HUMAN MOLECULAR GENETICS N7-2006 L. Duroux Slides assembled from diverse sources.

HUMAN MOLECULAR HUMAN MOLECULAR GENETICSGENETICS

N7-2006N7-2006L. DurouxL. Duroux

Slides assembled from diverse sourcesSlides assembled from diverse sources

Recommended reading list - Recommended reading list - textbookstextbooks

Human Molecular Genetics 3Human Molecular Genetics 3 Strachan & ReadStrachan & Read

• Garland Publishing, ISBN 0-8153-4182-2Garland Publishing, ISBN 0-8153-4182-2

Principles of Medical GeneticsPrinciples of Medical Genetics Gelehrter, Collins & GinsburgGelehrter, Collins & Ginsburg

• Lippincott, Williams & Wilkins, ISBN 0683034456Lippincott, Williams & Wilkins, ISBN 0683034456

Genetics in MedicineGenetics in Medicine Nussbaum, McInnes & WillardNussbaum, McInnes & Willard

• Elsevier, ISBN 0721602444Elsevier, ISBN 0721602444

JournalsJournals

Nature GeneticsNature Genetics http://www.nature.com/ng/index.htmlhttp://www.nature.com/ng/index.html

Nature Reviews GeneticsNature Reviews Genetics http://www.nature.com/nrg/index.htmlhttp://www.nature.com/nrg/index.html

Trends in GeneticsTrends in Genetics http://www.trends.com/tig/default.htmhttp://www.trends.com/tig/default.htm

Lecture PlanLecture Plan

1.1. Examples of genetic diseases in HumansExamples of genetic diseases in Humans

2.2. Meiosis & RecombinationMeiosis & Recombination

3.3. Mendelian GeneticsMendelian Genetics

4.4. Modes of HeredityModes of Heredity

5.5. Glossary and StandardsGlossary and Standards

1. Genetic Diseases in 1. Genetic Diseases in HumansHumans

Role of Genes in Human DiseaseRole of Genes in Human Disease

Most diseases / phenotypes result from the interaction Most diseases / phenotypes result from the interaction between genes and the environmentbetween genes and the environment

Some phenotypes are primarily genetically determinedSome phenotypes are primarily genetically determined AchondroplasiaAchondroplasia

Other phenotypes require genetic and environmental Other phenotypes require genetic and environmental factorsfactors

Mental retardation in persons with PKUMental retardation in persons with PKU

Some phenotypes result primarily from the environment or Some phenotypes result primarily from the environment or chancechance

Lead poisoningLead poisoning

100%Environmental

Struck by lightning

Infection

Weight

Cancer

Diabetes

Height

Sex, Down syndrome, achondroplasia100% Genetic

Hair Colour

ClinicalGenetics

Consultant

CytogeneticsLab

Molecular Genetics

Lab

A Medical Genetics UnitA Medical Genetics Unit

• Clinical diagnosisClinical diagnosis• Genetic counsellingGenetic counselling• Risk assessmentRisk assessment• Prenatal & presymptomatic diagnosisPrenatal & presymptomatic diagnosis

Medical genetics in the health serviceMedical genetics in the health service

Types of Genetic DisordersTypes of Genetic Disorders

1.1. Chromosomes and chromosome abnormalitiesChromosomes and chromosome abnormalities

2.2. Single gene disordersSingle gene disorders

3.3. Polygenic DisordersPolygenic Disorders

4.4. Mutation and human diseaseMutation and human disease

Chromosomal disordersChromosomal disorders

Addition or deletion of entire chromosomes or Addition or deletion of entire chromosomes or parts of chromosomesparts of chromosomes

Typically more than 1 gene involvedTypically more than 1 gene involved

1% of paediatric admissions and 2.5% of 1% of paediatric admissions and 2.5% of childhood deathschildhood deaths

Classic example is trisomy 21 - Down syndromeClassic example is trisomy 21 - Down syndrome

Down SyndromeDown Syndrome

KARYOTYPE

Single gene disorders Single gene disorders

Single mutant gene has a large effect on Single mutant gene has a large effect on the patientthe patient

Transmitted in a Mendelian fashionTransmitted in a Mendelian fashion Autosomal dominant, autosomal Autosomal dominant, autosomal

recessive, X-linked, Y-linkedrecessive, X-linked, Y-linked Osteogenesis imperfecta - Osteogenesis imperfecta - autosomal dominantautosomal dominant

