HUMAN MOLECULAR HUMAN MOLECULAR GENETICS GENETICS N7-2006 N7-2006 L. Duroux L. Duroux Slides assembled from diverse Slides assembled from diverse sources sources
Dec 21, 2015
HUMAN MOLECULAR HUMAN MOLECULAR GENETICSGENETICS
N7-2006N7-2006L. DurouxL. Duroux
Slides assembled from diverse sourcesSlides assembled from diverse sources
Recommended reading list - Recommended reading list - textbookstextbooks
Human Molecular Genetics 3Human Molecular Genetics 3 Strachan & ReadStrachan & Read
• Garland Publishing, ISBN 0-8153-4182-2Garland Publishing, ISBN 0-8153-4182-2
Principles of Medical GeneticsPrinciples of Medical Genetics Gelehrter, Collins & GinsburgGelehrter, Collins & Ginsburg
• Lippincott, Williams & Wilkins, ISBN 0683034456Lippincott, Williams & Wilkins, ISBN 0683034456
Genetics in MedicineGenetics in Medicine Nussbaum, McInnes & WillardNussbaum, McInnes & Willard
• Elsevier, ISBN 0721602444Elsevier, ISBN 0721602444
JournalsJournals
Nature GeneticsNature Genetics http://www.nature.com/ng/index.htmlhttp://www.nature.com/ng/index.html
Nature Reviews GeneticsNature Reviews Genetics http://www.nature.com/nrg/index.htmlhttp://www.nature.com/nrg/index.html
Trends in GeneticsTrends in Genetics http://www.trends.com/tig/default.htmhttp://www.trends.com/tig/default.htm
Lecture PlanLecture Plan
1.1. Examples of genetic diseases in HumansExamples of genetic diseases in Humans
2.2. Meiosis & RecombinationMeiosis & Recombination
3.3. Mendelian GeneticsMendelian Genetics
4.4. Modes of HeredityModes of Heredity
5.5. Glossary and StandardsGlossary and Standards
1. Genetic Diseases in 1. Genetic Diseases in HumansHumans
Role of Genes in Human DiseaseRole of Genes in Human Disease
Most diseases / phenotypes result from the interaction Most diseases / phenotypes result from the interaction between genes and the environmentbetween genes and the environment
Some phenotypes are primarily genetically determinedSome phenotypes are primarily genetically determined AchondroplasiaAchondroplasia
Other phenotypes require genetic and environmental Other phenotypes require genetic and environmental factorsfactors
Mental retardation in persons with PKUMental retardation in persons with PKU
Some phenotypes result primarily from the environment or Some phenotypes result primarily from the environment or chancechance
Lead poisoningLead poisoning
100%Environmental
Struck by lightning
Infection
Weight
Cancer
Diabetes
Height
Sex, Down syndrome, achondroplasia100% Genetic
Hair Colour
ClinicalGenetics
Consultant
CytogeneticsLab
Molecular Genetics
Lab
A Medical Genetics UnitA Medical Genetics Unit
• Clinical diagnosisClinical diagnosis• Genetic counsellingGenetic counselling• Risk assessmentRisk assessment• Prenatal & presymptomatic diagnosisPrenatal & presymptomatic diagnosis
Medical genetics in the health serviceMedical genetics in the health service
Types of Genetic DisordersTypes of Genetic Disorders
1.1. Chromosomes and chromosome abnormalitiesChromosomes and chromosome abnormalities
2.2. Single gene disordersSingle gene disorders
3.3. Polygenic DisordersPolygenic Disorders
4.4. Mutation and human diseaseMutation and human disease
Chromosomal disordersChromosomal disorders
Addition or deletion of entire chromosomes or Addition or deletion of entire chromosomes or parts of chromosomesparts of chromosomes
Typically more than 1 gene involvedTypically more than 1 gene involved
1% of paediatric admissions and 2.5% of 1% of paediatric admissions and 2.5% of childhood deathschildhood deaths
Classic example is trisomy 21 - Down syndromeClassic example is trisomy 21 - Down syndrome
Down SyndromeDown Syndrome
KARYOTYPE
Single gene disorders Single gene disorders
Single mutant gene has a large effect on Single mutant gene has a large effect on the patientthe patient
Transmitted in a Mendelian fashionTransmitted in a Mendelian fashion Autosomal dominant, autosomal Autosomal dominant, autosomal
recessive, X-linked, Y-linkedrecessive, X-linked, Y-linked Osteogenesis imperfecta - Osteogenesis imperfecta - autosomal dominantautosomal dominant
Sickle cell anaemia - Sickle cell anaemia - autosomal recessiveautosomal recessive
Haemophilia - Haemophilia - X-linkedX-linked
Neonatal fractures typical of osteogenesis imperfecta, an autosomal dominant disease caused by rare mutations in the type I collagen genes COL1A1 andCOL1A2
A famous carrier of haemophilia A, an X-linked disease caused by mutationin the factor VIII gene
Sickle cell anaemia,an autosomal recessivedisease caused bymutation in the -globin gene
Autosomal dominant pedigreeAutosomal dominant pedigree
Polygenic diseasesPolygenic diseases
The most common yet still the least understood The most common yet still the least understood of human genetic diseasesof human genetic diseases
Result from an interaction of multiple genes, Result from an interaction of multiple genes, each with a minor effecteach with a minor effect
The susceptibility alleles are commonThe susceptibility alleles are common
Type I and type II diabetes, autism, osteoarthritisType I and type II diabetes, autism, osteoarthritis
Polygenic disease pedigreePolygenic disease pedigree
2. Meiosis & Genetic 2. Meiosis & Genetic RecombinationRecombination
DNAa b c
genes
unreplicated pair of homologs
•Are long stable DNA strands with many genes.
