Identification of differentially expressed genes in human varicose veins: involvement of matrix gla protein in extracellular matrix remodeling

This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

Author's personal copy

Identification of differentially expressed genes and quantitative expression ofcomplement genes in the liver of marine medaka Oryzias melastigma challenged withVibrio parahaemolyticus

Jun Bo a,e, John P. Giesy a,b,c,e, Rui Ye a,e, Ke-Jian Wang c, Jae-Seong Lee d, Doris W.T. Au a,e,⁎a State Key Laboratory in Marine Pollution, City University of Hong Kong, Kowloon, Hong Kong, Chinab Department of Veterinary Biomedical Sciences and Toxicology Centre, University of Saskatchewan, Canadac State Key Laboratory of Marine Environmental Science, College of Oceanography and Environmental Science, Xiamen University, Xiamen, Fujian 361005, Chinad Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul, South Koreae Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong, China

a b s t r a c ta r t i c l e i n f o

Article history:Received 10 December 2011Received in revised form 24 February 2012Accepted 24 February 2012Available online 3 March 2012

Keywords:Suppression subtractive hybridization (SSH)Complement systemInnate immunityGene expressionFishImmunotoxicology

The innate immune system of fish is the primary defense against acute diseases. The marine medaka Oryziasmelastigma has been shown to be a potential marine fish model for ecotoxicology, but little is known aboutthe innate immune system of this small fish. In this study, suppression subtractive hybridization (SSH) wasused to identify differentially expressed immune genes in the liver of O. melastigma infected with Vibrioparahaemolyticus. Among the 396 genes identified, based on NCBI BLAST search of the 1279 sequenced clonesin the SSH libraries, 38 (9.6%) were involved in the immune process. Besides, genes involved in biological regula-tions (5.6%); cellular metabolism (24.7%); general response to stimuli (4.8%); cellular component organization(2.3%); signal transduction (2.5%) and transport process (2.8%) were also obtained. Ten complement componentgenes involved in four activation pathways were quantified (using q-PCR) and exhibited different patterns oftranscription between the control and challenged individuals. The results reported upon here support the feasi-bility of developing O. melastigma as a marine model fish to understand the basic biological processes related toimmune function and for immunotoxicological research. Findings of this study established a genetic platformfor studying immune function using O. melastigma.

© 2012 Elsevier Inc. All rights reserved.

1. Introduction

The immune system of teleosts, which responds rapidly to protectfish from pathogen infection, is a potential target of environmentalxenobiotics (Inadera, 2006). In fish, the innate immune system is anessential component in combating disease, and the acquired immunesystem of fish is relatively underdeveloped compared to that of othervertebrates, such as mammals and birds (Magnadottir, 2004). Theoutcome of acute infections infish appears to rely primarily on responsesof the innate immune system (Camp et al., 2000). There is a need toadvance current understanding of immune biology and toxicogenomicsin fish, in particular the innate immune system, which is crucial not onlyfor aquaculture management, but also for predictive ecotoxicology andenvironmental risk assessment (Villeneuve and Garcia-Reyero, 2011).

The marine medaka Oryzias melastigma is one potential modelmarine fish to be used in ecotoxicological studies (Kong et al., 2008;

Shen et al., 2010; Wang et al., 2011). In particular, previous researchhas demonstrated that O. melastigma is a potential model marinefish for studying innate immune function (Bo et al., 2011). However,there is little information available on genes that are most appropriatefor monitoring the function of the immune system, especially genes re-lated directly to the innate immune system of the marine medaka. Toestablish O. melastigma as a model marine fish for immunotoxicology,characterization of the gene components and pathways for the innateimmune system of marine medaka is needed.

The innate immune system of vertebrates is independent of priorexposure to any particular antigen. The complement system is a majormediator of innate immune defense against infection via inflammation,opsonization and cell lysis (Mayilyan et al., 2006), and it seems to play amore pivotal role in body defense in fish. The complement system ofteleosts, like that of other vertebrates, can be activated through threepathways. First, the classical complement activation pathway (CCP),which is triggered by binding of antibody to the cell surface, can alsobe activated by acute phase proteins or directly by viruses, bacteriaand virus-infected cells (Holland and Lambris, 2002; Gonzalez et al.,2007). The alternative complement activation pathway (ACP), which isindependent of antibody, is activated directly by foreignmicroorganisms.The lectin complement activation pathway (LCP) is elicited by binding of

Comparative Biochemistry and Physiology, Part D 7 (2012) 191–200

⁎ Corresponding author at: Department of Biology and Chemistry, City University ofHong Kong, Kowloon, Hong Kong, China Tel: +852 3442 9710; fax: +852 3442 0522.

E-mail address: [email protected] (D.W.T. Au).

1744-117X/$ – see front matter © 2012 Elsevier Inc. All rights reserved.doi:10.1016/j.cbd.2012.02.005

Contents lists available at SciVerse ScienceDirect

Comparative Biochemistry and Physiology, Part D

j ourna l homepage: www.e lsev ie r .com/ locate /cbpd

Author's personal copy

a protein complex consisting of mannose-binding lectins to mannans onbacterial cell surfaces (Holland and Lambris, 2002; Whyte, 2007).Recently, a fourth complement activation pathway, the “coagulationsystem” complement activation has been proposed (Amara et al.,2008). Findings by those authors suggest that various serine proteasesbelonging to the coagulation system can activate the complementcascade independently of the three previously established pathways.All four pathways converge to the lytic pathway, which leads to opsoni-zation or direct killing of the invaded microorganism.

In vertebrates, a diversity of plasma proteins that aremade in the liverserves as defense molecules in the innate immune system (Bayne et al.,2001). In the work presented here, we extend knowledge of the immunesystem to identify differentially expressed genes in the liver of O.melastigma in response to bacterial challenge by use of suppression sub-tractive hybridization (SSH). Hepatic expression of ten innate immune-related genes, which might be involved in complement activationpathways, were investigated in male O. melastigma challenged with bac-teria by use of quantitative real time PCR (q-PCR). The overall objective ofthis study was to demonstrate thatO. melastigma can serve as a potentialmarine fish model for understanding the basic biological processes relat-ed to innate immune function and for immunotoxicological research.

2. Materials and methods

2.1. Experimental animals

Marinemedaka (O. melastigma) were purchased from a commercialhatchery in Taiwan. The State Key Laboratory in Marine Pollution (CityUniversity of Hong Kong) has established a self-propagating populationof O. melastigma for more than 30 generations. Standard operatingprocedures (SOPs) for large-scale culturing of O. melastigma have beenestablished. Fish were maintained in the laboratory in aerated 30‰artificial seawater at 5.8±0.2 mg O2 L−1, 28±2 °C in a 14-h light:10-h dark cycle.

2.2. Preparation of bacteria

Vibrio parahaemolyticus is a curved, rod-shaped, Gram-negative,bacterium found in brackish saltwater, which has caused great loss inaquaculture (Cai et al., 2006). V. parahaemolyticus was purchased fromChina General Microbiological Culture Collection Center, CGMCC, Beijing,China, and cultured in LB broth at 28 °C with shaking at 200 rpm over-night, then the bacteria were collected by centrifugation (3000 g for10 min at 4 °C) and suspended in sterile saline solution (0.65% NaCl) ata concentration of 3×108 colony forming units (cfu)/mL.

2.3. Bacterial challenge and sampling for SSH

AdultO.melastigma (male, 5-month old, ~300 mg bodyweight) wereused in the experiment. During manipulations, fish were anesthetizedwith 0.02% tricaine methanesulfonate (MS-222, Sigma-Aldrich). For thebacterial challenge, a 2 μL stock bacterial suspension (6×105 cfu/fish)or equal volumes of 0.65% NaCl for the control were administered intothe peritoneal cavity (nearby the caudal to the pelvic fins), using a 5 μLHamilton syringe equippedwith anultra-fine needle under amicroscope.A sublethal dose of bacteria was selected based on results of preliminaryexperiments. After injection, fish were returned to the aquaria andallowed to recover. Samples of the liver (n=6) were collected at theend of 6 h, 24 h and 48 h post injection in the bacteria-challenged/saline-injected group. Samples of the liver were immediately frozen in liquidnitrogen, and stored at−80 °C for total RNA extraction.

