Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss)

Identification and expression analysis of an IL-18 homologue and itsalternatively spliced form in rainbow trout (Oncorhynchus mykiss)

Jun Zou1, Steve Bird1, Jonathan Truckle1, Niels Bols2, Mike Horne3 and Chris Secombes1

1Scottish Fish Immunology Research Centre, School of Biological Sciences, University of Aberdeen, UK; 2Department of Biology,

University of Waterloo, Ontario, Canada; 3Novartis Aquahealth, Enterprise House, Springkerse Business Park, Stirling, UK

A homologue of interleukin 18 has been identified fromrainbow trout, Oncorhynchus mykiss. The trout IL-18 genespans 3.7 kb and consists of six exons and five introns,sharing the same gene organization with its human coun-terpart. The putative translated protein is 199 amino acidsin length with no predicted signal peptide. Analysis of themultiple sequence alignment reveals a conserved ICE cutsite, resulting in a mature peptide of 162 amino acids. Thetrout IL-18 shares 41–45% similarity with known IL-18molecules and contains an IL-1 family signature motif. It isconstitutively expressed in a wide range of tissues includingbrain, gill, gut, heart, kidney, liver, muscle, skin and spleen.Transcription is not modulated by lipopolysaccharide,poly(I:C) or trout recombinant IL-1b in primary head kid-ney leucocyte cultures and RTS-11 cells, a macrophage cell

line. However, expression is downregulated by lipopoly-saccharide and rIL-1b in RTG-2 cells, a fibroblast-like cellline. An alternatively spliced form of IL-18 mRNA has alsobeen found and translates into a 182 amino acid proteinwith a 17 amino acid deletion in the precursor region of theauthentic form. This alternatively spliced form is also widelyexpressed although much lower than the authentic form.Interestingly, its expression is upregulated by lipopolysac-charide and poly(I:C), but is not affected by rIL-1b inRTG-2 cells. The present study suggests that alternativesplicing may play an important role in regulating IL-18activities in rainbow trout.

Keywords: interleukin 18; alternative splicing; expression;rainbow trout.

In the last few years, major advances have occurred in thediscovery of fish cytokine genes. This has been attributedmainly to the enormous progress made in genome projectsfor the Fugu and zebrafish genome, and the large increase offish EST (expressed sequence tag) entries in the Genebank.To date, at least a dozen cytokine homologues have beencloned in fish including TGF-b [1], IL-1b [2,3], TNF-a [4–7],IL-10 [8], IL-12 [9], type I interferons [10–12], and severalchemokines such as IL-8 [13,14], cIP-10 [15], CK-1 [16] andCK-2 [17].

Interleukin (IL) 18, produced mainly by activated macro-phages, is an important cytokine with multiple functions ininnate and acquired immunity [18–20]. One of the primarybiological properties is to induce interferon gamma (IFN-c)synthesis in Th1 and NK cells in synergy with IL-12 [21,22].

It promotes T and NK cell maturation, activates neutro-phils and enhancesFas ligand-mediated cytotoxicity [23–25].

IL-18 structurally belongs to the IL-1 family but has lowsequence homology with IL-1a, IL-1b and the IL-1 receptorantagonist (IL-Ra). It resembles IL-1b in many ways suchas possessing a similar b-trefoil structure and secretionprocess but has distinct biological functions [18,26]. LikeIL-1b, it is synthesized as an inactive precursor of approxi-mately 24 kDa and is stored intracellularly. Activation andsecretion of IL-18 is mainly effected through specificcleavage of the precursor after D35 by caspase 1, alsotermed IL-1b converting enzyme (ICE), which is believedto be one of the key processes regulating IL-18 bioactivity[27,28]. Some other enzymes, including caspase 3 andneutrophil proteinase 3, also cleave the IL-18 precursor togenerate active or inactive mature molecules [29,30]. Arecently identified IL-18 binding protein (IL)18 BP), aspecific natural antagonist, inhibits IL-18 activities bycompeting with the ligand for binding to the IL-18 receptors[31,32]. IL-18 expression is also regulated at the gene level.In mouse, there are at least two active promoters, oneconstitutively drives gene expression and the otherup-regulates expression in response to stimuli such aslipopolysaccharide (LPS) [33].

A nonmammalian IL-18 homologue has been sequencedin birds, sharing approximately 30% amino acid identitywith the other characterized mammalian IL-18s [34,35].Recently, a fish IL-18 homologue was identified by analy-sing the Fugu genome database [36]. In contrast to IL-1bwhere the ICE cut site is absent in most of the nonmam-malian species [2], the ICE cut site is well-conserved in theavian and Fugu IL-18s. Although native avian IL-18 has

Correspondence to C. J. Secombes, Scottish Fish Immunology

Research Centre, School of Biological Sciences, University of

Aberdeen, Zoology Building, Tillydrone Avenue, Aberdeen AB24

2TZ, UK. Tel.: + 44 1224 272872, Fax: + 44 1224 272396,

E-mail: [email protected]

Abbreviations: IL, interleukin; IL-1Ra, interleukin 1 receptor

antagonist; ICE: interleukin 1b converting enzyme; IL)18 BP,

interleukin 18 binding protein; IFN, interferon; c-IP10, interferongamma induced protein 10; CK, chemokine; NK, natural killer;

Th1, T-helper type 1; CD4, cluster of differentiation antigen 4;

EST, expressed sequence tag; LPS, lipopolysaccharide; poly(I:C),

polyinosinic-cytidylic acid.