Sickle cell anaemia - Sickle cell anaemia - autosomal recessiveautosomal recessive

Haemophilia - Haemophilia - X-linkedX-linked

Neonatal fractures typical of osteogenesis imperfecta, an autosomal dominant disease caused by rare mutations in the type I collagen genes COL1A1 andCOL1A2

A famous carrier of haemophilia A, an X-linked disease caused by mutationin the factor VIII gene

Sickle cell anaemia,an autosomal recessivedisease caused bymutation in the -globin gene

Autosomal dominant pedigreeAutosomal dominant pedigree

Polygenic diseasesPolygenic diseases

The most common yet still the least understood The most common yet still the least understood of human genetic diseasesof human genetic diseases

Result from an interaction of multiple genes, Result from an interaction of multiple genes, each with a minor effecteach with a minor effect

The susceptibility alleles are commonThe susceptibility alleles are common

Type I and type II diabetes, autism, osteoarthritisType I and type II diabetes, autism, osteoarthritis

Polygenic disease pedigreePolygenic disease pedigree

2. Meiosis & Genetic 2. Meiosis & Genetic RecombinationRecombination

DNAa b c

genes

unreplicated pair of homologs

•Are long stable DNA strands with many genes.

•Occur in pairs in diploid organisms.

•The two chromosomes in a pair are called “homologs”

•Homologs usually contain the same genes, arranged in the same

order

• Homologs often have different alleles of specific genes that differ in

part of their DNA sequence.

Chromosomes & GenesChromosomes & Genes

From Griffiths et al. Introduction to Genetic AnalysisW. H. Freeman 2000

The number of chromosomes per cell varies in different species

Chromosome StructureChromosome Structure

unreplicatedchromosome

telomeres

centromere

replicatedchromosome

sisterchromatids

Each chromatid consists of a very long strand of DNA. The DNA isroughly colinear with the chromosome but is highly structured aroundhistones and other proteins which serve to condense its length andcontrol the activity of genes.

Telomeres

Centromere

Specialized structuresat chromosome endsthat are important for chromosome stability.

A region within chromosomesthat is required for proper segregation during meiosisand mitosis.

Key chromosomal regionsKey chromosomal regions

Mitosis Goal is to produce two cells that are geneticallyidentical to the parental cell.

Meiosis Goal is to produce haploid gametes from adiploid parental cell. Gametes are geneticallydifferent from parent and each other.

Two types of cell divisionsTwo types of cell divisions

Homologs and SistersHomologs and Sisters

Sisterchromatids

unreplicatedhomologs

replicatedhomologs

In mitosis the homologs do not pair up. Rather they behave independently. Each resultant cell receives one copy of each homolog.

MitosisMitosis

2n 4n

2n

In meiosis the products are haploid gametes so two divisions are necessary. Prior to the first division, the homologs pair up (synapse) and segregate from each other. In the second meiotic division sister chromatids segregate. Each cell receives a single chromatid from only one of the two homologs.

MeiosisMeiosis

2n 4n

2n 1n

I II

Meiosis/perfect linkageMeiosis/perfect linkage

P L

p l

P L

p l

P L

p l

P L

P L

p l

p l

P L

p l

p l

P L

onlyparental-type

gametes

Meiosis w/recombinationMeiosis w/recombination

P L

p l

P L

p l

P L

P l

p L

p l

P l

p L

p l

P L

In some meiotic divisions these recombination events between thegenes will occur resulting in recombinant gametes.

chiasma

Meiotic recombination in a grasshopper: ChiasmaChiasma

Mitosis Mitosis vsvs Meiosis Meiosis

• One Division

• Homologues do not pair

• Centromeres divide

• Each cell inherits both homologues

• Mitosis is conservative producing daughter cells that are like parental cell.

• Two Divisions

• Homologues Pair up

• In meiosis I, centromeres do not divide

• Homologues segregate from each other.

• Meiosis is not conservative, rather it promotes variation through segregation of chromosomes and recombination

3. Mendelian Genetics3. Mendelian Genetics

The laws of heridityThe laws of heridity

Gregor Mendel: “Father of Genetics”Gregor Mendel: “Father of Genetics”

Augustinian Monk at Brno Monastery in Austria (now Czech Republic)

Not a great teacher but well trained in math, statistics, probability, physics, and interested in plants and heredity.