2.4. RNA isolation and cDNA synthesis

Total RNAs were extracted from a pooled sample of livers collectedat the three time-points by use of Trizol reagent (Invitrogen) and

following the manufacturer's instructions. For construction of the SSHlibrary, SMART PCR cDNAs were synthesized, amplified and digestedwith Ras I from 1 μg of the total RNA for each group using the SuperSMART™ PCR cDNA Synthesis Kit (Clontech) according to themanufac-turer's protocol.

2.5. Construction of the SSH library

SSH libraries were constructed according to previously establishedmethods (Chen et al., 2010). Briefly, genes that were up-regulated inresponse to bacteria were compared with those in the liver of salinecontrols in one run, while those genes that were up-regulated in thesaline control relative to the expression in livers of infected fish weredetermined in a second SSH run. Construction of the SSH library wasperformed using the PCR-Select™ cDNA Subtraction Kit (Clontech) byusing methods suggested by the manufacturer. The forward and reverseSSH libraries were then plated on LB+Ampicillin (150 μL/mL, Sigma)agar plates that had been pre-spread with 20 μL X-Gal (50 mg/mL,Promega) and 100 μL IPTG (100mM, Invitrogen) for screening of thetwo libraries, respectively.

2.6. Identification of positive clones and DNA sequencing

The inserted fragment sizes of selected clones were determined byuse of PCR followed by 1% agarose gel electrophoresis separation. ThePCR reaction was performed using 1 μL bacterial culture, primerspGEMT-F and pGEMT-R, and iTaq DNA polymerase (BioRed). PCRamplification was conducted with the following cycles: 3 min at94 °C; 30 cycles of 30 s at 94 °C; 30 s at 55 °C, 90 s at 72 °C; and3 min at 72 °C for the final extension. Selected clones were sequencedby use of an ABI 3730 automated sequencer (Applied Biosystems,USA) at the Beijing Genomics Institute (Beijing, China).

2.7. Sequence analysis

Sequences obtained were analyzed by use of DNASIS and DNAssist2.0. Homology searches were performed using BLASTx and BLASTp pro-grams, with default parameters against the non-redundant database, bythe National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). The CD-Search service (Marchler-Bauer and Bryant,2004) was used to identify the conserved domains (CD) present inpredicted protein sequences against NCBI's Conserved Domain Database(http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml). The best anno-tated hit from the similarity searchwas retained. Gene ontology (GO) an-notation (Ashburner et al., 2000) based onBLAST analysiswas performedusing AmiGO against the GO database (http://amigo.geneontology.org/cgi-bin/amigo/go.cgi). The sequences were submitted to GenBank atthe NCBI and accession numbers were assigned.

Sequences were blasted against the Japanese medaka (Oryziaslatipes) genome database, and E values less than 10−5 were consideredto be an orthologue between the two species. The non-redundant list ofgene symbols was further curated by the HUGO Gene nomenclaturecommittee. The gene symbol list was then input into the Database forAnnotation, Visualization and Integrated Discovery (DAVID) for enrich-ment analysis, Homo sapiens was chosen as the reference. The KyotoEncyclopedia of Genes and Genomes (KEGG) was used to determinethe placement of gene products in specific pathways.

2.8. Real time PCR for quantification of complement genes in O.melastigma challenged with bacteria

Ten genes [complement component 1 q subcomponent-like 4 like(C1q), complement component 3-2 (C3-2), complement component 4(C4), complement component 5 (C5), complement component 8 (C8),complement factor B (BF), complement factor H (HF), lectin, mannose-binding 2 (MBL2), mannose-binding lectin-associated serine protease

192 J. Bo et al. / Comparative Biochemistry and Physiology, Part D 7 (2012) 191–200

Author's personal copy

(MASP) and C1 inhibitor] that are potentially involved in the complementcascades were chosen for quantitative real time PCR (q-PCR) analyses.

Adult O. melastigma (male, 5-month old, ~300 mg body weight)were anesthetized with 0.02% tricaine methanesulfonate (MS-222,Sigma-Aldrich). Using a 5 μL Hamilton syringe equipped with an ultra-fine needle under a microscope, 2 μL of stock bacterial suspension(5.69×105 cfu) for the bacterial challenge or equal volume of 0.65%NaCl for the control was administered into the peritoneal cavity. Fishwere sampled at 0, 6, 12, 24 and 48 h post injection from the bacterialchallenged and the vehicle control fish. Liver isolated from each fishwas frozen immediately in liquid nitrogen and stored at −80 °C fortotal RNA extraction (n=3, each replicate was pooled from 2 fish).

Total RNAwas extracted using the TRIzolmethod, then reverse tran-scribed into cDNA using the One-Step TaKaRa Primescript™ RT ReagentKit (TaKaRa). Briefly, q-PCR assays were performed using the fluores-cent dye Power SYBR Green PCR Master Mix and ABI 7500 System.Gene-specific primers (Table 1) were designedwith the Primer ExpressSoftware v3.0. The 18S rRNAwas used as the reference gene, and the q-PCR was conducted as previously described (Bo et al., 2011). Therelative magnitudes of expression (fold change) of the tested genes,were calculated using the relative expression software (ABI), based onthe 2−ΔΔCT method (Livak and Schmittgen, 2001).

2.9. Statistical analysis

All results were presented as mean±standard deviation (SD), andthe statistical procedures were conducted using IBM SPSS Statistics17.0. The magnitude of gene expression in bacterial-challenged fish wasexpressed as the fold change relative to the value of the vehicle control.If necessary, data were normalized by log-transform. Differences of rela-tive gene expression among treatments were evaluated by one-wayANOVA followed by Tukey's test. Differences were considered to besignificant when pb0.05.

3. Results

3.1. Sequencing and analysis of clones from the SSH library

Two subtracted cDNA libraries (a forward and a reverse) weregenerated from the livers of male O. melastigma challenged with V. para-haemolyticus. A total of 1278 clones were sequenced, and using the NCBI

BLAST search among the clones, 396 translatable DNA sequences werepredicted to be proteins, and the putative amino acid sequences weresearched for conserved domains using CD-Search with creditableexpectation values (E-value≤10−5) (Table 2). These 396 genes werecategorized, using AmiGO against the Gene Ontology database, intoeight functional groups in association with different biological processesas follows: 38 (9.6%) were involved in the immune system; 22 (5.6%) inbiological regulations; 98 (24.7%)were associatedwith cellularmetabolicprocesses; 19 (4.8%) as responses to stimuli; 9 (2.3%) cellular componentorganization; 10 (2.5%) signal transduction; 11 (2.8%) transport process-es, and 189 (47.7%) were unknown and thus not classified. Seventeengenes [C1q, C3-2, C4, C5, C8, BF, HF, MBL2, MASP, C1 inhibitor, C1q-like23 kDa protein, complement C1q-like protein 4 precursor, coagulationfactor X (F10), coagulation factor II (F2), kininogen 1 (KNG1), fibrinogenbeta chain (FGB), fibrinogen gamma chain (FGG)], which are involvedin the four complement pathways associated with primary defenseagainst bacterial infection, were identified in O. melastigma.

3.2. Analysis of expression pattern of the complement genes in liver usingq-PCR

Pathway analysis conducted with DAVID showed that the comple-ment and coagulation cascades seemed to be more important thanother analyzed pathways, such as, the ribosome pathway, galactosemetabolism and systemic lupus erythematosus pathway, (Table 3).Ten genes (C1q, C3-2, C4, C5, C8, BF, HF, MBL2, MASP and C1 inhibitor)obtained from the SSH library were speculated to be involved in thethree complement activation pathways: classical pathway (C1q, C4,C3-2), alternative pathway (BF, HF, C3-2) and lectin pathway (MBL2,MASP, C4, C3-2) and involved in cell lysis (C5, C8) (Fig. 1).