•Occur in pairs in diploid organisms.
•The two chromosomes in a pair are called “homologs”
•Homologs usually contain the same genes, arranged in the same
order
• Homologs often have different alleles of specific genes that differ in
part of their DNA sequence.
Chromosomes & GenesChromosomes & Genes
From Griffiths et al. Introduction to Genetic AnalysisW. H. Freeman 2000
The number of chromosomes per cell varies in different species
Chromosome StructureChromosome Structure
unreplicatedchromosome
telomeres
centromere
replicatedchromosome
sisterchromatids
Each chromatid consists of a very long strand of DNA. The DNA isroughly colinear with the chromosome but is highly structured aroundhistones and other proteins which serve to condense its length andcontrol the activity of genes.
Telomeres
Centromere
Specialized structuresat chromosome endsthat are important for chromosome stability.
A region within chromosomesthat is required for proper segregation during meiosisand mitosis.
Key chromosomal regionsKey chromosomal regions
Mitosis Goal is to produce two cells that are geneticallyidentical to the parental cell.
Meiosis Goal is to produce haploid gametes from adiploid parental cell. Gametes are geneticallydifferent from parent and each other.
Two types of cell divisionsTwo types of cell divisions
Homologs and SistersHomologs and Sisters
Sisterchromatids
unreplicatedhomologs
replicatedhomologs
In mitosis the homologs do not pair up. Rather they behave independently. Each resultant cell receives one copy of each homolog.
MitosisMitosis
2n 4n
2n
In meiosis the products are haploid gametes so two divisions are necessary. Prior to the first division, the homologs pair up (synapse) and segregate from each other. In the second meiotic division sister chromatids segregate. Each cell receives a single chromatid from only one of the two homologs.
MeiosisMeiosis
2n 4n
2n 1n
I II
Meiosis/perfect linkageMeiosis/perfect linkage
P L
p l
P L
p l
P L
p l
P L
P L
p l
p l
P L
p l
p l
P L
onlyparental-type
gametes
Meiosis w/recombinationMeiosis w/recombination
P L
p l
P L
p l
P L
P l
p L
p l
P l
p L
p l
P L
In some meiotic divisions these recombination events between thegenes will occur resulting in recombinant gametes.
chiasma
Meiotic recombination in a grasshopper: ChiasmaChiasma
Mitosis Mitosis vsvs Meiosis Meiosis
• One Division
• Homologues do not pair
• Centromeres divide
• Each cell inherits both homologues
• Mitosis is conservative producing daughter cells that are like parental cell.
• Two Divisions
• Homologues Pair up
• In meiosis I, centromeres do not divide
• Homologues segregate from each other.
• Meiosis is not conservative, rather it promotes variation through segregation of chromosomes and recombination
3. Mendelian Genetics3. Mendelian Genetics
The laws of heridityThe laws of heridity
Gregor Mendel: “Father of Genetics”Gregor Mendel: “Father of Genetics”
Augustinian Monk at Brno Monastery in Austria (now Czech Republic)
Not a great teacher but well trained in math, statistics, probability, physics, and interested in plants and heredity.
While assigned to teach, he was also assigned to tend the gardens and grow vegetables for the monks to eat.
Mountains with short, cool growing season meant pea (Pisum sativum) was an ideal crop plant.