While assigned to teach, he was also assigned to tend the gardens and grow vegetables for the monks to eat.

Mountains with short, cool growing season meant pea (Pisum sativum) was an ideal crop plant.

Contributions in 1860s (US Civil War Era)

• Discovered Genes as Particles of Inheritance

• Discovered Patterns of Inheritance

• Discovered Genes Come from Both ParentsEgg + Sperm = Zygote

Nature vs Nurture

Sperm means Seed (Homunculus)

• Discovered One Form of Gene (Allele) Dominant to Another

• Discovered Recessive Allele Expressed in Absence of Dominant Allele

http

://ac

adem

ic.e

verg

reen

.edu

/v/v

ivia

noc/

hom

uncu

lus.

gif

Mendel worked with peas (Pisum sativum)

• Good choice for environment of monastery

• Network provided unusual varieties for testing

• Obligate self-pollination reproductive system

Permits side-by-side genetic barriers

Cross-pollinations require intentional process

• Crosses meticulously documented

• Crosses numerically/statistically analyzed

• Work lost in journals for 50 years!

• Rediscovered in 1900s independently by 3 scientists

• Recognized as landmark work!

TallP Dwarfx

F1All Tall

Phenotype

One Example of Mendel’s Work

Clearly Tall is Inherited…What happened to Dwarf?

F1 x F1 = F2

F23/4 Tall1/4 Dwarf

Dwarf is not missing…just masked as “recessive” in a diploid state… there IS a female contribution.

1. Tall is dominant to Dwarf

2. Use D/d rather than T/t for symbolic logic

DD dd

Dd

GenotypeHomozygous

DominantHomozygous

Recessive

Heterozygous

DwarfDwarfdddd

TallTallDdDddd

TallTallDdDd

TallTallDDDDDD

ddDDPunnett Square:

possible gametes

possible gametes

1. The Law of Segregation: Genes exist in pairs and alleles segregate from each other during gamete formation, into equal numbers of gametes. Progeny obtain one determinant from each parent.

2. The Law of Independent AssortmentMembers of one pair of genes (alleles) segregate independently of members of other pairs.

Two fundamental laws derived Two fundamental laws derived from Mendel’s workfrom Mendel’s work

After rediscovery of Mendel’s principles, After rediscovery of Mendel’s principles, an early task was to show that they were an early task was to show that they were

true for animalstrue for animals

And especially in humansAnd especially in humans

Problems with doing human genetics:Problems with doing human genetics:

Can’t make controlled crosses!Can’t make controlled crosses!

Long generation timeLong generation time

Small number of offspring per crossSmall number of offspring per cross

So, human genetics uses different So, human genetics uses different methodsmethods

Chief method used in human genetics is Chief method used in human genetics is pedigree analysispedigree analysis

I.e., the patterns of distribution of traits in I.e., the patterns of distribution of traits in kindredskindreds

Pedigrees give information on:Pedigrees give information on:

Dominance or recessiveness of allelesDominance or recessiveness of alleles

Risks (probabilities) of having affected Risks (probabilities) of having affected offspringoffspring

Standard symbols used in pedigreesStandard symbols used in pedigrees

4. Modes of Heredity4. Modes of Heredity

Autosomal DominantAutosomal Dominant

First pedigree of this type:First pedigree of this type:Farabee 1903Farabee 1903BrachydactylyBrachydactyly


Most dominant traits of clinical Most dominant traits of clinical significance are significance are veryvery rare rare

So, most matings that produce So, most matings that produce affected individuals are of the form:affected individuals are of the form:

Aa x aaAa x aa


Requirements for ideal auto. dom. pedigree:

Every affected person must have at least 1 affected parent



Both males and females are affected and capable of transmitting the trait



No skipping of generations



No alternation of sexes: we see father to son, father to daughter, mother to son, and mother to daughter



In the usual mating, expect 1/2 affected, 1/2 unaffected

Example: AchondroplasiaExample: Achondroplasia

Short limbs, a normal-sized head and Short limbs, a normal-sized head and body, normal intelligencebody, normal intelligence

Caused by mutation in the Caused by mutation in the FGFR3 geneFGFR3 gene

Fibroblast growth factor receptor 3Fibroblast growth factor receptor 3 Inhibits endochondral bone growth by Inhibits endochondral bone growth by

inhibiting chondrocyte proliferation and inhibiting chondrocyte proliferation and differentiation differentiation