Transcriptional profiles for the ten complement-related genes in theliver of male O. melastigmawere determined by q-PCR after being chal-lenged with V. parahaemolyticus from 6 h to 48 h (Table 4). There was astatistically significant, time-dependent up-regulation with respect tothe saline control group for the genes C3-2, C4 and HF. Expression ofC3-2 was small (0.9-fold and 1.1-fold, respectively) at 6 h and 12 h,and it was 2.8-fold (pb0.05) greater 24 h after bacterial challenge.Expression of C4 was up-regulated (6.8- and 2.8-fold, respectively) 12and 24 h after the bacterial challenge. Expression of HF was 2.4-fold(pb0.05) greater 48 h after infection. Conversely, transcription ofMASPwas less at all the sampled pointswith theminimum transcriptionlevel of 0.35-fold (pb0.05) at 48 h. No significant changes wereobserved for C5, C8, BF, MBL2 and C1 inhibitor. Expression of C1q wasnot detectable in males at any of the exposure times.

4. Discussion

Most of the 38 immune-relevant genes (including complementcomponents, clotting molecules, anti-proteases, lectins, lysozyme,antimicrobial peptide hepcidin etc.) identified by SSH are involvedin the acute phase response (APR). This suggests that a successfulbacteria-induced immune reaction was elicited and informationobtained from this study will provide useful insights into the immunemechanism (especially for innate immune response) using O. mela-stigma as a potential marine fish model.

4.1. Immune process

The APR is a set of metabolic and physiological reactions occurringin the host in response to tissue infection or injury and is a crucialcomponent of the innate immune response. The APR is best charac-terized by changes in concentrations of a group of plasma proteinsknown as acute phase proteins (APPs) which are mainly synthesizedin the liver and serve as defense molecules in the innate immune sys-tem (Bayne et al., 2001; Peatman et al., 2007). The genes expressed ascomponents of the APR were obtained from the SSH library (Table 2)

Table 1Primers used for quantitative real time PCR analysis.

Gene name Primer sequence (forward and reverse)(5′→3′)

Product length(bp)

C1q F: ATGGGCCAGCGTGGGACCT 235R: GCTGGCCTGTGTGCCAGCTT

C3-2 F: GGTCAAGAGTGAATGGAATGCCTA 176R: CTAACAGAAACAAGATGGAGAGCC

C4 F: GGCTGGAGTATGAGCAAGGCGG 72R: TGGTCTTCTCGTCTCCGTTGCAGT

C5 F: GGCGTGCACACCCTGAGCTT 103R: TCACCTCCCGCCTCACTCCT

C8 F: AGAAGCCCAAGGCCAACCCG 178R: TGGTCCGAGGCAGAGGAGCG

HF F: GCCGCCAATCCCGGGAACAA 121R: GGCGCCGGTGGTTTCCATGT

BF F: TGGCGGTGAGAGGGAGCACA 107R: GGGTTCCCCAGCTGACCAATGC

MASP F: GAGCGCGATCCTCTCACGCC 100R: AGAGCACTCCGGCGTCACCA

MBL2 F: CTGCAGCTTTGCCGCCATCG 113R: GCAGCTGGCAGTGCTCCACA

C1 inhibitor F: GCTGGGTGGCCAACAAGACCA 69R: GCTCCGTGCTGGGTGGAACC

18S F: CCTGCGGCTTAATTTGACCC 134R: GACAAATCGCTCCACCAACT

193J. Bo et al. / Comparative Biochemistry and Physiology, Part D 7 (2012) 191–200

Author's personal copy

Table 2Categorization of potential functional genes screened from the marine medaka O. melastigma SSH library according to GO annotation.

Gene name GenBank accession no. Species with homology to Length (bp) E-value (Blastp)

1. Immune processes (38 genes)Alpha-1-antitrypsin HM137115 Pseudopleuronectes americanus 552 2.00E−36Alpha-2-macroglobulin HM137129 Ctenopharyngodon idella 496 2.00E−64Antithrombin III HM137172 Takifugu rubripes 520 2.00E−57C1 inhibitor HQ144247 Larimichthys crocea 870 1.00E−99C1q-like 23 kDa protein HM137123 Neoditrema ransonnetii 1001 7.00E−55Coagulation factor X HM137116 Osmerus mordax 630 1.00E−41Coagulin factor II HM137108 Larimichthys crocea 874 1.00E−125Complement C1q-like protein 4 precursor HM137122 Salmo salar 735 1.00E−41Complement component 1, q subcomponent-like 4 like HM137118 Danio rerio 649 3.00E−21Complement component 4 (within H-2S) HM137120 Oryzias latipes 584 1.00E−80Complement component C3-2 HM137119 Oryzias latipes 1181 9.00E−158Complement component C5 HM137121 Oncorhynchus mykiss 511 3.00E−34Complement component C8 gamma chain HM137124 Salmo salar 410 2.00E−26Complement factor B HM137125 Oryzias latipes 688 6.00E−78Complement factor H precursor HQ144249 Oncorhynchus mykiss 481 1.00E−19Complement factor properdin HQ144250 Danio rerio 598 2.00E−27Complement regulatory plasma protein HM137126 Paralabrax nebulifer 512 1.00E−12C-type lysozyme GU980929 Oryzias latipes 554 1.00E−62Ferritin heavy chain HM137113 Chionodraco rastrospinosus 749 3.00E−88Ferritin, middle subunit HQ144243 Anoplopoma fimbria 798 3.00E−90Hepcidin-like precursor HM562669 Pagrus major 609 1.00E−17Interleukin-1 receptor type II HM137114 Paralichthys olivaceus 496 2.00E−49Kininogen-1 precursor HM137130 Esox lucius 1163 8.00E−53Lectin, mannose-binding 2 HM137110 Danio rerio 262 1.00E−41Leukocyte cell-derived chemotaxin 2 HM137127 Lates calcarifer 480 3.00E−60Lipopolysaccharide-binding protein HM137117 Paralichthys olivaceus 362 3.00E−43LMP2 HM137128 Oryzias latipes 618 3.00E−39Mannose-binding lectin-associated serine protease-3b HM137111 Xenopus laevis 787 2.00E−23Precerebellin-like protein HQ144248 Oncorhynchus mykiss 908 2.00E−32Proteoglycan 4 HM137131 Danio rerio 521 2.00E−55SAM domain and HD domain-containing protein 1 HM137112 Danio rerio 428 5.00E−61Secreted immunoglobulin domain 4 HQ144244 Danio rerio 760 2.00E−66Serine/cysteine proteinase inhibitor HM137109 Xiphophorus hellerii 638 1.00E−62Serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7 HQ144246 Danio rerio 525 1.00E−15Skin mucus lectin HM137133 Platycephalus indicus 534 5.00E−31Serotransferrin precursor JF437716 Oryzias latipes 710 8.00E−110Vitronectin protein HQ144245 Oncorhynchus mykiss 374 1.00E−06Warm-temperature-acclimation-related-65 kDa-protein-like-protein HM137132 Oryzias latipes 936 1.00E−362