(Received 12 January 2004, revised 5 March 2004,

accepted 22 March 2004)

Eur. J. Biochem. 271, 1913–1923 (2004) � FEBS 2004 doi:10.1111/j.1432-1033.2004.04101.x

not yet been purified, the bacteria-derivedmature peptide ofchicken IL-18 has been shown to induce IFN-c synthesis incultured primary chicken spleen cells [35]. More recently, ithas been demonstrated that IL-18 promotes proliferation ofCD4+ T cells in chicken, suggesting a Th1-like systemis operating in birds [37]. In the present study, we haveidentified an IL-18 homologue from rainbow trout, Onc-orhynchus mykiss, and investigated where this molecule isexpressed. In addition, we have discovered an alternativesplicing form of the IL-18 mRNA that may have animportant role in regulating IL-18 expression and process-ing in this species, the first report of such a phenomenon forthis cytokine.

Materials and methods

Cloning and sequencing of genomic DNA and cDNA

All products amplified by PCR were ligated into thepGEM-Teasy vector (Promega) and transformed intoTAM competent cells (ActiveMotif, Belgium). PlasmidDNA was purified using a plasmid miniprep kit (Qiagen)and sequenced by MWG-Biotech (Germany).

By searching EST databases, several EST clones(BX306040, BX316393, BX298965, BX316008, BX306507,BX311712, BX306039, BX306506, BX311711, BX319716)with homology tomammalian IL-18 protein sequences wereretrieved. Specific primers (Table 1) were synthesized toobtain the full length cDNA sequence using the RACE–PCR approach. Briefly, total RNA was extracted fromthe rainbow trout RTS-11 cell line (provided by N. Bols)[38] stimulated with 20 lgÆmL)1 poly(I:C) (Sigma) for 4 hand reverse-transcribed into cDNA with primer adapteroligo(dT). 3¢-RACE–PCRwas performed using primers F1/ADAP and F2/ADAP to amplify the full length sequence ofthe coding region and the 3¢-UTR [39]. For 5¢-RACE,cDNA was tagged with oligo(dC)n at the 5¢-end withterminal deoxynucleotidyl transferase (Promega) and usedas template for seminested PCR amplification with primersoligo-dG/R2 and oligo-dG/R3 [39]. The cycling programsfor RACE–PCR were 5 cycles of 94 �C for 20 s, 72 �Cfor 2 min; 32 cycles of 94 �C for 20 s, 62 �C for 20 s, 72 �C

for 45 s; followed by 1 cycle of 72 �C for 10 min. Twentymicolitres of PCR products were loaded on a 1.5% (w/v)agarose gel and visualized by staining the gel in 0.1 lgÆmL)1

ethidium bromide.For genomic cloning, rainbow trout tail fin was collected

and incubated with DNA lysis buffer (100 mM Tris/ClpH 8.5, 5 mM EDTA, 0.2% (w/v) SDS, 200 mM NaCl,100 lgÆmL)1 Proteinase K (Bioline), 20 lgÆmL)1 RNase A)(Sigma) at 52 �C for 3 h. The lysate was extracted twice withan equal volume of phenol/chloroform (24 : 1, v/v) andonce with chloroform. Genomic DNA was precipitatedwith two volumes of cold ethanol, washed with 70% (v/v)ethanol, and dissolved in TE buffer (10 mM Tris, 1 mM

EDTA, pH 8.0). Using genomic DNA as template, PCRwas performed to obtain the full length sequence of theIL-18 gene using primers F1 and RR1 and the PCRproducts sequenced. The PCR cycling programs forgenomic PCR were 1 cycle of 94 �C for 3 min; 30 cyclesof 94 �C for 20 s, 60 �C for 20 s, 72 �C for 3 min; followedby 1 cycle of 72 �C for 10 min. The PCR products werechecked by electrophoresis as described above.

Sequencing analysis

BLAST was used for the identification of homologoussequences in the GenBank databases. Multiple alignmentwas generated using the CLUSTAL W program (version 1.83)[40]. A phylogenetic tree was constructed with the PHYLIP

package (version 1.1) [41] and visualized using TREEVIEW

(version 1.6.6) [42]. Direct comparison of two sequenceswas performed using the GAP analysis program withintheWisconsinGeneticsComputerGroupSequenceAnalysisSoftware Package (version 10.0) [43]. Signal leader peptideprediction was made using the SIGNALP program (version2.0) [44].

RT-PCR studies of IL-18 expression in rainbow trout

To determine tissue distribution of IL-18 expression inhealthy fish (Almond Bank Fish Farm, Perthshire,Scotland) killed by severance of the spinal cord fol-lowing anaesthesia, total RNA was extracted from tissues

Table 1. Primer sequences and use.

Primer name Sequence (5¢)3¢) Use

Adaptor oligo(dT) GGCCACGCGTCGACTAGTAC(dT)17 3¢-RACE

ADAP GGCCACGCGTCGACTAGTAC 5¢-RACE

Oligo(dG) GGGGGGIGGGIIGGGIIG 5¢-RACE

F1 GCAATGCGACCGAGTGTCGGAG 3¢-RACE

Gene organization

F2 CGACATTTCCGAGTGACGTTC 3¢-RACE

R2 CCTTCAACACCCTGACTTCAC 5¢-RACE

R3 ATGTCCTCCTTGTCTACTACC 5¢-RACE

EF1 AGCAGCTCCGAATGTAAGGTG IL-18A expression

EF2 GCTCCGAATTCGAACATGAC IL-18B expression

ER1 AGGCAAAGGTTGCTCCAGTG IL-18 expression

Actin-F ATGGAAGATGAAATCGCC Gene expression

Actin-R TGCCAGATCTTCTCCATG Gene expression

RR1 TGGTACCACTCAACATGTCAGTAAGCG Gene organization

1914 J. Zou et al. (Eur. J. Biochem. 271) � FEBS 2004

Fig. 1. Genomic DNA and the deduced protein

sequence of rainbow trout IL-18. Exons and

introns are indicated in uppercase and lower-

case, respectively. Intron splicing signal motifs

are boxed and the polyadenylation signal

(ATTAAA) is underlined. The cytokine

instability motif (ATTTA) is in bold.