Mutation causes the receptor to signal Mutation causes the receptor to signal even in absence of ligandeven in absence of ligand

extracellular

intracellular

Normal FGFR3 signalingNormal FGFR3 signaling

FGFR3FGFR3FGF ligandFGF ligand

extracellular

intracellular

Normal FGFR3 signalingNormal FGFR3 signaling

Inhibition of bone growthInhibition of bone growth

extracellular

intracellular

AchondroplasiaAchondroplasia

• Receptor signals in absence of ligandReceptor signals in absence of ligand• Bone growth attenuatedBone growth attenuated

Gly380Arg mutation in transmembrane domain

**

Autosomal recessiveAutosomal recessive

Affected persons must be homozygous for Affected persons must be homozygous for the disease allelethe disease allele

These are likely to be These are likely to be moremore deleterious deleterious than dominant disorders, and so than dominant disorders, and so

are usually very rareare usually very rare

Thus, the usual mating is:Thus, the usual mating is:Aa x AaAa x Aa


Features of recessive pedigrees:

Both parents are normal, but may see multiple affected individuals in the sibship, even though the disease is very rare in the population



Usually see “skipped” generations.

Because most matings are with homozygous normal individuals and no offspring are affected



Expect increased consanguinity between the parents.

That is, the parents are more likely to be relatives

Examples of autosomal recessive Examples of autosomal recessive diseasesdiseases

Sickle-cell anemiaSickle-cell anemiaCystic fibrosisCystic fibrosis

X-linked RecessiveX-linked Recessive

Features of X-linked recessive inheritance:

Act as recessive traits in females, but dominant traits in males



An affected male cannot pass the trait on to his sons, but passes the allele on to all his daughters, who are unaffected carriers



A carrier female passes the trait on to 1/2 her sons


About 70 pathological traits known in humans

Examples: Hemophilia A, fragile X syndrome, Duchenne muscular dystrophy, color blindness

Summary of mutations which Summary of mutations which can cause a diseasecan cause a disease

Three principal types of mutationThree principal types of mutation Single-base changesSingle-base changes Deletions/Insertions (indels)Deletions/Insertions (indels) Unstable repeat unitsUnstable repeat units

Two main effectsTwo main effects Loss of functionLoss of function Gain of functionGain of function

5. Genetic Linkage5. Genetic Linkage

Mapping a disease LocusMapping a disease Locus

Although Mendel's Law of Independent Assortment applies well to genes that are on different chromosomes. It does not apply well to two genes that are close to each other on the same chromosome.

Such genes are said to be “linked” and tend to segregate together in crosses.

LinkageLinkage

Why map and characterize Why map and characterize disease genes?disease genes?

Can lead to an understanding of the molecular basis of the Can lead to an understanding of the molecular basis of the diseasedisease

May suggest new therapiesMay suggest new therapies

Allows development of DNA-based diagnosisAllows development of DNA-based diagnosis - including pre-symptomatic and pre-natal - including pre-symptomatic and pre-natal diagnosisdiagnosis

First question to ask in a First question to ask in a mapping exercisemapping exercise

Are there functional or cytogenetic clues?Are there functional or cytogenetic clues?

Functional CluesFunctional Clues

Osteogenesis imperfectaOsteogenesis imperfecta (OI)(OI) Collagen I Collagen IHaemophilia AHaemophilia A Factor VIII Factor VIIIHaemophilia BHaemophilia B Factor IX Factor IX

Cytogenetic CluesCytogenetic Clues

Duchenne muscular dystrophyDuchenne muscular dystrophy Translocation at Xp21 Translocation at Xp21Polyposis coliPolyposis coli Deletions in 5q Deletions in 5q

If there are clues, then one can If there are clues, then one can target a particular gene or a target a particular gene or a

particular chromosomal regionparticular chromosomal region

If there are no clues, then one If there are no clues, then one needs to conduct a genome-wide needs to conduct a genome-wide

linkage scanlinkage scan

Linkage analysisLinkage analysis The mapping of a trait on the basis of its The mapping of a trait on the basis of its

tendency to be co-inherited with tendency to be co-inherited with polymorphic markerspolymorphic markers

RecombinationRecombination The exchange (crossing over) of DNA The exchange (crossing over) of DNA

between members of a chromosomal pair, between members of a chromosomal pair, usually in meiosisusually in meiosis