2. Cellular metabolic processes (98 genes)14 kDa apolipoprotein HM137237 Epinephelus coioides 701 1.00E−3914 kDa apolipoprotein JF437717 Perca flavescens 391 3.00E−293-oxo-5-beta-steroid 4-dehydrogenase HM137207 Anoplopoma fimbria 784 6.00E−13340S ribosomal protein S17 HM137256 Salmo salar 503 2.00E−7140S ribosomal protein S18 HM137229 Pagrus major 759 1.00E−2940S ribosomal protein S8 HM137267 Anoplopoma fimbria 251 3.00E−3560S acidic ribosomal protein P0 HM137214 Anoplopoma fimbria 1086 2.00E−14860S ribosomal protein L38 HM137217 Salmo salar 539 3.00E−35Acidic ribosomal protein P0 HM137286 Xenopus laevis 731 4.00E−94Adenylate kinase isoenzyme 2, mitochondrial JF437718 Salmo salar 711 1.00E−65Aldehyde dehydrogenase 9A1 HM137226 Oryzias latipes 459 3.00E−79Aldolase B HM137209 Poecilia reticulata 1121 0.00E+00Allantoicase HM137258 Danio rerio 935 5.00E−95Alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase HM137254 Salmo salar 535 1.00E−77Alpha-N-acetylgalactosaminidase HM137239 Salmo salar 1197 2.00E−121AN1, ubiquitin-like, homolog HM137252 Rattus norvegicus 743 2.00E−71Apolipoprotein A-I HM137242 Morone saxatilis 999 2.00E−61Apolipoprotein A-IV precursor HM137283 Bos taurus 821 6.00E−09Apolipoprotein B HM137228 Salmo salar 950 7.00E−60Apolipoprotein C-I HM137222 Solea senegalensis 524 2.00E−10Atg12 protein HM137251 Danio rerio 486 5.00E−48Beta-hydroxysteroid dehydrogenase type 3 HM137206 Oryzias latipes 163 8.00E−21Biotinidase HM137230 Danio rerio 873 1.00E−41Biotinidase precursor HM137240 Perca flavescens 574 5.00E−59Biquitin-conjugating enzyme E2Q 1 (Ube2q1) HM137272 Danio rerio 96 2.00E−11Carnitine acetyltransferase JF437719 Danio rerio 160 3.00E−18Cathepsin F HM137210 Paralichthys olivaceus 1190 7.00E−137Choriogenin H HM137235 Oryzias latipes 1325 4.00E−63Choriogenin L HM137269 Oryzias melastigma 660 2.00E−113ClpX caseinolytic protease X homolog HM137224 Danio rerio 736 1.00E−79Cytochrome c oxidase subunit 5A, mitochondrial precursor HM137247 Salmo salar 433 5.00E−61Cytochrome c oxidase subunit I HM137276 Aplocheilus panchax 601 1.00E−12Cytochrome c oxidase subunit II HM137277 Anolis carolinensis 116 2.00E−11Cytochrome c oxidase subunit III JF437720 Oryzias latipes 814 2.00E−44

194 J. Bo et al. / Comparative Biochemistry and Physiology, Part D 7 (2012) 191–200

Author's personal copy

Table 2 (continued)

Gene name GenBank accession no. Species with homology to Length (bp) E-value (Blastp)

Cytochrome c oxidase subunit VIa precursor HM137205 Thunnus obesus 498 2.00E−37Cytochrome c oxidase, subunit Va HM137249 Xenopus tropicalis 370 7.00E−23Cytochrome oxidase subunit I JF437721 Enicmus brevicornis 437 2.00E−11Cytochrome P450 1A JF437722 Oryzias latipes 627 1.00E−08Cytochrome P450 20A1 HM137245 Salmo salar 327 1.00E−05Cytochrome P450 2C33-like HM137208 Gadus morhua 671 9.00E−64Cytochrome P450, family 4, subfamily b, polypeptide 1 HM137281 Mus musculus 388 1.00E−13Cytosolic malate dehydrogenase A HM137211 Oryzias latipes 647 1.00E−45Dolichyl-diphosphooligosaccharide-protein glycosyltransferase HM137266 Gallus gallus 452 5.00E−29Elongation factor 1 alpha HM137282 Oryzias latipes 773 3.00E−68Elongation factor 1 gamma HM137246 Oryctolagus cuniculus 560 2.00E−76Elongation factor 2 HM137255 Salmo salar 463 5.00E−60Endonuclease-reverse transcriptase HmRTE-e01 HM137221 Heliconius melpomene 545 1.00E−35Epidermis-type lipoxygenase 3 HM137261 Salmo salar 743 6.00E−110Eukaryotic translation initiation factor 3, subunit 5 epsilon, 47 kDa HM137231 Homo sapiens 653 3.00E−100Eukaryotic translation initiation factor 3, subunit 6 interacting protein HM137244 Danio rerio 231 1.00E−36Eukaryotic translation initiation factor 3, subunit 7 zeta HM137259 Danio rerio 591 3.00E−39Eukaryotic translation initiation factor 4A, isoform 1A HM137202 Danio rerio 564 4.00E−66Farnesyl pyrophosphate synthetase HM137223 Salmo salar 513 3.00E−64F-box only protein 9 HM137218 Salmo salar 433 1.00E−43FK506-binding protein 5 (FKBP5) HM137264 Salmo salar 285 1.00E−32Fructose-1,6-bisphosphatase 1 HM137262 Anoplopoma fimbria 551 2.00E−84Glutamate dehydrogenase 1 HM137275 Danio rerio 182 6.00E−28Glyceraldehyde-3-phosphate dehydrogenase HM137236 Dicentrarchus labrax 526 3.00E−93Glyoxylate reductase/hydroxypyruvate reductase JF437723 Osmerus mordax 351 2.00E−33Growth hormone receptor HM137225 Oryzias latipes 347 7.00E−55Hepatic lipase HM137268 Pagrus major 816 2.00E−81Histidine ammonia-lyase JF437724 Danio rerio 406 1.00E−69Hydroxymethylglutaryl-CoA lyase HM137233 Takifugu rubripes 430 4.00E−24Hydroxysteroid (17-beta) dehydrogenase 4 HM137203 Fundulus heteroclitus 814 5.00E−139Hypoxanthine phosphoribosyltransferase HM137241 Solea senegalensis 532 1.00E−81Ribosomal protein L27a JF437725 Epinephelus coioides 356 5.00E−48Inositol polyphosphate-5-phosphatase A HM137260 Danio rerio 725 2.00E−40Integral membrane protein 1 HM137265 Bos taurus 283 5.00E−40Inter-alpha (globulin) inhibitor H3 HM137199 Danio rerio 241 3.00E−19Ketodihydrosphingosine reductase HM137285 Danio rerio 1008 9.00E−164Lipocalin HM137238 Perca flavescens 176 6.00E−17Membrane-associated ring finger (C3HC4) 5 HM137253 Danio rerio 864 2.00E−93Methionyl aminopeptidase 2 HM137248 Danio rerio 508 3.00E−17Methyltransferase Mb3374 HM137220 Salmo salar 933 2.00E−20NADH dehydrogenase subunit 4 HM137215 Oryzias latipes 487 1.00E−17Ornithine aminotransferase HM137271 Salmo salar 290 1.00E−42Peroxisomal trans-2-enoyl-CoA reductase HM137250 Salmo salar 578 2.00E−82Phosphotriesterase-related protein HM137280 Salmo salar 567 6.00E−84Protein-O-mannosyltransferase 2 HM137273 Danio rerio 582 8.00E−27Purine nucleoside phosphorylase HM137212 Esox lucius 832 2.00E−95Ribosomal protein L13 HM137201 Solea senegalensis 249 2.00E−25Ribosomal protein L22 HM137232 Solea senegalensis 401 3.00E−35Ribosomal protein L23 HM137227 Danio rerio 679 3.00E−40Ribosomal protein L32 HM137234 Epinephelus coioides 483 1.00E−70Ribosomal protein L37 HM137219 Solea senegalensis 181 1.00E−17Ribosomal protein L4 HM137278 Solea senegalensis 152 2.00E−20Sich73-252g14.4 protein HM137274 Danio rerio 537 4.00E−33Similar to ribosomal protein L35a HM137279 Macaca mulatta 499 7.00E−32Similar to Salivary gland secretion 1 CG3047-PA JF437726 Danio rerio 225 4.00E−12TGF-beta-inducible nuclear protein 1 HM137216 Anoplopoma fimbria 603 1.00E−70Transketolase HM137257 Salmo salar 640 6.00E−80Ubiquitin HM137204 Oncorhynchus mykiss 508 2.00E−79Ubiquitin and ribosomal protein S27a precursor HM137270 Ictalurus punctatus 348 7.00E−45Ubiquitin carboxyl-terminal hydrolase isozyme L3 HM137200 Salmo salar 707 1.00E−77Ubiquitin carboxyl-terminal hydrolase isozyme L5 HM137284 Salmo salar 228 3.00E−15Ubiquitin-conjugating enzyme E2B HM137213 Danio rerio 829 6.00E−42UDP-glucose 4-epimerase HM137263 Oncorhynchus mykiss 366 6.00E−35UDP-glucose pyrophosphorylase 2 HM137243 Danio rerio 159 5.00E−17

