Human Genetics (Chapter 3: and some of 4). Composed of 4 nucleotide bases, 5 carbon sugar and phosphate. Base pair = rungs of a ladder. Edges = sugar-phosphate.

Human Genetics

(Chapter 3: and some of 4)

• Composed of 4 nucleotide bases, 5 carbon sugar and phosphate.

• Base pair = rungs of a ladder.

• Edges = sugar-phosphate backbone.

• Double Helix

• Anti-Parallel

The structure of DNA

Figure 2.21The structure of DNA

Figure 2.22aDNA ReplicationRemember – the two strands run in opposite directions

Synthesis of a new (daughter) strand occurs in the opposite direction of the old (parental) strand.

Complementary base-pairing occurs A with T and G with C

G and C have three hydrogen bonds

A and T have two hydrogen bonds

DNA Replication• Each new double helix is composed of an old

(parental) strand and a new (daughter) strand.

• As each strand acts as a template, process is called Semi-conservative Replication.

• Replication errors can occur. Cell has repair enzymes that usually fix problem. An error that persists is a mutation.

• This is permanent, and alters the phenotype.

The structure of RNA• Formed from 4

nucleotides, 5 carbon sugar, phosphate.

• Uracil is used in RNA.– It replaces Thymine

• The 5 carbon sugar has an extra oxygen.

• RNA is single stranded.

Central Dogma of Molecular Biology

• DNA holds the code

• DNA makes RNA

• RNA makes Protein• DNA to DNA is called

REPLICATION• DNA to RNA is called

TRANSCRIPTION• RNA to Protein is called

TRANSLATION

Central Dogma of Molecular Biology

• There are exceptions:

• Retroviruses – Use RNA as the genetic code– Must make DNA before making

protein product– This new DNA makes RNA and

then a protein

• Also, one protein is not always the product of a single gene – we will talk about this later in the course!

Figure 3.3 (1)Transcription – DNA to RNA

(RNA polymerase)

Figure 3.3 (2)Transcription – DNA to RNA

Figure 3.3 (3)Transcription – DNA to RNA

Figure 3.3 (4)Transcription – DNA to RNA

A close-up view of transcription

RNApolymerase

RNA nucleotides

Newly madeRNA Direction of

transcriptionTemplatestrand of DNA

• How does the order or sequence of nucleotides in a DNA and then a RNA molecule determine the order of amino acids in a protein? (Translation)

TACCTGAACGTACGTTGCATGACT

AUGGACUUGCAUCGAACGUACUGA

Met-Asp-Leu-His-Arg-Thr-Tyr-STOP

DNA

RNA

protein

Translation• Translation requires:

– Amino acids (AAs)– Transfer RNA: (tRNA) Appropriate to its time, transfers

AAs to ribosomes. The AA’s join in cytoplasm to form proteins. 20 types. Loop structure

– Ribosomal RNA: (rRNA) Joins with proteins made in cytoplasm to form the subunits of ribosomes. Linear molecule.

– Messenger RNA: (mRNA) Carries genetic material from DNA to ribosomes in cytoplasm. Linear molecule.

Translation• The mRNA has a specific

“open reading frame” made up of three base pairs –codon.

• The tRNA has the complementary base-pairing fit to the codon –known as an Anticodon

• Each of these codes for an amino acid

Translation• Initiation—

–mRNA binds to smaller of ribosome subunits, then, small subunit binds to big subunit.

–AUG start codon--complex assembles

• Elongation—–add AAs one at a time to form chain.– Incoming tRNA receives AA’s from outgoing tRNA.

Ribosome moves to allow this to continue

• Termintion—Stop codon--complex falls apart

Figure 3.5 (1)Translation

Figure 3.5 (2)Translation

Figure 3.5 (3)Translation

What happens when it all goes wrong?

– MUTATIONS!!!!!!!!!!– two general categories

1.result in changes in the amino acids in proteins

A change in the genetic code

2.Change the reading frame of the genetic message

Insertions or deletions

Figure 3.6aMutations

Mutations

Remember Thalidomide?• The structure of thalidomide is

similar to that of the DNA purine bases adenine (A) and guanine (G).

• In solution, thalidomide binds more readily to guanine than to adenine, and has almost no affinity for the other nucleotides, cytosine (C) and thymine (T).

• Furthermore, thalidomide can intercalate into DNA, presumably at G-rich sites.

Remember Thalidomide?• Thalidomide or one of its

metabolites intercalates into these G-rich promoter regions, inhibiting the production of proteins and blocking development of the limb buds.

• This intercalation would not significantly affect the over 90 per cent of genes that rely primarily on guanine sequences.

• Most other developing tissues in the embryo rely on pathways without guanine, and are therefore not affected by thalidomide

Remember Thalidomide?