Contributions in 1860s (US Civil War Era)
• Discovered Genes as Particles of Inheritance
• Discovered Patterns of Inheritance
• Discovered Genes Come from Both ParentsEgg + Sperm = Zygote
Nature vs Nurture
Sperm means Seed (Homunculus)
• Discovered One Form of Gene (Allele) Dominant to Another
• Discovered Recessive Allele Expressed in Absence of Dominant Allele
http
://ac
adem
ic.e
verg
reen
.edu
/v/v
ivia
noc/
hom
uncu
lus.
gif
Mendel worked with peas (Pisum sativum)
• Good choice for environment of monastery
• Network provided unusual varieties for testing
• Obligate self-pollination reproductive system
Permits side-by-side genetic barriers
Cross-pollinations require intentional process
• Crosses meticulously documented
• Crosses numerically/statistically analyzed
• Work lost in journals for 50 years!
• Rediscovered in 1900s independently by 3 scientists
• Recognized as landmark work!
TallP Dwarfx
F1All Tall
Phenotype
One Example of Mendel’s Work
Clearly Tall is Inherited…What happened to Dwarf?
F1 x F1 = F2
F23/4 Tall1/4 Dwarf
Dwarf is not missing…just masked as “recessive” in a diploid state… there IS a female contribution.
1. Tall is dominant to Dwarf
2. Use D/d rather than T/t for symbolic logic
DD dd
Dd
GenotypeHomozygous
DominantHomozygous
Recessive
Heterozygous
DwarfDwarfdddd
TallTallDdDddd
TallTallDdDd
TallTallDDDDDD
ddDDPunnett Square:
possible gametes
possible gametes
1. The Law of Segregation: Genes exist in pairs and alleles segregate from each other during gamete formation, into equal numbers of gametes. Progeny obtain one determinant from each parent.
2. The Law of Independent AssortmentMembers of one pair of genes (alleles) segregate independently of members of other pairs.
Two fundamental laws derived Two fundamental laws derived from Mendel’s workfrom Mendel’s work
After rediscovery of Mendel’s principles, After rediscovery of Mendel’s principles, an early task was to show that they were an early task was to show that they were
true for animalstrue for animals
And especially in humansAnd especially in humans
Problems with doing human genetics:Problems with doing human genetics:
Can’t make controlled crosses!Can’t make controlled crosses!
Long generation timeLong generation time
Small number of offspring per crossSmall number of offspring per cross
So, human genetics uses different So, human genetics uses different methodsmethods
Chief method used in human genetics is Chief method used in human genetics is pedigree analysispedigree analysis
I.e., the patterns of distribution of traits in I.e., the patterns of distribution of traits in kindredskindreds
Pedigrees give information on:Pedigrees give information on:
Dominance or recessiveness of allelesDominance or recessiveness of alleles
Risks (probabilities) of having affected Risks (probabilities) of having affected offspringoffspring
Standard symbols used in pedigreesStandard symbols used in pedigrees
4. Modes of Heredity4. Modes of Heredity
Autosomal DominantAutosomal Dominant
First pedigree of this type:First pedigree of this type:Farabee 1903Farabee 1903BrachydactylyBrachydactyly
Autosomal DominantAutosomal Dominant
Most dominant traits of clinical Most dominant traits of clinical significance are significance are veryvery rare rare
So, most matings that produce So, most matings that produce affected individuals are of the form:affected individuals are of the form:
Aa x aaAa x aa
Autosomal DominantAutosomal Dominant
Requirements for ideal auto. dom. pedigree:
Every affected person must have at least 1 affected parent
Autosomal DominantAutosomal Dominant
Requirements for ideal auto. dom. pedigree:
Both males and females are affected and capable of transmitting the trait
Autosomal DominantAutosomal Dominant
Requirements for ideal auto. dom. pedigree:
No skipping of generations
Autosomal DominantAutosomal Dominant
Requirements for ideal auto. dom. pedigree:
No alternation of sexes: we see father to son, father to daughter, mother to son, and mother to daughter
Autosomal DominantAutosomal Dominant
Requirements for ideal auto. dom. pedigree:
In the usual mating, expect 1/2 affected, 1/2 unaffected
Example: AchondroplasiaExample: Achondroplasia