3. Cellular component organization and cell adhesion (9 genes)Acyl-CoA-binding protein HM137178 Oryzias latipes 303 4.00E−34Coxsackie virus and adenovirus receptor precursor JF437727 Danio rerio 354 3.00E−32Ependymin-1 precursor HM137179 Anoplopoma fimbria 672 3.00E−16G protein-coupled receptor 178 HM137182 Danio rerio 386 8.00E−30Mannose receptor C1-like protein HM137180 Danio rerio 376 2.00E−06Myocilin HM137175 Homo sapiens 306 3.00E−12Nuclear receptor 2C2-associated protein HM137176 Salmo salar 301 1.00E−31Stabilin-2 precursor HM137181 Salmo salar 285 2.00E−09Stard10 protein HM137177 Danio rerio 343 8.00E−11

(continued on next page)

195J. Bo et al. / Comparative Biochemistry and Physiology, Part D 7 (2012) 191–200

Author's personal copy

which included complement components C1q, C3-2, C4, C5, C8, BF,HF, MASP, MBL2, C1 inhibitor, properdin, alpha-2-macroglobulin,alpha-1-antitrypsin, coagulation family (coagulation factors II, XI),

ferritin, LPS binding protein (LBP), α1-anti-trypsin, lysozyme, serineprotease inhibitors, antimicrobial peptide hepcidin, and ferritin,among others, up-regulation of which is consistent with the early

Table 2 (continued)

Gene name GenBank accession no. Species with homology to Length (bp) E-value (Blastp)

4. Signal transduction (10 genes)ADP-ribosylation factor 4 HM137189 Danio rerio 481 3.00E−27Canopy-1 precursor HM137185 Salmo salar 447 3.00E−40Glucocorticoid receptor DNA binding factor 1 HM137190 Mus musculus 609 3.00E−83Insulin-like growth factor binding protein 1 HM137186 Perca flavescens 531 1.00E−54Insulin-like growth factor-I HM137184 Cyprinus carpio 302 1.00E−38IQ motif containing GTPase activating protein 2 HM137187 Xenopus laevis 437 4.00E−45Muscle-specific beta 1 integrin binding protein 2 HM137183 Epinephelus coioides 312 3.00E−43Proheparin-binding EGF-like growth factor HM137191 Salmo salar 664 8.00E−17Ras-related protein Rac1 JF437728 Brugia malayi 150 1.00E−12Retinal G protein coupled receptor HM137188 Danio rerio 671 6.00E−40

5. Transport processes (11 genes)ADP/ATP translocase 2 JF437729 Danio rerio 377 6.00E−48Alpha-type globin HM137196 Oryzias latipes 361 3.00E−33Amisyn JF437730 Homo sapiens 540 1.00E−50Gga1 protein HM137195 Danio rerio 197 9.00E−11NAC alpha (nascent polypeptide-associated complex) JF437731 Pagrus major 541 9.00E−83Organic cation transporter like HM137192 Danio rerio 513 4.00E−41Oxysterol binding protein-like 9 JF437732 Danio rerio 583 1.00E−103Solute carrier family 35, member D1 HM137194 Homo sapiens 679 2.00E−73Solute carrier organic anion transporter family, member 2A1 HM137197 Bos taurus 556 2.00E−51Syntaxin 4 HM137198 Lateolabrax japonicus 601 7.00E−60Transient receptor potential cation channel, subfamily M, member 7 HM137193 Danio rerio 403 1.00E−38

6. Response to stimulus (19 genes)Catalase HM137160 Rachycentron canadum 1174 6.00E−155Cold-inducible RNA-binding protein HM137161 Anoplopoma fimbria 455 4.00E−04Fibrinogen beta chain precursor HM137173 Larimichthys crocea 493 3.00E−71Fibrinogen gamma polypeptide HM137159 Danio rerio 681 1.00E−68Heat shock 70 kDa protein 4 HM137164 Cyprinus carpio 483 2.00E−47Heat shock 70 kDa protein 5 HM137167 Danio rerio 292 2.00E−47Heat shock protein 90 beta HM137157 Paralichthys olivaceus 148 5.00E−21Liver angiotensinogen HM137155 Rhabdosargus sarba 1201 4.00E−123Matrix metallopeptidase 13 HM137168 Sparus aurata 949 2.00E−105Matrix metalloproteinase 9 HM137171 Paralichthys olivaceus 838 1.00E−75Metallothionein HM137170 Oryzias javanicus 322 9.00E−21Mitochondrial uncoupling protein 3 HM137162 Danio rerio 871 5.00E−128Myoglobin HM137165 Tetraodon nigroviridis 627 1.00E−41Peroxiredoxin 1 HM137169 Anoplopoma fimbria 978 2.00E−104Peroxiredoxin 3 HM137174 Danio rerio 762 4.00E−104Peroxiredoxin 6 HM137166 Salmo salar 515 2.00E−70Plasminogen HM137163 Oryzias latipes 951 2.00E−159Uncoupling protein 2 HM137156 Oreochromis niloticus 713 6.00E−85Vitellogenin 1 HM137158 Oryzias latipes 520 1.00E−83

7. Biological regulations (22 genes)26S proteasome non-ATPase regulatory subunit 8 HM137135 Osmerus mordax 887 2.00E−58Activity-dependent neuroprotective protein HM137153 Mus musculus 393 1.00E−26Acyl-CoA synthetase short-chain family member 2 HM137134 Danio rerio 1183 4.00E−84Alanine-glyoxylate aminotransferase 2-like 1 HM137143 Danio rerio 756 3.00E−56Antileukoproteinase precursor HM137138 Salmo salar 314 2.00E−13Apolipoprotein A-I-binding protein precursor JF437733 Esox lucius 469 1.00E−49Apoptogenic 1 isoform 2 HM137148 Mus musculus 594 2.00E−35BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 HM137154 Anoplopoma fimbria 853 1.00E−85Ceruloplasmin HM137147 Chionodraco rastrospinosus 634 7.00E−90Cysteine-rich protein 2 HM137136 Anoplopoma fimbria 308 2.00E−41Diablo-like protein JF437734 Perca flavescens 211 6.00E−16Heart-type fatty acid binding protein HM137145 Fundulus heteroclitus 474 3.00E−48Histone deacetylase 8 HM137144 Xenopus tropicalis 686 7.00E−38Imitation switch ISWI HM137139 Xenopus laevis 541 4.00E−90Liver-basic fatty acid binding protein HM137142 Acanthopagrus schlegelii 425 6.00E−55Spen homolog, transcriptional regulator HM137140 Homo sapiens 418 2.00E−44TBT-binding protein HM137149 Tetraodon nigroviridis 617 2.00E−22Thioredoxin domain containing 5 HM137146 Danio rerio 926 1.00E−64Transforming growth factor, beta receptor III HM137141 Gallus gallus 405 1.00E−09Whey acidic protein precursor HM137152 Salmo salar 703 9.00E−24Yes-associated protein 1 HM137151 Danio rerio 449 1.00E−32Zinc finger protein 706 HM137150 Anoplopoma fimbria 428 1.00E−32

8. Unknown (189 genes)

196 J. Bo et al. / Comparative Biochemistry and Physiology, Part D 7 (2012) 191–200

Author's personal copy

stages of the innate immune system being involved in response toinvasion of microorganisms.