� FEBS 2004 IL-18 homologue in rainbow trout (Eur. J. Biochem. 271) 1915

including brain, gill, gut, heart, kidney, liver, muscle, skinand spleen, using TRIZOL (Invitrogen) according to themanufacturer’s instructions. The RNA was then reversetranscribed into cDNA using Bioscript (Bioline) accordingto the manufacturer’s instructions. PCR was performed todetect IL-18A and IL-18B expression using primers EF1/ER1 and EF2/ER1 in a single PCR reaction. Three fishwere used in the study.

The rainbow trout RTS-11 macrophage cell line andRTG-2 cell line were maintained as described previously[38,45]. The cells were passaged two days before stimulationwith 10 lgÆmL)1 LPS (E.coli 0127:B8, Sigma), 50 lgÆmL)1

poly(I:C) (Sigma), or 100 ngÆmL)1 recombinant trout IL-1b(rIL-1b) [46] for 4 h, the peak time of gene expression formany of the cytokine genes studied in trout to date [5,46].Total RNA was extracted using TRIZOL (Invitrogen) andreverse transcribed into cDNA using Bioscript (Bioline) asdescribed above. The sythesized cDNA was checked andtitrated by PCR using b-actin primers to ensure equalamount of templates were used for quantitation of geneexpression. Two pairs of primers, EF1/ER1 and EF2/ER1were used in a single PCR reaction, to determine theexpression level of IL-18A and IL-18B, respectively. Fivemicrolitres of cDNA templates was used for a 50 lL PCRreaction. The PCR cycling programs for gene expressionstudy were 1 cycle of 94 �C for 3 min; 35 cycles of 94 �C for20 s, 60 �C for 20 s, 72 �C for 20 s; followed by 1 cycle of72 �C for 10 min. Twenty microlitres of PCR productswere loaded on a 2.0% (w/v) agarose gel and visualizedby staining the gel in 0.1 lgÆmL)1 ethidium bromide. Therelative levels of mRNA were quantified by densitometricscanning of the ethidium bromide stained gels, using anUltra Violet Products Ltd gel imaging system and UVP

GELWORKS ID advanced software, and expressed relative tothe b-actin transcript level.

Modulation of IL-18 expression was also studied in trouthead kidney leucocytes. The head kidney leucocytes fromthree fishwere isolated using a 51% (w/v) percoll gradient asdescribed by Hardie et al. [47]. Cells were seeded at adensity of 2.0 · 106 cells per culture flask in a final volumeof 50 mL medium and cultured at 22 �C in L15 medium(Gibco) containing 2% (v/v) fetal bovine serum (Sigma),penicillin (100 lgÆmL)1) (Gibco), and streptomycin (100unitsÆmL)1) (Gibco). The cells were either unstimulated,stimulated for 4 h with 20 lgÆmL)1 LPS, 100 ngÆmL)1 rIL-1b or a combination of 20 lgÆmL)1 LPS and 100 ngÆmL)1

rIL-1b. Total RNA was extracted and RT-PCR performedas described previously to determine IL-18 expression.Results are shown from two of the three fish investigated.

Results

Cloning and sequence analysis

By analysing EST databases, several salmon ESTs werefound with 25–29% amino acid identity to known IL-18molecules by BLAST searching. Thus, primers weresynthesized to obtain the full length cDNA sequence byRACE–PCR using cDNA generated from poly(I:C) stimu-lated RTS-11 cells. Subsequently, the full length sequence ofgenomic DNAwas obtained by PCR using primer F1/RR1(Fig. 1). The trout IL-18 gene spans approximately 3.7 kband is much smaller than its human counterpart(> 12.7 kb) but larger than that in the pufferfish species(Fig. 2). It has a similar genomic organization to the humanIL-18 gene, consisting of six exons and five introns. The

Fig. 2. Comparison of the genomic organization of IL-18 and IL-1b genes in human, rainbow trout and the predicted Fugu/tetraodon organization.

GenBank accession numbers: human IL-18, E17138, Fugu IL-18, AJ548845; tetraodon IL-18, AJ555460. The size of the coding region in the exons

is indicated. Open boxes represent untranslated regions, whilst closed boxes represent coding regions.

1916 J. Zou et al. (Eur. J. Biochem. 271) � FEBS 2004

intron sizes of the IL-18 genes differ among species but thesize of the coding region within the exons was similar(Fig. 2). For example, an extremely small exon (exon 3 in

trout), consisting of 12 bp, is present in both the fish andhuman IL-18 genes. The trout IL-18 has a very short3¢-UTR of 234 bp, containing a single mRNA instability

Fig. 3. Multiple alignment of the known IL-18 molecules.Conserved residues shared with the putative trout peptide are indicated with a dash (–) and

gaps in the alignment are represented with �*�. Conservation of amino acid identity is indicated in the consensus line with �*� whereas �:� and �.�indicate high and low levels of amino acid similarity, respectively. Arrows indicate the potential ICE cleavage site (fl) and the potential alternative

cleavage site ( ). The 12 b-sheets (solid horizontal bars) and two a-helices (open horizontal bars) in human IL-18 [26] are shown above the alignment.

The signature sequence is in bold and highlighted. GenBank accession numbers of the IL-18 genes are as follows: cow, Q9TU73; dog, Q9XSR0;

Fugu, AJ548844; horse, Q9XSQ7; human, Q14116; mouse, P70380; pig, O19073; rat, P97636; chicken, AJ277865; tetraodon, AJ555460.

� FEBS 2004 IL-18 homologue in rainbow trout (Eur. J. Biochem. 271) 1917

motif (ATTTA) shortly after a nonconventional polyade-nylation signal sequence (ATTAAA).