Basic rules of linkageBasic rules of linkage Loci on different chromosomes will not be co-Loci on different chromosomes will not be co-

inheritedinherited i.e. locus A on chromosome 1 will not be co-inherited with i.e. locus A on chromosome 1 will not be co-inherited with

locus B on chromosome 2locus B on chromosome 2

Loci on the same chromosome will be co-Loci on the same chromosome will be co-inherited****inherited****

The closer two loci are on the same chromosome the The closer two loci are on the same chromosome the greater the probability that they will be co-inheritedgreater the probability that they will be co-inherited i.e the likelihood of recombination is smalli.e the likelihood of recombination is small

Consider the following pair of genes from the sweet peathat are located on the same chromosome:

Trait affected Alleles Phenotype

Purple Flower color

p

P purple

red

Long Pollen length L Long

l short

Gene

Purple

Sweat Pea Purple & LongSweat Pea Purple & Long

Test cross - more clearly reveals what gametes (and how many) were contributed by the F1 dihybrid.

P/P L/L X p/p l/l

F1 P/p L/l X p/p l/l "tester"

F2 Score progeny (total = 2840)

Test crossTest cross

Recombination is very precise -- During meiosis chromosomespair and align with homologous genes in exact opposition. Thisallows crossovers between genes at the exact same nucleotides.

a b c d e f

a b c d e f

------AGCCCGTTAAGC------


Note: this diagram does not represent the actual molecularmechanism of recombination-- only the result.



Recombination precisionRecombination precision

Recombination mapping

a b c

A B C

Consider a chromosome segment with three genes that can be followed in a cross:

Will there be more recombination between A and B or between B and C ?

MappingMapping

Recombination mapping

Recombination frequency is a direct measure of the distance between genes. The higher the frequency of recombination (assortment) between two genes the more distant the genes are from each other.

A map distance can be calculated using the formula:

# recombinant progeny /total progeny X 100 = map distance (% recombination)

1 map unit = 1% recombination = 1 centimorgan

Calculation of Recombination Calculation of Recombination FrequencyFrequency

CentiMorgan (cM)CentiMorgan (cM)

Thomas Hunt MorganThomas Hunt Morgan

cM is the unit of genetic distancecM is the unit of genetic distance Loci 1cM apart have a 1% probability of Loci 1cM apart have a 1% probability of

recombination during meiosisrecombination during meiosis Loci 50cM apart are unlinkedLoci 50cM apart are unlinked

Logarithm of odds (LOD) Logarithm of odds (LOD) scorescore

The logarithm (in base 10) of the odds of linkage The logarithm (in base 10) of the odds of linkage the ratio of the likelihood that loci are linked to the the ratio of the likelihood that loci are linked to the

likelihood that they are not linkedlikelihood that they are not linked

A LOD of 3.0 = odds of 1000/1 in favour of A LOD of 3.0 = odds of 1000/1 in favour of linkagelinkage Equivalent to a 5% chance of error Equivalent to a 5% chance of error

gametes zygote phenotype observed

P L P/p L/l Purple long 1340 parental type

P l P/p l/l purple short 154 recombinant

p L p/p L/l red long 151 recombinant

p l p/p l/l red short 1195 parental type

2840 TOTAL

Calculation of map distance between the P and L genes

# recombinant progeny /total progeny X 100 = map distance

305 were recombinants (154 P l + 151 p L)

305/2840 X 100 = 10.7 map units or 10.7% recombination frequency

Recombination frequencies for a third gene (X) were determinedusing the same type of cross as that used for P and L.

.

P to L 10.7 map units

P to X 13.1 map units

X to L 2.8 map units

Map

13.1 unitsP-------------------------------L--------------X

10.7 units 2.8 units

We can deduce from this that L is between P and X and is closer to L than it is to P. Thus it is possible to generate a recombination map for an entire chromosomes.

Build a mapBuild a map

Chromosomes and Linkage

The maximum frequency of observed recombinants betweentwo genes is 50%. At this frequency the genes are assortingindependently (as if they were on two different chromosomes)

dpy bwho

4 13 104

The dpy and bw are 91 map units apart. How frequently will these alleles become separated (total % nonparentals types in a test cross)?

DpyHo Bw

Chromosomes and Linkage

The maximum frequency of observed recombinants betweentwo genes is 50%. At this frequency the genes are assortingindependently (as if they were on two different chromosomes).

