Top Banner
Identification and Identification and quantification of Fusarium species by molecular tools species by molecular tools Sonja Sletner Klemsdal Bioforsk Plant Health and Plant Protection Division Genetics and Biotechnology Dep.
34

Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Apr 15, 2018

Download

Documents

ngohanh
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Identification and Identification and quantification of Fusarium species by molecular toolsspecies by molecular tools

Sonja Sletner Klemsdal

Bioforsk

Plant Health and Plant Protection Division

Genetics and Biotechnology Dep.gy p

Page 2: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Identification of a Fusarium culture or in the plantp

Page 3: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species
Page 4: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Grains with no visible •Grains with no visible symptoms might also contain hi h l l f i high levels of Fusarium, e.g. F. langsethiae

Page 5: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

DNA based diagnosis

- Microarray

- DNA sequence analysis

Standard PCR- Standard PCR

- Nested PCRNested PCR

- Real time PCR

Page 6: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

DNA based diagnosis

- Microarray

- DNA sequence analysisDNA sequence analysis

- Standard PCR

N t d PCR- Nested PCR

- Real time PCR

14 trichothecene and fumonisinproducing Fusarium in one array (Kristensen et al. 2007)y ( )

Page 7: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

DNA based diagnosis

- Microarray

DNA l i- DNA sequence analysis

- Standard PCR

- Nested PCR

- Real time PCR

1. PCR amplification

2. DNA sequencing

3 Compare to DNA sequence databases3. Compare to DNA sequence databases

NCBI GenBank http://www.ncbi.nlm.nih.gov/p g

Fusarium ID http://fusarium.cbio.psu.edu/

Can we trust the accessions in the GenBank?

Page 8: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Which genes or DNA regions should be sequenced?

ITS regions of rDNA

Which genes or DNA regions should be sequenced?

g

β-tubulin gene

TEF : translation elongation factor 1α

”Barcoding”

TCCAATCATAGTAACTGCTACTGAGAAAACTTTCAATTCATAGTGGATTTTGATTGTTTGTCC C G C GC C G G C C C G GG G G G

Page 9: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

PCR based diagnosis

- Standard PCR

- Nested PCRNested PCR

- Real time PCR

→ Primer design

☺ Choice of DNA region☺ Choice of DNA region

- Species specific or ”group specific”

- rDNA, β-tubulin etc, RAPD fragments

☺ Spe ifi it !!!!!☺ Specificity !!!!!

3’ end important, experimental verificationp , p

☺ Sensitivity

Theoretically 1 single cell

Page 10: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

PCR based diagnosis

- Standard PCR

- Nested PCRNested PCR

- Real time PCR

→ Primer design→ Primer design

→ Inhibition of PCR?

PCR amplification using general PCR primers e.g. ITS

PCR lifi ti f l tPCR amplification of plant genes

cox gene (cytochrome oxidase)g ( y )

Add a DNA fragment in known quantities

Page 11: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

PCR based detectionPCR based detection

Species-specific PCRSpecies specific PCRhttp://www.sppadbase.com/

Group-specific PCR

For instance collective detection of species or isolates producing the same species or isolates producing the same mycotoxins

•Trichothecene-producers

F i i d• Fumonisin-producers

• Zearalenone producers• Zearalenone-producers

Page 12: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

From Proctor et al. 1995

Page 13: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

How to increase the sensitivity of a diagnostic PCR ?

Page 14: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Alt ti I T t th PCR Alternative I: Target the PCR primers to DNA regions previously amplified in the enomeamplified in the genome

E.g. rDNAg

18S 5.8S 28S 18S

ITS1 ITS2 IGS

18S 5.8S 28S 18S

ITS1 ITS2 IGS

PCR Sequencing Primer design

Page 15: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Sensitivity of specific primers forSensitivity of specific primers for F. langsethiae og F. sporotrichioidesF. sporotrichioides

1 5 x 10-8 g1 2 3 4 5 6 7 8 9 1. 5 x 10 g

2. 5 x 10-9 g

3 5 x 10-10 g3. 5 x 10-10 g

4. 5 x 10-11 g

0 125. 5 x 10-12 g

6. 5 x 10-13 g

7. 5 x 10-14 g

8. 5 x 10-15 g

9. Negative control

F langsethiaeF. langsethiae

Page 16: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

F poae specific PCR in artificiallyF. poae specific PCR in artificially inoculated cereal grains

1 2 3 4 5 6 7 8 1. Positive control

2 0%2. 0%

3. 1%

Wheat 4. 5%

5. 10%

O t

6. 20%

7. 100%Oats 8. Negative control

Page 17: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Alternative II: Nested PCRAlternative II: Nested PCR