The deduced trout IL-18 precursor consists of 199 aminoacids with no typical signal peptide detected using theSIGNALP prediction program. Analysis of multiple alignmentdemonstrated a well conserved ICE cut site signature(LXXD), generating a 167 amino acid putative maturepeptide for the trout IL-18 (Fig. 3). Compared to troutIL-1b, as another member of the IL-1 family known introut, it has a shorter N-terminal precursor region(32 amino acids). The putative trout IL-18 mature peptideis cysteine rich, consisting of seven cysteine residues, morethan that in any known mature molecule to date,and lacks any putative N-glycosylation sites. An IL-1family-like signature sequence, NH2-FFMEVIPGTSQYRFQSSLRTSSYLS-COOH, located near the C terminus, isvery similar to the IL-1 family like signature, F-X10-F-X-S-[ALV]-X2-[AP]-X2-[FYLIV]-[LIV]-X-T [2], and thesignature sequence of F-[FY]-X11-13-[FL]-X2-S-[SL]-X4-[FY]-L-[SA] appears to be unique for IL-18 as shown inthe multiple alignment.

The trout IL-18 precursor shares 41–46% similarity withthe IL-18 proteins from mammals, 42.9% with chicken,40.5% with Fugu, and 42.4% with tetraodon (Table 2). Ithas lower similarity with the other members of the IL-1family; 30–38%with IL-1a, 26–36%with IL-1b and� 30%with IL-1Ra (data not shown). To further analyse therelationship of trout IL-18 with the other three members ofthe IL-1 family, IL-1a, IL-1b, and IL-1Ra, a phylogenetictree was constructed using the neighbor-joining method,which revealed that the trout IL-18 molecule groupedclosely with other known IL-18 s (data not shown), andaway from IL-1a, IL-1b and IL-1Ra.

Alternative splicing

Using cDNA generated from the RTS-11 cells as template,PCR with primers F1 and ADAP generated two PCRproducts of approx. 950 bp and 1000 bp. Sequence com-parison of the two PCR products indicated they wereidentical except for a 51 nucleotide gap near the 5¢ end,translating two proteins of 199 amino acids and 182 amino

acids, respectively (termed IL-18A and IL-18B) (Fig. 4).The 17 amino acid deletion occurred within the putative32 amino acid precursor region as shown in the multiplealignment, suggesting the protein may be produced as anintracellular form or processed at a cut site which is presentat a location different from the conserved ICE cut site(LXXD) (Fig. 3). In fact, further analysis of the primarysequence revealed a region (LVVD) 25 amino acid down-streamof the predicted ICE cut site (LESD)whichwas quitesimilar to the signature motif for ICE cleavage, suggestingIL-18B could also be cleaved and secreted.

Fig. 4. Alternative splicing of the IL-18 gene in rainbow trout. (A) An

alternative mRNA splicing site is present in exon 2 of the trout IL-18

gene. Arrows indicate the splicing sites and the boxed letters represent

the splicing motif sequences. (B) The two transcripts, IL-18A and

IL-18B, resulting from the normal and the alternative splicing, and the

deduced amino acid sequences.

Table 2. Protein similarity and features of trout IL-18 with IL-18 from other species. Similarity was obtained by direct comparison of two IL-18

precursor sequences using the GAP analysis program. The mature peptide for some IL-18 molecules was predicted by the multiple alignments

showing the conserved ICE cut site.

Species

Similarity

(%)

Precursor length

(amino acids)

Mature peptide length

(amino acids)

N-terminal amino acid

of mature peptide

Cow 42.0 193 157 H

Dog 41.4 193 157 Y

Horse 45.6 193 157 Y

Human 42.1 193 157 Y

Mouse 44.3 192 157 N

Pig 42.6 192 157 Y

Rat 41.5 194 158 H

Chicken 42.9 198 160 A

Fugu 40.5 189 158 G

Tetraodon 42.4 189 158 S

Trout 100 199 168 D

1918 J. Zou et al. (Eur. J. Biochem. 271) � FEBS 2004

Expression studies

To determine the tissue distribution of IL-18 expression,RT-PCR was performed using two pairs of primers,EF1/ER1 and EF2/ER1, specifically detecting IL-18A andIL-18B expression in a single tube reaction. Figure 5 showsthat both IL-18A and IL-18B were globally expressed in allthe tissues examined, including brain, gill, gut, heart, kidney,liver, muscle, skin, and spleen, although a lower expressionlevel was observed for IL-18B. Higher levels of expressionwere detected in gut, heart and kidney.

Modulation of IL-18 expression was studied in primarycultured head kidney leucocytes, macrophages (RTS-11)and fibroblast cells (RTG-2). As shown in Fig. 6, bothIL-18A and IL-18B were constitutively expressed in theRTS-11 cells (A) and the head kidney leucocytes (C). Thetranscriptional level was not markedly affected by stimula-tion with LPS, poly(I:C) or rIL-1b, although a higherexpression level was seen for both forms after stimulation ofthe head kidney leucocytes with the LPS and rIL-1bmixture. A higher expression level of IL-18A was seenrelative to IL-18B in stimulated and unstimulated headkidney leucocytes and RTS-11 cells, being � 2.6 timesincreased according to the densitometric scanning of theethidium bromide stained gel. In contrast, transcription ofIL-18A and IL-18B in the RTG-2 cells was differentiallyregulated by LPS, poly(I:C) and rIL-1b. In the unstimulatedRTG-2 cells, both IL-18 transcripts were constitutivelysynthesized with a higher expression of IL-18A beingobserved (ratio of IL18A/IL-18B � 1.4) as in RTS-11 cells.Stimulation with LPS or poly(I:C) inhibited IL-18Aexpression but enhanced IL-18B transcription, such thatIL-18B rather than IL-18A was dominantly expressed afterstimulation with LPS (IL-18B/IL-18A � 3.0) or poly(I:C)(IL-18B/IL-18A � 1.7). rIL-1b decreased expression ofIL-18A and to a lesser extent IL-18B mRNA levels, suchthat again the ratio (� 1.9 times) was in favour of IL-18B.