Short limbs, a normal-sized head and Short limbs, a normal-sized head and body, normal intelligencebody, normal intelligence
Caused by mutation in the Caused by mutation in the FGFR3 geneFGFR3 gene
Fibroblast growth factor receptor 3Fibroblast growth factor receptor 3 Inhibits endochondral bone growth by Inhibits endochondral bone growth by
inhibiting chondrocyte proliferation and inhibiting chondrocyte proliferation and differentiation differentiation
Mutation causes the receptor to signal Mutation causes the receptor to signal even in absence of ligandeven in absence of ligand
extracellular
intracellular
Normal FGFR3 signalingNormal FGFR3 signaling
FGFR3FGFR3FGF ligandFGF ligand
extracellular
intracellular
Normal FGFR3 signalingNormal FGFR3 signaling
Inhibition of bone growthInhibition of bone growth
extracellular
intracellular
AchondroplasiaAchondroplasia
• Receptor signals in absence of ligandReceptor signals in absence of ligand• Bone growth attenuatedBone growth attenuated
Gly380Arg mutation in transmembrane domain
**
Autosomal recessiveAutosomal recessive
Affected persons must be homozygous for Affected persons must be homozygous for the disease allelethe disease allele
These are likely to be These are likely to be moremore deleterious deleterious than dominant disorders, and so than dominant disorders, and so
are usually very rareare usually very rare
Thus, the usual mating is:Thus, the usual mating is:Aa x AaAa x Aa
Autosomal recessiveAutosomal recessive
Features of recessive pedigrees:
Both parents are normal, but may see multiple affected individuals in the sibship, even though the disease is very rare in the population
Autosomal recessiveAutosomal recessive
Features of recessive pedigrees:
Usually see “skipped” generations.
Because most matings are with homozygous normal individuals and no offspring are affected
Autosomal recessiveAutosomal recessive
Features of recessive pedigrees:
Expect increased consanguinity between the parents.
That is, the parents are more likely to be relatives
Examples of autosomal recessive Examples of autosomal recessive diseasesdiseases
Sickle-cell anemiaSickle-cell anemiaCystic fibrosisCystic fibrosis
X-linked RecessiveX-linked Recessive
Features of X-linked recessive inheritance:
Act as recessive traits in females, but dominant traits in males
X-linked RecessiveX-linked Recessive
Features of X-linked recessive inheritance:
An affected male cannot pass the trait on to his sons, but passes the allele on to all his daughters, who are unaffected carriers
X-linked RecessiveX-linked Recessive
Features of X-linked recessive inheritance:
A carrier female passes the trait on to 1/2 her sons
X-linked RecessiveX-linked Recessive
About 70 pathological traits known in humans
Examples: Hemophilia A, fragile X syndrome, Duchenne muscular dystrophy, color blindness
Summary of mutations which Summary of mutations which can cause a diseasecan cause a disease
Three principal types of mutationThree principal types of mutation Single-base changesSingle-base changes Deletions/Insertions (indels)Deletions/Insertions (indels) Unstable repeat unitsUnstable repeat units
Two main effectsTwo main effects Loss of functionLoss of function Gain of functionGain of function
5. Genetic Linkage5. Genetic Linkage
Mapping a disease LocusMapping a disease Locus
Although Mendel's Law of Independent Assortment applies well to genes that are on different chromosomes. It does not apply well to two genes that are close to each other on the same chromosome.
Such genes are said to be “linked” and tend to segregate together in crosses.
LinkageLinkage
Why map and characterize Why map and characterize disease genes?disease genes?
Can lead to an understanding of the molecular basis of the Can lead to an understanding of the molecular basis of the diseasedisease
May suggest new therapiesMay suggest new therapies
Allows development of DNA-based diagnosisAllows development of DNA-based diagnosis - including pre-symptomatic and pre-natal - including pre-symptomatic and pre-natal diagnosisdiagnosis
First question to ask in a First question to ask in a mapping exercisemapping exercise
Are there functional or cytogenetic clues?Are there functional or cytogenetic clues?