Hepcidin is an important antimicrobial peptide (AMP) of the in-nate immune system, and exists in various vertebrates includingfish (Krause et al., 2000; Park et al., 2001; Wang et al., 2009). Fishhepcidins possess antibacterial activity in vitro and their expressionin liver is induced following bacterial challenge (Wang et al., 2009).Our previous results show that the expression of mRNAs of hepcidinsinO.melastigmawas rapidly and remarkably up-regulated after exposureto V. parahaemolyticus. Such a response might play a role in innate de-fense during early developmental stages and post bacterial challenge(Bo et al., 2011).

Lysozyme is an enzyme that disrupts bacterial cell walls by splittingglycosidic linkages in the peptidoglycan layers. It acts directly on thewalls of Gram-positive bacteria, and on the inner peptidoglycan layersof Gram-negative bacteria, after the complement and other enzymeshave disrupted the outer walls (Yano et al., 1996). Lysozyme exists inmost tissues and secretions of fish. In toxicological studies, lysozymelevels have been most frequently examined as a sensitive response(Reynaud and Deschaux, 2006; Sanchez and Porcher, 2009). The up-regulation of transcription of lysozyme which was observed afterbacterial challenge is consistent with the results reported for fish dueto bacterial infection that has been previously reported (Ye et al.,2010). The induced lysozyme activity of O. melastigma is probablycharacteristic of antimicrobial infection in fish.

Serine proteinase inhibitors (serpins) are irreversible suicide in-hibitors of proteases that regulate blood coagulation, prophenoloxi-dase activation, pathogen digestion, apoptosis, complement systemand cellular remodeling (Chen et al., 2010). Serpins have been widelyidentified in mammals, insects, plants, microorganisms (Cao et al.,2000), amphibians (Han et al., 2008), crustaceans (Homvises et al.,2010) and teleosts (Cao et al., 2000). Serpins have also been shownto participate in responses to bacterial and viral infections in crusta-ceans and teleost fishes (Chen et al., 2010; Donpudsa et al., 2010;Homvises et al., 2010). Several serpins, such as serine proteinase in-hibitor, serine/cysteine proteinase inhibitor and alpha1-antitrypsinwere isolated from the SSH library (Table 2). The greater expressionof serpins from O. melastigma challenged with bacteria indicatesthat these proteinase inhibitors might function in protecting thehost from bacterial infection.

Kinetics of the APR are such that the quantities of specific transcriptspresent in the cell starting an hour or less after the initiating stimulusand lasting for several days thereafter reflect the ARP ‘status’ of theorganism (Bayne and Gerwick, 2001). It has been suggested that the

APR of fish could be a potential biomarker for environmental insults(the presence of toxins, other pollutants, pathogens or parasites, or ofreporting other environmental perturbations) and as an index of fishhealth status (Bayne and Gerwick, 2001). Molecules that are compo-nents of the APR that were obtained from the SSH library, will contrib-ute to improvements in monitoring fish health and predicting theimpact of environmental stresses on fish populations.

4.2. Cellular metabolic process

Ninety eight genes that were involved in the cell metabolic processwere identified from the SSH library, and these genes constituted nearlyone-quarter of the total differentially expressed genes. It is interestingthat some genes, such as apolipoprotein and cathepsin, not only takepart in the cellular metabolic process but are also involved in theimmune process.

Four genes encoding apolipoprotein (apolipoproteins A-I, A-IV, B andC-I) were up-regulated in the forward SSH library in response to bacteri-al infection. Apolipoproteins bind to lipids to form lipoproteins, whichtransport the lipids through the lymphatic and circulatory systems. Theprimary role of apolipoprotein A-I is reverse cholesterol transport, apathway by which cholesterol is transported from extra hepatic cells tothe liver for excretion. However, some researchers have demonstratedthat apolipoprotein A-I could play a role in innate defense against bacte-rial pathogens or virus in teleosts (Franca et al., 2006; Villarroel et al.,2007; Johnston et al., 2008). Up-regulation of the apolipoprotein familyhomology in this study might indicate a possible role of this familybeing involved in anti-microbial infection.

Cysteine proteases, including the papain family, are a widespreadgroup of proteolytic enzymes that catalyze the hydrolysis of manydifferent proteins and play a role in intracellular protein degradationand turnover (Ahn et al., 2009). Cathepsin F is a papain-like cysteineprotease that has been shown to play a role in innate defense inParalichthys olivaceus when stimulated by LPS (Ahn et al., 2009).Other members of the cathepsin family such as cathepsin K, and ca-thepsin B in some fishes are also involved in innate immune response(Zhang et al., 2008; Harikrishnan et al., 2010). In this study, greaterexpression of cathepsin F gene transcripts post V. parahaemolyticuschallenge suggest a putative role in the immune defense againstbacterial infection. The dual functions of apolipoproteins and cathep-sin F in O. melastigma, being involved in both metabolism andimmune defense against microbial infection, still need to be furtherelucidated.

Table 3Results of DAVID pathway analysis using the KEGG pathway database. The Y-axis is the Benjamini FDR p value (− log10) and the X-axis shows the different biological pathways.

197J. Bo et al. / Comparative Biochemistry and Physiology, Part D 7 (2012) 191–200

Author's personal copy

4.3. Complement gene expression in bacteria-challenged O. melastigma

The complement system is amajor part of innate immunity, which isprimarily involved in killing pathogenic microorganisms. In mammals,the complement system is composed of more than 35 soluble andmembrane-bound proteins that recognize and clear microbes (Hollandand Lambris, 2002; Gonzalez et al., 2007). Fifteen components ofcomplement system sequences were obtained from our O. melastigmaSSH library. They are marked with stars in Fig. 1 which has formed ahypothetical platform useful for further validation of complement andcoagulation pathway cascades for O. melastigma.

Inmammals and teleosts, C3 is a central complement component andis part of all the four complement activation pathways, and proceedsthrough a lytic pathway that leads to formation of a membrane attack

complex (MAC) including C6–C9, which can directly lyse microbialcells. Expression of C3-2 was induced gradually in O. melastigma from6 h to 48 h following bacterial challenge.

In the classical pathway, no transcripts of C1q were detected in malefish at any of the durations after infection (Table 3). C1 initiates CCP, andCCP is triggered by binding of antibody to cell surfaces (Holland andLambris, 2002). In teleosts, the acquired immune system is not well-developed, and it takes longer to activate the CCP pathway. For example,expression of the three different immunoglobulin genes (IgM, IgD andIgZ) is significantly different between 2 and 8 weeks after stimulationwith the bacterium Flavobacterium columnare of mandarin fish(Siniperca chuatsi) (Tian et al., 2009). In Epinephelus coioides, significant-ly greater expression of IgM gene transcripts was observed at 2, 4 and5 weeks after infection with the bacterium Vibrio alginolyticus (Cui et

Fig. 1. The speculated complement pathways in marine medaka O. melastigma. The stars indicate the genes that have been obtained from our SSH library.Adapted from the KEGG pathway database.

198 J. Bo et al. / Comparative Biochemistry and Physiology, Part D 7 (2012) 191–200

Author's personal copy

al., 2010). Therefore, it is not unexpected that no expression of C1qmRNA was observed within 48 h after bacterial challenge. C4 can beactivated through the classical or lectin pathways (Boshra et al., 2006),and in the present study expression of the C4 gene was significantlyup-regulated 12 h and 24 h following bacterial challenge. It takes longerfor activation of classical pathway after bacterial infection (Tian et al.,2009; Cui et al., 2010), therefore it is possible that C4 is activatedthrough the lectin pathway ensuring early stages of response ofbacteria-challenged O. melastigma.

Activation of the alternative pathway is believed to be initiated byspontaneous hydrolysis of the thiolester bond of C3. Hydrolyzed C3binds to factor B (BF), making the latter susceptible to proteolyticattack by factor D, leading to the formation of alternative pathwayC3 convertase from C3 and B. There was no significantly induced BFfrom 6 h to 48 h after bacterial challenge. This result may indicatethat activation of alternative pathway is later at the early stages ofresponses of O. melastigma to bacteria.