Discussion

In the present study, we have identified an IL-18 homologuefrom rainbow trout by analysing the salmonid ESTdatabase. IL-18 is a member of the IL-1 family includingIL-1a, IL-1b, and the IL-1 receptor antagonist (IL-1Ra).

Although it has low sequence homology with othermembers of the family, it contains the IL-1 like familysignature and shares a three dimensional b-trefoil structurewith IL-1b [26]. The identified trout IL-18 has higher(approx. 41–46%) homology with other known IL-18molecules than with the three other IL-1 family members.Despite having the same number of exons and introns as thetrout IL-1b gene, the trout IL-18 gene resembles IL-18 genesfrom human, Fugu, and tetraodon, rather than the IL-1bgenes, in terms of exon/intron organization, the size ofcoding exons and the precursor molecules (Fig. 2). Therelationship between the trout IL-18 with the IL-1 familymembers is supported further by phylogenetic tree analysis,where the trout IL-18 molecule branched with other knownIL-18 molecules (data not shown).

Like IL-1b, IL-18 is synthesized as a biologically inactiveprecursor in the cytoplasm and must be cleaved by ICE togenerate the activemature peptide. The sequence data of theIL-1b homologues derived from nonmammalian speciesindicates that the ICE cut site is absent in many nonmam-malian species [2]. However, a recent study does suggest fishIL-1b is cleaved inmacrophages althoughwhere it is cleavedand the mechanism involved is still undetermined [46]. Byanalysing themultiple alignment of IL-18molecules, an ICEcleavage motif (LXXD) conserved from lower vertebratesto mammals is evident (Fig. 3), strongly suggesting ICEmay be involved in processing of IL-18 in lower vertebrates.A stretch of sequence LXXD(74–77; human) similar to theICE cleavage motif was also seen at a short distancedownstream of the LXXD(33–36) motif in some of theIL-18s including human, mouse, rat, Fugu, tetraodon andtrout. It is possible that this LXXD(74–77) motif could beused as an alternative cut site for ICE or other proteasessuch as caspase 3. Previous studies in humans demonstratedthat IL-18 was cleaved not only by ICE at DY(36–37) torelease bioactive mature IL-18 but also by caspase 3 atDS(71–72) and DN(76–77) to generate biologically inactiveproducts [29]. This is not surprising because cleavage at suchsites leads to proteins lacking the first two b-sheets (Fig. 3).In addition, neutrophil proteinase 3 can cleave IL-18 inhuman epithelial cells, leading to secretion of bioactiveIL-18 [30]. Interestingly, LVVD(54–57) in trout IL-18 isaligned well with the alternative cut site D76 in the humanmolecule in the multiple alignment (Fig. 3).

Fig. 5. Tissue distribution of IL-18 expression in healthy fish.The IL-18mRNA levels were expressed as a ratio relative to b-actinmRNA levels after

densitomitric scanning of the gels stained with ethidium bromide. The data presented are for a representative experiment of three fish examined.

� FEBS 2004 IL-18 homologue in rainbow trout (Eur. J. Biochem. 271) 1919

An alternatively spliced transcript of IL-18 was detectedby RT-PCR in both RTS-11 and RTG-2 cells. This is thefirst report of an alternative spliced form for IL-18 althoughseveral alternative IL-18 proteins were reported recently inhuman keratinocytes and blood plasma [48,49]. As shown inFig. 4, an mRNA splicing signal motif (gtaaag) was presentin the coding region of exon 2, resulting in partial deletion

of exon 2. However, this deletion did not disrupt proteintranslation and thus the alternative spliced mRNAremained in-frame and potentially translated into a 182amino acid protein (IL-18B), 17 amino acids shorter thanthe above form. The 17 amino acid deletion occurs in theprecursor region, which may affect the IL-18B cleavage.Furthermore, no signal leader peptide was predicted for the

Fig. 6. RT-PCR analysis of IL-18 expression in rainbow trout cell lines and cultured primary head kidney leucocytes.TheRTS-11 (A), RTG-2 cells (B)

and head kidney leucocytes (C) were stimulated with LPS, poly(I:C), rIL-1b or a mixture of LPS and rIL-1b as described in the materials and

methods. In C, two of the three fish investigated are shown and the average ratio of the IL-18 expression relative to b-actin presented.

1920 J. Zou et al. (Eur. J. Biochem. 271) � FEBS 2004

IL-18B molecule, excluding the possibility that it could bereleased through a conventional secretion pathway. The twopotential protease cut sites, LESD and LVVD, wereretained in the IL-18B molecule, with the latter possibly amore likely cut site based on the precursor length whichwould be similar to that in known IL-18. However, it is alsopossible that IL-18B could be synthesized as an intracellularform.