Functional CluesFunctional Clues
Osteogenesis imperfectaOsteogenesis imperfecta (OI)(OI) Collagen I Collagen IHaemophilia AHaemophilia A Factor VIII Factor VIIIHaemophilia BHaemophilia B Factor IX Factor IX
Cytogenetic CluesCytogenetic Clues
Duchenne muscular dystrophyDuchenne muscular dystrophy Translocation at Xp21 Translocation at Xp21Polyposis coliPolyposis coli Deletions in 5q Deletions in 5q
If there are clues, then one can If there are clues, then one can target a particular gene or a target a particular gene or a
particular chromosomal regionparticular chromosomal region
If there are no clues, then one If there are no clues, then one needs to conduct a genome-wide needs to conduct a genome-wide
linkage scanlinkage scan
Linkage analysisLinkage analysis The mapping of a trait on the basis of its The mapping of a trait on the basis of its
tendency to be co-inherited with tendency to be co-inherited with polymorphic markerspolymorphic markers
RecombinationRecombination The exchange (crossing over) of DNA The exchange (crossing over) of DNA
between members of a chromosomal pair, between members of a chromosomal pair, usually in meiosisusually in meiosis
Basic rules of linkageBasic rules of linkage Loci on different chromosomes will not be co-Loci on different chromosomes will not be co-
inheritedinherited i.e. locus A on chromosome 1 will not be co-inherited with i.e. locus A on chromosome 1 will not be co-inherited with
locus B on chromosome 2locus B on chromosome 2
Loci on the same chromosome will be co-Loci on the same chromosome will be co-inherited****inherited****
The closer two loci are on the same chromosome the The closer two loci are on the same chromosome the greater the probability that they will be co-inheritedgreater the probability that they will be co-inherited i.e the likelihood of recombination is smalli.e the likelihood of recombination is small
Consider the following pair of genes from the sweet peathat are located on the same chromosome:
Trait affected Alleles Phenotype
Purple Flower color
p
P purple
red
Long Pollen length L Long
l short
Gene
Purple
Sweat Pea Purple & LongSweat Pea Purple & Long
Test cross - more clearly reveals what gametes (and how many) were contributed by the F1 dihybrid.
P/P L/L X p/p l/l
F1 P/p L/l X p/p l/l "tester"
F2 Score progeny (total = 2840)
Test crossTest cross
Recombination is very precise -- During meiosis chromosomespair and align with homologous genes in exact opposition. Thisallows crossovers between genes at the exact same nucleotides.
a b c d e f
a b c d e f
------AGCCCGTTAAGC------
------AGCCCGTTAAGC------
Note: this diagram does not represent the actual molecularmechanism of recombination-- only the result.
------AGCCCGTTAAGC------
------AGCCCGTTAAGC------
Recombination precisionRecombination precision
Recombination mapping
a b c
A B C
Consider a chromosome segment with three genes that can be followed in a cross:
Will there be more recombination between A and B or between B and C ?
MappingMapping
Recombination mapping
Recombination frequency is a direct measure of the distance between genes. The higher the frequency of recombination (assortment) between two genes the more distant the genes are from each other.
A map distance can be calculated using the formula:
# recombinant progeny /total progeny X 100 = map distance (% recombination)
1 map unit = 1% recombination = 1 centimorgan
Calculation of Recombination Calculation of Recombination FrequencyFrequency
CentiMorgan (cM)CentiMorgan (cM)
Thomas Hunt MorganThomas Hunt Morgan
cM is the unit of genetic distancecM is the unit of genetic distance Loci 1cM apart have a 1% probability of Loci 1cM apart have a 1% probability of
recombination during meiosisrecombination during meiosis Loci 50cM apart are unlinkedLoci 50cM apart are unlinked
Logarithm of odds (LOD) Logarithm of odds (LOD) scorescore
The logarithm (in base 10) of the odds of linkage The logarithm (in base 10) of the odds of linkage the ratio of the likelihood that loci are linked to the the ratio of the likelihood that loci are linked to the
likelihood that they are not linkedlikelihood that they are not linked
A LOD of 3.0 = odds of 1000/1 in favour of A LOD of 3.0 = odds of 1000/1 in favour of linkagelinkage Equivalent to a 5% chance of error Equivalent to a 5% chance of error
gametes zygote phenotype observed
P L P/p L/l Purple long 1340 parental type
P l P/p l/l purple short 154 recombinant
p L p/p L/l red long 151 recombinant
p l p/p l/l red short 1195 parental type
2840 TOTAL
Calculation of map distance between the P and L genes
# recombinant progeny /total progeny X 100 = map distance
305 were recombinants (154 P l + 151 p L)
305/2840 X 100 = 10.7 map units or 10.7% recombination frequency
Recombination frequencies for a third gene (X) were determinedusing the same type of cross as that used for P and L.
.
P to L 10.7 map units
P to X 13.1 map units
X to L 2.8 map units
Map
13.1 unitsP-------------------------------L--------------X
10.7 units 2.8 units
We can deduce from this that L is between P and X and is closer to L than it is to P. Thus it is possible to generate a recombination map for an entire chromosomes.
Build a mapBuild a map
Chromosomes and Linkage
The maximum frequency of observed recombinants betweentwo genes is 50%. At this frequency the genes are assortingindependently (as if they were on two different chromosomes)
dpy bwho
4 13 104
The dpy and bw are 91 map units apart. How frequently will these alleles become separated (total % nonparentals types in a test cross)?