A

a

B

b

50% parental gametes (AB, ab)

50% non-parental gametes (aB, Ab)

A

a

B

b

If on the same chromosome, but greater than 50 map unitsapart, crossovers will actually occur > 50% of the timebut multiples will cancel each other out.

A

a

B

b

parental gametes (AB, ab)

non-parental gametes (aB, Ab)

A B

a b

Infinite Genetic DistanceInfinite Genetic DistanceGenes that are greater than 50 map units apart undergo frequentrecombination events and thus segregate randomly in relationto each other. Their position on the same chromosome is determined by constructing a map with multiple genes that are more close linked.

Bottom line:Two genes can be on the SAME chromosome but will behave as if they are unlinked in a test cross.

Molecular markers are most often variations in DNAsequence that do not manifest a phenotype in the organism.However they can be used to map genes in the same waythat markers affecting visible phenotypes are. An example of this would be a restriction fragment length polymorphism

restriction sites

Gene of interest

Recombination mapping using molecular markers

Human linkage Human linkage mapmap

From Griffiths et al. Introduction to Genetic AnalysisW. H. Freeman 2000

Determine the genotype of each family member Determine the genotype of each family member for polymorphic markers across the genomefor polymorphic markers across the genome

Practicalities of Linkage AnalysisPracticalities of Linkage Analysis

Chrom. 1Chrom. 1 Chrom. 2Chrom. 2 Chrom. 3Chrom. 3 etcetc

A polymorphic markerA polymorphic marker

A marker that is frequentlyA marker that is frequentlyheterozygous in the population heterozygous in the population

One can therefore distinguish the two One can therefore distinguish the two copies of a gene that an individual inheritscopies of a gene that an individual inherits

They are not themselves pathological - they They are not themselves pathological - they simply mark specific points in the genomesimply mark specific points in the genome

Polymorphic markers used in Polymorphic markers used in mapping studiesmapping studies

Variable number tandem repeats (VNTRs)Variable number tandem repeats (VNTRs)

MicrosatellitesMicrosatellites

Single nucleotide polymorphisms (SNPs)Single nucleotide polymorphisms (SNPs)

VNTRsVNTRs

Changes in the numbers of repeated DNA Changes in the numbers of repeated DNA sequences arranged in tandem arrayssequences arranged in tandem arrays

ACGTGTACTCACGTGTACTC

3-repeat allele3-repeat allele

4-repeat allele4-repeat allele

MicrosatellitesMicrosatellites

Particular class of VNTR with repeat units Particular class of VNTR with repeat units of 1-6bp in lengthof 1-6bp in length

Also known as short tandem repeats (STRs) and Also known as short tandem repeats (STRs) and sometimes as simple sequence repeats (SSRs)sometimes as simple sequence repeats (SSRs)

The most widely used are the CAThe most widely used are the CAnn microsatellites microsatellites

CACACACACACACACACACACACA

CACACACACACACACACACACACACACACACA

6 (CA) allele6 (CA) allele

8 (CA) allele8 (CA) allele

SNPsSNPsA polymorphism due to a base substitution or A polymorphism due to a base substitution or

the insertion or deletion of a single basethe insertion or deletion of a single base

TCGAGAGGCTAGGCTAGGA

TCGAGAGGCCAGGCTAGGASubstitutionSubstitution

T-alleleT-allele

C-alleleC-allele

TCGAGAGGCTAGGCTAGGA

TCGAGAGGCAGGCTAGGA

Insertion/Insertion/deletiondeletion

(+) allele(+) allele

(-) allele(-) allele

6 (CA) allele6 (CA) allele 8 (CA) allele8 (CA) allele

The individuals genotype is (6 8)The individuals genotype is (6 8)

The genotype for a microsatellite The genotype for a microsatellite marker on chromosome 1marker on chromosome 1

Paternal copyPaternal copy Maternal copyMaternal copy

* *

66 66 6 86 8

6 66 6 66 8 8

66 8 8 6 86 8

6 86 8 66 8 8

66 8 8 9 109 10

8 98 9 66 10 10

UninformativeUninformativeCompletely Completely informativeinformative

Uninformative and informative meiosesUninformative and informative meioses

66 66 6 66 6

6 66 6 66 6 6

11

Disease geneDisease gene

An autosomal An autosomal dominant dominant

disease for which the disease for which the gene resides on gene resides on chromosome 1chromosome 1

But you don’t But you don’t know that!know that!