N t d PCR I Nested PCR I PCR program 1 using primer pair 1

Nested PCR IIPCR program 1 and 2 are

The PCR product is diluted and used as a template in

PCR 2 si th s d

PCR program 1 and 2 are programmed to follow each other

PCR program 2 using the second primer pair

All 4 primers are present (Primer pair 1 and 2), but in different concentrations

2 tubes

different concentrations

Twice as expensive

T i s h k

1 tube

Less expensiveTwice as much work

High risk of t i ti

L p n

Less hands-on work

Reduced risk of contaminationcontamination Reduced risk of contamination

Page 18: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Nested PCR assays

Nested in 2 tubes Nested in 1 tubeNested in 2 tubes Nested in 1 tube

1

2Diluted 10.000x

Annealing 70 °C

Annealing 58 °C

Page 19: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Al i PCR dAlternative PCR products

AF BF

BR AR

Page 20: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Nested PCR for deteksjon av F. culmorumNested PCR for deteksjon av F. culmorum

FculA F/R – annealing temperature 70oC FculA F/R annealing temperature 70 C

– concentration 0,005 pmol

FculB F/R annealin temperature 58oC FculB F/R – annealing temperature 58oC

– concentration 50 pmolp

Page 21: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

N d PCR f F lNested PCR test for F. culmorum

M 1 2 3 4 5 6 7 8 N1. 50 ng

2 5Nested PCR 2. 5 n g

3. 500 pg

4. 50 p g

5. 5 pg

OBT186. 0,5 pg

7. 0,05 pg

8. 0,005 pg

9. Negative controlg

Klemsdal and Elen (2006) Lett. Appl. Microbiol. 42: 544-548

Page 22: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species
Page 23: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Standard PCR assays compared toStandard PCR assays compared to Real time PCR assays

• Real-time PCR less time consuming

R l ti PCR b d t d t i th tit• Real-time PCR can be used to determine the quantity

• In principle real-time PCR is more sensitivep p

Page 24: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Primers and probe design

A liPrimer Probe

p g

Amplicon50 - 150 bp in length

Primer

Tm 58 - 60ºC

Probe

Tm 10ºC higher than Primer Tm (7ºC for

As close to the probe as possible

20 - 80% GC

(Allelic Discrimination)

20 - 80% GC p pwithout overlappingLength 9 - 40

2ºC diff i T

Length 9 - 40 bases

<2ºC difference in Tm between the two primers No G on the 5’end

<4 contiguous G’sMaximum of 2 G or C

at 3’ end

4 contiguous G s

Must not have more G’s h C’than C’s

Page 25: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Primers and probe design

Primer Concentration Optimization MATRIX

p g

FORWARD 50 M 300 M 900 MFORWARD

REVERSE

50nM 300nM 900nM

50nM 50/50 300/50 900/50

300nM 50/300 300/300 900/300

900nM 50/900 300/900 900/900

Page 26: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

F i DON NIV ZEAF. graminearum – DON, NIV, ZEA

F culmorum – DON NIV ZEAF. culmorum DON, NIV, ZEA

F. poae - NIVF. langsethiae – T-2, HT-2F. sporotrichioides – T-2, HT-2F avenaceum MON ENNs (BEA)F. avenaceum – MON, ENNs, (BEA)F. tricinctum, F. equiseti, F. cerealis…….., q ,

TMTRITMTRI

TMLAN

TMAV

Page 27: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

TMTRI

TMAV

TMLAN

Page 28: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Multiplex quantitative PCRMultiplex quantitative PCR- Fluorescent labelled probes e.g. TaqMan (not SYBR green)

- Choose reporters based on wavelengths of the emitted fluorescent signalg

http://www1.qiagen.com/literature/brochures/pcr/1038604_TI-Multiplex.pdf

Page 29: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Choice of probes

D l l b ll d b (TAMRA)- Dual labelled probes (TAMRA)

- Eclipse MGBc pse G

- MGB (Minor Groove Binder)

Page 30: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Multiplex quantitative PCR

- Same sensitivity of the multiplex reaction as in the

Multiplex quantitative PCR

Same sensitivity of the multiplex reaction as in the single PCR reaction

Page 31: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Singleplex F. culmorum Triplex F. culmorum

Page 32: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

At present three assays:

I) I)

F. graminearum, F. culmorum and TRI5

II) II)

F. avenaceum and F. poae

III)

F langsethiaeF. langsethiae

Page 33: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Quarantine organisms

e.g. Fusarium foetens

Page 34: Identification and quantification of Fusarium species by ...fou02.bioforsk.no/fusarium/Presentasjoner/Identification and... · Identification and quantification of Fusarium species

Good luck with your experiments!