DpyHo Bw
Chromosomes and Linkage
The maximum frequency of observed recombinants betweentwo genes is 50%. At this frequency the genes are assortingindependently (as if they were on two different chromosomes).
A
a
B
b
50% parental gametes (AB, ab)
50% non-parental gametes (aB, Ab)
A
a
B
b
If on the same chromosome, but greater than 50 map unitsapart, crossovers will actually occur > 50% of the timebut multiples will cancel each other out.
A
a
B
b
parental gametes (AB, ab)
non-parental gametes (aB, Ab)
A B
a b
Infinite Genetic DistanceInfinite Genetic DistanceGenes that are greater than 50 map units apart undergo frequentrecombination events and thus segregate randomly in relationto each other. Their position on the same chromosome is determined by constructing a map with multiple genes that are more close linked.
Bottom line:Two genes can be on the SAME chromosome but will behave as if they are unlinked in a test cross.
Molecular markers are most often variations in DNAsequence that do not manifest a phenotype in the organism.However they can be used to map genes in the same waythat markers affecting visible phenotypes are. An example of this would be a restriction fragment length polymorphism
restriction sites
Gene of interest
Recombination mapping using molecular markers
Human linkage Human linkage mapmap
From Griffiths et al. Introduction to Genetic AnalysisW. H. Freeman 2000
Determine the genotype of each family member Determine the genotype of each family member for polymorphic markers across the genomefor polymorphic markers across the genome
Practicalities of Linkage AnalysisPracticalities of Linkage Analysis
Chrom. 1Chrom. 1 Chrom. 2Chrom. 2 Chrom. 3Chrom. 3 etcetc
A polymorphic markerA polymorphic marker
A marker that is frequentlyA marker that is frequentlyheterozygous in the population heterozygous in the population
One can therefore distinguish the two One can therefore distinguish the two copies of a gene that an individual inheritscopies of a gene that an individual inherits
They are not themselves pathological - they They are not themselves pathological - they simply mark specific points in the genomesimply mark specific points in the genome
Polymorphic markers used in Polymorphic markers used in mapping studiesmapping studies
Variable number tandem repeats (VNTRs)Variable number tandem repeats (VNTRs)
MicrosatellitesMicrosatellites
Single nucleotide polymorphisms (SNPs)Single nucleotide polymorphisms (SNPs)
VNTRsVNTRs
Changes in the numbers of repeated DNA Changes in the numbers of repeated DNA sequences arranged in tandem arrayssequences arranged in tandem arrays
ACGTGTACTCACGTGTACTC
3-repeat allele3-repeat allele
4-repeat allele4-repeat allele
MicrosatellitesMicrosatellites
Particular class of VNTR with repeat units Particular class of VNTR with repeat units of 1-6bp in lengthof 1-6bp in length
Also known as short tandem repeats (STRs) and Also known as short tandem repeats (STRs) and sometimes as simple sequence repeats (SSRs)sometimes as simple sequence repeats (SSRs)
The most widely used are the CAThe most widely used are the CAnn microsatellites microsatellites
CACACACACACACACACACACACA
CACACACACACACACACACACACACACACACA
6 (CA) allele6 (CA) allele
8 (CA) allele8 (CA) allele
SNPsSNPsA polymorphism due to a base substitution or A polymorphism due to a base substitution or
the insertion or deletion of a single basethe insertion or deletion of a single base
TCGAGAGGCTAGGCTAGGA
TCGAGAGGCCAGGCTAGGASubstitutionSubstitution
T-alleleT-allele
C-alleleC-allele
TCGAGAGGCTAGGCTAGGA
TCGAGAGGCAGGCTAGGA
Insertion/Insertion/deletiondeletion
(+) allele(+) allele
(-) allele(-) allele
6 (CA) allele6 (CA) allele 8 (CA) allele8 (CA) allele
The individuals genotype is (6 8)The individuals genotype is (6 8)
The genotype for a microsatellite The genotype for a microsatellite marker on chromosome 1marker on chromosome 1
Paternal copyPaternal copy Maternal copyMaternal copy
* *
66 66 6 86 8
6 66 6 66 8 8
66 8 8 6 86 8
6 86 8 66 8 8
66 8 8 9 109 10
8 98 9 66 10 10
UninformativeUninformativeCompletely Completely informativeinformative
Uninformative and informative meiosesUninformative and informative meioses
66 66 6 66 6
6 66 6 66 6 6
11
Disease geneDisease gene
An autosomal An autosomal dominant dominant
disease for which the disease for which the gene resides on gene resides on chromosome 1chromosome 1
But you don’t But you don’t know that!know that!
