] K J Livak and T D Schmittgen ldquoAnalysis of relative geneexpression data using real-time quantitative PCR and the2(T)(minusDelta Delta C) methodrdquoMethods vol 25 no 4 pp 402ndash408 2001
[30] L B Smith andW H Walker ldquoThe regulation of spermatogen-esis by androgensrdquo Seminars in Cell and Developmental Biologyvol 30 pp 2ndash13 2014
[31] H Chen S Jin S Huang et al ldquoTransplantation of alginate-encapsulated seminiferous tubules and interstitial tissue intoadult rats leydig stem cell differentiation in vivordquo Molecularand Cellular Endocrinology vol 436 pp 250ndash258 2016
[32] H Chen Y Wang R Ge and B R Zirkin ldquoLeydig cell stemcells identification proliferation and differentiationrdquoMolecularand Cellular Endocrinology 2016
[33] R M Sharpe ldquoMonitoring of spermatogenesis in man-measurement of Sertoli cell- or germ cell-secreted proteins in
semen or bloodrdquo International Journal of Andrology vol 15 no3 pp 201ndash210 1992
[34] K J Turner C McKinnell T T McLaren et al ldquoDetectionof germ cell-derived proteins in testicular interstitial fluidpotential for monitoring spermatogenesis in vivordquo Journal ofAndrology vol 17 no 2 pp 127ndash136 1996
[35] L R Franca R A Hess J M Dufour M C Hofmann and MD Griswold ldquoThe Sertoli cell one hundred fifty years of beautyand plasticityrdquo Andrology vol 4 no 2 pp 189ndash212 2016
[36] P G Stanton C F Foo A Rainczuk et al ldquoMapping the testicu-lar interstitial fluid proteome fromnormal ratsrdquoPROTEOMICSvol 16 no 17 pp 2391ndash2402 2016
Submit your manuscripts athttpswwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
Submit your manuscripts athttpswwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
Related Documents