A high level of constitutive expression of IL-18 wasobserved in all tissues of healthy fish, including brain, gill,gut, heart, kidney, liver, muscle, skin and spleen. This is inagreement with studies in mammals showing that IL-18was constitutively expressed in a wide range of cell typesincluding immune and nonimmune cells and stored as aninactive precursor in the cytoplasm [50]. Active IL-18 issecreted only after stimulation with appropriate stimuli andactivity is regulated at multiple levels. ICE processing of theinactive IL-18 precursor is believed to be crucial inmediating IL-18 secretion at the post-translational level.In addition, circulating IL-18 can be antagonized by theIL)18 BP, which competes with the ligand for receptorbinding. In the trout macrophages and head kidney cells,both the authentic and the alternatively spliced IL-18 wereconstitutively expressed and not affected by stimulationwith LPS, poly(I:C) or rIL-1b, suggesting that IL-18biological activities might be regulated in a similar way tomammals in such cells. Surprisingly, in contrast to the headkidney cells and the RTS-11 cells, differential expressionwas seen for IL-18A and IL-18B in the RTG-2 cells afterstimulation, as seen with LPS and poly(I:C), whichsignificantly enhanced IL-18B expression whilst inhibitingIL-18A expression. In mouse, IL-18 expression is con-trolled by two promoters, one responsible for constitutiveexpression and one for inducible expression [33]. It ispossible that synthesis of the two IL-18 transcripts areinitiated by two different promoters or regulated bydifferent elements in a single promoter. Thus, the presentstudy suggests that IL-18 production is mainly controlledat the post-transcriptional level in trout macrophages whilstin the RTG-2 cells, a fibroblast cell line, transcriptionalmodulation is also important. Why IL-18A and IL-18B aredifferentially regulated in such a different way in theRTG-2 cells and how this affects IL-18 biological functionswill be of interest to pursue further. Perhaps, balancing theexpression ratio of the two IL-18 forms could be animportant mechanism in controlling IL-18 expression orprocessing.

Interferon gamma (IFN-c), a Th1-type cytokine, hasbeen speculated to be present in lower vertebrates includingfish [51]. However, to date, fish IFN-c has not yet beenisolated, although some of the associated factors such as thereceptors, the regulatory molecules and interferon-inducedproteins have been sequenced in fish in recent years [15,52].It is known that IFN-c can be induced by two maincytokines, IL-12 and IL-18. In chicken, the recombinantIL-18 protein has been shown to induce IFN-c productionand promote proliferation of CD4+ T cells [37]. Thehomologues for the two subunits of the IL-12molecule haverecently been identified in the Japanese pufferfish [9]. All ofthese studies, together with the finding of the trout IL-18 inthe present study, suggest the existence of the IFN-chomologue in fish and perhaps a similar Th1-like network.

Acknowledgements

This work was funded by the Scottish Higher Education Funding

Council, a research contract from Novartis Aquahealth and a BBSRC

industrial case studentship to JT.

References

1. Hardie, L.J., Laing, K.J., Daniels, G.D., Grabowski, P.S.,

Cunningham, C. & Secombes, C.J. (1998) Isolation of the

first piscine transforming growth factor beta gene: analysis

reveals tissue specific expression and a potential regulatory

sequence in rainbow trout (Oncorhynchus mykiss). Cytokine 10,

555–563.

2. Bird, S., Zou, J., Wang, T., Munday, B., Cunningham, C. &

Secombes, C.J. (2002) Evolution of interleukin-1b. Cytokine

Growth Factor Rev. 13, 483–502.

3. Zou, J., Grabowski, P.S., Cunningham, C. & Secombes, C.J.

(1999) Molecular cloning of interleukin 1b from rainbow trout

Oncorhynchus mykiss reveals no evidence of an ice cut site. Cyto-

kine 11, 552–560.

4. Bobe, J. & Goetz, F.W. (2001) Molecular cloning and expression

of a TNF receptor and two TNF ligands in the fish ovary. Comp

Biochem. Physiol. B Biochem. Mol. Biol. 129, 475–481.

5. Laing, K.J., Wang, T., Zou, J., Holland, J., Hong, S., Bols, N.,

Hirono, I., Aoki, T. & Secombes, C.J. (2001) Cloning and

expression analysis of rainbow troutOncorhynchus mykiss tumour

necrosis factor-a. Eur. J. Biochem. 268, 1315–1322.6. Zou, J., Wang, T., Hirono, I., Aoki, T., Inagawa, H., Honda, T.,

Soma, G.I., Ototake, M., Nakanishi, T., Ellis, A.E. & Secombes,

C.J. (2002) Differential expression of two tumor necrosis factor

genes in rainbow trout, Oncorhynchus mykiss. Dev. Comp

Immunol. 26, 161–172.

7. Zou, J., Secombes, C.J., Long, S., Miller, N., Clem, L.W. &

Chinchar, V.G. (2003) Molecular identification and expression

analysis of tumor necrosis factor in channel catfish (Ictalurus

punctatus). Dev. Comp Immunol. 27, 845–858.

8. Zou, J., Clark, M.S. & Secombes, C.J. (2003) Characterisation,

expression and promoter analysis of an interleukin 10

homologue in the puffer fish, Fugu rubripes. Immunogenetics 55,

325–335.

9. Yoshiura, Y., Kiryu, I., Fujiwara, A., Suetake, H., Suzuki, Y.,

Nakanishi, T. & Ototake, M. (2003) Identification and char-

acterization of Fugu orthologues of mammalian interleukin-12

subunits. Immunogenetics 55, 296–306.

10. Altmann, S.M., Mellon, M.T., Distel, D.L. & Kim, C.H. (2003)

Molecular and functional analysis of an interferon gene from the

zebrafish, Danio rerio. J. Virol. 77, 1992–2002.

11. Long, S., Wilson, M., Bengten, E., Bryan, L., Clem, L.W., Miller,

N.W. &Chinchar, V.G. (2004) Identification of a cDNA encoding

channel catfish interferon. Dev. Comp Immunol. 28, 97–111.

12. Robertsen, B., Bergan, V., Rokenes, T., Larsen, R. & Albu-

querque, A. (2003) Atlantic salmon interferon genes: cloning,

sequence analysis, expression, and biological activity. J. Interferon

Cytokine Res. 23, 601–612.