Expression ofmRNA for C5 and C8 increase from6 h to 48 h after bac-terial challenge, although there was no statistically significant differencebetween the challenged and controlfish. Both C5 andC8 are downstreammolecules, which are involved in lysis of cells, and their responses weredetectable after 48 h.

Comparing the pattern of transcription of genes involved in thethree complement activation pathways, it is speculated that activationof LCP occurs earlier than that of CCP and ACP in O. melastigma chal-lenged with bacteria. However, the complement operating via the ACPpathway was already competent in the response of hatched larvae ofDanio rerio to a challenge with LPS (Wang et al., 2008). It appears thatthe role of the different complement activation pathways is differentdue to the mode of exposure or the species studied.

In the lectin activation pathway, mannose-binding lectin (MBL)binds to the surface of pathogens through mannose-binding lectin-associated serine protease (MASP), which results in opsonization andantimicrobial protection (Fujita et al., 2004). The results of the currentstudy showed that expression of MASP was induced during the earlystage (6 h) and subsequently down-regulated in marine medaka afterbacterial challenge (48 h). These results are consistent with thoseobserved in common carp (Cyprinus carpio L.) after infection with theparasite Ichthyophthirius multifiliis (Gonzalez et al., 2007). Hosts havedeveloped several systems including complement component systemsto prevent pathogens. Correspondingly, pathogens have also evolvedmulti-strategies to survive. Host–pathogen interactions are a result ofmutual inhibition, evasion and adaptation strategies, and the co-evolution of host cationic AMP and microbial resistance also has beenreported (Peschel and Sahl, 2006). Therefore, the depressed expressionof theMASPmight be part of the bacterial counter-measure to avoid theactivation of the complement system.

Recently, the complement system has been used to assess immuno-modulation in rainbow trout and humans after the host was exposed

by environmental contaminants 17 Beta-estradiol or DDT (bis [4-chlorophenyl]-1,1,1-trichloroethane) (Dutta et al., 2008; Wenger et al.,2011). The results of the present study support the feasibility of develop-ing O. melastigma as an alternative model to understand the basicbiological processes related to immune function in marine fish, howeverthe immunomodulation of the complement system of O. melastigmaexposed to xenobiotics still needs to be further investigated.

Acknowledgments

This work was partially supported by the Area of Excellence Schemeunder the University Grants Committee of the Hong Kong SpecialAdministration Region, China (project no. AoE/P-04/2004), the StateKey Laboratory in Marine Pollution (City University of Hong Kong) andthe Hong Kong–France Research Collaboration Grant (No. 9231003) toD.W.T. Au. Prof. J. Giesywas supported by the Canada Research Chair pro-gram, an at large Chair Professorship at the Department of Biology andChemistry and State Key Laboratory in Marine Pollution, City Universityof Hong Kong, the Einstein Professor Program of the Chinese Academyof Sciences and the Distinguished Professor Program of King SaudUniversity.

References

Ahn, S.F., Kim, N.Y., Seo, J.S., Je, J.E., Sung, J.H., Lee, S.H., Kim, J.K., Chung, J.K., Lee, H.H.,2009. Molecular cloning, mRNA expression and enzymatic characterization ofcathepsin F from olive flounder (Paralichthys olivaceus). Comp. Biochem. Physiol.B 154, 211–220.

Amara, U., Rittirsch, D., Flierl,M., Bruckner, U., Klos, A., Gebhard, F., Lambris, J.D., Huber-Lang,M., 2008. Interaction between the coagulation and complement system. Adv. Exp. Med.Biol. 632, 71–79.

Ashburner, M., Ball, C.A., Blake, J.A., Botstein, D., Butler, H., Cherry, J.M., et al., 2000.Gene ontology: tool for the unification of biology. The Gene Ontology Consortium.Nat. Genet. 25, 25–29.

Bayne, C.J., Gerwick, L., Fujiki, K., Nakao, M., Yano, T., 2001. Immune-relevant (includingacute phase) genes identified in the livers of rainbow trout, Oncorhynchus mykiss,by means of suppression subtractive hybridization. Dev. Comp. Immunol. 25,205–217.

Bayne, C.J., Gerwick, L., 2001. The acute phase response and innate immunity of fish.Dev. Comp. Immunol. 25, 725–743.

Bo, J., Cai, L., Xu, J.H.,Wang, K.J., Au, D.W.T., 2011. ThemarinemedakaOryziasmelastigma—a potential marine fishmodel for innate immune study.Mar. Pollut. Bull. 63, 267–276.

Boshra, H., Li, J., Sunyer, J.O., 2006. Recent advances on the complement system of teleostfish. Fish Shellfish Immunol. 20, 239–262.

Cai, J., Han, Y., Wang, Z., 2006. Isolation of Vibrio parahaemolyticus from abalone (Haliotisdiversicolor supertexta L.) postlarvae associated with mass mortalities. Aquaculture257, 161–166.

Camp, K.L., Wolters, W.R., Rice, C.D., 2000. Survivability and immune responses afterchallenge with Edwardsiella ictaluri in susceptible and resistant families of channelcatfish, Ictalurus punctatus. Fish Shellfish Immunol. 10, 475–487.

Cao, M.J., Osatomi, K., Matsuda, R., Ohkubo, M., Hara, K., Ishihara, T., 2000. Purificationof a novel serine proteinase inhibitor from the skeletal muscle of white croaker(Argyrosomus argentatus). Biochem. Biophys. Res. Commun. 272, 485–489.

Chen, F.Y., Liu, H.P., Bo, J., Ren, H.L., Wang, K.J., 2010. Identification of genes differentiallyexpressed in hemocytes of Scylla paramamosain in response to lipopolysaccharide.Fish Shellfish Immunol. 28, 167–177.

Table 4Transcriptional profiles for complement genes in V. parahaemolyticus challenged O. melastigma by q-PCR. Expression of genes in the liver was expressed as fold change relative tothe average value of the vehicle control. Data are expressed as mean±SD (n=3). ND indicates non-detectable expression.

Gene name Time of post bacterial challenge (h)

6 12 24 48

C1q ND ND ND NDC3-2 0.88±0.32 1.11±0.48 2.76±0.36⁎ 1.72±0.65C4 0.95±0.27 6.83±1.45⁎ 2.84±0.52⁎ 3.06±1.63C5 1.29±0.55 0.95±0.26 1.16±0.41 1.53±0.44C8 0.71±0.20 0.66±0.23 1.51±0.62 1.36±0.40HF 0.83±0.28 1.34±0.65 1.28±0.61 2.42±0.38⁎

BF 0.76±0.31 0.83±0.44 1.53±0.54 1.76±0.62MASP 1.97±1.42 1.49±0.28 0.47±0.18 0.35±0.06⁎

MBL2 0.58±0.18 0.92±0.41 1.88±1.37 1.90±1.0C1 inhibitor 0.44±0.15 1.54±0.58 1.77±0.68 2.14±1.49

⁎ Indicates statistically significant at pb0.05.

199J. Bo et al. / Comparative Biochemistry and Physiology, Part D 7 (2012) 191–200

Author's personal copy

Cui, M., Zhang, Q., Yao, Z., Zhang, Z., Zhang, H., Wang, Y., 2010. Immunoglobulin M geneexpression analysis of orange-spotted grouper, Epinephelus coioides, following heatshock and Vibrio alginolyticus challenge. Fish Shellfish Immunol. 29, 1060–1065.

Donpudsa, S., Ponprateep, S., Prapavorarat, A., Visetnan, S., Tassanakajon, A.,Rimphantitchayakit, V., 2010. A Kazal-type serine proteinase inhibitor SPIPm2from the black tiger shrimp Penaeus monodon is involved in antiviral responses.Dev. Comp. Immunol. 34, 1101–1108.