Disease geneDisease gene
Disease geneDisease gene
5 65 6 4 74 7 2 32 3
Marker studiedMarker studied
Disease geneDisease gene
2 32 3 1 51 5 4 44 4
Marker studiedMarker studied
Disease geneDisease gene
1 51 5 3 53 5 6 76 7
Marker studiedMarker studied
Disease geneDisease gene
2 42 4 2 52 5 2 72 7
Marker studiedMarker studied
Disease geneDisease gene
1 31 3 1 21 2 4 54 5
Marker studiedMarker studied
Disease geneDisease gene
2 42 4 2 52 5 2 72 7
Marker studiedMarker studied
((24)4) ((25)5) ((27)7)
((23)3) (16)(16)
(14)(14) ((26)6)
(46)(46)
(34)(34) (13)(13)
(33)(33) (14)(14)
(58)(58) (1(12))
(18)(18)
(13)(13) (78)(78)
(18)(18)
((26)6) (47)(47)
((24)4)(46)(46) (67)(67)
Genotype data for the whole familyGenotype data for the whole family
Disease geneDisease gene
The next step - define the maximal region The next step - define the maximal region of linkageof linkage
Gene resides Gene resides herehere
And then?And then?Make a list of the genes within the intervalMake a list of the genes within the interval
www.ensembl.orgwww.ensembl.org
Gene content of chromosome 1Gene content of chromosome 1
Genes within a linkage regionGenes within a linkage region
And finally?And finally?Find the mutation!Find the mutation!
Target candidate genes within the intervalTarget candidate genes within the interval
oror
Target all genesTarget all genes
byby
DNA sequencingDNA sequencing
Two important considerations Two important considerations for single-gene disordersfor single-gene disorders
Allelic heterogeneityAllelic heterogeneity The existence of many different disease-The existence of many different disease-
causing alleles at a locuscausing alleles at a locus
Locus heterogeneityLocus heterogeneity Determination of the same disease or Determination of the same disease or
phenotype by mutations at different loci phenotype by mutations at different loci
What about mapping polygenic What about mapping polygenic disorders?disorders?
Gene1
Gene 2
Gene 3
Gene 4
PHENOTYPE
Environment
DisorderDisorder Frequency (%)Frequency (%)
SchizophreniaSchizophrenia
AsthmaAsthma
Hypertension (essential)Hypertension (essential)
OsteoarthritisOsteoarthritis
Type II diabetes (NIDDM)Type II diabetes (NIDDM)
11
44
55
55
66
Polygenic Polygenic diseases are commondiseases are common
Unrelated affected individuals share Unrelated affected individuals share ancestral risk allelesancestral risk alleles
Affected individual joining Affected individual joining the family, emphasizing the the family, emphasizing the
common nature of the disease common nature of the disease
An affected individual An affected individual with unaffected parentswith unaffected parents
A polygenic phenotypeA polygenic phenotype
No clear inheritance patternNo clear inheritance pattern
SummarySummary
Mapping single gene disordersMapping single gene disorders Use cluesUse clues If none, genome-wide linkage analysisIf none, genome-wide linkage analysis
• A large pedigreeA large pedigree• Several smaller pedigree - but beware locus heterogeneity!Several smaller pedigree - but beware locus heterogeneity!