13. Laing, K.J., Zou, J.J., Wang, T., Bols, N., Hirono, I., Aoki, T. &

Secombes, C.J. (2002) Identification and analysis of an interleukin

8-like molecule in rainbow troutOncorhynchus mykiss.Dev. Comp

Immunol. 26, 433–444.

14. Najakshin, A.M., Mechetina, L.V., Alabyev, B.Y. & Taranin,

A.V. (1999) Identification of an IL-8 homolog in lamprey (Lam-

petra fluviatilis): early evolutionary divergence of chemokines.Eur.

J. Immunol. 29, 375–382.

15. Laing, K.J., Bols, N. & Secombes, C.J. (2002) A CXC chemokine

sequence isolated from the rainbow trout Oncorhynchus mykiss

resembles the closely related interferon-gamma-inducible

� FEBS 2004 IL-18 homologue in rainbow trout (Eur. J. Biochem. 271) 1921

chemokines CXCL9, CXCL10 andCXCL11.Eur. Cytokine Netw.

13, 462–473.

16. Dixon, B., Shum, B., Adams, E.J., Magor, K.E., Hedrick, R.P.,

Muir, D.G. & Parham, P. (1998) CK-1, a putative chemokine of

rainbow trout (Oncorhynchus mykiss). Immunol. Rev. 166,

341–348.

17. Liu, L., Fujiki, K., Dixon, B. & Sundick, R.S. (2002) Cloning

of a novel rainbow trout (Oncorhynchus mykiss) CC chemokine

with a fractalkine-like stalk and a TNF decoy receptor using

cDNA fragments containing AU-rich elements. Cytokine 17,

71–81.

18. Dinarello, C.A. & Fantuzzi, G. (2003) Interleukin-18 and

host defense against infection. J. Infect. Dis. 187 (Suppl. 2),

S370–S384.

19. Gracie, J.A., Robertson, S.E. & McInnes, I.B. (2003) Interleukin-

18. J. Leukoc. Biol. 73, 213–224.

20. Sugawara, I. (2000) Interleukin-18 (IL-18) and infectious diseases,

with special emphasis on diseases induced by intracellular patho-

gens. Microbes. Infect. 2, 1257–1263.

21. Micallef, M.J., Ohtsuki, T., Kohno, K., Tanabe, F., Ushio, S.,

Namba, M., Tanimoto, T., Torigoe, K., Fujii, M., Ikeda, M.,

Fukuda, S. & Kurimoto, M. (1996) Interferon-gamma-inducing

factor enhances T helper 1 cytokine production by stimulated

human T cells: synergism with interleukin-12 for interferon-cproduction. Eur. J. Immunol. 26, 1647–1651.

22. Okamura, H., Nagata, K., Komatsu, T., Tanimoto, T., Nukata,

Y., Tanabe, F., Akita, K., Torigoe, K., Okura, T. & Fukuda, S. &

(1995) A novel costimulatory factor for gamma interferon

induction found in the livers of mice causes endotoxic shock.

Infect. Immun. 63, 3966–3972.

23. Dao, T., Mehal, W.Z. & Crispe, I.N. (1998) IL-18 augments

perforin-dependent cytotoxicity of liver NK-T cells. J. Immunol.

161, 2217–2222.

24. Leung, B.P., Culshaw, S., Gracie, J.A., Hunter, D., Canetti, C.A.,

Campbell, C., Cunha, F., Liew, F.Y. & McInnes, I.B. (2001) A

role for IL-18 in neutrophil activation. J. Immunol. 167,

2879–2886.

25. Xu, D., Trajkovic, V., Hunter, D., Leung, B.P., Schulz, K.,

Gracie, J.A., McInnes, I.B. & Liew, F.Y. (2000) IL-18 induces

the differentiation of Th1 or Th2 cells depending upon

cytokine milieu and genetic background. Eur. J. Immunol. 30,

3147–3156.

26. Kato, Z., Jee, J., Shikano, H., Mishima, M., Ohki, I., Ohnishi, H.,

Li, A., Hashimoto, K., Matsukuma, E., Omoya, K., Yamamoto,

Y., Yoneda, T., Hara, T., Kondo, N. & Shirakawa,M. (2003) The

structure and bindingmode of interleukin-18.Nat. Struct. Biol. 10,

966–971.

27. Ghayur, T., Banerjee, S., Hugunin, M., Butler, D., Herzog, L.,

Carter, A., Quintal, L., Sekut, L., Talanian, R., Paskind, M.,

Wong, W., Kamen, R., Tracey, D. & Allen, H. (1997) Caspase-1

processes IFN-c-inducing factor and regulates LPS-induced

IFN-c production. Nature 386, 619–623.

28. Gu, Y., Kuida, K., Tsutsui, H., Ku,G., Hsiao, K., Fleming,M.A.,

Hayashi, N., Higashino, K., Okamura, H., Nakanishi, K.,

Kurimoto, M., Tanimoto, T., Flavell, R.A., Sato, V.,

Harding, M.W., Livingston, D.J. & Su, M.S. (1997) Activation

of interferon-gamma inducing factor mediated by interleukin-1bconverting enzyme. Science 275, 206–209.

29. Akita, K., Ohtsuki, T., Nukada, Y., Tanimoto, T., Namba, M.,

Okura, T., Takakura-Yamamoto, R., Torigoe, K., Gu, Y., Su,

M.S., Fujii, M., Satoh-Itoh, M., Yamamoto, K., Kohno, K.,

Ikeda, M. & Kurimoto, M. (1997) Involvement of caspase-1 and

caspase-3 in the production and processing of mature human

interleukin 18 in monocytic THP1 cells. J. Biol. Chem. 272,

26595–26603.

30. Sugawara, S., Uehara, A., Nochi, T., Yamaguchi, T., Ueda, H.,

Sugiyama, A., Hanzawa, K., Kumagai, K., Okamura, H. &

Takada, H. (2001) Neutrophil proteinase 3-mediated induction

of bioactive IL-18 secretion by human oral epithelial cells.