Dutta, R., Mondal, A.M., Arora, V., Nag, T.C., Das, N., 2008. Immunomodulatory effect ofDTT (bis [4-chlorophenyl]-1,1,1-trichloroethane) on complement system andmacrophages. Toxicology 252, 78–85.

Franca, R., Spidery, S., Maga, G., 2006. APOBEC deaminases as cellular antiviral factors: anovel natural host defense mechanism. Med. Sci. Monit. 12, 92–98.

Fujita, T., Matsushita, M., Endo, Y., 2004. The lectin-complement pathway — its role ininnate immunity and evolution. Immunol. Rev. 198, 185–202.

Gonzalez, S.F., Buchmann, K., Nielsen, M.E., 2007. Complement expression in commoncarp (Cyprinus carpio L.) during infection with Ichthyophthirius multifiliis. Dev.Comp. Immunol. 31, 576–586.

Han, Y., Yu, H., Yang, X., Rees, H.H., Liu, J., Lai, R., 2008. A serine proteinase inhibitorfrom frog eggs with bacteriostatic activity. Comp. Biochem. Physiol. B 149, 58–62.

Harikrishnan, R., Kim, M.C., Kim, J.S., Han, Y.J., Jang, I.S., Balasundaram, C., Heo, M.S.,2010. Immune response and expression analysis of cathepsin K in goldfish duringAeromonas hydrophila infection. Fish Shellfish Immunol. 28, 511–516.

Holland, M.C.H., Lambris, J.D., 2002. The complement system in teleost. Fish ShellfishImmunol. 12, 399–420.

Homvises, T., Tassankajon, A., Somboonwiwat, K., 2010. Penaeus monodon SERPIN,PmSERPIN6, is implicated in the shrimp innate immunity. Fish Shellfish Immunol.29, 890–898.

Inadera, H., 2006. The immune system as a target for environmental chemicals:xenoestrogens and other compounds. Toxicol. Lett. 164, 191–206.

Johnston, L.D., Brown, G., Gauthier, D., Reece, K., Kator, H., Veld, P.V., 2008. ApolipoproteinA-I from striped bass (Morone saxatilis) demonstrates antibacterial activity in vitro.Comp. Biochem. Physiol. B 151, 167–175.

Kong, R.Y.C., Giesy, J.P., Wu, R.S.S., Chen, X.H., Chiang, M.W.L., Lim, P.L., Yuen, B.B.H., Yip,B.W.P.,Mok, H.O.L., Au, D.W.T., 2008. Development of amarine fishmodel for studyingin vivo molecular responses in ecotoxicology. Aquat. Toxicol. 86, 131–141.

Krause, A., Neitz, S., Mägert, H.J., Schulz, A., Forssmann, W.G., Schulz-Knappe, P.,Adermann, K., 2000. LEAP-1, a novel highly disulfide-bonded human peptide,exhibits antimicrobial activity. FEBS Lett. 480, 147–150.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-timequantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408.

Magnadottir, B., 2004. Innate immunity of fish (overview). Fish Shellfish Immunol. 20,137–151.

Marchler-Bauer, A., Bryant, S.H., 2004. CD-Search: protein domain annotations on thefly. Nucleic Acids Res. 32, W327–W331.

Mayilyan, K.R., Arnold, J.N., Presanis, J.S., Soghoyan, A.F., Sim, R.B., 2006. Increased comple-ment classical andmannan-binding lectin pathway activities in schizophrenia. Neurosci.Lett. 404, 336–341.

Park, C.H., Valore, E.V., Waring, A.J., Ganz, T., 2001. Hepcidin, a urinary antimicrobialpeptide synthesized in the liver. J. Biol. Chem. 276, 7806–7810.

Peatman, E., Baoprasertkul, P., Terhune, J., Xu, P., Nandi, S., Kucuktas, H., Wang, S.,Somridhivej, B., Dunham, R., Liu, Z., 2007. Expression analysis of the acute phase re-sponse in channel catfish (Ictalurus punctatus) after infection with a Gram-negativebacterium. Dev. Comp. Immunol. 31, 1183–1196.

Peschel, A., Sahl, H.G., 2006. The co-evolution of host cationic antimicrobial peptidesand microbial resistance. Nat. Rev. Microbiol. 4, 529–536.

Reynaud, S., Deschaux, P., 2006. The effects of polycyclic aromatic hydrocarbons on theimmune system of fish: a review. Aquat. Toxicol. 77, 229–238.

Sanchez, W., Porcher, J.M., 2009. Fish biomarkers for environmental monitoring withinthe Water Framework Directive of the European Union. Trends Anal. Chem. 28,150–158.

Shen, M., Xu, J., Tsang, T.Y., Au, D.W., 2010. Toxicity comparison between Chattonellamarina and Karenia brevis using marine medaka (Oryzias melastigma): evidenceagainst the suspected ichthyotoxins of Chattonella marina. Chemosphere 80,585–591.

Tian, J., Sun, B., Luo, Y., Zhang, Y., Nie, P., 2009. Distribution of IgM, IgD and IgZ inmandarinfish, Siniperca chuatsi lymphoid tissues and their transcriptional changes afterFlavobacterium columnare stimulation. Aquaculture 288, 14–21.

Villarroel, F., Bastias, A., Casado, A., Amthauer, R., Concha, M.I., 2007. ApolipoproteinA-I, an antimicrobial protein in Oncorhynchus mykiss: evaluation of its expressionin primary defence barriers and plasma levels in sick and healthy fish. Fish Shell-fish Immunol. 23, 197–209.

Villeneuve, D.L., Garcia-Reyero, N., 2011. Vision & strategy: predictive ecotoxicology inthe 21st century. Environ. Toxicol. Chem. 30, 1–8.

Wang, K.J., Cai, J.J., Cai, L., Yang, M., Zhang, M., 2009. Cloning and expression of a hepcidingene from a marine fish (Pseudosciaena crocea) and the antimicrobial activity of itssynthetic peptide. Peptides 30, 638–646.

Wang, M., Wang, Y., Wang, J., Lin, L., Hong, H., Wang, D., 2011. Proteome profiles in medaka(Oryziasmelastigma) liver and brain experimentally exposed to acute inorganicmercury.Aquat. Toxicol. 103, 129–139.

Wang, Z., Zhang, S., Wang, G., 2008. Response of complement expression to challengewith lipopolysaccharide in embryos/larvae of zebrafish Danio rerio: acquisition ofimmunocompetent complement. Fish Shellfish Immunol. 25, 264–270.

Wenger, M., Sattler, U., Goldschmidt-Clermont, E., Segner, H., 2011. 17 Beta-estradiolaffects the response of complements and survival of rainbow trout (Oncorhynchusmykiss) challenged by bacterial infection. Fish Shellfish Immunol. 31, 90–97.

Whyte, S.K., 2007. The innate immune response offinfish— a review of current knowledge.Fish Shellfish Immunol. 23, 1127–1151.

Yano, H., Yoshimoto, H., Ohtsuru, A., Ito, M., Yamashita, S., Fujii, T., 1996. Characterizationof cultured rat embryonic palatal mesenchymal cells. Cleft Palate Craniofac. J. 33,379–384.

Ye, X., Zhang, L., Tian, Y., Tan, A., Bai, J., Li, S., 2010. Identification and expression analysis ofthe g-type and c-type lysozymes in grass carp Ctenopharyngodon idellus. Dev. Comp.Immunol. 34, 501–509.

Zhang, F.T., Zhang, Y.B., Chen, Y.D., Zhu, R., Dong, C.W., Li, Y.Y., Zhang, Q.Y., Gui, J.F.,2008. Expressional induction of Paralichthys olivaceus cathepsin B gene in responseto virus, poly I:C and lipopolysaccharide. Fish Shellfish Immunol. 25, 542–549.

200 J. Bo et al. / Comparative Biochemistry and Physiology, Part D 7 (2012) 191–200