DNA sequence analysis of linked regionDNA sequence analysis of linked region
Mapping polygenic disordersMapping polygenic disorders Model-free genome-wide linkage analysisModel-free genome-wide linkage analysis
• Now being superseded by genome-wide association analysisNow being superseded by genome-wide association analysis Functional analysis of associated polymorphisms within Functional analysis of associated polymorphisms within
the refined genomic intervalthe refined genomic interval
ConclusionsConclusions
For a single gene disease identifying the causal For a single gene disease identifying the causal mutation is now relatively straightforwardmutation is now relatively straightforward
Technological and analytical advances are also Technological and analytical advances are also making polygenic diseases tractablemaking polygenic diseases tractable
Genetics is going to play an ever increasing role Genetics is going to play an ever increasing role in medical diagnosis and in the development of in medical diagnosis and in the development of improved treatment regimesimproved treatment regimes
Additional MaterialAdditional Material
The The chromosomal chromosomal
basis of basis of Mendel’s lawsMendel’s laws
Yellow-roundseeds (YYRR)
Green-wrinkledseeds (yyrr)
Meiosis
Fertilization
Gametes
All F1 plants produceyellow-round seeds (YyRr)
P Generation
F1 Generation
Meiosis
Two equallyprobable
arrangementsof chromosomesat metaphase I
LAW OF SEGREGATION LAW OF INDEPENDENT ASSORTMENT
Anaphase I
Metaphase II
Fertilization among the F1 plants
9 : 3 : 3 : 1
14
14
14
14
YR yr yr yR
Gametes
Y
RRY
y
r
r
y
R Y y r
Ry
Y
r
Ry
Y
r
R
Y
r
y
r R
Y y
R
Y
r
y
R
Y
Y
R R
Y
r
y
r
y
R
y
r
Y
r
Y
r
Y
r
Y
R
y
R
y
R
y
r
Y
F2 Generation
Starting with two true-breeding pea plants,we follow two genes through the F1 and F2 generations. The two genes specify seed color (allele Y for yellow and allele y forgreen) and seed shape (allele R for round and allele r for wrinkled). These two genes are on different chromosomes. (Peas have seven chromosome pairs, but only two pairs are illustrated here.)
The R and r alleles segregate at anaphase I, yielding two types of daughter cells for this locus.
1
Each gamete gets one long chromosome with either the R or r allele.
2
Fertilizationrecombines the R and r alleles at random.
3
Alleles at both loci segregatein anaphase I, yielding four types of daughter cells depending on the chromosomearrangement at metaphase I. Compare the arrangement of the R and r alleles in the cellson the left and right
1
Each gamete gets a long and a short chromosome in one of four allele combinations.
2
Fertilization results in the 9:3:3:1 phenotypic ratio in the F2 generation.
3
Physical basis of Mendel’s laws
chromosome theory
segregation
independent assortment
Glossary & Definitions IGlossary & Definitions I
Character - a structure, function, or Character - a structure, function, or attribute determined by a gene or group attribute determined by a gene or group of genesof genes i.e. the appearance of the seed coat in i.e. the appearance of the seed coat in
Mendel’s garden pea studiesMendel’s garden pea studies
Trait - the alternate forms of the Trait - the alternate forms of the charactercharacter i.e “smooth” or “wrinkled” peasi.e “smooth” or “wrinkled” peas
Glossary & Definitions IIGlossary & Definitions II
Phenotype - the physical description of Phenotype - the physical description of the character in an individual organismthe character in an individual organism i.e a green peai.e a green pea
Genotype - the genetic constitution of Genotype - the genetic constitution of the organismthe organism
Glossary & Definitions IIIGlossary & Definitions III
LocusLocus - a chromosomal location - a chromosomal location
AllelesAlleles - alternative forms of the same locus - alternative forms of the same locus
MutationMutation - a change in the genetic material, - a change in the genetic material, usually rare and pathologicalusually rare and pathological
PolymorphismPolymorphism - a change in the genetic - a change in the genetic material, usually common and not pathologicalmaterial, usually common and not pathological
Glossary and Definitions IVGlossary and Definitions IV
HomozygoteHomozygote - - an organism with two identical an organism with two identical allelesalleles
HeterozygoteHeterozygote - an organism with two different - an organism with two different allelesalleles
HemizygoteHemizygote -- having only one copy of a genehaving only one copy of a gene Males are hemizygous for most genes on the sex Males are hemizygous for most genes on the sex
chromosomeschromosomes
Dominant traitDominant trait -- a trait that shows in a a trait that shows in a heterozygoteheterozygote
Recessive traitRecessive trait - a trait that is hidden in a - a trait that is hidden in a heterozygoteheterozygote
Glossary and Definitions VGlossary and Definitions V
A common misconception is A common misconception is that genes are dominant or that genes are dominant or
recessiverecessive
However,However,
it is the trait that is it is the trait that is dominant or recessive, dominant or recessive,
not the genenot the gene
Standard pedigree symbolsStandard pedigree symbolsMale, Male, affectedaffected
Female, Female, unaffectedunaffected
Male, Male, deceaseddeceased
MatingMating
ConsanguineousConsanguineousmatingmating
PregnancyPregnancy
Male, heterozygous forMale, heterozygous forautosomal recessive traitautosomal recessive trait
Female, heterozygous forFemale, heterozygous forAutosomal or X-linkedAutosomal or X-linked recessive traitrecessive trait
Dizygotic Dizygotic (non-identical)(non-identical)twinstwins
Monozygotic Monozygotic (identical)(identical)twinstwins
Spontaneous abortion Spontaneous abortion or still birthor still birth