J. Immunol. 167, 6568–6575.

31. Aizawa, Y., Akita, K., Taniai, M., Torigoe, K., Mori, T., Nishida,

Y., Ushio, S., Nukada, Y., Tanimoto, T., Ikegami, H., Ikeda, M.

& Kurimoto, M. (1999) Cloning and expression of interleukin-18

binding protein. FEBS Lett. 445, 338–342.

32. Novick, D., Kim, S.H., Fantuzzi, G., Reznikov, L.L., Dinarello,

C.A. & Rubinstein, M. (1999) Interleukin-18 binding protein: a

novel modulator of the Th1 cytokine response. Immunity. 10,

127–136.

33. Tone, M., Thompson, S.A., Tone, Y., Fairchild, P.J. & Wald-

mann, H. (1997) Regulation of IL-18 (IFN-c-inducing factor)

gene expression. J. Immunol. 159, 6156–6163.

34. Kaiser, P. (2002) Turkey and chicken interleukin-18 (IL18) share

high sequence identity, but have different polyadenylation sites in

their 3¢ UTR. Dev. Comp Immunol. 26, 681–687.

35. Schneider, K., Puehler, F., Baeuerle, D., Elvers, S., Staeheli, P.,

Kaspers, B. &Weining, K.C. (2000) cDNA cloning of biologically

active chicken interleukin-18. J. Interferon Cytokine Res. 20,

879–883.

36. Bird, S., Zou, J. & Secombes, C.J. (2003) Takifugu rubripes

mRNA for IL-18 precursor. Genbank accession no. AJ

548844.

37. Gobel, T.W., Schneider, K., Schaerer, B., Mejri, I., Puehler, F.,

Weigend, S., Staeheli, P. &Kaspers, B. (2003) IL-18 stimulates the

proliferation and IFN-gamma release of CD4+ T cells in the

chicken: conservation of a Th1-like system in a nonmammalian

species. J. Immunol. 171, 1809–1815.

38. Ganassin, R.C. (1998) Development of a monocyte/macrophage-

like cell line, RTS11, from rainbow trout spleen. Fish Shellfish

Immunol. 8, 457–476.

39. Bird, S., Wang, T., Zou, J., Cunningham, C. & Secombes, C.J.

(2002) The first cytokine sequence within cartilaginous fish: IL-1

beta in the small spotted catshark (Scyliorhinus canicula).

J. Immunol. 168, 3329–3340.

40. Thompson, J.D., Higgins, D.G. & Gibson, T.J. (1994)

CLUSTAL W: improving the sensitivity of progressive multiple

sequence alignment through sequence weighting, position-specific

gap penalties and weight matrix choice. Nucleic Acids Res. 22,

4673–4680.

41. Saitou, N. & Nei, M. (1987) The neighbor-joining method: a new

method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4,

406–425.

42. Page, R.D. (1996) TreeView: an application to display phylo-

genetic trees on personal computers. Comput. Appl. Biosci. 12,

357–358.

43. Needleman, S.B. & Wunsch, C.D. (1970) A general method

applicable to the search for similarities in the amino acid sequence

of two proteins. J. Mol. Biol. 48, 443–453.

44. Nielsen, H., Engelbrecht, J., Brunak, S. & von Heijne, G. (1997)

Identification of prokaryotic and eukaryotic signal peptides and

prediction of their cleavage sites. Protein Eng 10, 1–6.

45. Wolf, K. & Quimby, M.C. (1962) Established eurythermic line of

fish cells in vitro. Science 135, 1065–1066.

46. Hong, S., Zou, J., Crampe, M., Peddie, S., Scapigliati, G., Bols,

N., Cunningham, C. & Secombes, C.J. (2001) The production and

bioactivity of rainbow trout (Oncorhynchus mykiss) recombinant

IL-1b. Vet. Immunol. Immunopathol. 81, 1–14.

47. Hardie, L.J., Chappell, L.H. & Secombes, C.J. (1994) Human

tumor necrosis factor a influences rainbow trout Oncorhynchus

mykiss leucocyte responses. Vet. Immunol. Immunopathol. 40,

73–84.

1922 J. Zou et al. (Eur. J. Biochem. 271) � FEBS 2004

48. Koizumi, H., Sato-Matsumura, K.C., Nakamura, H., Shida, K.,

Kikkawa, S., Matsumoto, M., Toyoshima, K. & Seya, T. (2001)

Distribution of IL-18 and IL-18 receptor in human skin: various

forms of IL-18 are produced in keratinocytes. Arch. Dermatol.

Res. 293, 325–333.

49. Shida, K., Shiratori, I., Matsumoto, M., Fukumori, Y.,

Matsuhisa, A., Kikkawa, S., Tsuji, S., Okamura, H.,

Toyoshima, K. & Seya, T. (2001) An alternative form of IL-18

in human blood plasma: complex formation with IgM defined by

monoclonal antibodies. J. Immunol. 166, 6671–6679.

50. Nakanishi, K., Yoshimoto, T., Tsutsui, H. & Okamura, H. (2001)

Interleukin-18 regulates both Th1 and Th2 responses. Annu. Rev.

Immunol. 19, 423–474.

51. Graham, S. & Secombes, C.J. (1990) Cellular requirements for

lymphokine secretion by rainbow trout Salmo gairdneri leuco-

cytes. Dev. Comp Immunol. 14, 59–68.

52. Hansen, J.D. & La Patra, S. (2002) Induction of the rainbow trout

MHC class I pathway during acute IHNV infection.

Immunogenetics 54, 654–661.

� FEBS 2004 IL-18 homologue in rainbow trout (Eur. J. Biochem. 271) 1923