Genes can lead to inherited diseases

• A gene which doesn’t function on an autosomal chromosome can lead to devastating diseases

• Autosomal chromosomes are 22 pairs of chromosomes which do not determine gender

• Such diseases can be caused by both a dominant or a recessive trait

Autosomal Recessive Disorders

• Tay-Sachs Disease:– Jewish people in USA (E. Euro descent)– Not apparent at birth– 4 to 8 months

• Neurological impairment evident

• Gradually becomes blind and helpless

• Develops uncontrollable seizures/paralyzed

• Allele is on Chromosome 15– Lack of enzyme hexosaminidase A (Hex A)

• Lysosomes don’t work, build up in brain

Autosomal Recessive Disorders

• Cystic Fibrosis– Most common in USA (Caucasian) – 1 in 20 caucasians is a carrier – Mucus in bronchial and pancreas thick/viscous– Breathing and food digestion problems

• Allele is on chromosome 7– Cl ions can not pass through plasma membrane

channels

• Cl ions pass –water goes with it. No water, thick mucus

Autosomal Recessive Disorders

• Phenylketonuria (PKU)– Affects in in 5,000 newborns– Most common nervous system disorder

• Allele is on chromosome 12– Lack the enzyme needed for the metabolism of the

amino acid phenylalanine– A build up of abnormal breakdown pathway

• Phenylketone

• Accumulates in urine. If diet is not checked, can lead to severe mental retardation

Autosomal Dominant Disorders

• Neurofibromatosis

• Very common genetic disorder

• Tan spots on skin

• Later tumors develop

• some sufferers have large head and ear and eye tumors.

• Allele is on chromosome 17– Gene controls the production of a protein called

neurofibromin– This naturally stops cell growth

Autosomal Dominant Disorders

• Huntington Disease

• Leads to degeneration of brain cells

• Severe muscle spasms and personality disorders

• Attacks in middle age

• Allele is on chromosome 4– Gene controls the production of a protein called

huntington– Too much AA glutamine. Changes size and shape of

neurons

Incomplete Dominant traits

• Sickle Cell Anemia

• Controlled by intermediate phenotypes at a ratio of 1:2:1

• Red blood cells are not concave

• Normal Hemoglobin (HbA). Sickle cell (HbS)

• HbA-HbA-normal Hbs-Hbs – sickle cell

• HbA-Hbs- have the trait

Mutations

- any change in the nucleotide sequence of DNA

Figure 10.21

Normal hemoglobin Sickle-cell hemoglobin

Glu Val

Normal hemoglobin DNA Mutant hemoglobin DNA

mRNA mRNA

Sickle Cell Anemia

Figure 9.21

Individual homozygousfor sickle-cell allele

Sickle-cell (abnormal) hemoglobin

Abnormal hemoglobin crystallizes,causing red blood cells to become sickle-shaped

Sickled cells

Breakdown ofred blood cells

Accumulation ofsickled cells in spleen

Physicalweakness Anemia Heart

failurePain and

feverBrain

damage

Damage toother

organs

Clumping of cellsand clogging of

small blood vessels

Spleendamage

Impairedmental

functionParalysis

Pneumoniaand otherinfections

Rheumatism Kidneyfailure

Genetic engineering

Genetic engineering• The direct alteration of a genotype

– Human genes can be inserted into human cells for therapeutic purposes

– Genes can be moved from one species to another

• Moving genes from human to human or between species requires the use of special enzymes known as restriction enzymes.– These cut DNA at very specific sites– They restrict DNA from another species – isolated from

bacteria.

Figure 4.1•Each restriction enzyme cuts the DNA at a specific site, defined by the DNA sequence

•Enzymes which produce “sticky ends” are more useful•Allows gene of interest to be inserted into a vector

•Also need a DNA probe•Radioactive ssDNA that will bind to gene of interest so you can locate it

Genetic engineering

Genetic engineering• Transferred DNA is denatured to give ssDNA

• The probe will bind to gene of interest by Complementary base-pairing - A with T and G with C

Figure 4.3 (1)Genetically engineered

insulin

Figure 4.3 (2)Genetically engineered

insulin

Figure 4.3 (3)Genetically engineered

insulin

Figure 4.3 (4)Genetically engineered

insulin

Genetically engineered insulin

• Why do some people not like the idea?

The plasmid also needs a “marker gene”

This is usually an antibiotic resistance gene

Some people fear that the insulin which is extracted from the bacteria would also contain a gene product to make anyone who uses the insulin resistant to antibiotics!

Gene therapy• Can treat human diseases

– eg – severe combined immune deficiency syndrome (SCIDS)• Bubble- Boy/Girl syndrome

• The enzyme which causes this is on chromosome 20– Called adenosine deaminase (ADA)

• Many problems– Difficult to transfer large genes

– Insert in a way that the gene expresses to protein correctly

– TRANSLATION!!!!!!!!!!!!

Figure 4.4 (1)Gene therapy

Figure 4.4 (2)Gene therapy

Figure 4.4 (3)Gene therapy

Figure 4.4 (4)Gene therapy

Figure 4.4 (5)Gene therapy

Virus has genetic defect to prevent viral reproduction and spreading to other cells

Figure 4.4 (6)Gene therapyVirus vector must get the gene into the nucleus of the patient’s lymphocyte

Figure 4.4 (7)Gene therapyGene has to be incorporated into cell’s DNA where it will be transcribed

Also inserted gene must not break up some other necessary gene sequence

Gene therapy• The genetically engineered lymphocytes injected

into the patient should out grow the “natural” (defective) lymphocytes

• As ADA-deficient cells to not divide as fact as those with the active enzyme

• Not permanent - need repeat injections as injected lymphocytes are mature and have limited life span

• Stem cells would get around this problem (later!)

Genetic Profiling• We could screen everyone’s DNA for mutations.

• How would this affect insurance?

• How would this affect health care?

• What about “reproductive control”?

• What do you think?

The end!

Any questions?