5 65 6 4 74 7 2 32 3

Marker studiedMarker studied


2 32 3 1 51 5 4 44 4



1 51 5 3 53 5 6 76 7



2 42 4 2 52 5 2 72 7



1 31 3 1 21 2 4 54 5



2 42 4 2 52 5 2 72 7


((24)4) ((25)5) ((27)7)

((23)3) (16)(16)

(14)(14) ((26)6)

(46)(46)

(34)(34) (13)(13)

(33)(33) (14)(14)

(58)(58) (1(12))

(18)(18)

(13)(13) (78)(78)

(18)(18)

((26)6) (47)(47)

((24)4)(46)(46) (67)(67)

Genotype data for the whole familyGenotype data for the whole family


The next step - define the maximal region The next step - define the maximal region of linkageof linkage

Gene resides Gene resides herehere

And then?And then?Make a list of the genes within the intervalMake a list of the genes within the interval

www.ensembl.orgwww.ensembl.org

Gene content of chromosome 1Gene content of chromosome 1

Genes within a linkage regionGenes within a linkage region

And finally?And finally?Find the mutation!Find the mutation!

Target candidate genes within the intervalTarget candidate genes within the interval

oror

Target all genesTarget all genes

byby

DNA sequencingDNA sequencing

Two important considerations Two important considerations for single-gene disordersfor single-gene disorders

Allelic heterogeneityAllelic heterogeneity The existence of many different disease-The existence of many different disease-

causing alleles at a locuscausing alleles at a locus

Locus heterogeneityLocus heterogeneity Determination of the same disease or Determination of the same disease or

phenotype by mutations at different loci phenotype by mutations at different loci

What about mapping polygenic What about mapping polygenic disorders?disorders?

Gene1

Gene 2

Gene 3

Gene 4

PHENOTYPE

Environment

DisorderDisorder Frequency (%)Frequency (%)

SchizophreniaSchizophrenia

AsthmaAsthma

Hypertension (essential)Hypertension (essential)

OsteoarthritisOsteoarthritis

Type II diabetes (NIDDM)Type II diabetes (NIDDM)

11

44

55

55

66

Polygenic Polygenic diseases are commondiseases are common

Unrelated affected individuals share Unrelated affected individuals share ancestral risk allelesancestral risk alleles

Affected individual joining Affected individual joining the family, emphasizing the the family, emphasizing the

common nature of the disease common nature of the disease

An affected individual An affected individual with unaffected parentswith unaffected parents

A polygenic phenotypeA polygenic phenotype

No clear inheritance patternNo clear inheritance pattern

SummarySummary

Mapping single gene disordersMapping single gene disorders Use cluesUse clues If none, genome-wide linkage analysisIf none, genome-wide linkage analysis

• A large pedigreeA large pedigree• Several smaller pedigree - but beware locus heterogeneity!Several smaller pedigree - but beware locus heterogeneity!

DNA sequence analysis of linked regionDNA sequence analysis of linked region

Mapping polygenic disordersMapping polygenic disorders Model-free genome-wide linkage analysisModel-free genome-wide linkage analysis

• Now being superseded by genome-wide association analysisNow being superseded by genome-wide association analysis Functional analysis of associated polymorphisms within Functional analysis of associated polymorphisms within

the refined genomic intervalthe refined genomic interval

ConclusionsConclusions

For a single gene disease identifying the causal For a single gene disease identifying the causal mutation is now relatively straightforwardmutation is now relatively straightforward

Technological and analytical advances are also Technological and analytical advances are also making polygenic diseases tractablemaking polygenic diseases tractable

Genetics is going to play an ever increasing role Genetics is going to play an ever increasing role in medical diagnosis and in the development of in medical diagnosis and in the development of improved treatment regimesimproved treatment regimes

Additional MaterialAdditional Material

The The chromosomal chromosomal

basis of basis of Mendel’s lawsMendel’s laws

Yellow-roundseeds (YYRR)

Green-wrinkledseeds (yyrr)

Meiosis

Fertilization

Gametes

All F1 plants produceyellow-round seeds (YyRr)

P Generation

F1 Generation

Meiosis

Two equallyprobable

arrangementsof chromosomesat metaphase I

LAW OF SEGREGATION LAW OF INDEPENDENT ASSORTMENT

Anaphase I

Metaphase II

Fertilization among the F1 plants

9 : 3 : 3 : 1

14

14

14

14

YR yr yr yR

Gametes

Y

RRY

y

r

r

y

R Y y r

Ry

Y

r

Ry

Y

r

R

Y

r

y

r R

Y y

R

Y

r

y

R

Y

Y

R R

Y

r

y

r

y

R

y

r

Y

r

Y

r

Y

r

Y

R

y

R

y

R

y

r

Y

F2 Generation

Starting with two true-breeding pea plants,we follow two genes through the F1 and F2 generations. The two genes specify seed color (allele Y for yellow and allele y forgreen) and seed shape (allele R for round and allele r for wrinkled). These two genes are on different chromosomes. (Peas have seven chromosome pairs, but only two pairs are illustrated here.)

The R and r alleles segregate at anaphase I, yielding two types of daughter cells for this locus.

1

Each gamete gets one long chromosome with either the R or r allele.

2

Fertilizationrecombines the R and r alleles at random.

3

Alleles at both loci segregatein anaphase I, yielding four types of daughter cells depending on the chromosomearrangement at metaphase I. Compare the arrangement of the R and r alleles in the cellson the left and right

1

Each gamete gets a long and a short chromosome in one of four allele combinations.

2

Fertilization results in the 9:3:3:1 phenotypic ratio in the F2 generation.

3

Physical basis of Mendel’s laws

chromosome theory

segregation

independent assortment

Glossary & Definitions IGlossary & Definitions I

Character - a structure, function, or Character - a structure, function, or attribute determined by a gene or group attribute determined by a gene or group of genesof genes i.e. the appearance of the seed coat in i.e. the appearance of the seed coat in

Mendel’s garden pea studiesMendel’s garden pea studies

Trait - the alternate forms of the Trait - the alternate forms of the charactercharacter i.e “smooth” or “wrinkled” peasi.e “smooth” or “wrinkled” peas

Glossary & Definitions IIGlossary & Definitions II

Phenotype - the physical description of Phenotype - the physical description of the character in an individual organismthe character in an individual organism i.e a green peai.e a green pea

Genotype - the genetic constitution of Genotype - the genetic constitution of the organismthe organism

Glossary & Definitions IIIGlossary & Definitions III

LocusLocus - a chromosomal location - a chromosomal location

AllelesAlleles - alternative forms of the same locus - alternative forms of the same locus

MutationMutation - a change in the genetic material, - a change in the genetic material, usually rare and pathologicalusually rare and pathological

PolymorphismPolymorphism - a change in the genetic - a change in the genetic material, usually common and not pathologicalmaterial, usually common and not pathological

Glossary and Definitions IVGlossary and Definitions IV

HomozygoteHomozygote - - an organism with two identical an organism with two identical allelesalleles

HeterozygoteHeterozygote - an organism with two different - an organism with two different allelesalleles

HemizygoteHemizygote -- having only one copy of a genehaving only one copy of a gene Males are hemizygous for most genes on the sex Males are hemizygous for most genes on the sex

chromosomeschromosomes

Dominant traitDominant trait -- a trait that shows in a a trait that shows in a heterozygoteheterozygote

Recessive traitRecessive trait - a trait that is hidden in a - a trait that is hidden in a heterozygoteheterozygote

Glossary and Definitions VGlossary and Definitions V

A common misconception is A common misconception is that genes are dominant or that genes are dominant or

recessiverecessive

However,However,

it is the trait that is it is the trait that is dominant or recessive, dominant or recessive,

not the genenot the gene

Standard pedigree symbolsStandard pedigree symbolsMale, Male, affectedaffected

Female, Female, unaffectedunaffected

Male, Male, deceaseddeceased

MatingMating

ConsanguineousConsanguineousmatingmating

PregnancyPregnancy

Male, heterozygous forMale, heterozygous forautosomal recessive traitautosomal recessive trait

Female, heterozygous forFemale, heterozygous forAutosomal or X-linkedAutosomal or X-linked recessive traitrecessive trait

Dizygotic Dizygotic (non-identical)(non-identical)twinstwins

Monozygotic Monozygotic (identical)(identical)twinstwins

Spontaneous abortion Spontaneous abortion or still birthor still birth

HUMAN MOLECULAR GENETICS N7-2006 L. Duroux Slides assembled from diverse sources.

Documents

linked slide

syndrome slide

humans slide

human disease slide

globin gene slide

mendelian genetics

syndrome karyotype slide

genetic hair colour